Alternative heterocycles for DNA recognition: An N-methylpyrazole/N-methylpyrrole pair specifies for A·T/T·A base pairs

Article abstract of DOI:10.1016/S0968-0896(00)00219-4

Side-by-side pairs of three five-membered rings, N-methylpyrrole (Py), N-methylimidazole (Im), and N-methylhydroxypyrrole (Hp), have been demonstrated to distinguish each of the four Watson-Crick base pairs in the minor groove of DNA. However, not all DNA sequences targeted by these pairing rules achieve affinities and specificities comparable to DNA binding proteins. We have initiated a search for new heterocycles which can expand the sequence repetoire currently available. Two heterocyclic aromatic amino acids, N-methylpyrazole (Pz) and 4-methylthiazole (Th), were incorporated into a single position of an eight-ring polyamide of sequence ImImXPy-γ-ImPyPyPy-β-Dp to examine the modulation of affinity and specificity for DNA binding by a Pz/Py pair and/or a Th/Py pair. The X/Py pairings Pz/Py and Th/Py were evaluated by quantitative DNase I footprint titrations on a DNA fragment with the four sites 5′-TGGNCA-3′ (N=T, A, G, C). The Pz/Py pair binds T·A and A·T with similar affinity to a Py/Py pair but with improved specificity, disfavoring both G·C and C·G by about 100-fold. The Th/Py pair binds poorly to all four Watson-Crick base pairs. These results demonstrate that in some instances new heterocyclic aromatic amino acid pairs can be incorporated into imidazole-pyrrole polyamides to mimic the DNA specificity of Py/Py pairs which may be relevant as biological criteria in animal studies become important.

Full text of DOI:10.1016/S0968-0896(00)00219-4

Bioorganic & Medicinal Chemistry 9 (2001) 7±17
Alternative Heterocycles for DNA Recognition:
An N-Methylpyrazole/N-Methylpyrrole Pair Speci®es for
AꢀT/TꢀA Base Pairs
Doan H. Nguyen, Jason W. Szewczyk, Eldon E. Baird and Peter B. Dervan*
Division of Chemistry and Chemical Engineering, California Institute of Technology,
Pasadena, CA 91125, USA
Received 26 April 2000; accepted 13 July 2000
AbstractÐSide-by-side pairs of three ®ve-membered rings, N-methylpyrrole (Py), N-methylimidazole (Im), and N-methylhydroxy-
pyrrole (Hp), have been demonstrated to distinguish each of the four Watson±Crick base pairs in the minor groove of DNA.
However, not all DNA sequences targeted by these pairing rules achieve anities and speci®cities comparable to DNA binding
proteins. We have initiated a search for new heterocycles which can expand the sequence repetoire currently available. Two het-
erocyclic aromatic amino acids, N-methylpyrazole (Pz) and 4-methylthiazole (Th), were incorporated into a single position of an
eight-ring polyamide of sequence ImImXPy-g-ImPyPyPy-b-Dp to examine the modulation of anity and speci®city for DNA
binding by a Pz/Py pair and/or a Th/Py pair. The X/Py pairings Pz/Py and Th/Py were evaluated by quantitative DNase I footprint
titrations on a DNA fragment with the four sites 50-TGGNCA-30 (NˆT, A, G, C). The Pz/Py pair binds Tꢀ A and Aꢀ T with similar
anity to a Py/Py pair but with improved speci®city, disfavoring both Gꢀ C and Cꢀ G by about 100-fold. The Th/Py pair binds
poorly to all four Watson±Crick base pairs. These results demonstrate that in some instances new heterocyclic aromatic amino acid
pairs can be incorporated into imidazole±pyrrole polyamides to mimic the DNA speci®city of Py/Py pairs which may be relevant as
biological criteria in animal studies become important. # 2000 Elsevier Science Ltd. All rights reserved.
Introduction
Given the sequence dependent microstructure of the
DNA helix,10 16 it is signi®cant that a simple recogni-
tion code can be developed.17 20 In both published and
unpublished work, over a hundred pyrrole±imidazole
polyamides have been synthesized which recognize pre-
determined sequences. However, within this group, a
number of DNA sequences have emerged as dicult tar-
gets for pyrrole±imidazole polyamides to bind with sub-
nanomolar anity. Sequence dependent DNA structural
features such as intrinsic minor groove width, minor
groove ¯exibility, and inherent DNA curvature may
reduce polyamide binding at certain sites.10 16 Since
molecular composition could enhance anity at dicult
sequences, the discovery of new monomer subunits that
provide polyamides with anities and speci®cities com-
parable to naturally occurring DNA binding proteins
remains a high priority.
Small molecules that target speci®c predetermined DNA
sequences have the potential to control gene expression.1 3
Polyamides containing the three aromatic amino acids
3-hydroxypyrrole (Hp), imidazole (Im) and pyrrole (Py)
are synthetic ligands that have an anity and speci®city
for DNA comparable to naturally occurring DNA bind-
ing proteins.4 6 Recently, eight-ring hairpin polyamides
have been found to regulate transcription and permeate a
variety of cell types in culture.1,2 DNA recognition
depends on the side-by-side amino acid pairings oriented
N!C with respect to the 50!30 direction of the DNA
helix in the minor groove.4 6 Antiparallel pairing of Im
opposite Py (Im/Py pair) distinguishes Gꢀ C from Cꢀ G
and both of these from Aꢀ T/Tꢀ A base pairs.5,6 A Py/Py
pair binds both Aꢀ T and Tꢀ A in preference to Gꢀ C/
Cꢀ G.5,6 The discrimination of Tꢀ A from Aꢀ T using Hp/
Py pairs completes the four base pair (bp) code.7 9
The substitution of pyrrole C3-H with N or C3-OH to
generate imidazole or hydroxypyrrole, respectively,
clearly demonstrates the impact of atomic substitutions,
in polyamide monomer units, on DNA recognition.5 9
These substitutions also highlight the importance of the
3-position as a recognition element in the ¯oor of the
*Corresponding author. Tel.: +626-356-6002; fax: +626-683-8753;
e-mail: dervan@caltech.edu
0968-0896/01/$ - see front matter # 2000 Elsevier Science Ltd. All rights reserved.
