Phenanthridine Derivative Host Heat Shock Cognate 70 Down-Regulators as Porcine Epidemic Diarrhea Virus Inhibitors

Article abstract of DOI:10.1021/acs.jnatprod.0c01252

Porcine epidemic diarrhea virus (PEDV) has become increasingly problematic around the world, not only for its hazards to livestock but also due to the possibility that it is a zoonotic disease. Although vaccine therapy has made some progress toward PEDV c

Full text of DOI:10.1021/acs.jnatprod.0c01252

pubs.acs.org/jnp
Article
Phenanthridine Derivative Host Heat Shock Cognate 70 Down-
Regulators as Porcine Epidemic Diarrhea Virus Inhibitors
Duo-Zhi Chen,∥ Shi-Rui Fan,∥ Bi-Juan Yang, Huo-Chun Yao, Yi-Ting Wang, Jie-Yun Cai, Chen-Xu Jing,
Zi-Hao Pan, Miao Luo, Yan-Qiu Yuze, Guang-Jin Liu,* and Xiao-Jiang Hao*
Cite This: J. Nat. Prod. 2021, 84, 1175−1184
Read Online
sı
*
Metrics & More
Article Recommendations
Supporting Information
ACCESS
ABSTRACT: Porcine epidemic diarrhea virus (PEDV) has become increasingly problematic around the world, not only for its
hazards to livestock but also due to the possibility that it is a zoonotic disease. Although vaccine therapy has made some progress
toward PEDV control, additional effective therapeutic strategies against PEDV are needed, such as the development of
chemotherapeutic agents. The aim of this work was to identify novel anti-PEDV agents by designing and synthesizing a series of
phenanthridine derivatives. Among them, three compounds (compounds 1, 2, and 4) were identified as potent anti-PEDV agents
exhibiting suppression of host cell heat shock cognate 70 (Hsc70) expression. Mechanism studies revealed that host Hsc70 is
involved in the replication of PEDV, and its expression can be suppressed by destabilization of the mRNA, resulting in inhibition of
PEDV replication. Activity against PEDV in vivo in PEDV-infected piglets suggested that phenanthridine derivatives are the first
host-acting potential anti-PEDV agents.
oronaviruses are pathogens that may cause great harm to
human and animal health. These viruses can cause severe
It has been shown that regulating some relatively
conservative viral replication-related factors in host cells to
affect viral replication by affecting the microenvironment of
viral replication is also an effective strategy for the prevention
of viruses, especially those with high variability. Previous
studies have reported that regulation of host heat shock
cognate 70 (Hsc70) expression may be a promising antiviral
therapeutic strategy.15,16 Hsc70 is a cytoplasmic adenosine
triphosphate binding protein with 646 amino acids. It is a
member of the heat shock protein 70 (Hsp70) family.17
Virology research has shown that Hsc70 might play a role in
regulating virion capsid assembly.18 It has also been
demonstrated that host Hsc70 also forms part of the virus
C
and life-threatening diseases of the enteric or respiratory
systems. For example, zoonotic coronaviruses cause severe
acute respiratory syndrome (SARS) and Middle East
respiratory syndrome (MERS) in humans and the deadly
porcine epidemic diarrhea virus (PEDV) for newborn
piglets.1−6 Compared to other positive-sense RNA viruses,
coronaviruses have an exceptionally large genome and employ
a complex genome expression strategy. Next to a role in basic
virus replication or virus assembly, many of the coronavirus
proteins expressed in the infected cell contribute to the
coronavirus−host interplay to create difficulties in combating
these infections.7−10 As a result, despite the harmful impact of
such coronavirus infections and the likelihood of future
outbreaks of additional pathogenic coronaviruses, the options
to prevent or treat these infections remain very limited. This
highlights the importance of advancing research on novel
antiviral mechanisms and alternative new antiviral agents that
not only inhibit viral replication but also prevent the
emergence of resistance.11−14
Received: November 18, 2020
Published: March 24, 2021
© 2021 American Chemical Society and
American Society of Pharmacognosy
https://doi.org/10.1021/acs.jnatprod.0c01252
J. Nat. Prod. 2021, 84, 1175−1184
1175

Journal of Natural Products
pubs.acs.org/jnp
Article
Figure 1. Design and synthesis of phenanthridine derivatives. (a) Regions (colors labeled) of the lycorine and phenanthridine skeleton targeted for
modification, i.e., the C-1 and C-2 hydroxy groups, the double bond between C-3 and C-4, the N-5 position, and the benzodioxole group. (b) The
12 phenanthridine derivatives (highlighted in beige) synthesized. In part b, the reagents and conditions are as follows: (a) MeI, DMF, rt, 12 h; (b)
t-BuOK, t-BuOH, N2, reflux, 4 h; (c) 10% Pd/C, CH2Cl2, rt, 24 h; (d) BBr3, CH2Cl2, −78 °C, 4 h; (e) RX, NaH, THF, N2, rt, 24 h; (f) Ac2O,
pyridine, DMAP, THF, N2, 60 °C, 6 h; (g) propargyl bromide, K2CO3, acetone, N2, 60 °C, 24 h; (h) 2-azidoethan-1-amine, Cu2SO4, sodium
ascorbate, H2O/t-BuOH, N2, 60 °C, 20 h; (i) SOCl2, DMF, THF, 50 °C, 2 h; (j) ammonia reagents, 5 °C; (k) K2CO3, norbornene, Pd(OAc)2,
TFP, CH3CN, 85 °C, 6 h; (l) BH3−THF, THF, −78 °C, 2 h.
