ATP13A3 is a major component of the enigmatic mammalian polyamine transport system

JBC Papers in Press. Published on December 11, 2020 as Manuscript RA120.013908

The latest version is at https://www.jbc.org/cgi/doi/10.1074/jbc.RA120.013908

Norin Nabil Hamouda¹, Chris Van den Haute^2,3, Roeland Vanhoutte⁴, Ragna Sannerud⁵, Mujahid Azfar¹, Rupert

Mayer⁶, Álvaro Cortés Calabuig⁷, Johannes V. Swinnen⁸, Patrizia Agostinis^9,10, Veerle Baekelandt², Wim

Annaert⁵, Francis Impens⁶, Steven H. L.Verhelst^4,11, Jan Eggermont¹, Shaun Martin^1,#, Peter Vangheluwe^1,#*

¹Laboratory of Cellular Transport Systems, ⁴Laboratory of Chemical Biology, ⁹Laboratory of Cell Death

Research & Therapy, Department of Cellular and Molecular Medicine, KU Leuven, Leuven, Belgium

²Laboratory for Neurobiology and Gene Therapy, ⁵VIB-KU Leuven Laboratory of Membrane Trafficking;

Department of Neurosciences, KU Leuven, Leuven, Belgium

³Leuven Viral Vector Core, KU Leuven, Leuven, Belgium

⁶VIB Center for Medical Biotechnology, VIB Proteomics Core, Department for Biomolecular Medicine, Ghent

University, Ghent, Belgium

⁷Genomics Core Leuven, KU Leuven, Leuven, Belgium

⁸Laboratory of Lipid Metabolism and Cancer, Department of Oncology, LKI – Leuven Cancer Institute, KU

Leuven, Leuven, Belgium

¹⁰VIB-KU Leuven Center for Cancer Biology, Department of Oncology, KU Leuven, Leuven, Belgium

¹¹Leibniz Institute for Analytical Sciences ISAS, Otto-Hahn-Str. 6b, 44227 Dortmund, Germany

^#Joint last authors

* Corresponding author:

Prof. Dr. Peter Vangheluwe

Department of Cellular and Molecular Medicine

KU Leuven Campus Gasthuisberg, O&N I Herestraat 49 - box 802, 3000 Leuven

Tel.: ±32 16 33 07 20

E-mail: peter.vangheluwe@kuleuven.be

ORCID ID: https://orcid.org/0000-0002-7822-2944

Running Title:

ATP13A3 is involved in Polyamine Transport

Keywords

ATP13A3, P-type ATPase, transporter, P5B-ATPase, Polyamine, Polyamine transport system, Putrescine

1

Polyamine synthesis starts from ornithine that is

converted to PUT by ornithine decarboxylase,

followed by PUT metabolism to SPD and SPM via

SPD and SPM synthase, respectively (Fig. S1) (2).

This pathway is strictly regulated, mainly through

controlling the levels and activity of the rate-

limiting enzyme ornithine decarboxylase via

antizyme and antizyme inhibitor (Fig. S1) (6).

Polyamine synthesis can also be prevented by

synthetic blockers such as difluoromethylornithine

(DFMO), a selective inhibitor of ornithine

Abstract

Polyamines, such as putrescine, spermidine and

spermine,

are

physiologically

important

polycations, but the transporters responsible for

their uptake in mammalian cells remain poorly

characterized. Here, we reveal a new component of

the mammalian polyamine transport system (PTS)

using CHO-MG cells, a widely used model to study

alternative polyamine uptake routes and

characterize polyamine transport inhibitors for

therapy. CHO-MG cells present polyamine uptake

deficiency and resistance to a toxic polyamine

biosynthesis inhibitor MGBG (methylglyoxal bis-

(guanylhydrazone)), but the molecular defects

responsible for these cellular characteristics remain

unknown. By genome sequencing of CHO-MG

cells, we identified mutations in an unexplored

gene, ATP13A3, and found disturbed mRNA and

protein expression. ATP13A3 encodes for an

decarboxylase,

or

methylglyoxal

bis-

(guanylhydrazone) (MGBG), a SPD analog that

inhibits the formation of decarboxylated S-

adenosylmethionine, a precursor of SPD and SPM

(Fig. S1) (7). Inhibition of polyamine synthesis by

DFMO leads to an increased cellular polyamine

uptake (8-10) as well as increased ornithine

decarboxylase and S-adenosyl methionine

decarboxylase synthesis (8), indicating that

polyamine production and uptake exert

complementary functions.

orphan P5B-ATPase (ATP13A3),

a

P-type

transport ATPase that represents a candidate

polyamine transporter. Interestingly, ATP13A3

complemented the putrescine transport deficiency

and MGBG resistance of CHO-MG cells, whereas

its knockdown in wild-type cells induced a CHO-

MG phenotype, demonstrating a decrease in

putrescine uptake and MGBG sensitivity. Taken

together, our findings identify ATP13A3 as a major

component of the mammalian PTS that confers

sensitivity to MGBG and that has been previously

genetically linked with pulmonary arterial

hypertension.

So far, the mechanism of cellular polyamine uptake

and the identity of the mammalian PTS remain

largely unknown (6,9,11) even though polyamine

transporters represent interesting cancer targets

(12). One of the best-studied models used to

characterize the mammalian PTS includes a mutant

Chinese hamster ovary (CHO) cell line that was

generated by random mutagenesis followed by

selection for MGBG resistance (hence named

CHO-MG) (13). These cells exhibit a distinct

phenotype manifested by an impaired polyamine

uptake and a better survival against MGBG toxicity

due to a reduced cellular uptake of MGBG (14).

The cell model has been extensively used to study

pathways of the enigmatic mammalian PTS (13-18)

and to test polyamine transport inhibitors for

therapy (19-22). However, despite serious efforts,

the defective polyamine transporter(s) in the CHO-

MG model remain(s) to be identified.

Introduction

The polyamines, putrescine (PUT), spermidine

(SPD) and spermine (SPM) are abundant aliphatic

polycations that are required for various cell

functions including proliferation, differentiation,

apoptosis, protein post-translational modifications

and ion channel regulation (1,2). Polyamines

provide cardioprotection and extend lifespan in

several model organisms (3,4), whereas excessive

concentrations of polyamines induce cellular

toxicity, possibly through the formation of toxic

metabolites (5). Therefore, the cellular polyamine

homeostasis is tightly controlled by fine-tuning

polyamine biosynthesis, degradation, export and

cellular uptake of exogenous polyamines via the

polyamine transport system (PTS) (2).

Based on studies in CHO-MG cells and other

models, several polyamine transport routes have

been proposed to account for experimental

observations of cellular polyamine uptake, but a

unifying theory is lacking, presumably due to the

existence of multiple parallel systems (12).

Potential plasma membrane polyamine transporters

include the solute carrier transporter, SLC3A2, with

2

PUT selectivity (23,24). An alternative pathway

involves the endocytic internalization of

extracellular polyamines via heparan sulfate groups

of plasma membrane proteins called glypicans

(25,26). Also, a vesicular SLC18B1 importer has

been reported presenting SPD and SPM selectivity

(27). Recently, we characterized the ubiquitous

verified whether the PTS was defective in the CHO-

MG cell line. We assessed the cellular polyamine

uptake capacity using BODIPY-conjugated SPD

and SPM (Fig. 1B) that are taken up by the PTS

(30) and transported by ATP13A2 (28), but both

CHO cell lines exhibited similar levels of

BODIPY-SPD and -SPM uptake (Fig. 1B). Also,

CHO-WT and CHO-MG models were equally

sensitive to the toxicity of high SPD and SPM

concentrations (Fig. S2). Since no obvious SPM or

SPD phenotype was observed in CHO-MG, we next

evaluated PUT uptake and toxicity. We, therefore,

synthesized BODIPY-labeled PUT for this study

and observed that its uptake was approximately

five-fold lower in CHO-MG than in CHO-WT (Fig.

1B), confirming a defective PTS in CHO-MG.

Benzyl viologen (BV), a known inhibitor of the

PTS (31), blocked BODIPY-PUT uptake in CHO-

WT to the levels observed in CHO-MG cells (Fig.

1B). We then investigated the effect of increasing

concentrations of exogenous PUT on the toxicity of

50 µM MGBG, a concentration that caused a

significant reduction in CHO-WT viability as

previously shown in Fig. 1A. Supplementation of

PUT on itself did not induce toxicity in either of the

two CHO models (Fig. 1C), in line with previous

observations (28), whereas PUT reduced MGBG

toxicity in CHO-WT in a dose-dependent manner

reaching complete prevention at 1 mM PUT (Fig.