PII: S0968-0896(00)00219-4

8
D. H. Nguyen et al. / Bioorg. Med. Chem. 9 (2001) 7±17
minor groove. The aromatic amino acid monomers of
polyamides are also amenable to modi®cation at the 1-
and 5-positions of the pyrrole±imidazole rings. Substitu-
tions at the 1-position have been investigated,5 but until
now, substitutions at the pyrrole 5-position have not been
evaluated. Replacement of the C5-H of N-methylpyr-
role with N generates a new heterocyclic amino acid
subunit, N-methylpyrazole (Pz). Pyrazole was thought
to be of interest in light of altered ring electronics, pos-
sible interactions between the newly introduced nitrogen
and the polyamide backbone amide oxygen, di€ering
cell-permeation properties or degradation pathways in
living animals. Additionally, a previously reported
heterocyclic aromatic amino acid, 4-methylthiazole
(Th), which substitutes an S for C3-H, N for C5-H and
C for N1 relative to pyrrole, was added to this study for
comparison (Figs 1 and 2). When incorporated into
three ring distamycin analogues, the 4-methylthiazole
(Th) monomer,21 which places a sulfur atom into the
¯oor of the minor groove, conferred A/T preference
over G/C.21,22 Thiazole (Th) has been proposed in the
literature as an A-speci®c recognition element since the
bulkiness of the sulfur atom was expected to sterically
clash opposite the O2 of thymine and therefore be better
accommodated opposite an adenine base.23,24 However,
it has been shown that the asymmetric cleft in the minor
groove of A/T pairs preferentially places the bulky C3-
OH group of Hp opposite T rather than A, where there
is a steric destabilization with the C2-H of adenine.7,8
Since an additional hydrogen bond is also made
between Hp and T, it remains quite interesting to
Figure 1. Binding model for the 1:1 complexes formed between the
DNA and ImImXPy-g-ImPyPyPy-b-Dp. Circles with dots represent
lone pairs of N3 of purines and O2 of pyrimidines. Circles containing
an H represent the N2 hydrogen of guanine. N is represented as A or
T but can be A, T, G, or C. Putative hydrogen bonds are illustrated by
dotted lines. The atomic variations (at positions X, Y, and Z) between
the pyrrole, hydroxypyrrole, imidazole, pyrazole and thiazole mono-
mers are also shown.
Figure 2. Monomer units incorporated into hairpin polyamides. Ball
and stick polyamide±DNA binding models are also shown. Shaded
circles denote Im while nonshaded circles represent Py. Nonshaded
circles containing an X represent Py, Pz or Th monomer units. Non-
shaded diamonds denote the b-residue. g-Aminobutyric acid (g) and
dimethylaminopropylamide (Dp) are depicted as a curved line and a
plus sign, respectively.

D. H. Nguyen et al. / Bioorg. Med. Chem. 9 (2001) 7±17
9
investigate the discrimination of Aꢀ T/Tꢀ A base pairs by
purely steric means using the Th/Py pairing within the
context of our hairpin motif.
PyPy-b-Dp-EDTA (2E) was also constructed to con®rm
the orientation and stoichiometry of this hairpin at each
binding site (Fig. 3). We report here the DNA binding
anity and sequence selectivity of the previously repor-
ted7,26 control polyamide ImImPyPy-g-ImPyPyPy-b-
Dp (1) in relation to the new polyamides ImImPzPy-g-
ImPyPyPy-b-Dp (2), and ImImThPy-g-ImPyPyPy-b-
Dp (3) for the 6 bp sites, 50-TGGTCA-30, 50-TGGACA-
30, 50-TGGGCA-30, and 50-TGGCCA-30, thereby evalu-
ating the three pairings Py/Py, Pz/Py and Th/Py,
respectively, against all four Watson±Crick base pairs.
Three separate techniques are used to characterize the
DNA binding properties of the newly designed poly-
amides: DNase I footprinting, methidiumpropyl-EDTAꢀ
Fe(II) (MPEꢀ Fe(II)) footprinting, and anity cleavage.
Quantitative DNase I footprinting titrations allow
determination of equilibrium association constants (Ka)
of the polyamides for respective match and mismatch
sites.27 29 Information about precise binding site size is
gained from MPEꢀ Fe(II) footprinting,30,31 while anity
cleavage studies con®rm the binding orientation and
stoichiometry of the hairpin±DNA complex.17,32
To investigate these new pairings, three polyamides,
ImImPyPy-g-ImPyPyPy-b-Dp (1), ImImPzPy-g-ImPy-
PyPy-b-Dp (2), and ImImThPy-g-ImPyPyPy-b-Dp (3),
were synthesized by solid-phase methods25 to contain
either a side-by-side pairing of two pyrrole rings (Py/
Py), a pyrazole and pyrrole pairing (Pz/Py), or a thia-
zole and pyrrole pairing (Th/Py), respectively. The
corresponding EDTA analogue ImImPzPy-g-ImPy-
Results
Monomer synthesis
Ethyl-3-amino-1-methylpyrazole-5-carboxylate (4) and
ethyl-2-amino-4-methylthiazole-5-carboxylate (6) were
prepared according to published procedures33 35 on
multi-gram scale. These amino ethyl esters were then
Boc-protected and the ethyl ester hydrolyzed to produce
3-[(tert-butoxycarbonyl) amino]-1-methylpyrazole-5-
carboxylic acid (5) (Boc-Pz-OH) and 2-[(tert-butoxy-
carbonyl) amino]-4-methylthiazole-5-carboxylic acid (7)
(Boc-Th-OH) respectively (Fig. 4).
Polyamide synthesis
The polyamide resin ImImPyPy-g-ImPyPyPy-b-Pam-
resin was synthesized as previously described.7,26 The
Figure 3. Structures of the eight-ring hairpin polyamides 1, 2, 3 and
the corresponding Fe(II)ꢀ EDTA anity cleavage derivative 2E as
synthesized by solid-phase methods.
Figure 4. (a) Synthesis of Boc-Pz-OH (5). (i) Boc2O, DIEA, DMF, (ii)
1 M NaOH; (b) Synthesis of Boc-Th-OH (7). (i) Boc2O, DIEA, DMF,
(ii) 1 M KOH.

10
D. H. Nguyen et al. / Bioorg. Med. Chem. 9 (2001) 7±17
polyamide resins ImImPzPy-g-ImPyPyPy-b-Pam-resin
and ImImThPy-g-ImPyPyPy-b-Pam-resin were synthe-
sized using previously described Boc-chemistry manual
synthesis protocols.25 Both Boc-Pz-OH and Boc-Th-OH
monomers were activated with HBTU/DIEA and cou-
pled for 20 h at 37 ꢁC before termination with acetic
anhydride. After Boc-deprotection of the resin-bound
polyamide chain, the Boc-Im-OH was activated with
Figure 5. (a) Illustration and complete sequence of the 278 bp pDHN1 EcoRI/PvuII restriction fragment. The four designed binding sites that were
analyzed in quantitative footprint titration experiments are indicated with a box surrounding each of the 6 bp sites. Quantitative DNase I footprint
titration experiment with (b) ImImPyPy-g-ImPyPyPy-b-Dp (1) and (c) ImImPzPy-g-ImPyPyPy-b-Dp (2) on the 30-end labeled 278 bp restriction
fragment: lane 1, intact DNA; lane 2, T reaction; lane 3, DNase I standard; lanes 4±15, DNase I digestion products in the presence of 10 pM, 20 pM,
50 pM, 100 pM, 200 pM, 500 pM, 1 nM, 2 nM, 5 nM, 10 nM, 20 nM and 50 nM polyamide respectively. All four 6 bp binding sites 50-TGGTCA-30,
50-TGGACA-30, 50-TGGGCA-30 and 50-TGGCCA-30 were analyzed and are shown on the right side of the autoradiogram. All reactions contain
15 kcpm restriction fragment, 10 mM Trisꢀ HCl (pH 7.0), 10 mM KCl, 10 mM MgCl2 and 5 mM CaCl2.