particle, and host Hsc70 modulates virus infectivity as well as
lipid droplet−dependent virus release after HCV (hepatitis C
virus) enters host cells.19 Down-regulation of Hsc70 in virus-
infected host cells reduces the levels of many different types of
viruses, such as flaviviruses and hepatoviruses. Hsc70 down-
regulators inhibit viral replication while preventing the
emergence of resistance.20,21 Although there have been no
reports indicating a correlation between Hsc70 expression and
virus replication in animals or studies of the effects of Hsc70
on the coronavirus, the aforementioned findings indicate that
Hsc70 may be a useful potential drug target against
coronavirus infection. Our previous studies have identified a
series of phenanthridine derivatives as potent antiviral agents
for HBV (hepatitis B virus), HCV (hepatitis C virus), and
TMV (tobacco mosaic virus), which act by down-regulating
host Hsc70 expression.22−24 This implies that Hsc70-
1176
https://doi.org/10.1021/acs.jnatprod.0c01252
J. Nat. Prod. 2021, 84, 1175−1184

Journal of Natural Products
pubs.acs.org/jnp
Article
Figure 2. Anti-PEDV evaluation of phenanthridine derivatives at a concentration of 10 μM in vitro. (a) Compounds 1, 2, 4, and 11 inhibited PEDV
(p < 0.01) at the transcription level but did not exhibit cytotoxicity at a high concentration of 100 μM by the CKK-8 method. (b) Compounds 1, 2,
and 4 inhibited PEDV at the protein level at a single concentration of 10 μM. (c) Compound 4 inhibited PEDV at the protein level at a gradient
concentration. (d) The viral titer was determined by a plaque assay and quantified. The data shown are from three independent experiments. (e)
Indirect immunofluorescence assay indicated that levels of the PEDV protein (red color) in thenanthridine-treated cells were much less than those
in the mock.
regulation is a promising strategy for fighting viral infections
and that phenanthridine-type compounds may be suitable as
molecular probes to investigate whether a coronavirus may be
inhibited by effecting host cell Hsc70 expression, even though
it belongs to a different family with a different replication
mechanism compared with that of HBV, HCV, or TMV.
Since the coronavirus, porcine epidemic diarrhea virus
(PEDV) was first discovered in Belgium in the 1970s; it has
spread to many countries, including the People’s Republic of
China, Japan, the United States, and Canada, and is rapidly
becoming problematic across the world.25−28 PEDV is a deadly
virus for newborn piglets with case fatality rates of nearly
100%. Research has shown that PEDV is typical of
coronaviruses and is closely related to and shows significant
genetic uniformity with other members of the coronaviruses
family. In addition, some pilot studies have suggested that
PEDV may be a zoonotic disease, even though traditionally it
is believed to not infect humans.29,30 In this investigation, with
the purpose to explore new mechanisms for inhibiting the
coronavirus in a preliminary manner, PEDV was employed as
the model virus system, and a series of phenanthridine
derivative inhibitors were rationally designed and synthesized.
The antiviral activities in vitro and in vivo and the mechanisms
of action of these compounds were evaluated to investigate
correlations between the replication of the coronavirus
examined and the expression of host Hsc70.
RESULTS AND DISCUSSION
■
Design and Synthesis of Phenanthridine Derivatives.
Based on previous studies of phenanthridine derivatives and
their anti-HBV/HCV activities, down-regulation of host
Hsc70, and structure−activity relationships (SARs, Figure
1177
https://doi.org/10.1021/acs.jnatprod.0c01252
J. Nat. Prod. 2021, 84, 1175−1184

Journal of Natural Products
pubs.acs.org/jnp
Article
1a),25−28 a series of phenanthridine derivatives was designed
and synthesized. As shown in Figure 1b, compounds 1−4 were
derived from lycorine through a semisynthesis process.
Lycorine was initially exhaustively methylated, followed by
Hoffman degradation and Pd/C hydrogenation. Subsequent
BBr3 degradation and then alkylation or acylation yielded
compounds 1−4. The rest of the compounds were synthesized
via one-step palladium-catalyzed sequential aryl−aryl and n-
aryl coupling between bromobenzoic acid analogues and
iodobenzene analogues. In total, 12 compounds were prepared
for further evaluation of anti-PEDV activity.
Anti-PEDV Activity of Phenanthridine Derivatives In
Vitro. The phenanthridine compounds were initially screened
to evaluate their inhibitory effect on PEDV through a PEDV
recipient African green monkey embryonic kidney cell line
(Marc145 cells). In this assay system, the Marc145 cells were
infected with PEDV. The PEDV-positive Marc145 cells then
readily produced infectious PEDV particles; incubation of
̈
naive Marc145 cells caused PEDV infection in the cells. The
PEDV-infected Marc145 cells were treated with the synthe-
sized phenanthridine derivatives for 24 h; then, PEDV mRNA
was detected by real-time quantitative PCR (qPCR), using 6-
azauridine28 as a positive control. The results indicated that
some derivatives (1, 2, 4, and 11) inhibited the replication of
PEDV. Compounds 1, 2, and 4 decreased the production of
PEDV mRNA by up to 70% (Figure 2a). A dose−effect
relationship assay of 1, 2, and 4 was examined (EC50), and
their cytotoxicity was assessed in vitro by the CKK-8 method
(Figure 2a). Overall, the results showed that 1 and 4 exhibited
good anti-PEDV activity with EC50 values of 1.89 and 0.72 μM,
respectively, and no cytotoxicity at a high concentration of 100
μM. Western-blot analysis confirmed that compounds 1, 2, and
4 suppressed PEDV at the protein level (Figure 2b), and
compound 4 inhibited the replication of PEDV in a dose-
dependent manner (Figure 2c). In addition, using a plaque
assay, the viral titer of drug-treated cells was determined and,
as Figure 2d shows, compounds 1 and 4 clearly decreased the
PEDV virion in infected cells at the concentration of 20 μM.
To visualize the reduction of PEDV protein in the cytoplasm,
indirect immunofluorescence was carried out on phenanthri-
dine inhibitor-treated Marc145 cells. Treatment with 10 μM of
the compounds for 24 h caused inhibition of the PEDV protein
in Marc145 cells (Figure 2e, red color). All these various test
results indicated that compounds 1 and 4, but especially 4, can
inhibit the replication of PEDV.
