Pyrimidine containing epidermal growth factor receptor kinase inhibitors: Synthesis and biological evaluation

Article abstract of DOI:10.1111/cbdd.13027

Structure-based design and synthesis of pyrimidine containing reversible epidermal growth factor receptor (EGFR) inhibitors 1a–d are reported. The compounds (1a–d) inhibited the EGFR kinase activity in vitro with IC₅₀ range 740?nm to 3?μm. mRNA

Full text of DOI:10.1111/cbdd.13027

DR. RAJ KUMAR (Orcid ID : 0000-0001-5113-6627)
MRS ANJANA MUNSHI (Orcid ID : 0000-0001-9488-1993)
Article type : Research Article
Pyrimidine Containing Epidermal Growth Factor Receptor Kinase inhibitors:
Synthesis and Biological Evaluation
Short Running title: Pyrimidines as EGFR Inhibitors
Gaurav Joshi,a Himanshu Nayyar,a Sourav Kalra,b Praveen Sharma,b Anjana Munshi,b
Sandeep Singh,b Raj Kumar*a
aLaboratory for Drug Design and Synthesis, Centre for Pharmaceutical Sciences and Natural Products,
bCentre for Human Genetics and Molecular Medicine, Central University of Punjab, 151 001, Bathinda,
India
*E-mail: raj.khunger@gmail.com, rajcps@cup.ac.in; Tel: +91-0164-2864215; fax: +91-1636-236564
Abstract: Structure based design and synthesis of pyrimidine containing reversible
epidermal growth factor receptor (EGFR) inhibitors 1a-d are reported. The compounds
(1a-d) inhibited the EGFR kinase activity in vitro with IC50 range 740 nM to 3 µM.
mRNA expression of EGFR downstream target genes i.e. twist, c-fos and aurora were
found to be altered upon treatment with compounds 1a-d. The compounds 1a-d
exhibited excellent anticancer activity at low micromolar level (3.2-9 µM) in lung, colon
and breast cancer cell lines. Furthermore, compounds induced the alteration in
mitochondrial membrane potential and reactive oxygen species level and. Selected
compound 1b was found to increase sub-G1 population indicative of cell death, the mode
of cell death was apoptotic as evident from Annexin V verses propidium iodide assay.
Molecular modelling further helped investigating the binding recognition pattern of the
compounds in ATP-binding EGFR domain similar to erlotinib and dissimilar to WZ4002.
This article has been accepted for publication and undergone full peer review but has not been
through the copyediting, typesetting, pagination and proofreading process, which may lead to
differences between this version and the Version of Record. Please cite this article as doi:
10.1111/cbdd.13027
This article is protected by copyright. All rights reserved.

Keywords: EGFR, Pyrimidine, Anticancer, Cell cycle analysis, Molecular Modelling.
1. INTRODUCTION
Cancer involves the uncontrolled proliferation of the cells and can occur almost in
any type of tissue[1]. Cancerous cells possess certain characteristics that include
tissue invasion, metastasis, evasion of apoptosis, angiogenesis, inflammation,
immortality which make them insensitive to conventional anticancer agents[2-4]
.
This necessitated the need of target based anticancer drug discovery[5]. Amongst
the various anticancer drug targets known, epidermal growth factor receptor
(EGFR) belonging to a family of tyrosine kinase, discovered by Stanley and Cohen
is well characterised and most studied due to its overexpression in a variety of
cancer especially lung, breast, ovary, etc. and auto phosphorylation leading to
upregulated downstream cell signalling[6].
Quinazoline based first generation EGFR inhibitors (Figure 1) such gefitinib and
erlotinib were approved by USFDA in 2002 and 2004, respectively against non-
small cell lung cancer (NSCLC)[7]. However, emergence of acquired resistance and
point mutations (T790M and L858R) with their use made them ineffective and to
overcome this, development of second generation EGFR inhibitors such as
canertinib and afatanib able to make covalent bond with CYS797 took place[8-10]
.
But, due to their skin and gastrointestinal toxicity[11]; possibly because of their
similar quinazoline scaffold and covalent bond formation stimulated the
researchers to explore other alternate template i.e. pyrimidine based irreversible,
third generation EGFR inhibitors for instances WZ4002 and osimertinib[12, 13]
.
Although early, Phase I clinical trials of third generation EGFR inhibitors are
found to be promising and effective but they are likely to produce off-target side
effects and toxicities after their prolonged use[14, 15]
.
Thus, based on our previous experiences in anticancer drug discovery[16-24], we
have designed the target compounds (Figure. 2) considering the common
pharmacophoric features of erlotinib (reversible) and WZ4002 (irreversible)[25]
with the assumptions that compounds should: (a) possess pyrimidine ring with 2-
alkoxy/hydroxyl anilino moiety for hydrogen bond interaction with MET793, (b)
This article is protected by copyright. All rights reserved.