D. H. Nguyen et al. / Bioorg. Med. Chem. 9 (2001) 7±17
11
1
HBTU/DIEA and coupled onto NH2-PzPy-g-ImPy-
PyPy-b-Pam-resin and NH2-ThPy-g-ImPyPyPy-b-Pam-
resin at 37 ꢁC for 24 and 40 h, respectively. The terminal
imidazole was incorporated as previously published.25 A
single-step aminolysis, using dimethylaminopropyl-
amine (55 ꢁC, 18 h), cleaved the resin ester linkage of all
three polyamides from their solid supports. The resin
cleavage products were puri®ed by reversed phase
HPLC to give ImImPyPy-g-ImPyPyPy-b-Dp (1), ImIm
PzPy-g-ImPyPyPy-b-Dp (2), and ImImThPy-g-ImPy-
PyPy-b-Dp (3). The polyamide ImImPzPy-g-ImPyPyPy-b-
Dp-EDTA (2E) was prepared by aminolysis of the corre-
sponding resin with 3,30-diamino-N-methyldipropylamine
(55 ꢁC, 18 h) followed by reversed phase HPLC puri®ca-
tions which a€orded a free amine group at the C-terminus
for postsynthetic modi®cation. The polyamide-amine
ImImPzPy-g-ImPyPyPy-b-Dp-NH2 (2-NH2) was treated
with an excess of EDTA-dianhydride (DMSO/NMP,
DIEA, 55 ꢁC, 15 min), the remaining anhydride hydro-
lyzed (0.1 N NaOH, 55ꢁC, 10 min) and the EDTA-mod-
i®ed polyamide puri®ed by reversed phase HPLC.
Ka=4.7 (Æ0.7)Â 109 M 1 and Ka=3.1 (Æ0.4)Â109 M
,
respectively. The mismatch sequences 50-TGGGCA-30
and 50-TGGCCA-30 are bound with at least 15-fold
1
lower anity (Ka=2.2 (Æ0.6)Â108 M
and Ka=2.5
respectively). ImImPzPy-g-ImPy-
1
(Æ0.9)Â108 M
,
PyPy-b-Dp (2) bound the two sites 50-TGGTCA-30 and
50-TGGACA-30 with equilibrium association constants
1
of
Ka=2.0
(Æ0.5)Â
109 M
and
Ka=1.0
(Æ0.3)Â109 M 1, respectively. No binding of polyamide
2 is observed within the concentration range of these
DNase I footprinting titration experiments for the two
sites 50-TGGGCA-30 and 50-TGGCCA-30 (Ka
ꢂ2.0Â107 M at both sites). Polyamide 3 containing a
1
Th/Py pairing did not show any binding (Ka
at all sites), at concentrations up to
1
ꢂ2.0Â107 M
50 nM, for any site. At concentrations greater than
50 nM, polyamide 3 exhibited non speci®c binding for
multiple DNA sites. While polyamide 2 bound its match
sites with binding isotherms consistent with binding in a
1:1 polyamide±DNA complex (Fig. 6), further char-
acterization was necessary to assure similar behavior to
pure imidazole±pyrrole polyamides.
Binding energetics
Binding site size
Quantitative DNase I footprinting titration experi-
ments27 29 (10 mM Tris±HCl, 10mM KCl, 10mM
MgCl2, 5 mM CaCl2, pH 7.0, 22ꢁC) were performed on a
30-32P end labeled 278 bp EcoRI/PvuII restriction frag-
ment from the plasmid pDHN1 to determine the equi-
librium association constants for polyamides 1, 2 and 3
at the four designed sites (Fig. 5 and Table 1). On this
restriction fragment, ImImPyPy-g-ImPyPyPy-b-Dp (1)
bound the two match sites 50-TGGTCA-30 and 50-
TGGACA-30 with equilibrium association constants of
MPEꢀ Fe(II) footprinting30,31 (20 mM HEPES bu€er
(pH 7.3), 200 mM NaCl, 50 mg/mL glycogen, 50mM
DTT, 0.5 mM MPEꢀ Fe(II), and 22 ꢁC) on 30- and 5 -32P
end labeled EcoRI/PvuII 278 bp restriction fragments
from the plasmid pDHN1 reveals that ImImPzPy-g-
ImPyPyPy-b-Dp (2), at 50 nM concentration, binds to
and protects its designated six base pair match sites 50-
TGGTCA-30 and 50-TGGACA-30. Binding at the single
base pair mismatch sites 50-TGGGCA-30 and 50-
1
Table 1. Equilibrium association constantsa (M
)
Polyamide
50-caTGGTCAta-30
50-caTGGACAta-30
50-caTGGGCAta-30
50caTGGCCAta-30
Py/Py
Pz/Py
Th/Py
aThe reported equilibrium association constants are the mean values obtained from three DNase I footprint titration experiments. Assays were
carried out in the presence of 10 mM Tris±HCl, 10 mM KCl, 10 mM MgCl2, and 5 mM CaCl2 at pH 7.0 and 22ꢁC. The new monomer pyrazole is
indicated with an open circle containing a Z ( ) while thiazole is represented as an open circle with T inside ( ).

12
D. H. Nguyen et al. / Bioorg. Med. Chem. 9 (2001) 7±17
Figure 6. Data from quantitative DNase I footprint titration experi-
ments for ImImPyPy-g-ImPyPyPy-b-Dp (1) and ImImPzPy-g-ImPy-
PyPy-b-Dp (2) binding to the two match sites 50-TGGTCA-30 and 50-
TGGACA-30. ꢀnorm points were obtained using storage phosphor
autoradiography and processed by standard methods.26,36 The data
for the binding of polyamide 1 to 50-TGGTCA-30 is indicated by ®lled
circles, of polyamide 1 to 50-TGGACA-30 by ®lled squares, of poly-
amide 2 to 50-TGGTCA-30 by open triangles, and of polyamide 2 to
50-TGGACA-30 by open diamonds. Each data point shows the average
value obtained from three footprinting experiments. The solid curves
are best-®t Langmuir binding titration isotherms obtained from non-
linear least squares algorithm where n=1 as previously described.26,36
TGGCCA-30 could not be seen at the 50 nM con-
centration. The sizes of the asymmetrically 30-shifted
footprint cleavage patterns are consistent with a hairpin
polyamide binding at six base pair site in the minor
groove of DNA as observed for purely imidazole±pyr-
role hairpin polyamides (Figs 7a and 8).