Phenanthridine Derivatives Down-Regulate Host
Hsc70 Expression. To investigate the mode of action of
the phenanthridine derivatives produced, the capacity to down-
regulate Hsc70 was evaluated using an Hsc70 mRNA
quantitative assay model in Marc145 cells. The infected
Marc145 cell line was treated with the top compounds for 24
h, followed by determination of Hsc70 mRNA expression. As
shown in Figure 3a, phenanthridine derivatives 1, 2, and 4
suppressed host Hsc70 expression at a concentration of 10 μM.
Furthermore, according to a qPCR assay, their PEDV
inhibition and Hsc70 down-regulation activities were corre-
lated positively (Figure 3b). These results indicate that
phenanthridine derivatives inhibit the PEDV while simulta-
neously suppressing Hsc70 expression. In a subsequent
Western blot assay, the same phenomenon could also be
observed that compound 4 inhibited the PEDV while down-
regulating the expression of Hsc70 at the protein level in a
dose-dependent manner (Figure 3c). Together, these results
Figure 3. Phenanthridine derivatives regulate the expression of host
Hsc70. (a) Intracellular Hsc70 mRNA (detected with qPCR, p <
0.01) treated with phenanthridine derivatives. (b) Correlation
between inhibition of Hsc70 expression and anti-PEDV activities of
the tested phenanthridine-type derivatives (detected with qPCR). (c)
Compound 4 suppressed the PEDV-N protein as well as the Hsc70
protein (Western blot) in a dose-dependent manner.
imply that there was a correlation between Hsc70 down-
regulation and the anti-PEDV activity of phenanthridine
derivatives.
Anti-PEDV Mechanism of Phenanthridine Deriva-
tives. The results suggested that suppression of Hsc70
expression of the host cells may be the main mechanism for
the anti-PEDV activities of phenanthridine derivative. To test
this, the effects of compound 4 on PEDV assembly were
initially evaluated by comparing the proportion between
supematant PEDV gene copies and interacellular PEDV gene
copies of control and compound-treated groups. As mentioned
above, down-regulation in the host would block the assembly
of the virus, and the results obtained did indicate that 4
1178
https://doi.org/10.1021/acs.jnatprod.0c01252
J. Nat. Prod. 2021, 84, 1175−1184

Journal of Natural Products
pubs.acs.org/jnp
Article
Figure 4. Studies on anti-PEDV mechanism of phenanthridine derivatives. (a) Effects of compound 4 on PEDV assembly (p < 0.01). (b)
Construction of external Hsc70-containing plasmid. Phenanthridine derivatives strongly inhibited PEDV replication in PEDV-infected Marc145
cells with the addition of external Hsc70. The Marc145 cells were infected with PEDV for 24 h, followed by transfection of the cells with pEGFP-
N1/Hsc70 (or pEGFP-N1 as control) for 24 h. These cells were then treated with compounds 1, 2, and 4 (20 μM) for 24 h. The level of Hsc70
mRNA as well as PEDV RNA was evaluated with real-time PCR using PEDV-infected Marc145 cells treated with neither top compound nor
external Hsc70 as control. For the y-axis, the control value of Hsc70 and PEDV mRNA was normalized as 1; the amounts of Hsc70 mRNA or
PEDV RNA in the cells with or without drug treatment were plotted relative to that value. The experiment was repeated three times. (c)
Compound 4 also showed stronger anti-PEDV activity at protein levels in Hsc70 inserted cells. (d) The half-life (T1/2) of Hsc70 mRNA was
shortened in Marc145 cells treated with compounds 1, 2, and 4 (20 μM) as compared with that in the untreated control.
suppressed the assembly of PEDV. Following this, external
Hsc70 was inserted into PEDV-positive Marc 145 cells by
transfecting the cells with a Hsc70-containing plasmid
(pEGFP-N1/Hsc70, Figure 4b), with the purpose of
confirming that the anti-PEDV activities of compounds 1, 2,
and 4 are Hsc70-dependent. If compounds truly act by down-
regulating Hsc70, each compound should be effective against
Hsc70-related PEDV replication. Figure 4b shows that
addition of external Hsc70 increased PEDV replication in
Marc145 cells by 7.2-fold. However, treatment with phenan-
thridine derivatives such as compound 4 significantly
decreased PEDV RNA by 8.1 times (cells without external
Hsc70) to 29.3 times (cells with external Hsc70). At the
protein level, compound 4 suppressed the PEDV-N protein by
20.5 times in external Hsc70 inserted cells. In contrast, the
positive control, 6-azauridine, showed much weaker antiviral
activity in Hsc70-inserted cells than in normal cells (Figure
4c). These results indicated that PEDV inhibition by the most
active phenanthridine derivatives in this model was more
potent than that in the PEDV-positive Marc 145 cells with no
addition of Hsc70, suggesting that Hsc70 is a possible
mechanism of action for the phenanthridine derivatives
evaluated.