be able to selectively target hypoxic tumours by possessing nitro substituent on
either or both the aromatic rings with/without solubility enhancer due to their
bioreduction to yield electrophilic substances which are capable of damaging
protein and nucleic acids[24, 26] and have radiosensitising ability[27], (c) be reversible
and non-covalent in nature as irreversible inhibitors not only make covalent
interactions with CYS797 of target but also undergo conjugate addition with other
nucleophiles in the body due to their Michael acceptor property, thereby leading
to off-target side effects and, (d) be easy to synthesize and cost-effective.
In the present work, synthesis and detailed in vitro biological evaluation of the
target compounds are reported. Additionally, mechanistic interventions derived
through target based EGFR inhibitory activities, reactive oxygen species
generation, mitochondrial destabilisation potential, effect of EGFR inhibition on its
down regulatory mRNA levels through RT-PCR, followed by arrest of cell cycle
with respect to synthetics has been performed. The facts were further substantiated
through molecular docking methods on kinase domain of EGFR.
2. EXPERIMENTAL SECTION
2.1. General
All the reagents required for synthesis were purchased Sigma-aldrich, Loba, Avra
and CDH, India and were used without further purification. All the reagents for
biology were purchase from Sigma, Invitrogen and cells were procured from
NCCS Pune, India. Flow cytometry experiments were performed in BD Accuri C6
software and all the absorbance/fluorescent based studies were performed on
Biotage microplate reader.
All yields refer to isolated products after purification. Products were characterized
by spectroscopic data (IR, NMR, MS spectra and CHNS analysis). NMR
experiments were measured in CDCl3/ d6-DMSO relative to TMS (0.00 ppm). IR
(KBr pellets) spectra were recorded on a Fourier transform infrared (FT-IR)
Thermo spectrophotometer. Melting points were determined in open capillaries
and were uncorrected. All the target compounds were characterised by IR, NMR,
and Mass and or elemental analyses (see supplementary information).
This article is protected by copyright. All rights reserved.

2.2. Chemistry
2.2.1. Synthesis of 2-chloro-4-(3-nitrophenoxy)pyrimidine (4)
A mixture of 2, 4-dichloro pyrimidine (0.5 g, 3.35 mmol), 3-nitrophenol (0.46 g,
3.35 mmol) and NaOH (0.134 g, 3.35 mmol) in acetone and water (3mL v/v) was
stirred at 60 °C for 24 h. The completion of the reaction was observed by TLC.
The reaction mixture was then allowed to cool down to room temperature and
excess of solvent was removed using rotary evaporator. Dried compound was
washed with solution of 10% sodium carbonate (25 mL × 3) and dried over
anhydrous Na2SO4 to afford the crude product which was used next step without
further purification.
2.2.2. Synthesis of 2,4-bis(3-nitrophenoxy)pyrimidine (1a)
A mixture of 2, 4-dichloro pyrimidine (0.5 g, 3.35 mmol), 3-nitrophenol (0.92 g,
6.70 mmol) and NaOH (0.134 g, 3.35 mmol) in acetone and water (3mL v/v) was
stirred at 60 °C for 48 h. The progress of reaction was monitored by TLC. The
reaction mixture was then allowed to cool down to room temperature and excess of
solvent was removed using rotary evaporator. Dried compound was washed with
solution of 10% sodium carbonate (25mL × 3) and further dried over anhydrous
Na2SO4 to afford the crude product. The purity of the isolated 1a was determined
by HPLC (Shimadzu) (C18, 4.6 × 250 mm, 5µm), using 25% MeOH as mobile
phase with a flow rate of 1.0 mL/min. The physical data of 1a has been given in
supplementary information.
2.2.3. Synthesis of 1-(3-methoxy-4-nitrophenyl)-4-methylpiperazine (8)
1-methyl piperazine (0.42 mL, 4.378 mmol) and 4-fluoro 2-methoxy 1-
nitrobenzene (0.5 g, 2.91 mmol) were heated at 50 °C for 4-6 hours in DMF and
K2CO3 (2 eq., 0.80 g). After the completion of the reaction (TLC), the crude
mixture was extracted with ethyl acetate (10 mL × 3). The organic layer was
evaporated using rotary evaporator to afford yellow colour compound.
This article is protected by copyright. All rights reserved.

2.2.4. Synthesis of 2-methoxy-4-(4-methylpiperazin-1-yl) aniline (5)
To a solution of (1.99 mmol, 0.5 g,) in methanol (3 mL) was added tin (II)
8
dichloride dihydrate (9.95 mmol 2.25 g). The reaction mixture was allowed to cool
and conc. HCl was added (4 mL). The reaction was stirred further at room
temperature for 6-8 h. After the completion of the reaction (TLC), excess solvent
was removed using rotary evaporator. The dried compound was washed and
basified using conc. NaOH (pH 11). The water layer was extracted with diethyl
ether (25 mL × 3). The combined organic layer was dried (Na2SO4), filtered and
the solvent was removed under reduced pressure to afford the title compound (5).
2.2.5. Synthesis
nitrophenoxy) pyrimidin-2- amine (1b)
(0.5 g, 1.9 mmol) and (0.36 g, 1.6mmol) were dissolved in isobutanol and
of
N-(2-methoxy-4-(4-methylpiperazin-1-yl)
phenyl)-4-(3-
4
5
CF3COOH (1.6 mL, 1.05 mmol) was added. The reaction mixture was refluxed for
3 h. After the completion of the reaction (TLC), the crude mixture was extracted
with methylene chloride (10 mL × 3). The organic layer was evaporated using
rotary evaporator to obtain a brownish color solid that was purified through
column chromatography (Silica gel #60-120, 70-30% EtOAc : Petroleum ether) to
obtain the pure product. The purity of the isolated 1b was determined by HPLC
(Shimadzu) (C18, 4.6 × 250 mm, 5µm), using 30% MeOH as mobile phase with a
flow rate of 1.0 mL/min. The physical data of 1b has been given in supplementary
information.
2.2.6. Synthesis of 2-((4-(3-nitrophenoxy)pyrimidin-2-yl)amino)phenol (1c)
4
(0.5 g, 1.9 mmol), and 5 (0.4 g, 1.80 mmol) in DMF and K2CO3 (2 eq.) were
heated at 50 °C for 5 h. After the completion of the reaction (TLC), the crude
mixture was extracted with ethyl acetate (10 mL × 3). The organic layer was
evaporated using rotary evaporator to afford a solid compound. The product was
purified through column chromatography (Silica gel #60-120, 20-80% EtOAc:
Petroleum ether) to obtain the pure product (1c). The purity of the isolated 1c was
determined by HPLC (Shimadzu) (C18, 4.6 × 250 mm, 5µm), using 25% MeOH
This article is protected by copyright. All rights reserved.