Binding orientation and stoichiometry
Figure 7. (a) MPEꢀ Fe(II) footprinting experiment on the 30-32P end
labeled 278 bp EcoRI/PvuII restriction fragment from plasmid
pDHN1. The targeted 50-TGGTCA-30, 50-TGGACA-30, 50-TGGG
CA-30, and 50-TGGCCA-30 sites are shown on the right side of the
autoradiogram. Lane 1, intact DNA; lane 2, T reaction; lane 3,
MPEꢀ Fe(II) standard in the absence of any polyamide; lanes 4 and 5,
MPEꢀ Fe(II) cleavage products in the presence of 5 nM and 50nM Im-
ImPzPy-g-ImPyPyPy-b-Dp (2), respectively. All lanes contain 15 kcpm
30-radiolabeled DNA, 20 mM HEPES bu€er (pH 7.3), 200 mM NaCl,
50 mg/mL glycogen, 5 mM DTT, and 0.5 mM MPEꢀ Fe(II). (b) Anity
cleavage experiment on the 30-32P end labeled 278 bp EcoRI/PvuII
restriction fragment from plasmid pDHN1. The targeted 50-
TGGTCA-30, 50-TGGACA-30, 50-TGGGCA-30, and 50-TGGCCA-30
sites are shown on the right side of the autoradiogram. Lane 1, T
reaction; lane 2, intact DNA; lanes 3±5, anity cleavage products in
the presence of 5 nM, 50 nM, and 500 nM ImImPzPy-g-ImPyPyPy-b-
Dp-EDTA (2E), respectively. All lanes contain 15 kcpm 30-radi-
olabeled DNA, 20 mM HEPES bu€er (pH 7.3), 200 mM NaCl, 50 mg/
mL glycogen, 5 mM DTT, and 1.0 mM Fe(II).
Anity cleavage experiments17,32 were performed on 30-
and 50-32P end labeled EcoRI/PvuII 278 bp restriction
fragments from the plasmid pDHN1 (20 mM HEPES
bu€er, pH 7.3, 200 mM NaCl, 50 mg/mL glycogen,
5 mM DTT, 1 mM Fe(II), and 22 ꢁC). Anity cleavage
experiments were performed with a carboxy terminus
EDTAꢀ Fe(II) modi®ed analogue 2E of polyamide 2.
The observed cleavage patterns for ImImPzPy-g-ImPy-
PyPy-b-Dp-EDTA (2E) are 30-shifted, consistent with
minor groove occupancy (Figs 7b and 8). A single clea-
vage locus proximal to the 50-side of both the 50-
TGGTCA-30 and 50-TGGACA-30 binding sites at 5 nM
is consistent with a single orientation 1:1 polyamide±
DNA complex.
The purely imidazole±pyrrole polyamide 1 only exhibits
a 20-fold greater speci®city for its match sites. Although
a Pz/Py pairing exhibits slightly lower anity for Aꢀ T/
Tꢀ A base pairs than a Py/Py pairing, polyamide 2 con-
tinues to bind to DNA with an anity and speci®city
comparable to DNA binding proteins. The 2.3-fold
decrease in anity of the Pz/Py pairing relative to a Py/
Py pairing may arise from some electrostatic repulsion
between the N2 of pyrazole and the amide oxygen of the
polyamide backbone (Fig. 9a). MPEꢀ Fe(II) footprinting
Discussion
The Pz/Py pair
Quantitative DNase I footprinting reveals that the
incorporation of a pyrazole monomer into a hairpin
polyamide results in a 100-fold increase in speci®city for
the match sites 50-TGGTCA-30 and 50-TGGACA-30
over the mismatch sites 50-TGGGCA-30 and 50-TGG
CCA-30 due to signi®cantly lower mismatch anities.

D. H. Nguyen et al. / Bioorg. Med. Chem. 9 (2001) 7±17
13
Figure 8. (Top) Anity cleavage patterns for ImImPzPy-g-ImPyPyPy-b-Dp-EDTA (2E) at 500 nM. (Bottom) MPEꢀ Fe(II) protection patterns for
ImImPzPy-g-ImPyPyPy-b-Dp (2) at 50 nM.
and anity cleavage experiments demonstrate that
ImImPzPy-g-ImPyPyPy-b-Dp (2) binds its designated
six base pair sites, in the minor groove of DNA, in a
single orientation and as a 1:1 polyamide±DNA com-
plex, consistent with the hairpin polyamide binding
model.
The Th/Py pair
It has been proposed in the literature that the degen-
eracy of Aꢀ T/Tꢀ A recognition by polyamides could be
overcome by using a thiazole (Th) monomer that would
be sterically destabilized when placed opposite a thy-
mine base.23, 24 Thiazole was therefore proposed to be
an A-speci®c recognition element.23,24 Conversely,
recent studies7 9 on hydroxypyrrole (Hp) have shown
that steric destabilization, arising from the bulky
hydroxyl group, occurs only when Hp is located oppo-
site adenine, resulting in the loss of DNA binding a-
nity. Since this steric destabilization is absent and an
extra hydrogen bond is formed when hydroxylpyrrole is
placed opposite thymine,8 Hp is a T-speci®c recognition
element. While the Hp structural data8 reduce the plau-
sibility of thiazole conferring A-speci®city as proposed,
it does allow for the possibility of thiazole being T-spe-
ci®c based solely on steric discrimination. Therefore, the
singular steric discrimination by thiazole was interesting
in light of the dual steric and hydrogen-bonding compo-
nents of T/A di€erentiation by hydroxypyrrole (Hp).
The quantitative DNase I footprinting titrations reveal
that the binding anity of an eight-ring hairpin poly-
amide is compromised by the incorporation of a single
4-methylthiazole monomer. It is puzzling that the 4-
methylthiazole/N-methylpyrrole pair (Th/Py) has low
anity for both Aꢀ T and Tꢀ A. Perhaps di€erent analo-
gues of this ring system should be investigated further.
Figure 9. (a) Model for the electrostatic repulsion between the lone
electron pairs on N2 of pyrazole and the lone electron pairs on the
amide oxygen of the polyamide backbone. (b) Model for the possible
steric clash between the 4-methyl of thiazole and the carbonyl of the
proximal carboxamide.