A further investigation into the mode of action of these
compounds was conducted. Based on the finding that certain
phenanthridine derivatives reduced Hsc70 mRNA in Marc145
cells, it was hypothesized that these compounds may suppress
Hsc70 expression by destabilizing Hsc70 mRNA. To test this
hypothesis, the half-life (T1/2) of Hsc70 mRNA was
determined in phenanthridine-treated Marc145 cells. In this
actinomycin-D-treated quantitative assay model, the phenan-
thridine derivatives 1, 2, and 4 decreased the T1/2 value of
Hsc70 mRNA by up to 72% (from 6.51 to 2.31, 2.61, and 1.84
h, respectively) in Marc145 cells (Figure 4d), thereby they
each exhibited a destabilization effect on Hsc70 mRNA. This
indicates that these phenanthridine derivatives may down-
1179
https://doi.org/10.1021/acs.jnatprod.0c01252
J. Nat. Prod. 2021, 84, 1175−1184

Journal of Natural Products
pubs.acs.org/jnp
Article
no further purification for use in other reactions. 6-Azauridine (TCI)
was purchased from the discovery platform Inc. PEDV N protein
monoclonal antibody was prepared and preserved by Yao’s research
group.31 Methanol, isopropanol, agarose, DEPC water, nonfat-dried
milk, bovine serum albumin (BSA), Tween-20, PBS (Hyclon) buffer,
TAE (10×) buffer, 2× Taq enzyme, GoldView nucleic acid dye, ECL
chemiluminescence solution, 0.25% trypsin-EDTA (1×) (Gibco), a
NALGENETM Cruo 1 °C freezing container, β-actin monoclonal
antibody, Goat Antimouse IgG-HPR (Beyotime), Goat Antirabbit
IgG-HPR (Beyotime), Cy3-labeled Goat Anti-Rabbit lgG (H+L)
SDS-PAGE sample loading buffer (2×) (Beyotime), Cell Counting
Kit-8 (CKK-8) (Beyotime), penicillin−streptomycin solution (100×)
(Beyotime), and DAPI staining solution (Beyotime) were purchased
from Nanjing Dingsi Biotechnology Co., Ltd. (People’s Republic of
China). A fluorescence quantification kit (ChamQ Universal SYBR
qPCR Master Mix) and RNA reverse transcription kit (HiScript II
first Strand cDNA synthesis kit (+gDNA wiper)) were purchased
from Nanjing Vazyme Biotechnology Co., Ltd. (People’s Republic of
China). Tris-MOPS-SDS running buffer powder, transfer buffer
powder (GenScript), a Pierce BCA protein quantitative analysis kit
(Takara), and Real Band 3-color regular range protein marker were
purchased from Nanjing Lanlong Biotechnology Co., Ltd. (People’s
Republic of China).
Synthesis of Phenanthridine Derivatives. 4-Vinyl-N-methyl-
5,6-dihydro[8,9]-dioxolo-phenanthridine (1a).21 A solution of
lycorine (300 mg, 1 mmol) in DMF (10 mL) was poured into a
round-bottomed flask, followed by addition of CH3I (400 μL, 2
mmol). The mixture was stirred at room temperature for 12 h and
then evaporated to remove DMF. The vessel was charged with t-
BuOK (1.1 g, 10 mmol) and t-BuOH (10 mL), heated to 90 °C, and
stirred for another 4 h. After cooling the mixture to room
temperature, the reaction was quenched with 50 mL of saturated
NH4Cl and extracted twice with EtO2 (20 mL). The organic phase
was washed with saturated NH4Cl and brine, dried over MgSO4,
filtered, and concentrated. The resulting residue was purified by
column chromatography and eluted with petroleum ether−EtOAc
(5:1) to yield compound 1a (240 mg, 70% yield) as pale yellow
crystals (from CHCl3).
4-Ethyl-N-methyl-5,6-dihydro-[8,9]dioxolo-phenanthridine
(1b).21 A solution of 2 (27 mg, 0.1 mmol) and 10% Pd/C (30 mg) in
CH2Cl2 (5 mL) was stirred under a H2 atmosphere for 24 h. The
organic layer was filtered and concentrated. The resulting residue was
purified by column chromatography and eluted with petroleum
ether−EtOAc (15:1) to afford compound 1b (22 mg, 90% yield) as
pale yellow crystals (from CHCl3).
4-Ethyl-N-methyl-5,6-dihydro-8,9-diphenol-phenanthridine
(1c).21 Compound 1b (0.2 mmol) was dissolved in 10 mL of CH2Cl2.
The solution was cooled to −78 °C, and BBr3 (200 μL, 0.4 mmol)
was added. The mixture was stirred for 10 h and diluted in 50 mL of
saturated NaHCO3, followed by extraction with CH2Cl2 (2 × 20 mL).
The organic layer was washed with brine and concentrated. The
resulting residue was purified by column chromatography using
CHCl3−MeOH (4, 25:1; 5, 20:1) as the eluent to afford 1c (35.7 mg,
70% yield).
regulate Hsc70 expression of PEDV-infected host cells and
then suppress the replication of PEDV mainly by destabilizing
the mRNA of Hsc70 as compared to that of untreated cells.
Evaluation of Anti-PEDV Activity of Phenanthridine
Derivatives in Vivo. Because the most active phenanthridine
derivatives exhibited potent anti-PEDV activity with low
cytotoxicity in vitro, it was predicted that these compounds
may also be effective in vivo. Thus, pharmacodynamics
experiments were conducted on virulent PEDV-infected
piglets. Nine newborn piglets were randomly divided into
four groups. The dose of administration was converted from
the 25% LD50 value of compounds 1 and 4 determined in
mice. All the piglets remained active, fleshy and with normal
feces, prior to infection with the virus. Except for one piglet
used as blank control, the other eight were all inoculated with
virulent PEDV (NK-2). At 15 h after inoculation, rectal swabs
of all piglets except the blank control tested positive for PEDV
RNA. Next, three piglets were treated with compound 1 for 72
h at a dose of 50 mg/kg every 24 h, and another three were
treated with compound 4 at the same dose, with two of the
infected pigs left untreated as a negative control. After the
virulent PEDV inoculation for 96 h, the negative control group
developed severe watery feces, lethargy, and anorexia and died
within the next 12 h. However, the two phenanthridine-
treatment groups showed much milder clinical symptoms, and
none of the piglets died during the entire experiment. After
sacrificing all the piglets, small intestine samples from the
negative control group revealed prominent changes charac-
terized by thinner intestine mucosa with increasing trans-
parency, mucosal swelling, and congestion. Microscopic
examination of the jejunum, ileum, and colon of all the piglets
was then conducted. The results showed that samples from the
negative control group exhibited multifocal diffusion of villous
atrophy, swelling, sloughing, and attenuation of villi and fusion
of numerous villi. However, such pathological changes were
reduced significantly in samples from piglets treated with
compounds 1 and 4. Further immunofluorescence assays
indicated that, in comparison with that of the negative control,
PEDV replication in the intestine of the phenanthridine-
treated groups was suppressed considerably. These results
show, in a preliminary manner, that compounds 1 and 4 may
inhibit replication of PEDV in vivo and reduce PEDV-
associated mortality.