as mobile phase with a flow rate of 1.0 mL/min. The physical data of 1c has been
given in supplementary information.
2.2.7. Synthesis of 2-((4-(3-aminophenoxy)pyrimidin-2-yl)amino)phenol (1d)
1c (0.5 g, 2.21 mmol), was dissolved in methanol (3 mL) and to it tin (II)
dichloride dihydrate (9.95 mmol 2.25 g) was added. The reaction mixture was
allowed to cool and conc. HCl was added (4 mL). The reaction was stirred further
at room temperature for 6-8 hours. After the completion of the reaction (TLC),
excess solvent was removed using rotary evaporator. The dried compound was
washed and basified using conc. NaOH (pH 11). The water phase was extracted
with diethyl ether (25 mL × 3). The combined organic layer was dried (Na2SO4),
filtered dried and purified through column chromatography (Silica gel # 60-120,
60-40% EtOAc: Petroleum ether) to obtain the pure product (1d). The purity of the
isolated 1d was determined by HPLC (Shimadzu) (C18, 4.6 × 250 mm, 5µm),
using 25% MeOH as mobile phase with a flow rate of 1.0 mL/min. The physical
data of 1d has been given in supplementary information.
2.3. Molecular Docking Studies
The protein structure PDB ID: 1M17[28] was procured from the protein data bank.
It has better resolution of 2.6 angstroms and contains co-crystallized erlotinib. The
ligands were prepared using OPLS-2005 force field in the Ligprep module. The
protein preparation was done using the “Prepwiz” module in which addition of
hydrogen atoms, bond orders assignment, removal of water molecules beyond 5Å,
and filling the missing side chain and loops using PRIME module was done. The
pre-processed protein was further refined using the OPLS-2005 force field. The
grid generation was carried out using grid generation module considering the
centroid of the co-crystallized ligand erlotinib. The docking was performed using
GLIDE module with extra precision (XP) mode.
This article is protected by copyright. All rights reserved.

2.4.
Biology
2.4.1. EGFR inhibitory assay
EGFR Inhibitory potential of the investigational compounds was determined by z-
lyte kinase assay kit-tyr4 peptide (catalogue no. PV3193). The inhibitory effect on
kinase was measured spectrophotometrically at 400, 445 and 520 nm, respectively.
Erlotinib was used as a positive control for the inhibitory assay. For assay mixture
consist of 133 µL kinase buffer, 0.5 µL kinase peptide mixtures, 0.5 µL
phosphopeptide mixtures, 0.5 µL ATP test sample solution. The investigational
compounds were serially diluted at a concentration of 250, 750 nM and 1, 5, 25
µM in 4% DMSO. The assay plates were prepared in triplicates and were mixed
and incubated at room temperature for 1 h. After this treatment with 5 µL of
development solution was done and further kept in dark for another 1 hr.
ultimately the enzymatic reaction was stopped with the addition of 5 µL stop
solution. The absorbance was measured using UV-VIS spectrophotometer.
Calculation emission ratio: Emission ratio= Coumarin Emission (445
nm)/fluorescein emission (520 nm). The extent of phosphorylation was calculated
by following formula:
(
)
ꢌꢍꢉꢃꢃꢉꢂꢊ ꢄꢇꢈꢉꢂ ꢎ ꢏꢋꢐꢐ% ꢑ ꢒꢋꢐꢐ%
% ꢀꢁꢂꢃꢀꢁꢂꢄꢅꢆꢇꢈꢉꢂꢊ = ꢋ −
(ꢒꢐ%ꢑꢒꢋꢐꢐ%) ꢓ [ꢌꢍꢉꢃꢃꢉꢂꢊ ꢄꢇꢈꢉꢂ (ꢏꢋꢐꢐ%ꢑꢏꢐ%)]
Where C0%= Average coumarin emission signal of the 100% Phos. Control; C100% =
Average coumarin emission signal of the 0% Phos. Control; F100% = Average
Fluorescein emission signal of the 100% Phos. Control; F0% = Average Fluorescein
emission signal of the 0% Phos. Control
2.4.2. RT-PCR Assay
RNA was isolated from cells using Tri-reagent available with Sigma-Aldrich and
was in accordance to manufacturer’s protocol. Cells were lysed using Tri-reagent
and then mixed with chloroform and further centrifuged at 12,000 g for 10
minutes. The aqueous phase was removed and precipitation of RNA was done
This article is protected by copyright. All rights reserved.