For example, what is the role of the methyl substituent
at the 4-position? With the change in both length and
bond angle of the thiazole core,21 one could imagine an
energetically unfavorable steric clash between the 4-
methyl and the carbonyl of the proximal carboxamide
(Fig. 9b).

14
D. H. Nguyen et al. / Bioorg. Med. Chem. 9 (2001) 7±17
Implications for the design of minor groove binding
polyamides
acetonitrile/min. Preparatory reversed phase HPLC was
performed on a Beckman HPLC with a Waters BondaPak
25Â100 mm, 100 mm C18 column equipped with a guard,
0.1% (wt/v) TFA, 8.0 mL/min, 0.25% acetonitrile/min. 18
Mꢀ water was obtained from a Millipore MilliQ water
puri®cation system, and all bu€ers were 0.2 mm ®ltered.
The results presented here reveal that the N-methylpyr-
azole ring might replace the N-methylpyrrole moiety for
minor groove DNA recognition. The ability to generate
alternative pairing schemes for the minor groove with new
monomers could greatly expand the targetable sequence
repertoire of hairpin polyamides (Table 2). As issues of
biodistribution in animal studies become important, an
expanded set of pairing rules such as Pz/Pz or Im/Pz
would be of interest to examine in this series for bio-
logical applications.
Monomer synthesis
3-[(tert-Butoxycarbonyl)amino]-1-methylpyrazole-5-car-
boxylic acid (5). The amino ethyl ester 4 (6.0 g,
35.5 mmol) was dissolved in 100 mL of DMF and DIEA
(12.3 mL, 70.6 mmol). To the stirred solution di-tert-
butyl-dicarbonate (15.4 g, 70.6 mmol) was added and
allowed to react overnight. The solution was poured
into water and extracted with diethyl ether. The organic
layers were combined, dried with MgSO4, and con-
centrated in vacuo to provide a white solid that was
then dissolved in ethanol. 1 M NaOH was added and
the solution heated at 45 ꢁC for 1 h. The clear solution
was diluted with water and the ethanol removed in
vacuo. The solution was extracted with diethyl ether,
the pH of the aqueous layer reduced to 3 with 10% (v/v)
H2SO4 and the mixture extracted with ethyl acetate. The
combined organic layers were dried with MgSO4 and
concentrated in vacuo to provide 5 as a white powder
Experimental
Materials
Dicyclohexylcarbodiimide (DCC), hydroxybenzotriazole
(HOBt), 2-(1H-benzotriazole-1-yl)-1,1,3,3-tetramethyl-
uronium hexa¯uorophosphate (HBTU), 0.75 mmol/g
Boc-b-alanine-(4 -carboxamidomethyl)-benzyl-ester-
copoly (styrene±divinylbenzene) resin (Boc-b-Pam-resin),
and Boc-g-aminobutyric acid were purchased from Pep-
tides International. N,N-Diisopropylethylamine (DIEA),
N,N-dimethylformamide (DMF), 1:1 dimethylsulfoxide:
N-methylpyrrolidinone (DMSO/NMP), and acetic an-
hydride (Ac2O) were purchased from Applied Biosys-
tems. Dichloromethane (DCM) and triethylamine (TEA)
were reagent grade from EM. Thiophenol (PhSH),
dimethylaminopropylamine (Dp), and 3,30diamino-N-
methyldipropylamine (Dp-NH2) and EDTA-dianhy-
dride were purchased from Aldrich. Tri¯uoroacetic acid
(TFA) Biograde was from Halocarbon. All reagents
were used without further puri®cation.
1
(3.24 g, 38% yield): H NMR (DMSO-d6) d 13.32 (br s,
1H), 9.73 (s, 1H), 6.70 (s, 1H), 3.95 (s, 3H), 1.45 (s, 9H);
13C NMR (DMSO-d6) d 161.5, 153.7, 146.8, 133.8,
101.4, 80.2, 39.5, 29.0; FABMS m/e 264.0958 (M+Na,
264.0960 calcd for C10H15N3O4+Na).
2-[(tert-Butoxycarbonyl)amino]-4-methylthiazole-5-car-
boxylic acid (7). The amino ethyl ester 6 (10 g, 53.5
mmol) and di-tert-butyl-dicarbonate (23.4 g, 107 mmol )
were dissolved in 150 mL of DMF and DIEA (19 mL,
107 mmol). The stirred reaction was heated to 50 ꢁC for
3 days. The reaction was allowed to cool to room tem-
perature and diluted with 350 mL of water. The pH of
the aqueous layer was reduced to 3 with 10% (v/v)
H2SO4 and the mixture extracted with diethyl ether. The
organic layers were combined, dried with MgSO4, and
concentrated in vacuo to provide a suspended solid.
This solid was collected by vacuum ®ltration and
washed with hexanes to provide a tan powder that was
then dissolved in ethanol. 1 M KOH was added and the
solution heated to 70 ꢁC for 2 h. The mixture was
poured into 250 mL of water and washed with diethyl
ether, the pH of the aqueous layer reduced to 3 with
10% (v/v) H2SO4, and the milky white solution extrac-
ted with diethyl ether. The combined organic extracts
were concentrated in vacuo to provide 7 as a white solid
1H NMR spectra were recorded on a General Electric±
QE NMR spectrometer at 300 MHz in DMSO-d6 with
chemical shifts reported in parts per million relative to
residual solvent. UV spectra were measured in water on a
Hewlett±Packard Model 8452A diode array spectro-
photometer. Matrix-assisted, laser desorption/ionization
time of ¯ight mass spectrometry (MALDI-TOF) was
performed at the Protein and Peptide Microanalytical
Facility at the California Institute of Technology. High-
resolution FAB mass spectra were recorded at the Mass
Spectroscopy Laboratory at University of California,
Riverside. DNA sequencing was performed at the
Sequence/Structure Analysis Facility (SAF) at the Cali-
fornia Institute of Technology. HPLC analysis was per-
formed on a Beckman Gold System using a RAINEN
C18, Microsorb MV, 5 mm, 300Â4.6 mm reversed phase
column in 0.1% (wt/v) TFA with acetonitrile as eluent
and a ¯ow rate of 1.0 mL/min, gradient elution 1.25%
1
(7.1 g, 27.8 mmol, 52% yield): H NMR (DMSO-d6) d
12.5 (br s, 1H), 11.8 (br s, 1H), 2.4 (s, 3H), 1.4 (s, 9H);
13C NMR (DMSO-d6) d 164.6, 162.2, 156.8, 153.7,
115.9, 82.8, 28.8, 17.8; EIMS m/e 259.0751 (M+H,
259.0752 calcd for C10H15N2O4S).