EXPERIMENTAL SECTION
■
General Experimental Procedures. ESI and HRMS data were
recorded using a Finnegan MAT 90 instrument and VG Auto Spec-
3000 spectrometer, respectively. NMR experiments were conducted
on a Bruker AM-400, DRX-500, or Avance III 600 spectrometer using
residual CDCl3 and DMSO-d6 or TMS as internal standards. Column
chromatography was performed on silica gel (60−80 mesh, 200−300
mesh, 300−400 mesh, Qingdao Haiyang Chemical Co. Ltd., Qingdao,
China). Precoated silica gel 60 GF254 (Merck, Darmstadt, Germany)
was used for TLC analyses. Semipreparative HPLC analysis was
performed on a Hypersil Gold RP-C18 column (i.d. 10 mm × 250
mm, 5 μm, 5 mL/min) developed with CH3CN−H2O at room
temperature. All regular solvents and reagents were reagent grade and
purchased from Sigma-Aldrich Chemical Co. (St. Louis, USA), Acros
Organics (Geel, Belgium), or J&K Scientific (Beijing, People’s
Republic of China). Lycorine was purchased from Laideng Chemical
Co. (Kunming, People’s Republic of China). The purities of all
compounds used in biological assays exceeded 95%, as determined by
HPLC. HPLC was performed on an X-Bridge RP-C18 column (4.6
mm × 250 mm, 5 μm, and 5 mL/min) with CH3OH−H2O at room
temperature. All reported yields are for dry compounds that required
Compounds 1 and 4. Compound 1c (0.1 mmol) was dissolved in
dry THF (10 mL), after which NaH (50 mg, 2 mmol) and the
appropriate haloalkane (1 mmol) were added. The mixture was stirred
at room temperature for 24 h and then quenched with water (50 mL)
in an ice bath. The reaction solution was evaporated to remove THF
and extracted twice with CH2Cl2 (30 mL). The organic layer was
washed with saturated NaHCO3 and then brine, dried over MgSO4,
filtered, and concentrated. The resulting residue was purified by
column chromatography using petroleum ether−EtOAc as the eluent
to afford compounds 1 and 4.
4-Ethyl-N-methyl-5,6-dihydro-8,9-diacetoxyphenanthridin (2).
Compound 1c (0.1 mmol) was dissolved in a solution of pyridine
(3 mL) containing the appropriate anhydride or acyl chloride (0.5
mmol) and DMAP (30 mg). The solution was stirred at room
temperature for 20 h under N2 and then poured into ice-cold water
(50 mL) with vigorous stirring. The mixture was extracted twice with
1180
https://doi.org/10.1021/acs.jnatprod.0c01252
J. Nat. Prod. 2021, 84, 1175−1184

Journal of Natural Products
pubs.acs.org/jnp
Article
Table 1. Primer Sequences Involved in This Study
primer
sequence
NI-Hsc70-F-XHOI
NI-Hsc70-R-SACII
Hsc70-F
CTACCGGACTCAGATCTCGAGATGTCCAAGGGACCTGCAGTT
CGGTGGATCCCGGGCCCGCGGATCAACCTCTTCAATGGTGGGC
CATTACCCGTGCCCGATTT
Hsc70-R
ACTCCACCAGCAGTTTCA
β-actin-F
CGGGAAATCGTGCGTGAC
β-actin-R
ATGCCCAGGAAGGAAGGTTG
PEDV-N-F
PEDV-N-R
CCACTAACAAGGGGAATA
CAACTACAATGGGGAGC
Figure 5. Detection of protective efficiency in piglets during virus exposure. HE (hematoxylin and eosin) staining showed that the impaired
structural integrity, slight mononuclear cell infiltration, and vascular congestion of samples from compound-treated groups were much weaker than
those of the negative control. In additional immunofluorescence assays of small intestine samples in all four groups, PEDV (green fluorescence) in
the samples from compound-treated groups was suppressed significantly. (Amplification: 20× , scale bar represents 100 μM, images with 5×
amplification can be found in the Supporting Information, Figure S4).
EtOAc (30 mL) and washed with saturated NaHCO3 and brine, after
which it was concentrated, and the crude product was purified by
silica gel column chromatography to afford compound 2.
Compounds 1d and 3. These two compounds were synthesized
according to previous reports.31
Compounds 2a, 3a, 4a, 5a, 6a, and 7a. Bromobenzoic acid
analogues (1 mmol) were dissolved in THF (10 mL), to which DMF
(0.1 mL) and SOCl2 (0.5 mL, 4 mmol) were added. In each case, the
reaction solution was stirred for 2 h at 50 °C and then concentrated to
remove THF. The residue was added to a 30% solution of the
corresponding ammonia reagents in water (20 mL) at 5 °C and
filtered. The resulting cake was purified by column chromatography to
yield compounds 2a, 3a, 4a, 5a, 6a, or 7a.
Compounds 2b, 3b, 5b, 6b, 6b′, and 7. A flask was charged under
N2 with Pd(OAc)2 (3.0 mg, 0.013 mmol), tri-2-furylphosphine (6.2
mg, 0.027 mmol), K2CO3 (72.3 mg, 0.52 mmol), amides 2a, 3a, 4a,
5a, 6a, or 7a (0.26 mmol), a solution of norbornene (26.9 mg, 0.286
mmol) in anhydrous solvent (5.8 mL), and 1-iodo-2-methylbenzene
1181
https://doi.org/10.1021/acs.jnatprod.0c01252
J. Nat. Prod. 2021, 84, 1175−1184

Journal of Natural Products
pubs.acs.org/jnp
Article
(0.26 mmol). The reaction mixture was heated under stirring to 85 °C
for 6 h and then cooled to room temperature. After addition of
saturated NH4Cl (30 mL) and extraction with EtOAc (3 × 15 mL),
the combined organic extracts were washed with brine (30 mL) and
dried over Na2SO4. Removal of the solvent under reduced pressure
gave the crude product, which was purified by flash chromatography
on silica gel to furnish compounds 2b, 3b, 5b, 6b, 6b′, or 7.