using isopropanol. The precipitates were further pelleted at 10,000 rpm for 10
minutes. The pellet was air dried and suspended in ultrapure water.
1 μg RNA as template was used to synthesise cDNA in presence of MMLV-RT,
MMLV-RT buffer, 10 mM dNTPs, DTT and RNAse OUT (Invitrogen).
The list of primer used for RT and real time PCR is given below:
c-Fos (Fwd) - 5’ aaggagaatccgaagggaaa
c-Fos (Rev) - 5’ agggcccttatgctcaatct
Twist (Fwd)
ꢀ
- 5’ gtccgcagtcttacgaggag
- 5’ ccagcttgagggtctgaatc
- 5’ agagctacgagctgcctgac
- 5’ agcactgtgttggcgtacag
Twist (Rev)
ꢀ
Actin (Fwd)
ꢀ
Actin (Rev)
ꢀ
Aurora-A (Fwd) - 5’ ctcgccaggtaaacagaagc
Aurora-A (Rev) - 5’ ccttagttcgcctctgcatc
2.4.3. 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay
Anti-proliferative potential of the investigational compounds was assessed using
MTT assay. The assay was performed in 96-well plate in which each well was
filled with 100 µL complete cell suspension media to which treatment with the
synthetic compounds was given at three concentrations viz., 1, 5 and 25 µM and
incubated thereafter for 24 h. After 24 h, media was discarded and subsequently
washed with 1X PBS and was consequently treated with MTT dye (5 mg in 10 mL
of 1X PBS) at a concentration of 10 µL per well and incubated at room
temperature in dark for 4 h to allow formation of formazan crystals. After that
formazan crystals were dissolved in DMSO and the absorbance was read
spectrophotometrically using microplate reader at 570 nm. The results were then
represented as mean S.D obtained from three independent experiments.
This article is protected by copyright. All rights reserved.

2.4.4. Human peripheral blood mononuclear cells (PBMCs), Buccal cell culture
and MTT assay
Blood from healthy volunteer was drawn and treated with RBC lysis buffer to
isolate hPBMCs. The cells were then suspended in RPMI media supplemented
with 10% fetal Bovine serum (FBS), 1 X antibiotic solution. The suspension was
added to 96 well plate (10000 cells per well) at 100 µL and was incubated at 37
°C. The treatment with the synthetic compounds was given at three concentrations
viz., 5 and 25 µM and incubated thereafter for 24 h and were consequently treated
with MTT dye (5 mg in 10 mL of 1 X PBS) at a concentration of 10 µL per well
and incubated at room temperature in dark for 4 h to allow formation of formazan
crystals. After that formazan crystals were dissolved in DMSO and the absorbance
was read spectrophotometrically using microplate reader at 570 nm. The results
were then represented as mean
S.D obtained from three independent
experiments. Buccal cavity cells used during experiment were harvested and
culture according to the earlier described protocol by Weisberg et al[29, 30]. All
human cell based experiment was conducted in accordance to protocol no.
CUPB/cc/14/IEC/4483 approved by Institutional Ethics Committee of Central
University of Punjab, Bathinda, as per guidelines issued by Indian Council of
Medical Research (ICMR), Govt. of India.
2.4.5. Reactive oxygen species (ROS) and mitochondrial membrane integrity assays
Cancer cells were treated with the investigational compounds. 24 h post treatment,
the cells were processed for JC-1 and DHE staining to study mitochondrial
membrane polarization and ROS generation, respectively. DHE analysis was done
in flow cytometer (BD Accuri) (for single cell analysis), and also by measuring
OD at 610 nm using a microplate reader. JC-1 assay analysis was done by
measuring OD at (emission at 527 and 590) using a microplate reader. The
experiments were performed at 37 °C followed by washing with 1X PBS to
remove extra dye.
This article is protected by copyright. All rights reserved.

2.4.6. Cell apoptosis assay and mode of cell death (using Annexin V and Propidium
Iodide)
Cellular samples (A549 previously treated with compound 1b for 24 h) were
prepared for staining by transferring 1- 106 cell per tube. The cells were further
centrifuged at 1200 rpm for 5 min and washed with 1X PBS. Thereafter cells were
fixed using chilled ethanol and incubated for 3 h at -20 °C. Post 3 h cells were
subjected to centrifugation at 2500 rpm and washed once with 1 X PBS. 50 µL of
propidium iodide (along with 50 µL Ribonuclease A) was added to each well and
incubated for 30 minutes at room temperature in dark. The DNA content was then
measured using Flow cytometer (BD Accuri).
In order to investigate the exact mode a cell death, Annexin V vs propidium iodide
assay was performed. The cancer cell lines treated with investigational compound
1b previously for 24 hrs were harvested and to each tube added Annexin V dye
and propidium iodide (above mentioned steps were repeated) and incubated for 30
minutes at room temperature in the dark.
3. RESULTS AND DISCUSSION
3.1. Synthesis
Synthesis of the target compounds (1a-d; Scheme 1) was accomplished by heating
2, 4-dichloro pyrimidine (
2; 1 equiv) with 3-nitrophenol (3; 2 equiv) at 60 °C in
acetone-water mixture under basic condition (sodium hydroxide) for 24 h that
regioselectively afforded
equiv) was reacted with
4
3
. Whereas, the complete SNAr occurred when
2 (1
(2 equiv) and when treated with at 100 °C in
4
5
isobutanol under the catalytic influence of CF3COOH for 3 h yielded 1b. The
compound was synthesized from
using the reported procedure[31]. Interestingly,
when heated with in DMF at 50 °C in the presence of K2CO3 for 5 h, resulted
5
6
4
5
in formation of 1c, a methyl ether as well as N-methylpiperzinyl cleaved product.
Though deprotection of methyl ether under basic conditions is known but to the
best of our knowledge cleavage of N-methylpiperzinyl is unreported. Compound
This article is protected by copyright. All rights reserved.