1C). Since MGBG is taken up by the PTS (7,13,14),

our results point to a competition between PUT and

MGBG uptake via the same transport system.

P5B-ATPase, ATP13A2, as

transporter in the late

a

polyamine

endo-/lysosomal

compartment that preferentially sequesters SPM

and SPD out of the late endo-/lysosomal lumen into

the cytosol (28). ATP13A2 removes polyamines

from the lysosome, which benefits lysosomal health

and functionality. This process is compatible with

the glypican-dependent endosomal uptake route

that contributes to the cellular uptake of polyamines

complementing the polyamine synthesis in the

cytosol. ATP13A2 may mediate cellular polyamine

uptake via a two-step mechanism involving cellular

entry of polyamines through endocytosis, followed

by sequestration of polyamines out of the late endo-

/lysosomes by ATP13A2 (28). It remains unknown

whether the other orphan P5B-ATPases,

ATP13A3-5, may also be polyamine transporters of

the mammalian PTS (29).

We, therefore, hypothesized that the underlying

molecular defect of the CHO-MG phenotype might

be due to a dysfunction of one or more members of

the P5B-ATPases. In CHO-MG cells, we identified

mutations in the coding sequence of the ATP13A3

gene, which encodes for a P5B-ATPase expressed

in the early and recycling endosomes (29). We

demonstrated ATP13A3 expression deficiency at

both the mRNA and protein levels. Importantly,

reintroducing wild type ATP13A3 restores the

polyamine uptake and MGBG resistance phenotype

of CHO-MG cells, whereas ATP13A3 knockdown

in wildtype cells induces these phenotypes.

Therefore, ATP13A3 represents a novel member of

the mammalian PTS.

Overall, CHO-MG cells are resistant to MGBG and

present a reduced BODIPY-PUT uptake capacity,

which may relate to a defective polyamine

transporter of MGBG and PUT.

ATP13A3 deficiency in CHO-MG cells

Based on the recent discovery that ATP13A2 is a

polyamine transporter that regulates the cellular

polyamine content (28), we hypothesized that

ATP13A2, or one of the other related P5-type

orphan transporters such as ATP13A1 (a P5A-

ATPase) or ATP13A3-5 (P5B-ATPases) (29), may

be implicated in the CHO-MG phenotype. The

Chinese hamster (Cricetulus griseus) genome does

not contain an ATP13A5 gene (32), so we compared

the relative mRNA expression levels of the P5A-

ATPase ATP13A1 and the P5B-ATPases

ATP13A2-4 between CHO-WT and CHO-MG via

Results

CHO-MG cells exhibit MGBG resistance and

impaired BODIPY-PUT uptake

First, we confirmed via viability assays the

resistance of CHO-MG cells against MGBG-

induced toxicity as compared to CHO control cells

(CHO-WT) (Fig. 1A) (9,13,14). Furthermore, we

3

q-RT-PCR (Fig. 2A), for which the primer sets

were validated (Fig. S3A). Whereas the relative

mRNA levels of ATP13A1 and ATP13A2 were not

significantly different, ATP13A3 mRNA was

significantly decreased in CHO-MG compared to

CHO-WT cells (Fig. 2A). Importantly, we

confirmed the decreased expression of ATP13A3 in

CHO-MG cells at the protein level via proteomic

analysis (Fig. 2B and Fig. S3B). ATP13A4 mRNA

expression was hardly detected in the CHO models,

although the ATP13A4 primers were validated with

cDNA derived from hamster brain, the tissue that

shows the highest ATP13A4 expression in mice

(33) (Fig. S3C). The low ATP13A4 expression in

CHO cells is in line with the poor ATP13A4

expression in human ovaries (34).

catalytically dead mutant of ATP13A3 that is

defective in the auto-phosphorylation activity

(D498N; A3-DN), and hence predicted to be

transport deficient (Fig. 3A) (29). Note that the

ATP13A3 antibody fails to detect a clear band in

CHO-WT, indicating that the antibody may react

weaker with the endogenous hamster ATP13A3

protein than with the overexpressed human

ATP13A3 protein (9 residues are different in the

epitope region), and/or the endogenous signal may

be overshadowed by

a

relatively high

overexpression. Importantly, compared to the non-

transduced CHO-MG cells, there was a significant

increase in the uptake of BODIPY-PUT in CHO-

MG+A3-WT cells, comparable to the uptake level

observed in CHO-WT+A3-WT cells (Fig. 3B),

demonstrating successful recovery of BODIPY-

PUT uptake. However, this rescue was not

observed in CHO-MG+A3-DN cells expressing the

catalytic dead ATP13A3 mutant (Fig. 3B),

indicating that the transport function of ATP13A3

was essential for the recovery of BODIPY-PUT

uptake. Note that the uptake of BODIPY-PUT in

CHO-WT+A3-WT cells, exhibiting the highest

ATP13A3 expression, still falls within the linear

range (Fig. S4). The resistance to MGBG-induced

toxicity was also significantly reduced by 40% in

CHO-MG+A3-WT cells as compared to the non-

transduced CHO-MG and CHO-MG+A3-DN cell

lines (Fig. 3C).

To further establish ATP13A3 dysfunction as a key

contributor in the CHO-MG phenotype, we induced

stable shRNA-mediated knockdown of ATP13A3

in the CHO-WT background and checked if that

would lead to a phenotype comparable to CHO-MG

cells. Via q-RT-PCR, we observed a major

reduction in ATP13A3 expression in two

independent knockdown models (Fig. 4A), which

reduced the uptake of BODIPY-PUT to the same

level as in CHO-MG cells (Fig. 4B) and

significantly increased the resistance of the cells

against MGBG by 40% (Fig. 4C), in line with the

rescue results (Fig. 3C).

As CHO-MG cells were generated by random

mutagenesis (13), we analyzed the DNA sequence

of the CHO-MG ATP13A3 gene. Genome

sequencing revealed 54 DNA mutations in the

CHO-MG ATP13A3 gene as compared to the

reference

CHO

genome

(RefSeq

Assembly GCF_000223135.1). Only two of the 54

mutations were found in the coding sequence and

both of them were heterozygous. The first coding

sequence mutation is located on nucleotide 45284

of contig NW_003615339.1 (GT=0/1; AD=21,33;

DP=54; GQ=99; PL=1216,0,715) leading to a

nonsense mutation at the protein level converting

the Trp codon 511 (TGG) to a stop codon (TGA)

(p.Trp511X) (Fig. 2C). The second coding

sequence mutation results in a frameshift at the

protein level at position 936 (p.Phe936Serfs25X)

(Fig. 2C). Here, nucleotide 57302 in contig

NW_003615339.1 is deleted (GT=0/1; AD=25,27;

DP=52; GQ=99; PL=855,0,777), removing the first

thymine in the Phe codon (TTC) at position 936 of

the ATP13A3 protein sequence. Both mutations in

the coding sequence of ATP13A3 are compatible

with the decreased mRNA and protein expression

of ATP13A3 in CHO-MG cells.

Impaired ATP13A3 transport activity underlies

the CHO-MG phenotype

Together, the complementary data in the rescue and

knockdown cell models convincingly demonstrate

that defective ATP13A3-mediated transport

underlies the impaired BODIPY-PUT uptake in

CHO-MG cells and is at least partially responsible

for the MGBG resistance phenotype.

Next, we verified whether the impaired ATP13A3

expression is responsible for the CHO-MG

phenotype by restoring ATP13A3 levels via

lentiviral transduction. We generated stable CHO-

WT and CHO-MG cells expressing comparable

levels of human wild type (A3-WT) or a

4

ATP13A3-dependent transport presents a broad

polyamine specificity

Cellular uptake of BODIPY-PUT involves

endocytosis

We examined the likely substrate specificity of

ATP13A3-dependent transport via cellular uptake

experiments. Overexpression of wild-type

ATP13A3 in CHO-MG caused no significant

difference in the uptake of BODIPY-PUT, -SPD

and -SPM as compared to CHO-WT+A3-WT (Fig.

5A). Via competition assays, we observed that the

non-labeled PUT competed with BODIPY-PUT

uptake in cells expressing wild-type ATP13A3

(Fig. 5C), further confirming that PUT is most

likely a substrate transported through ATP13A3.