Table 2. Polyamide ring pairings
ImImPzPy-ꢀ-ImPyPyPy-ꢁ-Dp (2). ImImPzPy-g-ImPy-
PyPy-b-Pam-resin was synthesized in a stepwise fashion
by manual solid-phase protocols25 from Boc-b-alanine-
Pam-resin (1.0 g, 0.75 mmol/g). Boc-Pz-OH (241 mg,
1 mmol) and HBTU (360 mg, 0.95 mmol) were
Tꢀ A
Aꢀ T
Gꢀ C
Cꢀ G
Py/Py
Pz/Py
Th/Py
+
+
+
+

D. H. Nguyen et al. / Bioorg. Med. Chem. 9 (2001) 7±17
15
combined in 2 mL of DMF. DIEA (1 mL) was then
added and the reaction mixture allowed to stand for
5 min. The activated monomer was added to the reac-
tion vessel, containing NH2-Py-g-ImPyPyPy-b-Pam-
resin, and the coupling was allowed to proceed for 20 h
at 37 ꢁC before termination with acetic anhydride. After
Boc-deprotection of the resin-bound polyamide chain,
the Boc-Im-OH was activated with HBTU/DIEA as
previously described and coupled onto NH2-PzPy-g-
ImPyPyPy-b-Pam-resin at 37 ꢁC for 24 h. The terminal
imidazole was incorporated as previously published. A
sample of ImImPzPy-g-ImPyPyPy-b-Pam-resin (300 mg,
0.44 mmol/g) was placed in a 20 mL scintillation vial,
2 mL of dimethylaminopropylamine was added, and the
mixture was allowed to stand at 55 ꢁC for 18 h. Resin
was removed through ®ltration through a disposable
propylene ®lter, and the resulting solution diluted with
water to a total volume of 8 mL and puri®ed directly by
reversed phase HPLC to provide ImImPzPy-g-ImPy-
PyPy-b-Dp (2) (5.7 mg, 3.5% recovery) as a white pow-
der upon lyophilization of the appropriate fractions. 1H
NMR (DMSO-d6) d 10.47 (s, 1H), 10.29 (s, 1H), 10.14
(s, 1H), 10.04 (s, 1H), 10.02 (s, 1H), 9.97 (s, 1H), 9.92 (s,
1H), 9.25 (br s, 1H), 8.1 (m, 3H), 7.68 (s, 1H), 7.48 (s,
2H), 7.43 (s, 1H), 7.28 (s, 1H), 7.2 (m, 2H), 7.18 (s, 2H),
7.11 (s, 1H), 7.08 (s, 1H), 6.96 (s, 1H), 6.89 (s, 1H), 4.06
(s, 3H), 4.04 (s, 3H), 4.02 (s, 3H), 3.97 (s, 3H), 3.87 (s,
3H), 3.85 (s, 3H), 3.83 (s, 3H), 3.81 (s, 3H), 3.4 (m, 2H),
3.2 (m, 2H), 3.1 (m, 2H), 3.0 (m, 2H), 2.7 (m, 6H), 2.4
(m, 4H), 1.8 (m, 4H); MALDI-TOF-MS (mono-
isotopic), 1224.63 (1224.57 calcd for M+H).
solution puri®ed directly by preparatory reversed phase
HPLC to provide 2E as a white powder (3.6 mg, 36%
recovery). MALDI-TOF-MS (monoisotopic), 1542.16
(1542.81 calcd for M+H).
ImImThPy-ꢀ-ImPyPyPy-ꢁ-Dp (3). ImImPzPy-g-ImPy-
PyPy-b-Pam-resin was synthesized in a stepwise fashion
by manual solid-phase protocols25 from Boc-b-alanine-
Pam-resin (1.0 g, 0.75 mmol/g). Boc-Th-OH (258 mg,
1 mmol) and HBTU (360 mg, 0.95 mmol) were com-
bined in 2 mL of DMF. DIEA (1 mL) was then added
and the reaction mixture allowed to stand for 5 min.
The activated monomer was added to the reaction ves-
sel, containing NH2-Py-g-ImPyPyPy-b-Pam-resin, and
the coupling was allowed to proceed for 20 h at 37 ꢁC
before termination with acetic anhydride. After Boc-
deprotection of the resin-bound polyamide chain, the
Boc-Im-OH was activated with HBTU/DIEA as pre-
viously described and coupled onto NH2-ThPy-g-
ImPyPyPy-b-Pam-resin at 37 ꢁC for 40 h. The terminal
imidazole was incorporated as previously published. A
sample of resin (150 mg, 0.43 mmol/g) was placed in a
20 mL scintillation vial, 2 mL of dimethylaminopropyl-
amine was added, and the mixture was allowed to stand
at 55 ꢁC for 18 h. Resin was removed by ®ltration
through a disposable polypropylene ®lter, and the
resulting solution diluted with water to a total volume
of 8 mL and puri®ed directly by reversed phase HPLC
to provide ImImThPy-g-ImPyPyPy-b-Dp (1.5 mg, 1.8%
recovery) as a white powder upon lyophilization of the
1
appropriate fractions. H NMR (DMSO-d6) d 10.29 (s,
1H), 10.05 (s, 1H), 10.02 (s, 1H), 9.98 (s, 3H), 9.92 (s,
1H), 9.2 (br s, 1H), 8.1 (m, 3H), 7.78 (s, 1H), 7.49 (s,
2H), 7.32 (s, 1H), 7.28 (s, 1H), 7.26 (s, 1H), 7.24 (s, 2H),
7.18 (s, 1H), 7.10 (s, 1H), 6.9 (m, 2H), 3.99 (s, 3H), 3.97
(s, 3H), 3.91 (s, 3H), 3.82 (s, 3H), 3.80 (s, 3H), 3.7 (m,
9H), 3.4 (m, 2H), 3.2 (m, 2H), 3.1 (m, 2H), 3.0 (m, 2H),
2.7 (m, 6H), 2.4 (m, 4H), 1.8 (m, 4H); MALDI-TOF-
MS (monoisotopic), 1241.67 (1241.53 calcd for M+H).
ImImPzPy-ꢀ-ImPyPyPy-ꢁ-Dp-NH2 (2-NH2). A sample
of ImImPzPy-g-ImPyPyPy-b-Pam-resin (250 mg, 0.44
mmol/g) was placed in a 20 mL scintillation vial, 2 mL
of 3,30-diamino-N-methyldipropylamine was added, and
the mixture was allowed to stand at 55 ꢁC for 18 h.