1c underwent reduction of nitro group to afford 1d in methanol when treated with
SnCl2 (3-4 equiv) and concentrated hydrochloric acid for 6-8 h.
All the final compounds were purified through column chromatography, and were
unreported and fully characterised by mp, IR, NMR, Mass and or elemental
analyses (see supplementary information).
3.2.Biological Evaluation
3.3. EGFR kinase Inhibitory Activity
To investigate EGFR inhibitory potential, investigational compounds (1a-d) were
screened for inhibition of ATP dependent phosphorylation of EGFR and inhibitory
potential was measured spectrophotometrically at 400 nm, 445 nm and 520 nm
respectively. Erlotinib was used as a positive control for the inhibition test. The
assay relies upon an enzymatic reaction through which auto phosphorylation and
signalling activity of the EGFR is measured[17]. The results are summarised in
Table 1. Compounds 1b and 1d showed activities in nanomolar range in
accordance to erlotinib, whereas compounds 1a and 1c exhibited low micromolar
activity.
3.4. RT-PCR assay
EGFR signalling is a growth promoting signalling that ensures cell survival as well
as proliferation via modulation of target gene expression. Since the synthesized
compounds are designed to target EGFR, we proceeded to analyse the mRNA
expression of EGFR target genes, twist, c-Fos as well as aurora. EGFR is known to
up-regulate expression of twist as well as aurora to exert anti-apoptotic effect[17, 32]
while it down-regulates the expression of c-Fos, which is apoptotic in nature[17, 32]
,
.
Briefly A549 cells were treated with designed EGFR inhibitors (at 5µM of
concentration) and Erlotinib was used as positive control for its inhibition followed
by RT-PCR based analysis of above mentioned target gene expression. The results
showed that twist expression was down-regulated upon treatment with 1b, 1c and
1d, as well as erlotinib (Figure. 3 lane 2 of 4) compared to the control cells while
This article is protected by copyright. All rights reserved.

Aurora expression was downregulated by compounds 1b and 1d. On the other
hand, same treatments lead to up-regulation of c-Fos expression (Figure. 3, lane 2-
4) compared to the control cells. As c-Fos is negatively regulated by EGFR, it may
be concluded from our results that compounds 1b and 1d were able to inhibit
EGFR activity which lead to down-regulation of twist and up-regulation of c-Fos
expression while aurora, which is also a target of EGFR kinase, expression
remained unchanged.
studies.
β-Actin was used as loading control for all the expression
3.5.Molecular Docking
Since designed compounds were able to inhibit EGFR kinase activity, a molecular
docking of all the compounds (1a ) along with standard EGFR inhibitors,
-
d
erlotinib and WZ4002 into ATP-binding site of EGFR kinase domain (PDB:
1M17)[28] was performed to theoretically understand and investigate their binding
pattern. The favourable interactions between the compounds and EGFR were
scored using Glide (Schrödinger Suite with MAESTRO 10.6 version). We
validated the docking protocol by re-docking the erlotinib, an EGFR inhibitor, into
the crystal structure of ATP binding domain of EGFR kinase domain. The docked
erlotinib exhibited a binding pose similar to the co-crystallized erlotinib with a root
mean square deviation of 1.27 Å which was in good agreement. It was observed
that all the target compounds occupied the ATP binding site with similar binding
cavity and interactions to erlotinib (Figure. 4 A and B). However, WZ4002
exhibited U-shaped pattern dissimilar to erlotinib and target compounds (Figure. 4
C and D). This supported the fact that designed compounds were reversible in
nature. It was observed that 1b and 1d were found to have better dock score (1b:
7.92 and 1d: -8.09; erlotinib: -9.02) and hence better EGFR inhibitory activity.
-
In spite of the different binding orientations of target compounds and erlotinib as
compared to WZ4002, the pyrimidine ring of all the compounds superimposed
each other and one of its nitrogen atoms and N
H linker formed hydrogen bonds
with the NH2 and carbonyl oxygen atom of an important hinge region residue
MET769 of kinase ATP binding site. The hinge residues region of ATP binding
This article is protected by copyright. All rights reserved.