Compounds 5, 6, 8, 9, 10, and 12. A solution of 2b, 3b, 5b, 6b,
6b′, or 7 (0.1 mmol) in THF (5 mL) was added to BH3−THF (1M,
1 mL) at −78 °C. The reaction was stirred for 2 h and then quenched
using H2O (5 mL). The mixture was extracted with Et2O (20 mL)
twice. The organic phase was washed with brine and concentrated,
and the residue was purified by column chromatography to give 5, 6,
8, 9, 10, or 12.
were infected by PEDV. Total RNA was extracted after 24 h for
measurement using a qPCR assay.
Hsc70 Messenger RNA Half-Life Assay. Marc145 cells were
either left untreated or treated with 50 μg/mL compounds for 24 h.
Then, 10 μg/mL actinomycin D (A.G. Scientific, San Diego, CA) was
added to block transcription. Total cellular RNAs were harvested at
different times after actinomycin D treatment to analyze Hsc70
mRNA (mRNA) levels with qPCR Hsc70 mRNA levels which were
normalized to β-actin and plotted against time, and the decay rate or
half-life of Hsc70 mRNA was calculated.
Western Blot Assay. The extracted total protein or viral lysates
were denatured by adding SDS-PAGE sample loading buffer (2×) and
then boiled for 5 min at 100 °C. Proteins were analyzed by SDS-
PAGE and then transferred to polyvinylidene fluoride (PVDF)
membranes (Millipore) using a GE TE77 ECL Transphor semidry
transfer unit. The membranes were blocked in 5% nonfat dry
skimmed milk in PBST solution for 1 h and then washed three times
for 10 min with PBST solution. Membrane samples were probed with
a monoclonal antibody specific for the PEDV protein (diluted to 1
μg/mL) or Hsc70 (diluted to 0.2 μg/mL; Abcam, Ltd.). As a control,
probing experiments were also performed using a polyclonal antibody
against actin (diluted to 0.2 μg/mL). After they were washed with
PBST, the membranes were incubated for 1 h with an appropriate
secondary antibody. The protein signal was visualized and captured
using the Immbilon Western chemiluminescent HRP substrate ECL
working solution (Millipore Inc.) and a ChemiDoc, Touch imaging
system (Bio-Rad, CA).
Anti-PEDV Activities of Phenanthridine Compounds In
Vivo. A total of nine colostrum-deprived 1-day-old piglets (Taihu
and Changbai binary hybridization) were chosen and serologically
confirmed to be negative for PEDV and TGEV antibodies via indirect
ELISA. All piglets were tended under strict veterinary supervision and
then randomly assigned to four groups (control) and were artificially
fed with milk and housed in separate rooms. Three groups (negative
control, compound 1 treated, and compound 4 treated) were
challenged orally with 5 mL of 103 MID/mL of PEDV virulent
virus (intestinal tissue from virulent PEDV-infected piglets).
Compounds 1 or 4 (50 mg/kg) and the same volume of saline
were given orally to the compound-1-treated group, the compound-4-
treated group, and the negative control group, respectively. Following
the challenge, infected piglets were examined for clinical symptoms
once per day. After 115 h of challenge, both piglets in the negative
control group and one from the compound-1-treated group died
within 5 h. All the surviving piglets were then euthanized by
pentobarbital sodium injection for pathological examination. At
necropsy, the intestine and other major organs were examined.
Jejunum, ileum, and colon samples were placed in 4% paraformalde-
hyde, dehydrated in graded alcohol, embedded in paraffin, cut into 5
μm sections, and mounted on microscope slides. All animal
experiments were approved by the Institutional Animal Care and
Use Committee of Nanjing Agricultural University (Nanjing, People’s
Republic of China) following the guidelines of the National Institutes
of Health. The approved protocol number for this investigation was
NAU201846, and the approval date is 1 December 2018.
Compounds 6d and 11. These two compounds were synthesized
according to previous reports.29
Cells and Viruses. The Marc145 cell line was propagated in
Dulbecco’s Modified Eagle’s Medium (DMEM) (Hyclon) supple-
mented with 10% fetal bovine serum (FBS, Gibco-BRL, Gaithersburg,
MD). The PEDV strain 85-7 (Passage 5, P5) used herein was isolated
in our laboratory and cultured at a multiplicity of infection (MOI) of
0.1 in the presence (10 ng/μL) or in the absence of trypsin. Briefly, a
cultured confluent monolayer of MARC-145 cells were inoculated
with stock virus 85-7 strain and allowed to adsorb for 1 h at 37 °C
with 5% CO2. The cells were washed three times with DMEM; then,
maintenance medium (DMEM with 2% FBS) was added, and the
culturing continued at 37 °C with 5% CO2. The cells were harvested
when a cytopathic effect (CPE) of 80% developed. The cell mixtures
were subjected to one freeze−thaw cycle and centrifuged at 3000 × g
for 10 min at 4 °C, and the supernatants were harvested for further
propagation or saved at −80 °C.
Quantitative Real-Time PCR (qPCR). Total RNA of the PEDV-
infected cells or recombinant plasmid transfected-cells was extracted
using the RNAiso Plus reagent (Takara, Japan), according to the
manufacturer’s protocols. The concentrations of the extracted RNA
were measured using a Thermo Scientific Nano Drop 2000c (Thermo
Scientific, USA). Gene-specific primers for qPCR are listed in Table
1.17,19,20 qPCR was performed with ChamQ Universal SYBR qPCR
Master Mix using an ABI 7300 real-time PCR system. The β-actin
gene served as the endogenous control.23 Relative quantities of
mRNA accumulation were evaluated based on the 2−ΔΔCt method
compared with mock-treated results.22 Each sample was run in
triplicate.