Resin was removed through ®ltration through a dis-
posable propylene ®lter, and the resulting solution dilu-
ted with water to a total volume of 8 mL and puri®ed
directly by reversed phase HPLC to provide ImImPzPy-
g-ImPyPyPy-b-Dp-NH2 (2-NH2) (8.2 mg, 5.9% recov-
ery) as a white powder upon lyophilization of the
DNA reagents and materials
Enzymes were purchased from Boehringer±Mannheim
and used with their supplied bu€ers. Deoxyadenosine and
thymidine 50-[a-32P] triphosphates were obtained from
Dupont/NEN. Calf thymus DNA (sonicated, deprotein-
ized), DNase I (7500 u/mL, FPLC pure), Tris±HCl,
dithiothreitol (DTT), RNase-free water (used for all
footprinting and anity cleavage reactions), and 0.5 M
EDTA were purchased from Amersham Pharmacia.
XGal and IPTG were from ICN. Ampicillin trihydrate
was acquired from Sigma. Absolute ethanol was pur-
chased from Equistar. Calcium chloride, potassium
chloride, and magnesium chloride were from Fluka.
Formamide and pre-mixed Tris-borate±EDTA (Gel-
Mate) were from Gibco. All reagents were used without
further puri®cation. DNA manipulations were per-
formed according to standard protocols.36
1
appropriate fractions. H NMR (DMSO-d6) d 10.47 (s,
1H), 10.29 (s, 1H), 10.14 (s, 1H), 10.03 (s, 2H), 9.98 (s,
1H), 9.92 (s, 1H), 9.25 (br s, 1H), 8.1 (m, 3H), 7.82 (br s,
3H), 7.68 (s, 1H), 7.48 (s, 2H), 7.43 (s, 1H), 7.29 (s, 2H),
7.2 (m, 1H), 7.18 (s, 1H), 7.1 (m, 2H), 6.95 (s, 2H), 6.90
(s, 1H), 4.06 (s, 3H), 4.04 (s, 3H), 4.02 (s, 3H), 3.97 (s,
3H), 3.87 (s, 3H), 3.85 (s, 3H), 3.83 (s, 3H), 3.81 (s, 3H),
3.2±3.0 (m, 8H), 2.9 (m, 2H), 2.5 (m, 4H), 2.37 (br s,
4H), 2.0±1.7 (br m, 6H); MALDI-TOF-MS (mono-
isotopic), 1267.78 (1267.61 calcd for M+H).
ImImPzPy-ꢀ-ImPyPyPy-ꢁ-Dp-EDTA (2E). EDTA-di-
anhydride (50 mg) was dissolved in 1 mL of DMSO/
NMP solution and 1 mL of DIEA by heating at 55 ꢁC
for 5 min. The dianhydride solution was added to Im-
ImPzPy-g-ImPyPyPy-b-Dp-NH2 (2-NH2) (8.2 mg, 6.5
mmol) dissolved in 750 mL of DMSO. The mixture was
heated to 55 ꢁC for 25 min, treated with 3 mL of 0.1 N
NaOH, and heated to 55 ꢁC for 10 min. TFA (0.1%)
was added to adjust the total volume to 8 mL, and the
Construction of plasmid DNA
The plasmid pDHN1 was prepared by hybridization of
a complementary set of synthetic oligonucleotides: 50-

16
D. H. Nguyen et al. / Bioorg. Med. Chem. 9 (2001) 7±17
GATCCTTAGCTGTGTAATCATGGCCATAGCTG
TGTAATCATGGGCATAGCTGTGTAATCATGGA
CATAGCTGTA-30 and 50-AGCTTACAGCTATGTC
CATGATTACACAGCTATGCCCATGATTACACA
GCTATGGCCATGATTACACAGCTAAG-30. The hy-
bridized insert was ligated into BamHI/HindIII linear-
ized pUC19 using T4 DNA ligase. Epicurean coli XL-1
Blue supercompetent cells were then transformed with
the ligated plasmid, and plasmid DNA from ampicillin-
resistant white colonies isolated using a Promega Maxi-
Prep kit. The presence of the desired insert was deter-
mined by dideoxy sequencing.
Fe(NH4)2(SO4)2). The reactions were initiated with
10 mL of 200 mM DTT and cleavage allowed to proceed
for 14 min. The reactions were stopped by ethanol pre-
cipitation, resuspended in 100 mM Tris-borate±EDTA/
80% formamide loading bu€er, denatured at 85 ꢁC for
10 min, and immediately loaded onto an 8% denaturing
polyacrylamide gel (5% cross-link, 7 M urea) at 2000 V
for 1 h 45 min.
Anity cleavage
All reactions were carried out in a volume of 400 mL. A
polyamide stock solution or water (for reference lanes)
was added to an assay bu€er where the ®nal concentra-
tions were 20mM HEPES bu€er (pH 7.3), 200 mM NaCl,
50mg/mL glycogen, 5 mM DTT, and 1.0 mM Fe(II).
Equilibration proceeded for 20 min after the addition of
20 mL of 10 mM Fe(NH4)2(SO4)2. The reactions were
initiated with 40 mL of 50 mM DTT and cleavage allowed
to proceed for 30 min. The reactions were stopped by
ethanol precipitation, resuspended in 100 mM Tris-
borate±EDTA/80% formamide loading bu€er, denatured
at 85ꢁC for 10min, and immediately loaded onto an 8%
denaturing polyacrylamide gel (5% cross-link, 7 M
urea) at 2000 V for 1 h 45 min.
Preparation of 32P-end-labeled restriction fragments
Plasmid pDHN1 was linearized with EcoRI and PvuII
restriction enzymes, then treated with Sequenase,
d0eoxyadenosine 50-[a-32P]triphosphate, and thymidine
5 -[a-32P]triphosphate for 30 labeling. The 50 labeling of
the desired restriction fragment was achieved through
PCR ampli®cation using the primers [g-32P]DHN1-A
(50-[g-32P]AATTCGAGCTCGGTACCCGGG-30) and
DHN1-B (50-CTGGCACGACAGGTTTCCCGA-30).
The labeled fragment (30 or 50) was loaded onto a 7%
nondenaturing polyacrylamide gel, and the desired 278
bp band was visualized by autoradiography and isolated.
Acknowledgements
DNase I footprinting
All reactions were carried out in a volume of 400 mL. We
note explicitly that no carrier DNA was used in these
reactions until after DNase I cleavage. A polyamide stock
solution or water (for reference lanes) was added to an
assay bu€er where the ®nal concentrations were 10 mM
Tris±HCl bu€er (pH 7.0), 10 mM KCl, 10 mM MgCl2,
5 mM CaCl2, and 15 kcpm 30-radiolabeled DNA. The
solutions were equilibrated for a minimum of 12 h at
22 ꢁC. Cleavage was initiated by the addition of 10 mL of
a DNase I stock solution (diluted with 1 mM DTT to
give a stock concentration of 0.75u/mL) and was allowed
to proceed for 7 min at 22ꢁC. The reactions were stopped
by adding 50 mL of a solution containing 2.25 M NaCl,
150 mM EDTA, 0.6 mg/mL glycogen, and 30 mM base
pair calf thymus DNA and then ethanol-precipitated.