site starts from the LYS764 and ends with CYS773. The other common amino
acids such as GLU738, THR766, CYS773 and ASP831 were involved in the
hydrogen bonding interactions whereas LEU768, GLY772 and LEU694 formed a
hydrophobic pocket and participated in hydrophobic interactions with the
compounds. The NO2 group of 1b was aligned towards THR766; a gatekeeper
residue and involved in favourable hydrogen bonding interaction with THR766
(Figure. 5). THR766 is blocked by the addition of the inhibitor while it does not
participate in ATP binding. The P loop of kinase domain starts from PHE688 and
ends with the TRP707. It also contains activation loop with DFG motif that
contains ASP831, PHE832 and residues GLY833. The nitrophenyl ring of 1b was
surrounded by DFG motif.
3.6. Anti-proliferative Assay
To evaluate the anti-proliferative potential[17, 21, 23] of synthetics (1a-d). MTT based
cell viability assay was performed using breast (MCF-7), colon (HCT-116 wild
type) and lung (A549) cancer cell lines. 10000 cells (100 µL/well) were seeded in
96 well plate and treatments with synthetics at 1, 5 and 25 µM concentration were
given in triplicate followed by 24 h incubation and thereafter analysed via MTT
assay. The results are compiled in Table 2. Compound 1c was found to exhibit IC50
values of 4 µM in HCT-116 wild type, Compound 1d exhibited IC50 values of 3.7
µM and 3.2 µM in MCF-7 and A549 cancer cell lines, respectively. Although the
compounds 1a and 1c were not much active against EGFR but showed comparable
IC50s against cancer cell lines suggesting their alternate mode of anticancer
mechanism(s) and not solely due to EGFR inhibition.
Further we also evaluated the investigational compounds for their selective
toxicities toward normal cells. The experiment was set using normal cells (Buccal
Cavity cells) and we found no significant cytotoxicity toward normal cells even at
highest concentration of 50 µM (Figure.6A). Based upon our previous research
experience[17] whereby we found erlotinib possess the acute cytotoxicity to Human
Peripheral Blood Mononuclear Cells (hPBMCs) at higher concentration, we were
interested to evaluate our investigational compounds for their effect on hPBMCs.
This article is protected by copyright. All rights reserved.

To our delight, we observed no significant cytotoxicity toward hPBMCs even at
the highest concentration of 25 µM for 24 h (Figure.6B).
In order to find out the anticancer effect of compounds in addition to EGFR
inhibition (if any), we next planned to measure the intracellular Reactive Oxygen
Species (ROS) and alteration in mitochondrial membrane integrity of cancer cells
induced by the compounds as follows.
3.7. Dihydroethidium (DHE) based Reactive Oxygen Species (ROS) Assay
Anticancer effects are generally associated with change in ROS levels inside the
cell[17, 21, 23]. To assess the effects of the synthetics on ROS level and to conclude
whether the anticancer effect of the investigational compounds (1a-d) is mediated
by free radicals, ROS assay was performed using DHE based fluorescent detection
system on lung (A549) cancer cell line.
Investigational compounds (1a-d) were evaluated for their ROS generation
properties at 1, 5 and 25 µM concentration at 610 nm. The results showed that
there is not much change in ROS levels at all concentration in comparison to
positive control (Figure 7A).
3.8. Mitochondrial membrane integrity (JC-1) assay
During programmed cell death several key events occur in mitochondria among
which mitochondrial transmembrane potential is an important parameter that
defines the fate of cancer cells. Anticancer drugs are known to cause variation in
mitochondrial potential which are easily detected by cyto-fluorimetric dyes[17, 21,
23]. Deviations in mitochondrial membrane potential lead to release of cytochrome-
c into cytoplasm thus induce intrinsic pathway of apoptosis. To investigate the
changes in mitochondrial membrane induced by the synthetic molecules (1a-d; at
1, 5 and 25 µM concentration) were assayed on A-549 lung cancer cells using
lipophilic
cationic
dye,
5,5’,6,6’-tetrachloro-1,1’,3,3’tetraethylbenzimi-
dazolylcarbocyanine iodide (JC-1). JC-1 dye selectively enters mitochondria and
This article is protected by copyright. All rights reserved.

reversibly changes colour from red to green as membrane potential decreases
(OD590/OD527 ratio). The results showed that all the compounds lead to
imbalance OD590/527 ratios and thus destabilize mitochondrial membrane (Figure
7B) which in turn, leads to cytochrome-c leakage to the cytoplasm. Cytochrome-c
leakage into cytoplasm is one of the foundation steps during initiation of apoptosis.
3.9. Cell cycle analysis and mode of cell death
Anticancer compounds tend to cause cell death and delay the cell cycle
progression by arresting cell cycle[17, 21]. To investigate the specific phase of
inhibition, A549 cell line was treated with a selected compound 1b at 1, 5 and 25
µM concentrations for 24 h. The results showed no significant changes in G1, S as
well as G2-M phases, but it was observed that sub-G1 population increased several
folds at higher concentration of the 1b (0 to 30%) indicative of cell death. It may
be hypothesized that the drug may be toxic to the cells independent of the status of
cell cycle as it is evident from the Figure 8A that G1, S and G2-M phases showed
very less number of cells at higher dose of drug compared to the profiles observed
in control cells (Figure 8B). Other possible explanation is that these cancer cells
might be having mitotic catastrophy[33] at higher drug concentrations. So, in order
to confirm the mode of cell death, we went on to perform annexin-V as well
propidium iodide staining at the same concentrations. Annexin-V positive cells
indicate apoptotic populations while under normal conditions, propidium iodide
does not stain live or early apoptotic cells due to the existence of an undamaged
plasma membrane. In late apoptotic and necrotic cells, the integrity of the plasma
and nuclear membranes declines allowing propidium iodide to pass through the
membranes which further, intercalate into nucleic acids, and display red
fluorescence. Whether the investigational compound 1b exhibited early apoptosis
or the mode of cell death was late apoptosis/necrosis the experiment was setup
using A549 cell line in conjugation with propidium iodide and annexin V. This
experiment detects the release of phosphatidylserine and its conjugation with
annexin V dye. The result exhibited that the mode of cell death was apoptosis
(early apoptosis) as seen by annexin V binding to early apoptosis quadrant in
This article is protected by copyright. All rights reserved.