Immunofluorescence Assay (IFA). An IFA was performed as
follows (Figure 5). The mock or PEDV-infected Marc145 cells were
fixed with 4% methanol at 37 °C for 10 min and then permeabilized
with 2% Triton X-100 at 37 °C for 5 min. The cells were blocked with
1% BSA at 37 °C for 1 h; then, incubation was carried out with mouse
anti-PEDV monoclonal antibody in 1% BSA (1:200, overnight, 4 °C).
Afterward, the cells were incubated with Cy3-labeled goat antimouse
IgG (H+L) (1:500, 37 °C, 1 h, in the dark) and then stained with
DAPI (37 °C, 10 min, in the dark). Finally, the stained cells were
examined by fluorescence microscopy (Zeiss, Germany). All solutions
were prepared in 1% BSA, and the cells were washed with PBS
containing 0.5% Tween-20 (PBST) five times between each step.
Cytotoxicity Assay of Compounds. The Marc145 cell
monolayer was digested with trypsin-EDTA, and cell numbers were
obtained with a cytometer. Then, 100 μL of a culture with 2 × 105
cells/mL was plated into 96-well plates. Fresh culture medium
containing each test compound at various concentrations was added 6
h later. Cytotoxicity was evaluated using a CKK-8 assay, according to
the manufacturer’s instructions.
Overexpression of Hsc70 Assays. The external Hsc70 was
amplified from the Hsc70 plasmid by PCR and then cloned into the
pEGFP-N1 expression vector to generate pEGFP-N1/Hsc70
plasmids. The PCR primers are listed in Table 1. The recombinant
plasmids were transfected into Marc145 cells using Lipofectamine
2000 (Invitrogen, USA), according to the manufacturer’s instructions.
Then, 24 h later, the transfected cells were divided into dishes for
either drug treatment or an untreated control. Next, 2 h later, cells
Statistical Analysis. Results were expressed as means SD and
analyzed with GraphPad Prism 7. One-way analysis of variance was
employed to determine significant differences among multiple groups,
and a t test was employed to identify differences between the two
groups (*p < 0.05, **p < 0.01, ***p < 0.001). Data were combined
from at least three independent experiments unless otherwise stated.
ASSOCIATED CONTENT
■
sı
* Supporting Information
The Supporting Information is available free of charge at
https://pubs.acs.org/doi/10.1021/acs.jnatprod.0c01252.
NMR data, NMR spectra, images of clinical signs of in
vivo assays, and IFA images of tissue samples (PDF)
1182
https://doi.org/10.1021/acs.jnatprod.0c01252
J. Nat. Prod. 2021, 84, 1175−1184

Journal of Natural Products
pubs.acs.org/jnp
Article
Innovation Promotion Association of CAS (2018429), The
Central Asian Drug Discovery and Development Center of
Chinese Academy of Sciences (CAM201801), the Fundamen-
tal Research Funds for the Central Universities
(KJQN201618), and the Priority Academic Program Develop-
ment of Jiangsu Higher Education Institutions.
AUTHOR INFORMATION
Corresponding Authors
Xiao-Jiang Hao − State Key Laboratory of Phytochemistry and
Plant Resources in West China, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650201, People’s
Republic of China; orcid.org/0000-0001-9496-2152;
Email: haoxj@mail.kib.ac.cn
■
Guang-Jin Liu − College of Veterinary Medicine, Nanjing
Agricultural University, Nanjing 210095, People’s Republic of
China; Email: liugj100@njau.edu.cn
REFERENCES
■
(1) Coleman, C. M.; Frieman, M. B. J. Virol. 2014, 88, 5209−5212.
(2) Song, Z.; Xu, Y.; Bao, L.; Zhang, L.; Yu, P.; Qu, Y.; Zhu, H.;
Zhao, W.; Han, Y.; Qin, C. Viruses 2019, 11, 59/1−59/28.
(3) de Wit, E.; van Doremalen, N.; Falzarano, D.; Munster, V. J. Nat.
Rev. Microbiol. 2016, 14, 523−534.
(4) Fan, Y.; Zhao, K.; Shi, Z.-L.; Zhou, P. Viruses 2019, 11, 210/1−
210/14.
(5) Balboni, A.; Battilani, M.; Prosperi, S. New Microbiol. 2012, 35,
Authors
Duo-Zhi Chen − State Key Laboratory of Phytochemistry and
Plant Resources in West China, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650201, People’s
Republic of China
1−16.
Shi-Rui Fan − State Key Laboratory of Phytochemistry and
Plant Resources in West China, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650201, People’s
Republic of China; University of Chinese Academy of
Sciences, Beijing 100049, People’s Republic of China
Bi-Juan Yang − State Key Laboratory of Phytochemistry and
Plant Resources in West China, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650201, People’s
Republic of China; University of Chinese Academy of
Sciences, Beijing 100049, People’s Republic of China
Huo-Chun Yao − College of Veterinary Medicine, Nanjing
Agricultural University, Nanjing 210095, People’s Republic of
China
Yi-Ting Wang − State Key Laboratory of Phytochemistry and
Plant Resources in West China, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650201, People’s
Republic of China; University of Chinese Academy of
Sciences, Beijing 100049, People’s Republic of China
Jie-Yun Cai − State Key Laboratory of Phytochemistry and
Plant Resources in West China, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650201, People’s
Republic of China
Chen-Xu Jing − State Key Laboratory of Phytochemistry and
Plant Resources in West China, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650201, People’s
Republic of China
Zi-Hao Pan − College of Veterinary Medicine, Nanjing
Agricultural University, Nanjing 210095, People’s Republic of
China
Miao Luo − College of Veterinary Medicine, Nanjing
Agricultural University, Nanjing 210095, People’s Republic of
China
Yan-Qiu Yuze − College of Veterinary Medicine, Nanjing
Agricultural University, Nanjing 210095, People’s Republic of
China
(6) Chafekar, A.; Fielding, B. C. Viruses 2018, 10, 93/1−93/22.