The cleavage products were resuspended in 100 mM
Tris-borate±EDTA/80% formamide loading bu€er,
denatured at 85 ꢁC for 10 min, and immediately loaded
onto an 8% denaturing polyacrylamide gel (5% cross-
link, 7 M urea) at 2000 V for 1 h 45 min. The gels were
dried under vacuum at 80 ꢁC and then quantitated using
storage phosphor technology. Equilibrium association
constants were determined as previously described.26 29
We are grateful to the National Institutes of Health
(GM 27681) for research support, National Institutes of
Health for a research service award to J.W.S., The
Howard Hughes Medical Institute for a predoctoral
fellowship to E.E.B. and the Natural Sciences and
Engineering Research Council of Canada for a post-
graduate scholarship to D.H.N.
Supporting Information Available: DNase I footprinting
experiments of polyamide 3 (PDF). See any current mast-
head page for ordering and Internet access instructions.
References and Notes
1. Gottesfeld, J. M.; Nealy, L.; Trauger, J. W.; Baird, E. E.;
Dervan, P. B. Nature 1997, 387, 202.
2. Dickinson, L. A.; Guzilia, P.; Trauger, J. W.; Baird, E. E.;
Mosier, D. M.; Gottesfeld, J. M.; Dervan, P. B. Proc. Natl.
Acad. Sci. USA 1998, 95, 12890.
3. Mapp, A. K.; Ansari, A. Z.; Ptashne, M.; Dervan, P. B.
Proc. Natl. Acad. Sci. USA 2000, 97, 3930.
4. Trauger, J. W.; Baird, E. E.; Dervan, P. B. Nature 1996,
382, 559.
5. Dervan, P. B.; Burli, R. W. Curr. Opin. Chem. Biol. 1999, 3,
688.
MPEꢀ Fe(II) footprinting
6. Wemmer, D. E.; Dervan, P. B. Curr Opin. Struc. Biol. 1997,
7, 355.
7. White, S. E.; Szewczyk, J. W.; Turner, J. M.; Baird, E. E.;
Dervan, P. B. Nature 1998, 391, 468.
8. Kielkopf, C. L.; White, S. E.; Szewczyk, J. W.; Turner, J.
M.; Baird, E. E.; Dervan, P. B.; Rees, D. C. Science 1998,
282, 111.
9. White, S. E.; Turner, J. M.; Szewczyk, J. W.; Baird, E. E.;
Dervan, P. B. J. Am. Chem. Soc. 1999, 121, 260.
All reactions were carried out in a volume of 400 mL. A
polyamide stock solution or water (for reference lanes)
was added to an assay bu€er where the ®nal concentra-
tions were 20 mM HEPES bu€er (pH 7.3), 200 mM
NaCl, 50 mg/mL glycogen, 5 mM DTT, and 0.5 mM
MPEꢀ Fe(II). Equilibration proceeded for 10 min after
the addition of 40 mL of 5 mM MPEꢀ Fe(II) (freshly made
by combining equal volumes of 10 mM MPE and 10 mM

D. H. Nguyen et al. / Bioorg. Med. Chem. 9 (2001) 7±17
17
10. Wu, H.; Crothers, D. M. Nature 1984, 308, 509.
11. Stietz, T. A. Annu. Rev. Biophys. 1990, 23, 205.
12. Goodsell, D. S.; Kopka, M. L.; Cascio, D.; Dickerson, R. E.
Proc. Natl. Acad. Sci. USA 1993, 90, 2930.
25. Baird, E. E.; Dervan, P. B. J. Am. Chem. Soc. 1996, 118,
6141.
26. Bremer, R. E.; Baird, E. E.; Dervan, P. B. Chem. Biol.
1998, 5, 119.
13. Paolella, D. N.; Palmer, R.; Schepartz, A. Science 1994,
264, 1130.
27. Brenowitz, M.; Senear, D. F.; Shea, M. A.; Ackers, G. K.
Methods Enzymol. 1986, 130, 132.
14. Kahn, J. D.; Yun, E.; Crothers, D. M. Nature 1994, 368, 163.
15. Geierstanger, B. H.; Wemmer, D. E. Annu. Rev. Biochem.
1995, 24, 463.
16. Hansen, M. R.; Hurley, L. H. Acc. Chem. Res. 1996, 29, 249.
17. Dervan, P. B. Science 1986, 232, 464.
18. Dervan, P. B. In Nucleic Acids and Molecular Biology;
Springer-Verlag: Heidelberg, 1988, Vol. 2, pp. 49±64.
19. Thuong, N. T.; Helene, C. Angew. Chem. 1993, 32, 666.
20. Nielsen, P. E. Chem. Eur. J. 1997, 3, 505.
21. Rao, K. E.; Shea, R. G.; Yadagiri, B.; Lown, J. W. Anti-
Cancer Drug Des. 1990, 5, 3.
28. Brenowitz, M.; Senear, D. F.; Shea, M. A.; Ackers, G. K.
Proc. Natl. Acad. Sci. USA 1986, 83, 8462.
29. Senear, D. F.; Brenowitz, M.; Shea, M. A.; Ackers, G. K.
Biochemistry 1986, 25, 7344.
30. Van Dyke, M. W.; Hertzberg, R. P.; Dervan, P. B. Proc.
Natl. Acad. Sci. USA 1982, 79, 5470.
31. Van Dyke, M. W.; Dervan, P. B. Science 1984, 225, 1122.
32. Taylor, J. S.; Schultz, P. G.; Dervan, P. B. Tetrahedron
1984, 40, 457.
33. Ding, L.; Grehn, L.; Ragnarsson, U. Acta Chem. Scand.
1990, 44, 75.
22. Sharma, S. K.; Tandon, M.; Lown, J. W. J. Org. Chem.
2000, 65, 1102.
23. Kopka, M. L.; Goodsell, D. S.; Han, G. W.; Chiu, T. K.;
Lown, J. W.; Dickerson, R. E. Structure 1997, 5, 1033.
24. Walker, W. L.; Landaw, E. M.; Dickerson, R. E.; Good-
sell, D. S. Proc. Natl. Acad. Sci. USA 1998, 95, 4315.
34. Chenard, B. L. J. Org. Chem. 1984, 49, 1224.
35. Dodson, R. M.; King, L. C. J. Am. Chem. Soc. 1945, 67,
2242.
36. Sambrook, J.; Fritsch, E. F.; Maniatis, T. Molecular Clon-
ing; Cold Spring Harbor Laboratory: Cold Spring Harbor,
NY, 1989.