Interestingly, non-fluorescent SPD and SPM also

competed with the uptake of BODIPY-PUT in all

cell lines with functional ATP13A3, possibly

hinting at a broad polyamine substrate specificity

(Fig. 5D). Moreover, MGBG showed competition

against BODIPY-PUT uptake in a dose-dependent

manner in CHO-WT+A3-WT and CHO-MG+A3-

WT (Fig. 5B), confirming that MGBG and

BODIPY-PUT follow the same uptake route via

ATP13A3. Also, SPD and SPM protected against

MGBG toxicity in CHO-WT cells (Fig. S5 A, B).

Next, we independently verified substrate

specificity in viability experiments with DFMO, an

inhibitor of ornithine decarboxylase, the rate-

limiting step in polyamine synthesis. Blocking

endogenous polyamine synthesis by DFMO (Fig.

S1) makes cells more dependent on cellular uptake

of polyamines (9). Interestingly, ATP13A3

expression significantly reduced DFMO toxicity in

the CHO-MG background, mainly when exogenous

PUT was provided, and more mildly when SPD or

SPM was administered (Fig. 5E-G), demonstrating

that polyamine uptake via ATP13A3 complements

a lower ornithine decarboxylase activity. Note that

PUT exhibits no toxicity in the concentration range

we used, whereas SPD and SPM become toxic at

higher concentrations, which explains why

ATP13A3 protection against DFMO fades at higher

concentrations of SPD and SPM (Fig. 5E-G).

Overall, our data indicate that ATP13A3-dependent

transport presents a broad specificity to polyamines

including PUT, SPD and SPM, as well as MGBG.

Since ATP13A3 localizes to the early and recycling

endosomes (29), we investigated whether

endocytosis is involved in the uptake of BODIPY-

PUT by testing the effect of endocytosis inhibitors.

Administration of a cocktail of Dynasore, genistein

and Pitstop-2, which collectively inhibits the

clathrin-mediated,

clathrin-independent

and

caveolin-mediated endocytic pathways (28),

significantly reduced BODIPY-PUT uptake in

CHO-WT and CHO-WT+A3-WT but not in CHO-

MG cells (Fig. 6A), demonstrating the contribution

of endocytosis in the uptake process. Also, we

observed via confocal microscopy that the

fluorescence intensity of BODIPY-PUT was

significantly higher and more widespread in CHO-

WT than in CHO-MG cells where the signal was

confined to vesicular structures (Fig. 6C, D) that

co-localized with various endosomal markers (Fig.

6E, F). These observations in CHO-MG cells are in

line with the impaired transport of endocytosed

BODIPY-PUT to the cytosol as a consequence of

ATP13A3 dysfunction. We also checked whether

the lower BODIPY-PUT uptake in CHO-MG cells

is not merely the result of impaired endocytosis by

measuring uptake of Alexa647-transferrin (35) that

is sensitive to the same endocytosis inhibitor

cocktail (Fig. 6B). Remarkably, we observed that

the endocytosis of Alexa647-transferrin in CHO-

MG cells was five-fold higher than in CHO-WT

(Fig. 6B), which is, therefore, not responsible for

the lower BODIPY-PUT uptake levels observed in

CHO-MG cells.

Although BV is a potent inhibitor of BODIPY-PUT

uptake (Fig. 6A), it had no effect on Alexa647-

transferrin uptake (Fig. 6B), indicating that BV

may block another stage of the BODIPY-PUT

uptake route. Interestingly, BV treatment led to a

reduced uptake of BODIPY-PUT that accumulates

in vesicular structures, similar to the BODIPY-PUT

pattern in ATP13A3-deficient CHO-MG cells (Fig.

6C, D). This indicates that BV may inhibit

BODIPY-PUT uptake downstream of endocytosis,

possibly at the level of ATP13A3.

5

ATP13A2 and ATP13A3 Fulfill Overlapping

Functions in Cellular Polyamine Uptake

alleles of the ATP13A3 gene, since our proteomics

analysis indicated that the ATP13A3 protein is lost

in CHO-MG as compared to CHO-WT. One DNA

mutation causes an early truncation at the protein

level that may lead to nonsense-mediated mRNA

decay and subsequent loss of ATP13A3 mRNA and

protein. Also, a frameshift mutation was identified,

which may result in an unstable protein

contributing to the complete loss of ATP13A3

protein. Via complementary rescue and knockdown

experiments, we demonstrated that ATP13A3

represents a critical genetic defect underlying the

CHO-MG phenotype of polyamine uptake

deficiency. However, ATP13A3 complementation

only resulted in a partial but not full reversion of the

MGBG phenotype of CHO-MG cells. The partial

recovery may indicate that the human ATP13A3

isoform is not completely compatible with the

hamster ortholog. Alternatively, CHO-MG cells

were generated by random mutagenesis and several

rounds of MGBG selection (7,13), suggesting that

also mutations in other genes may contribute to the

MGBG resistance phenotype. The surprisingly high

endocytosis rate in CHO-MG cells may indeed

point to other genetic alterations or compensatory

responses that contribute to the phenotype.

We recently reported that ATP13A2 is a polyamine

transporter with a higher affinity for SPM and SPD

than PUT, which stimulates the uptake of BODIPY-

SPM and -SPD in cells, regulates the endogenous

polyamine content and complements DFMO

toxicity (28). Also, ATP13A2 deficiency causes

increased sensitivity to exogenous SPD or SPM due

to lysosomal stress (28). We therefore examined

whether ATP13A2 may also play a role in the

CHO-MG phenotype. However, in CHO-MG cells,

the ATP13A2 mRNA levels were not significantly

altered (Fig. 2A), the uptake of BODIPY-SPD and

BODIPY-SPM was not reduced (Fig. 1B), and

CHO-WT and CHO-MG models presented a

similar sensitivity towards SPD or SPM toxicity

(Fig. S2A, B). While these data indicate that

ATP13A2 deficiency is most likely not involved in

the CHO-MG phenotype, we further investigated if

ATP13A2 overexpression may partially convert the

CHO-MG phenotype to a CHO-WT phenotype.

We, therefore, generated stable CHO-WT and

CHO-MG cells overexpressing comparable levels

of ATP13A2 WT (A2-WT) or a catalytically dead

mutant (D508N; A2-DN) (Fig. S6A) and observed

that not only ATP13A3 (Fig. 3B), but also

ATP13A2 rescued BODIPY-PUT uptake to

comparable levels as CHO-WT (Fig. S6B). Yet,

ATP13A2 could not recover the resistance to

MGBG-induced toxicity (Fig. S6C). Moreover,

unlike ATP13A3 (Fig. 5B), a competition was not

observed between MGBG and PUT in CHO-MG

cells overexpressing wild-type ATP13A2 (Fig.

S6D), suggesting that the human ATP13A2 isoform

is not sensitive to MGBG.

CHO-MG cells represent one of the most frequently

studied mammalian cell models with a deficient

PTS. Since ATP13A3 wild type, but not a transport

deficient mutant, rescues the polyamine uptake

deficiency in CHO-MG cells, we convincingly

demonstrate that the orphan P5B-ATPase

ATP13A3 is a major component of the mammalian

PTS. In the evolution of the vertebrate lineage,

ATP13A3 emerged together with ATP13A2 as the

result of early gene duplication of an ancestral P5B-

ATPase ortholog (29). Via an extensive

biochemical analysis on purified protein, we

Discussion

recently demonstrated that ATP13A2 is

a

In this study, we identified the orphan P5B-

ATPase, ATP13A3, as a major factor in the

mammalian PTS that is responsible for the

polyamine-transport deficiency phenotype of

CHO-MG cells, a frequently used model to

characterize the mammalian PTS and polyamine

transport inhibitors with therapeutic potential (19-

22).

Via genome sequencing in CHO-MG cells, we

identified two heterozygous mutations in the coding

sequence of the ATP13A3 gene. Both mutations are

most likely located in trans, affecting the two

polyamine transporter that regulates cellular

polyamine uptake (28). ATP13A2 shares with

ATP13A3 a highly conserved putative substrate-

binding site in transmembrane segment M4 that in

ATP13A2 impacts on polyamine transport (28,36)

indicating that also ATP13A3 may most likely be a

polyamine transporter. Here, we found that

ATP13A3 contributes to cellular polyamine uptake

via a two-step uptake mechanism, first involving

endocytosis followed by ATP13A3-mediated

transport of endocytosed polyamines to the cytosol.