(7) Torres, J.; Surya, W.; Li, Y.; Liu, D. X. Viruses 2015, 7, 2858−
2883.
(8) V’Kovski, P.; Al-Mulla, H.; Thiel, V.; Neuman, B. W. Virus Res.
2015, 202, 33−40.
(9) Hilgenfeld, R. FEBS J. 2014, 281, 4085−4096.
(10) de Wilde, A. H.; Snijder, E. J.; Kikkert, M.; van Hemert, M. J.
Curr. Top. Microbiol. Immunol. 2017, 419, 1−42.
(11) Zhao, M.; Zhang, H.; Liu, K.; Gao, G. F.; Liu, W. J. Sci. China:
Life Sci. 2017, 60, 1307−1316.
(12) Kilianski, A.; Baker, S. C. Antiviral Res. 2014, 101, 105−112.
(13) Gulland, A. Br. Med. J. 2016, 352, i225/1.
(14) Shadrick, W. R.; Ndjomou, J.; Kolli, R.; Mukherjee, S.; Hanson,
A. M.; Frick, D. N. J. Biomol. Screening 2013, 18, 761−781.
(15) Kawai, A.; Sagara, J. Igaku no Ayumi 1996, 176, 211−214.
(16) Radhakrishnan, A.; Yeo, D.; Brown, G.; Myaing, M. Z.; Iyer, L.
R.; Fleck, R.; Tan, B.-H.; Aitken, J.; Sanmun, D.; Tang, K.; Yarwood,
A.; Brink, J.; Sugrue, R. J. Mol. Cell. Proteomics 2010, 9, 1829−1848.
(17) Chromy, L. R.; Pipas, J. M.; Garcea, R. L. Proc. Natl. Acad. Sci.
U. S. A. 2003, 100, 10477−10482.
(18) Parent, R.; Qu, X.; Petit, M.-A.; Beretta, L. Hepatology 2009, 49,
1798−1809.
(19) Liu, T.; Daniels, C. K.; Cao, S. Pharmacol. Ther. 2012, 136,
354−374.
(20) Chen, D.; Cai, J.; Yin, J.; Jiang, J.; Jing, C.; Zhu, Y.; Cheng, J.;
Di, Y.; Zhang, Y.; Cao, M.; Li, S.; Peng, Z.; Hao, X. Future Med. Chem.
2015, 7, 561−570.
(21) Wang, Y.-P.; Liu, F.; He, H.-W.; Han, Y.-X.; Peng, Z.-G.; Li, B.-
W.; You, X.-F.; Song, D.-Q.; Li, Z.-R.; Yu, L.-Y.; Cen, S.; Hong, B.;
Sun, C.-H.; Zhao, L.-X.; Kreiswirth, B.; Perlin, D.; Shao, R.-G.; Jiang,
J.-D. Antimicrob. Agents Chemother. 2010, 54, 2070−2077.
(22) Chen, D.; Cai, J.; Cheng, J.; Jing, C.; Yin, J.; Jiang, J.; Peng, Z.;
Hao, X. Sci. Rep. 2015, 5, 14972.
(23) Chen, D.-Z.; Jiang, J.-D.; Zhang, K.-Q.; He, H.-P.; Di, Y.-T.;
Zhang, Y.; Cai, J.-Y.; Wang, L.; Li, S.-L.; Yi, P.; Peng, Z.-G.; Hao, X.-J.
Bioorg. Med. Chem. Lett. 2013, 23, 2679−2682.
(24) Gao, L.-M.; Han, Y.-X.; Wang, Y.-P.; Li, Y.-H.; Shan, Y.-Q.; Li,
X.; Peng, Z.-G.; Bi, C.-W.; Zhang, T.; Du, N.-N.; Jiang, J.-D.; Song,
D.-Q. J. Med. Chem. 2011, 54, 869−876.
Complete contact information is available at:
https://pubs.acs.org/10.1021/acs.jnatprod.0c01252
(25) Jung, K.; Saif, L. J. Vet. J. 2015, 204, 134−143.
(26) Lee, C. Virol. J. 2015, 12, 193/1−193/16.
Author Contributions
(27) Sung, M.-H.; Lin, C.-N.; Chiou, M.-T.; Cheng, I. J.; Thanh, Q.-
H.; Chao, D.-Y.; Lan, Y.-C. PLoS One 2019, 14, e0213153/1−
e0213153/13.
∥D.-Z.C. and S.-R.F. contributed equally to this work.
Notes
(28) Zhao, P.-D.; Tan, C.; Dong, Y.; Li, Y.; Shi, X.; Bai, J.; Jiang, P.
Can. J. Vet. Res. 2015, 79, 8−15.
The authors declare no competing financial interest.
(29) Liu, C.; Tang, J.; Ma, Y.; Liang, X.; Yang, Y.; Peng, G.; Qi, Q.;
Jiang, S.; Li, J.; Du, L.; Li, F. J. Virol. 2015, 89, 6121−6125.
(30) Marthaler, D.; Bruner, L.; Collins, J.; Rossow, K. Emerging
Infect. Dis. 2014, 20, 2162−2163.
ACKNOWLEDGMENTS
■
This research was funded by the National Natural Science
Foundation of China (81973212, 81773610), The Youth
1183
https://doi.org/10.1021/acs.jnatprod.0c01252
J. Nat. Prod. 2021, 84, 1175−1184

Journal of Natural Products
pubs.acs.org/jnp
Article
(31) Sun, M.; Yu, Z-Y-Q.; Ma, J.-L.; Pan, Z.-H.; Lu, C.-P.; Yao, H.-
C. J. Vetmic. 2017, 205, 6−13.
1184
https://doi.org/10.1021/acs.jnatprod.0c01252
J. Nat. Prod. 2021, 84, 1175−1184