(Figure. 8C). Camptothecin was taken as positive control for the study at
concentration of 10 µM.
4. CONCLUSION
In summary, we have designed, synthesised, and evaluated the pyrimidine based
compounds (1a-1d) for their potential to exhibit anti-EGFR kinase activity at
nanomolar range (1b and 1d) and anticancer activity at low micromolar range. The
above observations were further supported by the facts that they were able to alter
the levels of EGFR downstream targets and mitochondrial membrane potential
leading to the initiation of apoptosis of cancer cells. However, compounds were
not able to alter the intracellular ROS levels of cancel cells. Molecular docking
studies revealed that compounds could align in the ATP binding pocket of EGFR
similar to erlotinib but dissimilar to WZ4002. Annexin-V versus propidium iodide
based assay suggested that mode of cell death was due to apoptosis. All the above
observations indicated multiple mode of mechanisms involved in anticancer effects
of compounds. Further results on their detailed antitumor potential will be
published in due course.
ACKNOWLEDGEMENT
RK and GJ thank UGC, New Delhi, India for the financial assistance F.30-
13/2013(BSR). SS thanks DST for financial assistance (DST-SERB EMR,
SR/SO/AS-31/2014), PS is recipient of JRF from the project.
CONFLICT OF INTEREST
The authors declare no conflict of interest.
This article is protected by copyright. All rights reserved.

FIGURE 1 Chemical structures of some reported epidermal growth factor receptor inhibitors
FIGURE 2 Design of target compounds (1) as epidermal growth factor receptor inhibitors
FIGURE 3 RT-PCR showing Twist, Aurora, and c-Fos alongside loading control β-actin after
treatment with compounds as indicated while Erlotinib (Erl) is used as positive control.
FIGURE 4 (A) Aligned compounds 1a (pink), 1b (yellow), 1c (peach), and 1d (cyan) depicting
the similar binding pattern with that of erlotinib (green); (B) 3D-interaction diagram depicting
the similar binding pattern of 1b ( yellow; a representative compound) and erlotinib to the EGFR
wild type; (C) Aligned compound 1d (peach; a representative compound) and erlotinib (green)
depicting the dissimilar binding pattern with that of WZ4002 (purple); (D) 3D-interaction
diagram depicting the dissimilar binding pattern of 1b ( yellow; a representative compound) and
WZ4002 (purple) to the EGFR wild type.
FIGURE 5 3D- interaction diagram of 1b depicting the important interactions with the wild type
EGFR kinase domain.
FIGURE 6A Percent survival of buccal cavity cells at 50 µM in response to treatment with
investigational compounds (1a-d) for time duration of 24 h. 6B Percent survival of human
peripheral blood mononuclear cells in response to treatment with investigational compounds (1a-
d). Data is expressed as mean values S.D. of three independent experiments.
FIGURE 7A DHE based assay to measure intracellular reactive oxygen species (ROS) induced
by investigational compounds on A549 cancer cell lines. 7B JC-1 dye based assay to measure
change in mitochondrial membrane potential induced by investigational compounds on A549
cancer cell line
FIGURE 8A Cell cycle analysis using flow cytometry. Compound 1b was used in the study
using A549 cancer cell line (EGFR positive) that showed apoptosis (sub-G1 phase arrest). 8B
The bar graph represents the percent cell count (DNA) at various stages of cell cycle. 8C
Analysis of mode of cell death. The experiment was performed using annexin V vs propidium
iodide with compound 1b and positive control (camptothecin). The compound 1b binds
specifically to annexin V showing mode of cell death as apoptotic.
This article is protected by copyright. All rights reserved.