6

A two-step cellular uptake mechanism has already

been described for SPM involving endocytosis via

heparan sulfate proteoglycans (15) and lysosomal

export via ATP13A2 (28). The lower fluorescent

intensity of BODIPY-PUT in CHO-MG versus

CHO-WT cells may suggest that a fraction of the

endocytosed BODIPY-PUT in ATP13A3-deficient

CHO-MG cells is secreted via the recycling

endosomes, the compartment where ATP13A3

resides (29). Alternatively, the saturation of luminal

polyamines in the endosomal system of CHO-MG

cells may reduce the level of free plasma

membrane-localized polyamine receptors that

capture polyamines prior to endocytosis, such as

glypicans, which bind SPM with high affinity (15).

heterozygous ATP13A3 mutations have been

identified in pulmonary arterial hypertension (40-

42). Our study suggests that altered polyamine

transport or uptake may play a role in this rare but

fatal disorder. Strikingly, ATP13A2 mutations are

not implicated in cardiovascular, but in

neurodegenerative diseases, such as Parkinson’s

disease (43,44), indicating that ATP13A2 and

ATP13A3 exert distinct (patho-) physiological

roles. Indeed, while both isoforms are ubiquitously

expressed, slight differences were observed in

substrate specificity between ATP13A2 and

ATP13A3, and also their intracellular localization

is confined to distinct sub-compartments of the

endocytic pathway (ATP13A2 in late endo-

/lysosomes and ATP13A3 in early and recycling

endosomes) (29). Sequence differences in key

regulatory domains further indicate that both

isoforms may be differentially controlled by

distinct signaling pathways (29,45). Further

biochemical experiments on purified protein are

needed to conclusively confirm the putative

polyamine transport function of ATP13A3, and

compare the relative substrate specificity and

regulatory mechanisms of ATP13A3 versus

ATP13A2.

Our data suggest that ATP13A2 and ATP13A3

fulfill overlapping functions in cellular polyamine

uptake, but only ATP13A3 mediates MGBG

sensitivity. It is also possible that the human and

hamster ATP13A2 isoforms present different

sensitivities to MGBG. The fact that two ubiquitous

P5B transporters, ATP13A2 and ATP13A3,

contribute to cellular polyamine uptake may

explain why the identification of the mammalian

PTS has been challenging despite serious attempts.

Also, ATP13A4 and ATP13A5 are closely related

isoforms that may represent additional members of

the PTS, but display a more restricted tissue and

cell-type expression (29). Future studies will

address the complementarity and redundancy of

these various transporters and their interplay with

polyamine metabolism, which is under the control

of antizyme and antizyme inhibitors (37).

Compelling evidence has shown the involvement of

the ATP13A2 transport activity, as well as its yeast

P5B ortholog, YPK9, in the homeostasis of heavy

metal ions such as Zn²⁺, Mn²⁺and Fe³⁺(46-49).

However, biochemical experiments showed that

ATP13A2 is a polyamine transporter (28) and that

in vitro ATP13A2 activity is not regulated by Zn²⁺,

Mn²⁺and Fe³⁺(28,45). The effect of P5B ATPases

on heavy metal toxicity may, therefore, be an

indirect effect that requires the polyamine transport

function. Polyamines are heavy metal-chelating

agents and exert potent antioxidant effects, which

may explain why P5B polyamine transporters

provide protection against heavy metal toxicity

(50,51). Further studies are required to examine

whether also ATP13A3 exerts a protective effect

against heavy metals.

Studying ATP13A3 in combination with other

related P5B-ATPases will open the door to better

understand the role of polyamine uptake and

transport in a broad range of polyamine-dependent

cell functions (1,2) and the regulation of the life

span of model organisms, such as mice, Drosophila

melanogaster, Caenorhabditis elegans and

Saccharomyces cerevisiae (3,4). Conversely,

blocking the PTS has been proposed for cancer

therapy (12,38), and insights into the role of P5B-

ATPases in cellular polyamine uptake will now

facilitate a more targeted drug discovery strategy.

ATP13A3 expression has been highlighted as a

potential biomarker for DFMO-based therapies in

pancreatic cancers (39), suggesting that ATP13A3

may be a possible cancer target. Moreover,

In conclusion, by investigating the molecular

defects in a widely used cell model with polyamine

transport deficiency, we have identified the orphan

P5B-ATPase, ATP13A3, as a novel member of the

enigmatic mammalian PTS that contributes to

7

cellular polyamine uptake and that is implicated in

disease.

Cell Culture and Lentiviral Transduction

CHO-MG cells were generously provided by Prof.

Wayne Flintoff (University of Western Ontario,

Canada) and CHO-WT cells were used as a

corresponding control. CHO-WT and CHO-MG

cells were cultured respectively in Ham’s Nutrient

Mixture F12 (supplemented with 5% Eagle′s

minimum essential medium non-essential amino

acid solution; #M7145, Sigma) and Roswell Park

Memorial Institute (RPMI) 1640 media

(supplemented with 2 µg/mL L-Proline; #P5607,

Sigma) containing 10% fetal bovine serum (FBS;

# F7524, Sigma), 10% Glutamax (#35050-038,

Gibco), and 1% penicillin/streptomycin (#P4458,

Sigma) at 37°C with 5% CO₂.

Experimental Procedures

Materials

We were kindly supplied with MGBG by Prof. Paul

van Veldhoven (KU Leuven, Belgium) and boron

dipyrromethene (BODIPY)-conjugated polyamines

(SPD, SPM) by Prof. Steven Verhelst (KU Leuven,

Belgium) (30).

Treatments purchased from Sigma are BV

(#271845), DFMO (#D193), Dynasore (#D7693),

Pitstop-2 (#SML1169), PUT (#P7505), SPM

(#S3256) and SPD (#S2626). Alexa647-transferrin

(#T23366) was obtained from Invitrogen and

genistein (#ab120112) from Abcam.

Both of the CHO-WT and CHO-MG cell lines were

authenticated via DNA fingerprinting (Leibniz-

Institut

DSMZ-Deutsche

Sammlung

von

Primary antibodies used were ATP13A2 (#A3361,

Sigma), ATP13A3 (#HPA029471, Sigma), early

endosomal antigen 1 (EEA1; #E4156, Sigma),

Mikroorganismen und Zellkulturen GmbH).

Lentiviral transduction of CHO-WT/MG cells was

carried out using a lentiviral vector of human

ATP13A2 or ATP13A3 to induce overexpression

and micro RNA (miR)-based short hairpin RNA of

human ATP13A3 to induce knock-down (52). The

protein expression of wild-type ATP13A2 (A2-

WT) or ATP13A3 (A3-WT) and catalytically dead

mutants, D508N of ATP13A2 (A2-DN) or D498N

of ATP13A3 (A3-DN), in the stable CHO-WT/MG

cell lines was verified by immunoblotting, and the

knockdown was verified by q-RT-PCR.

glyceraldehyde

3-phosphate

dehydrogenase

(GAPDH; #G8795, Sigma), lysosomal-associated

membrane protein 1 (LAMP1; #ab24170, Abcam),

ras-associated binding protein

7

(RAB7;

#ab137029, Abcam) and RAB11 (#71-5300,

Thermo Fisher), and secondary antibodies included

anti-mouse IgG (#7076S, Cell Signaling

Technology) and anti-rabbit IgG (#7074S, Cell

Signaling Technology) horse radish peroxidase-

linked antibodies, and Alexa Fluor 594 goat anti-

rabbit antibody (#A-11037, Thermo Scientific).

All cell lines used were checked for mycoplasma

contamination using PlasmoTest™ - Mycoplasma

Detection kit (Invivogen) and were shown to be

negative.

All non-labeled and BODIPY-labeled polyamines

(PUT, SPD and SPM) were prepared in 0.1 M

MOPS-KOH (pH 7.0) to a final stock concentration

of 500 mM (200 mM in the case of non-labeled

SPM). DFMO was prepared fresh in cell culture

media to a final stock concentration of 500 mM, and

MGBG was dissolved in Milli-Q H₂O to a final

stock concentration of 100 mM. The endocytosis

inhibitors, Dynasore, genistein and Pitstop-2, were

dissolved in dimethyl sulfoxide (DMSO; #276855,

Sigma) to final concentrations of 50 mM, 25 mM,

25 mM and 10 mg/mL, respectively.

Cellular Viability Assay

Cells were cultured in a 96-well plate at a density

of 1 x 10⁴cells per well, except for DFMO

experiments for which 5 x 10³cells per well were

seeded. The media were discarded the next day and

replaced with media containing different

concentrations of the treatment of interest. Cell

viability was assessed after 24 h, and after 72 h for

DFMO treatments using the CellTiter 96^®AQ_ueous

One Solution Cell Proliferation Assay (MTS)

(#G3580, Promega) following the manufacturer

instructions. Absorbance was assessed at 490 nm

using a plate reader (Molecular Devices).

Information about other reagents and kits is

mentioned when used throughout this section.

8

Cellular Polyamine Uptake, Competition Assays

and Endocytosis

were blocked for 60 min with 0.1 M glycine in

DPBS-T and blocked further for 60 min with

DPBS-T containing 10% FBS and 1% BSA.

Subsequently, cells were incubated overnight at

4°C with specific primary antibodies for EEA1,

RAB11, RAB7 and LAMP1 (1:200 in DPBS-T

with 1% FBS and 0.1% BSA). Then, cells were

briefly blocked again for 15 min with DPBS-T

Cells were cultured in a 12-well plate at a density

of 3 x 10⁵cells per well and were treated the next

day for 90 min at 37°C with 5 µM BODIPY-

conjugated polyamine for uptake assays and co-

treated with indicated concentrations of MGBG or

non-fluorescent polyamine for competition assays,

with or without 90 min of 1 mM BV pre-treatment

to inhibit polyamine uptake. To study endocytosis,

cells were cultured in a 12-well plate at a density of

1 x 10⁵cells per well. After 48 h, cells were treated

with BV or endocytosis inhibitors (100 μM

Dynasore, 50 μM genistein and 50 μM Pitstop-2),

while being starved for 30 min. Then, they were

incubated at 4°C for 15 min, treated with Alexa647-

transferrin for 20 min and incubated at 37°C, 5%

CO₂for 15 min. After incubating the cells with the

treatments, they were washed with Dulbecco’s

phosphate-buffered saline (DPBS) modified with

no calcium or magnesium (#D8537, Sigma) and

collected using TrypLE Express (#12604021,

Thermo Fisher) or trypsin in case of Alexa647-

transferrin experiments. Cells were re-suspended in

DPBS supplemented with 1% bovine serum

albumin (BSA; #3854.3, Carl Roth) and uptake was

measured using an Attune NTX Flow Cytometer

(Life Technologies). The settings were set at 1 x 10⁴

events (debris-free) per condition and the values of

the mean fluorescent intensity (MFI) of the blue

laser channel (BL1; excitation = 488 nm, emission

= 530 nm) with BODIPY-PUT/SPD/SPM, and the

red laser channel (RL1; excitation = 637 nm,

emission = 670 nm) with Alexa647-transferrin

were used for further analysis.

containing

10%

FBS

and

1%

BSA.

Immunostaining was carried out with Alexa Fluor

594 goat anti-rabbit antibody (1:1000 in DPBS-T

with 1% FBS and 0.1% BSA) for 60 min followed

by nuclear staining using 4',6-Diamidino-2-

phenylindole (DAPI; #D9542, Sigma; 200 ng/mL

in DPBS-T with 1% FBS and 0.1% BSA) for 15

min. Eventually, cells were washed thoroughly with

DPBS-T, and coverslips were glued on glass slides

using Fluorsave reagent (#345789-20 mL,

Millipore), left to dry and then stored at -20°C till

imaging. Images were acquired using an LSM780

confocal microscope (Zeiss) using a 63x objective

lens. Analyses for MFI and Pearson’s coefficient

for co-localization were performed using

FIJI/ImageJ.

Primer Design, RNA extraction and Quantitative

Real-Time PCR

Primers were designed using Primer-BLAST or

Primer3. BLAT was used to identify the target

chromosome of the primers, exon-spanning was

checked using Ensembl and primers were

synthesized by Integrated DNA Technologies.

Primer Sequences are displayed in Table 1. FKBP

prolyl isomerase 1A (FKBP1A) was used as a

reference gene (53). Standard curves from five-fold

serial dilutions of cDNA were used to determine

amplification efficiencies. Primer specificity and

validation were verified by analyzing the PCR

product on an agarose gel in comparison with the

Low Molecular Weight DNA Ladder (N3233S,

New England BioLabs).

Confocal Microscopy

Cells were seeded in 12 well-plates at a density of

5 x 10³cells per well on coverslips and they were

left to grow for 2 days after the seeding. They were

then treated with BODIPY-PUT for 90 min at 37°C

with or without 30 min pre-treatment of 1 mM BV.

Afterward, cells were washed with DPBS, fixed

with 4% paraformaldehyde for 30 min at 37°C and

washed again with DPBS. This was followed by

either storing the cells in DPBS at 4°C or directly

proceeding further. First, cells were permeabilized

for 30 min with 0.1% Triton X prepared in DPBS

containing 0.1% Tween 20 (DPBS-T). Then, they

RNA was isolated from 5 x 10⁶cells per cell line

using NucleoSpin RNA plus Kit (#740984,

Macherey-Nagel). RNA from the hamsters’ brains

was extracted using TRIzol reagent (#15596026 &

15596018,

Invitrogen)

following

the

manufacturer’s instructions. The concentration and

purity (260:230 nm and 260:280 nm absorbance

ratios) were measured using

spectrophotometer (Thermo Fisher).

a

Nanodrop

9

Conversion of 1 µg of RNA to cDNA was

performed using RevertAid H Minus First Strand

cDNA Synthesis Kit (#K1631, Thermo Fisher).

Five-fold serial dilutions of cDNA were checked in

duplicates. Reaction mixtures contained 12.5 µL

SYBR Green master mix (#04707516001, Roche),

1 µL forward primer, 1 µL reverse primer, 5.5 µL

distilled water and 5 µL cDNA, while the negative

controls were prepared using an equivalent volume

of distilled water instead of cDNA. Reactions were

performed in a 96 well-plate using Light Cycler

machine (Roche) and amplification conditions were

as follows: 95°C for 10 min followed by 50 cycles

at 95°C for 10 s and 55°C for 30 s, and the reaction

was terminated at 95°C for 1 min then at 55°C for

1 min followed by melting curve analysis from 55-

95°C. The mean Cq values were analyzed.

fluorescent

indicator

and

by

liquid

chromatography-mass spectrometry (LC-MS)

performed on a Prominence Ultra-fast Liquid

Chromatography system (Shimadzu) equipped with

a 2x150 mm C18 analytical column (Waters X-

Bridge) coupled to an MS-2020 single quadrupole

mass analyzer (Shimadzu). A linear gradient of 5-

80% acetonitrile in water (with 0.1% formic acid)

was utilized. Silica column chromatography was

performed using 230-400 mesh silica (Kieselgel

60). NMR spectra were recorded in CDCl₃and

measured using a Bruker Ultrashield^TM400 MHz

NMR Spectrometer. Chemical shifts are reported in

ppm relative to the residual solvent peak.

Tert-butyl (4-aminobutyl)carbamate (1)

Immunoblotting

Boc-protected PUT 1 was synthesized based on the

method of Dardonville et al. (54). To this end, PUT

(323 mg, 4 eq., 3.67 mmol) was dissolved in 4 mL

CHCl₃and cooled to 0°C. Boc₂O (526 µL, 1eq.,

2.29 mmol) was dissolved in 10 mL CHCl₃and

slowly added to the PUT solution over the course

of 2h. The reaction mixture was then allowed to

warm to room temperature and stirred overnight.

Upon completion of the reaction (TLC: PE/EtOAC

1:1), the solvents were evaporated and the crude

product was redissolved in 20 mL DCM. The crude

mixture was extracted three times with H₂O. The

organic fraction was collected, dried over MgSO₄

and concentrated. The product was further purified

using column chromatography (petroleum

ether/EA 1:1 → EA/MeOH/TEA 9:1:0.01) to

obtain the title compound as a colorless oil. (169

mg, yield = 98%) ESI-MS: m/z calculated for

C₉H₂₀N₂O₂[M+H]⁺requires 189.15, found 188.95

Cells were detached using TrypLE Express, then

they were centrifuged at 300 x g for 5 min and

washed once with DPBS then centrifuged again.

Total cell lysates were obtained by lysing the final

pellets in RIPA buffer (#89900, Thermo Fisher)

containing 10x protease (#S8830, Sigma) and 1x

phosphatase (#A32957, Thermo Fisher) inhibitors.

Protein concentration was determined using Pierce

BCA Protein Assay Kit (#23227, Thermo Fisher)

following the manufacturer’s instructions.

Immunoblotting was performed as described in

(47). Primary antibodies against ATP13A2

(1:1000), ATP13A3 (1:1000) and GAPDH

(1:5000) were incubated overnight. Anti-mouse

IgG and anti-rabbit IgG horseradish peroxidase-

linked secondary antibodies were used for 1 h at a

dilution of 1:2000. Detection was performed using

SuperSignal™ West Pico PLUS Chemiluminescent

Substrate (#34580, Thermo Fisher) or SuperSignal

West Femto Maximum Sensitivity Substrate

(#34095, Thermo Fisher) and visualization was

carried out using the Bio-Rad ChemiDoc MP

imaging system.