Scheme 1. Synthesis of target compounds (1a-d). Reaction conditions: (i) acetone-water, 60 °C,
24 h , 94%; (ii) isobutanol, CF3COOH, 100 °C, 3 h, 62 %; (iii) DMF, K2CO3, 50 °C, 5 h, 60%;
(iv) acetone-water, 60 °C, 48 h, 83%; (v) SnCl2 (3-4 equiv), conc. HCl, 6-8 h, 71%; (vi) N-
methyl-piperazine, K2CO3, DMF, 50 °C, 4-6 h, 93%, (vii) SnCl2 (3-4 equiv), conc. HCl, 6-8 h,
73%.
Table 1. EGFR inhibitory activity of the investigational compounds1a-d
Table 2. Anti-proliferative activity of investigational compounds 1a-d
REFERENCES
[1].
G. Joshi, P. K. Singh, A. Negi, A. Rana, S. Singh and R. Kumar, Chem.-Biol. Interact., 2015, 240,
120-133.
[2].
[3].
D. Hanahan and R. Weinberg, Cancer: Principles & Practice of Oncology, 2015, 10.
J. A. McCubrey, S. L. Abrams, T. L. Fitzgerald, L. Cocco, A. M. Martelli, G. Montalto, M. Cervello,
A. Scalisi, S. Candido and M. Libra, Adv. Biol. Regul., 2015, 57, 75-101.
S. Seton-Rogers, Nat. Rev. Cancer, 2016, 16 (3), 128-128.
A. L. Hopkins, Nat. Chem. Biol., 2008, 4 (11), 682-690.
P. Seshacharyulu, M. P. Ponnusamy, D. Haridas, M. Jain, A. K. Ganti and S. K. Batra, Expert Opin.
Ther. Targets, 2012, 16 (1), 15-31.
[4].
[5].
[6].
[7].
[8].
[9].
A. Russo, T. Franchina, G. Ricciardi, A. Picone, G. Ferraro, M. Zanghì, G. Toscano, A. Giordano and
V. Adamo, Oncotarget, 2015, 6 (29), 26814-26825.
D. W. Bell, I. Gore, R. A. Okimoto, N. Godin-Heymann, R. Sordella, R. Mulloy, S. V. Sharma, B. W.
Brannigan, G. Mohapatra and J. Settleman, Nat. Genet., 2005, 37 (12), 1315-1316.
T. K. Sundaresan, L. V. Sequist, J. V. Heymach, G. J. Riely, P. A. Jänne, W. H. Koch, J. P. Sullivan, D.
B. Fox, R. Maher and A. Muzikansky, Clin. Cancer Res., 2016, 22 (5), 1103-1110.
[10]. S. M. Lim, Y. Jeong and S. Hong, Future Med. Chem., 2016, 8 (8), 853-878.
[11]. I. Stasi and F. Cappuzzo, Transl. Respir. Med., 2014, 2 (1), 1.
[12]. J. Engel, J. Lategahn and D. Rauh, ACS Med. Chem. Lett., 2015, 7 (1), 2-5.
[13]. S. L. Greig, Drugs, 2016, 76 (2), 263-273.
[14]. Z. Song, Y. Ge, C. Wang, S. Huang, X. Shu, K. Liu and Y. Zhou, 2016, 59, 6580–6594.
[15]. L. Landi and F. Cappuzzo, Transl. Lung Cancer Res., 2013, 2 (1), 40-49.
[16]. J. M. Alex, S. Singh and R. Kumar, Arch. Pharm., 2014, 347 (10), 717-727.
[17]. M. Chauhan, G. Joshi, H. Kler, A. Kashyap, S. M. Amrutkar, P. Sharma, K. D. Bhilare, U. C.
Banerjee, S. Singh and R. Kumar, RSC Adv., 2016, 6 (81), 77717-77734.
[18]. M. Chauhan, A. Rana, J. M. Alex, A. Negi, S. Singh and R. Kumar, Bioorg. Chem., 2015, 58, 1-10.
[19]. G. Kaur, R. P. Cholia, A. K. Mantha and R. Kumar, J. Med. Chem., 2014, 57 (24), 10241-10256.
[20]. A. Kondaskar, S. Kondaskar, R. Kumar, J. C. Fishbein, N. Muvarak, R. G. Lapidus, M. Sadowska, M.
J. Edelman, G. M. Bol and F. Vesuna, ACS Med. Chem. Lett., 2010, 2 (3), 252-256.
[21]. R. Kumar, U. C. Banerjee, S. M. Amrutkar, A. T. Baviskar, S. Singh, G. Joshi and H. Kler, RSC Adv.,
2016, 6 (18), 14880-14892.
[22]. S. Kumar, S. Sapra, R. Kumar, M. K. Gupta, S. Koul, T. Kour, A. K. Saxena, O. P. Suri and K. L. Dhar,
Med. Chem. Res., 2012, 21 (11), 3720-3729.
This article is protected by copyright. All rights reserved.

[23]. A. Negi, J. M. Alex, S. M. Amrutkar, A. T. Baviskar, G. Joshi, S. Singh, U. C. Banerjee and R. Kumar,
Bioorg. Med. Chem., 2015, 23 (17), 5654-5661.
[24]. A. Rana, J. M. Alex, M. Chauhan, G. Joshi and R. Kumar, Med. Chem. Res., 2015, 24 (3), 903-920.
[25]. Y. Sakuma, Y. Yamazaki, Y. Nakamura, M. Yoshihara, S. Matsukuma, H. Nakayama, T. Yokose, Y.
Kameda, S. Koizume and Y. Miyagi, Lab. Invest., 2012, 92 (3), 371-383.
[26]. Z. Li, X. Li, X. Gao, Y. Zhang, W. Shi and H. Ma, Anal. Chem., 2013, 85 (8), 3926-3932.
[27]. J. Linam and L.-X. Yang, Anticancer Res., 2015, 35 (5), 2479-2485.
[28]. J. Stamos, M. X. Sliwkowski and C. Eigenbrot, J. Biol. Chem., 2002, 277 (48), 46265-46272.
[29]. H. Babich, M. Krupka, H. A. Nissim and H. L. Zuckerbraun, Toxicology in vitro, 2005, 19 (2), 231-
242.
[30]. J. H. Weisburg, D. B. Weissman, T. Sedaghat and H. Babich, Basic & clinical pharmacology &
toxicology, 2004, 95 (4), 191-200.
[31]. C. Han, L. Wan, H. Ji, K. Ding, Z. Huang, Y. Lai, S. Peng and Y. Zhang, Eur. J. Med. Chem., 2014, 77,
75-83.
[32]. L.-Y. Hung, J. T. Tseng, Y.-C. Lee, W. Xia, Y.-N. Wang, M.-L. Wu, Y.-H. Chuang, C.-H. Lai and W.-C.
Chang, Nucleic Acids Res., 2008, 36 (13), 4337-4351.
[33]. M. Castedo, J.-L. Perfettini, T. Roumier, K. Andreau, R. Medema and G. Kroemer, Oncogene,
2004, 23 (16), 2825-2837.
This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.

This article is protected by copyright. All rights reserved.