3-azidopropyl 4-methylbenzenesulfonate (2)

Tosylate 2 was synthesized based on the procedure

of Chan et al. (55). To this end, 3-chloropropanol

(1.00 g, 10.58 mmol, 1 eq.) was dissolved in 10 mL

H₂O. NaN₃(688 mg, 10.58 mmol, 1 eq.) was added

to this solution and the reaction was refluxed

overnight. Upon completion of the reaction

(petroleum ether/EA 1:1), the reaction mixture was

Synthesis of BODIPY conjugated PUT

All starting materials and solvents were bought

from commercial vendors and used without further

purification. Reactions were analyzed by Thin

Layer Chromatography (TLC) on pre-coated 0.20

mm thick ALUGRAM^®TLC sheets with

10

cooled to room temperature and extracted three

times with 20 mL DCM. The organic fractions were

collected, dried over MgSO₄and evaporated to

dryness. The crude product was redissolved in 15

mL dry DCM. Triethylamine (2.95 mL, 2 eq., 21.17

mmol) was added and the mixture was cooled to

0°C. Tosyl chloride (2.44 g, 1.2 eq., 11.64 mmol)

was added to the reaction mixture, which was

subsequently allowed to warm to room temperature

and stirred overnight. Upon completion of the

reaction (TLC: PE:EtOAc 4:1), the solvents were

evaporated and the crude product purified by

column chromatography (PE:EtOAC 1:0 → 9:1) to

obtain the title compound as a colorless solid.

(1.554 g, yield = 58% over two steps) ESI-MS: m/z

calculated for C₁₀H₁₃N₃O₃S [M+H]⁺requires

256.07, found 256.90.

Alkyne-BODIPY 4 was synthesized according to

the method described in Vanhoutte et al. (30). The

identity was in agreement with the data reported in

the literature. ESI-MS: m/z calculated for

C₁₈H₂₁BF₂N₂[M+H]⁺315.18, found 315.00

Tert-butyl (4-((3-(4-(3-(5,5-difluoro-1,3,7,9-

tetramethyl-5H-4l4,5l4-dipyrrolo[1,2-c:2',1'-

f][1,3,2]diazaborinin-10-yl)propyl)-1H-1,2,3-

triazol-1-yl)propyl)amino)butyl)carbamate (5)

Tert-butyl (4-((3-

azidopropyl)amino)butyl)carbamate (3)

Boc-PUT 1 (88 mg, 467 µmol, 1 eq.) was dissolved

in 2 mL dry THF under Argon atmosphere. DIPEA

(333 µL, 1.87 mmol, 4 eq.) was added to this

solution, which was subsequently cooled to 0°C.

Tosylate 2 was added gradually to the reaction

mixture, which was subsequently allowed to warm

up to room temperature. The reaction stirred

overnight at room temperature. Upon completion of

the reaction (TLC: DCM/MeOH 9:1), the solvents

were evaporated and the crude product purified

over column chromatography (DCM/MeOH 9:1) to

obtain the title compound as a colorless oil. (38.37

mg yield = 30%) ESI-MS: m/z calculated for

C₁₂H₂₅N₅O₂[M+H]⁺requires 272.20, found 272.00

Compound 3 (24 mg, 1 eq., 88.44 µmol) was

dissolved in 2 mL DCM. Alkyne-BODIPY 4 (29.18

mg, 1.05 eq., 92.86 µmol), DIPEA (63 µL, 4 eq.,

353.77 µmol) and subsequently CuBr (6.34 mg, 0.5

eq., 44.22 µmol) were added to the reaction

mixture. The reaction was stirred at room

temperature for 3h. Upon completion of the

reaction (TLC: DCM/MeOH 9:1), the solvents

were evaporated and the crude product purified

using column chromatography (DCM/MeOH 9:1)

to obtain the title compound as a red oil. (32.45 mg,

yield = 63%) ESI-MS: m/z calculated for

C₃₀H₄₆BF₂N₇O₂[M+H]⁺requires 586.37, found

586.20

5,5-difluoro-1,3,7,9-tetramethyl-10-(pent-4-yn-

1-yl)-9a,10-dihydro-5H-5l4,6l4-dipyrrolo[1,2-

c:2',1'-f][1,3,2]diazaborinine (4)

N1-(3-(4-(3-(5,5-difluoro-1,3,7,9-tetramethyl-

5H-4l4,5l4-dipyrrolo[1,2-c:2',1'-

f][1,3,2]diazaborinin-10-yl)propyl)-1H-1,2,3-

11

triazol-1-yl)propyl)butane-1,4-diamine

dihydrochloride (6)

sec OFF, 3 cycles, 7-9 W output. After sonication,

samples were incubated at room temperature with

shaking (650 rpm) for 10 min. Reduction of sample

protein disulfide bonds was achieved by adding

DTT (dithiothreitol, Sigma Aldrich) to a final

concentration of 5 mM and incubation for 30 min at

50°C and 650 rpm. Alkylation was performed by

adding IAA (iodoacetamide, Fluka) to a final

concentration of 10 mM and incubation at RT in the

dark for 15 min at 650 rpm. Following reduction

and alkylation, pH was adjusted with 10% FA

(formic acid, Acros Organics) to

a

final

concentration of 1% FA and samples incubated for

10 min at RT and 500 rpm. APols were precipitated

by centrifugation at 16,000 x g for 5 min at RT and

supernatant discarded. The APols pellet was

washed with 0.1% FA for 5 min at 500 rpm and

precipitated again by centrifugation at 16,000 x g

for 5 min at RT. The supernatant was again

discarded and the pellet was solubilized in 200 µL

of 100 mM TEAB (tetraethylammonium

bicarbonate, Sigma Aldrich). 1 µg of trypsin was

added to each sample and digestion performed

overnight at 37°C and 800 rpm shaking. Samples

were briefly spun down, the pH adjusted to a final

FA concentration of 1% and incubated for 10 min

at RT at 650 rpm. Apols were precipitated by

centrifugation at 16,000 x g for 10 min at RT and

the supernatant, containing the tryptic peptides,

transferred to MS vials and vacuum dried

completely. Samples were stored at -20°C until

measured by LC-MS/MS.

Compound 5 (32.45 mg, 55.42 µmol) was dissolved

in 6 mL 4N HCl in dioxane and stirred for 5 minutes

at room temperature. Upon completion of the

reaction, the solvents were evaporated to obtain the

title compound as a red solid (30.94 mg, yield =

100%).

ESI-MS:

m/z

calculated

for

C₂₅H₄₀BCl₂F₂N₇[M+H-HCl]⁺requires 486.32,

found 486.15. ¹H NMR (400 MHz, CDCl3, 298K):

δ = 7.91- 7.48 (m, 2H), 7.24-6.94 (m, 1H), 6.44-

5.66 (m, 2H), 3.83-3.53 (m, 4H), 3.22- 3.00 (m,

4H), 2.71- 1.81 (m, 8H), 1.63 -1.32 (m, 14H).

Proteomics

Sample preparation and LC-MS/MS analysis

A count of 5 x 10⁶trypsinized cells per cell line was

collected by two centrifugation spins at 300 x g for

5 min, followed by pellet re-suspension in DPBS.

Dry pellets were snap-frozen in liquid nitrogen and

stored at -80°C. Proteomics was performed on four

biological replicates of each cell line.

Purified peptides were re-dissolved in 30 µL

loading solvent (0.1% TFA in water/ACN (96:4,

v/v)) and peptide concentration determined by

measuring on

a

Lunatic spectrophotometer

(Unchained Labs) (Mendes Maia et al. 2020 ACS

Omega, in press). 2 µg of peptide material of each

sample was injected for LC-MS/MS analysis on an

Ultimate 3000 RSLC nano-LC (Thermo Fisher

Scientific, Bremen, Germany) in-line connected to

a Q Exactive HF mass spectrometer (Thermo Fisher

Scientific) equipped with a nanospray flex ion

source (Thermo Fisher Scientific).

A total of 8 membrane fraction samples were

prepared for LC-MS/MS analysis. Sample

preparation was based on methods reported earlier

by Ning et al. in 2013 and 2014 (56,57). For this

purpose, 500 µL of a 100 mM HEPES solution were

added to samples containing 100 µg protein in 500

µL 0.25 M sucrose and protease inhibitors to reach

a final HEPES concentration of 50 mM. APols

(Amphipol A8-35, Anatrace Products) was added

to a final concentration of 1%. Samples were

homogenized on ice by using a tip sonicator

(VC100 Vibra-Cell, Sonics & Materials) using the

following settings: 40 Hz amplitude, 5 sec ON, 2

Trapping was performed at 10 μL/min for 4 min in

loading solvent A on a 20 mm trapping column

(made in-house, 100 μm internal diameter (I.D.), 5

μm beads, C18 Reprosil-HD, Dr. Maisch,

Germany). Peptide separation after trapping was

12

performed on a 200 cm long micropillar array

column (PharmaFluidics) with C18-endcapped

functionality. The Ultimate 3000’s column oven

was set to 50°C. For proper ionization, a fused silica

PicoTip emitter (10 µm inner diameter) (New

Objective) was connected to the µPAC™ outlet

union and a grounded connection was provided to

this union. Peptides were eluted by a non-linear

gradient from 1 to 55% MS solvent B (0.1% FA in

water/ACN (2:8, v/v)) over 145 min, starting at a

flow rate of 750 nL/min switching to 300 nL/min

after 15 min, followed by a 15-minutes washing

phase plateauing at 99% MS solvent B. Re-

equilibration with 99% MS solvent A (0.1% FA in

water) was performed at 300 nL/min for 45 min

followed by 5 min at 750 nL/min adding up to a

total run length of 210 min. The mass spectrometer

was operated in data-dependent, positive ionization

mode, automatically switching between MS and

MS/MS acquisition for the 16 most abundant peaks

in a given MS spectrum. The source voltage was 2.2

kV, and the capillary temperature was 275°C. One

MS1 scan (m/z 375−1,500, AGC target 3 x 10⁶

ions, maximum ion injection time 60 ms), acquired

at a resolution of 60,000 (at 200 m/z), was followed

by up to 16 tandem MS scans (resolution 15,000 at

200 m/z) of the most intense ions fulfilling

predefined selection criteria (AGC target 1 x 10⁵

ions, maximum ion injection time 80 ms, isolation

window 1.5 Da, fixed first mass 145 m/z, spectrum

data type: centroid, intensity threshold 1.3 x 10⁴,

exclusion of unassigned, 1, 7, 8, >8 positively

charged precursors, peptide match preferred,

exclude isotopes on, dynamic exclusion time 12 s).

The HCD collision energy was set to 28%

ATP13A4. The mass tolerance for precursor and

fragment ions was set to 4.5 and 20 ppm,

respectively, during the main search. Enzyme

specificity was set to the C-terminal of arginine and

lysine, also allowing cleavage next to prolines with

a maximum of two missed cleavages. Variable

modifications were set to oxidation of methionine

residues as wells as acetylation of protein N-

termini. Matching between runs was enabled with a

matching time window of 0.7 min and an alignment

time window of 20 min. Only proteins with at least

one unique or razor peptide were retained leading

to the identification of 5,040 proteins. Proteins were

quantified by the MaxLFQ algorithm integrated

into the MaxQuant software. A minimum ratio

count of two unique or razor peptides was required

for quantification. Further data analysis was

performed with the Perseus software (version

1.6.7.0) after uploading the protein groups file from

MaxQuant (60). Reverse database hits were

removed and replicate samples were grouped.

Proteins with less than three valid values in at least

one group were removed and missing values were

imputed from a normal distribution around the

detection limit resulting in 3,382 quantified

proteins, which were subsequently used for further

data analysis. These quantified proteins were

subjected to a two-sided, unpaired t-test using

permutation-based multiparameter correction with

1000 randomizations and a false discovery rate of

1%. The results of this t-test are shown in the

volcano plot in Fig. S2B. For each protein, the log2

(MG/WT) fold change value is indicated on the X-

axis, while the statistical significance (-log p-value)

is indicated on the Y-axis. Proteins outside the

curved lines, set by an FDR value of 0.01 and an S0

value of 0.1 in the Perseus software, represent

specific significant up- or down-regulated proteins.

Normalized

Collision

Energy

and

the

polydimethylcyclosiloxane background ion at

445.12003 Da was used for internal calibration

(lock mass).

Genomics

Data analysis

Samples were prepared with the KAPA Library

HyperPrep Kit (#07962363001, Roche) according

to the manufacturer protocol. Samples were

indexed to allow for multiplexing and subsequently

sequenced on an Illumina Novaseq platform

according to the manufacturer recommendations.

Paired-end reads of 150 bp length were produced

with a total of 59 M reads. Quality control of raw

reads was performed with FastQC v0.11.7 (61).

Alignment was performed with BWA mem (62)

Data analysis was performed with MaxQuant

(version 1.6.9.0) using the Andromeda search

engine with default search settings including a false

discovery rate set at 1% on both the peptide and

protein level (58,59). Spectra were searched against

the Chinese hamster (CHO K1 cell line) SwissProt

database (from September 2019 with 23,889

entries) and NCBI single protein databases for

hamster ATP13A1, ATP13A2, ATP13A3 and

13

against the Chinese Hamster reference genome.

Reads mapping to multiple loci in the reference

genome were discarded. Resulting BAM alignment

files were handled with Samtools v1.5 (63).

Validation of BAM files and duplicate marking was

performed with Picard. Variants and VCF files

were produced with GATK 3.7 (64). Effect of

variants was determined with Ensembl Variant

Effect Predictor (VEP) (65).

Whitney) t-test (^*/€P<0.05, ^**/€€P < 0.01, ^{***/€€€}P <

0.001 and ^{****/€€€€}P < 0.0001).

Data Availability

The mass spectrometry proteomics data have been

deposited to the ProteomeXchange Consortium via

the

PRIDE

(66)

partner

repository

(http://www.ebi.ac.uk/pride) with the dataset

identifier PXD020559 and 10.6019/PXD020559.

And the full genomics dataset can be accessed on

Genbank (sequence read archive accession:

PRJNA627458) via the link:

https://www.ncbi.nlm.nih.gov/sra/PRJNA627458

All of the remaining data are contained in the article

or its supporting information.

Statistical Analysis

Data are presented as the mean ± SE or mean ± SD

and ‘n’ indicates the number of independent

experiments. Statistical analysis was conducted by

one/two-way analysis of variance (ANOVA) with

Bonferroni post hoc corrections or unpaired (Mann-

Acknowledgements

We thank the Proteomics Core (VIB-UGent, Belgium) and the Genomics Core Leuven (KU Leuven, Belgium) for

their generous help and technical assistance. We acknowledge the Cell Culture Facility (KU Leuven, Belgium) for

their help with preparing the cell media, and the FACS Core (VIB-KU Leuven, Belgium) for the use of the Attune

NTX Flow Cytometer (Life Technologies). We also acknowledge the use of the facilities and equipment of the Cell

and Tissue Imaging Cluster (P. Vanden Berghe, KU Leuven, Belgium).

Author Contributions

The study was designed by PV, SM and NNH; CVdH generated the viral vectors and stable cell lines; RV

synthesized BODIPY-labeled polyamines; NNH performed and analyzed all experiments (except for the proteomics

analysis by FI and RM, the genomic sequencing analysis and bioinformatics by ACC and the acquisition of most

confocal microscopy images by SM. PV and NNH wrote the manuscript, which was reviewed and approved by all

authors.

Funding and Additional Information

This work was funded by the KU Leuven C1 grant LysoCaN (C16/15/073 to PV, WA, PA and JS), the Flemish

Research Foundation FWO (G094219N), Strategic Basic Research Neuro-Traffic (S006617N to PV, WA, JS, FI

and VBa) and the M. J. Fox Foundation/Aligning Science Across Parkinson's (ASAP-0458; PV and VBa).

Conflict of Interest:

The authors declare no competing financial interests.

References

1.

Pegg, A. E. (2016) Functions of Polyamines in Mammals. Journal of Biological Chemistry 291, 14904-

14912

2.

3.

Pegg, A. E. (2009) Mammalian polyamine metabolism and function. IUBMB life 61, 880-894

Eisenberg, T., Abdellatif, M., Schroeder, S., Primessnig, U., Stekovic, S., Pendl, T., Harger, A., Schipke,

J., Zimmermann, A., Schmidt, A., Tong, M., Ruckenstuhl, C., Dammbrueck, C., Gross, A. S., Herbst, V.,

Magnes, C., Trausinger, G., Narath, S., Meinitzer, A., Hu, Z., Kirsch, A., Eller, K., Carmona-Gutierrez,

14

D., Büttner, S., Pietrocola, F., Knittelfelder, O., Schrepfer, E., Rockenfeller, P., Simonini, C., Rahn, A.,

Horsch, M., Moreth, K., Beckers, J., Fuchs, H., Gailus-Durner, V., Neff, F., Janik, D., Rathkolb, B.,

Rozman, J., de Angelis, M. H., Moustafa, T., Haemmerle, G., Mayr, M., Willeit, P., von Frieling-

Salewsky, M., Pieske, B., Scorrano, L., Pieber, T., Pechlaner, R., Willeit, J., Sigrist, S. J., Linke, W. A.,

Mühlfeld, C., Sadoshima, J., Dengjel, J., Kiechl, S., Kroemer, G., Sedej, S., and Madeo, F. (2016)

Cardioprotection and lifespan extension by the natural polyamine spermidine. Nature medicine 22, 1428-

1438

4.

Eisenberg, T., Knauer, H., Schauer, A., Büttner, S., Ruckenstuhl, C., Carmona-Gutierrez, D., Ring, J.,

Schroeder, S., Magnes, C., Antonacci, L., Fussi, H., Deszcz, L., Hartl, R., Schraml, E., Criollo, A.,

Megalou, E., Weiskopf, D., Laun, P., Heeren, G., Breitenbach, M., Grubeck-Loebenstein, B., Herker, E.,

Fahrenkrog, B., Fröhlich, K.-U., Sinner, F., Tavernarakis, N., Minois, N., Kroemer, G., and Madeo, F.

(2009) Induction of autophagy by spermidine promotes longevity. Nature Cell Biology 11, 1305-1314

5.

6.

7.

Pegg, A. E. (2013) Toxicity of Polyamines and Their Metabolic Products. Chemical Research in

Toxicology 26, 1782-1800

Miller-Fleming, L., Olin-Sandoval, V., Campbell, K., and Ralser, M. (2015) Remaining Mysteries of

Molecular Biology: The Role of Polyamines in the Cell. Journal of Molecular Biology 427, 3389-3406

Heaton, M. A., and Flintoff, W. F. (1988) Methylglyoxal-bis(guanylhydrazone)-resistant Chinese hamster

ovary cells: Genetic evidence that more than a single locus controls uptake. Journal of Cellular

Physiology 136, 133-139

8.

Persson, L., Holm, I., Ask, A., and Heby, O. (1988) Curative effect of DL-2-difluoromethylornithine on

mice bearing mutant L1210 leukemia cells deficient in polyamine uptake. Cancer research 48, 4807-4811

9.

Byers, T. L., Wechter, R., Nuttall, M. E., and Pegg, A. E. (1989) Expression of a human gene for

polyamine transport in Chinese-hamster ovary cells. Biochemical Journal 263, 745

10.

Evageliou, N. F., Haber, M., Vu, A., Laetsch, T. W., Murray, J., Gamble, L. D., Cheng, N. C., Liu, K.,

Reese, M., Corrigan, K. A., Ziegler, D. S., Webber, H., Hayes, C. S., Pawel, B., Marshall, G. M., Zhao,

H., Gilmour, S. K., Norris, M. D., and Hogarty, M. D. (2016) Polyamine Antagonist Therapies Inhibit

Neuroblastoma Initiation and Progression. Clinical Cancer Research 22, 4391

11.

Delcros, J.-G., Tomasi, S., Carrington, S., Martin, B., Renault, J., Blagbrough, I. S., and Uriac, P. (2002)

Effect of Spermine Conjugation on the Cytotoxicity and Cellular Transport of Acridine. Journal of

Medicinal Chemistry 45, 5098-5111

12.

13.

14.

Wang, M., Phanstiel, O., and von Kalm, L. (2017) Evaluation of Polyamine Transport Inhibitors in a

Drosophila Epithelial Model Suggests the Existence of Multiple Transport Systems. Med Sci (Basel) 5, 27

Mandel, J.-L., and Flintoff, W. F. (1978) Isolation of mutant mammalian cells altered in polyamine

transport. Journal of Cellular Physiology 97, 335-343

Byers, T. L., Kameji, R., Rannels, D. E., and Pegg, A. E. (1987) Multiple pathways for uptake of

paraquat, methylglyoxal bis(guanylhydrazone), and polyamines. American Journal of Physiology-Cell

Physiology 252, C663-C669

15

15.

16.

Belting, M., Mani, K., Jönsson, M., Cheng, F., Sandgren, S., Jonsson, S., Ding, K., Delcros, J.-G., and

Fransson, L.-Å. (2003) Glypican-1 Is a Vehicle for Polyamine Uptake in Mammalian Cells: A Pivotal

Role for Nitrosothiol-Derived Nitric Oxide. Journal of Biological Chemistry 278, 47181-47189

Soulet, D., Gagnon, B., Rivest, S., Audette, M., and Poulin, R. (2004) A Fluorescent Probe of Polyamine

Transport Accumulates into Intracellular Acidic Vesicles via a Two-step Mechanism. Journal of

Biological Chemistry 279, 49355-49366

17.

18.

Sharpe, J. G., and Seidel, E. R. (2005) Polyamines are absorbed through a y+ amino acid carrier in rat

intestinal epithelial cells. Amino Acids 29, 245-253

Soulet, D., Covassin, L., Kaouass, M., Charest-Gaudreault, R., Audette, M., and Poulin, R. (2002) Role of

endocytosis in the internalization of spermidine-C(2)-BODIPY, a highly fluorescent probe of polyamine

transport. Biochem J 367, 347-357

19.

20.

Muth, A., Madan, M., Archer, J. J., Ocampo, N., Rodriguez, L., and Phanstiel, O. (2014) Polyamine

Transport Inhibitors: Design, Synthesis, and Combination Therapies with Difluoromethylornithine.

Journal of Medicinal Chemistry 57, 348-363

Liao, C.-P., Phanstiel, O., Lasbury, M. E., Zhang, C., Shao, S., Durant, P. J., Cheng, B.-H., and Lee, C.-

H. (2009) Polyamine Transport as a Target for Treatment of <em>Pneumocystis</em>

Pneumonia. Antimicrobial Agents and Chemotherapy 53, 5259

21.

22.

23.

Nazifi, S. m., Sadeghi-Aliabadi, H., Fassihi, A., and Saghaie, L. (2018) Structure–activity relationship of

polyamine conjugates for uptake via polyamine transport system. Structural Chemistry 30

Phanstiel, O., and Archer, J. J. (2012) Chapter 7 Design of Polyamine Transport Inhibitors as

Therapeutics. in Polyamine Drug Discovery, The Royal Society of Chemistry. pp 162-190

Uemura, T., Stringer, D. E., Blohm-Mangone, K. A., and Gerner, E. W. (2010) Polyamine transport is

mediated by both endocytic and solute carrier transport mechanisms in the gastrointestinal tract. American

journal of physiology. Gastrointestinal and liver physiology 299, G517-G522

24.

25.

Uemura, T., Yerushalmi, H. F., Tsaprailis, G., Stringer, D. E., Pastorian, K. E., Hawel, L., Byus, C. V.,

and Gerner, E. W. (2008) Identification and Characterization of a Diamine Exporter in Colon Epithelial

Cells. Journal of Biological Chemistry 283, 26428-26435

Ding, K., Sandgren, S., Mani, K., Belting, M., and Fransson, L.-Å. (2001) Modulations of Glypican-1

Heparan Sulfate Structure by Inhibition of Endogenous Polyamine Synthesis: Mapping of Spermine-

binding Sites and Heparanase, Heparin Lyase, and Nitric Oxide/Nitrite Cleavage Sites. Journal of

Biological Chemistry 276, 46779-46791

26.

27.

Haysmark, B., Fransson, L.-Å., Jönsson, M., Belting, M., and Persson, S. (1996) Heparan

sulphate/heparin glycosaminoglycans with strong affinity for the growth-promoter spermine have high

antiproliferative activity. Glycobiology 6, 121-129

Hiasa, M., Miyaji, T., Haruna, Y., Takeuchi, T., Harada, Y., Moriyama, S., Yamamoto, A., Omote, H.,

and Moriyama, Y. (2014) Identification of a mammalian vesicular polyamine transporter. Scientific

Reports 4, 6836

16

28.

29.

van Veen, S., Martin, S., Van den Haute, C., Benoy, V., Lyons, J., Vanhoutte, R., Kahler, J. P.,

Decuypere, J.-P., Gelders, G., Lambie, E., Zielich, J., Swinnen, J. V., Annaert, W., Agostinis, P.,

Ghesquière, B., Verhelst, S., Baekelandt, V., Eggermont, J., and Vangheluwe, P. (2020) ATP13A2

deficiency disrupts lysosomal polyamine export. Nature 578, 419-424

Sørensen, D. M., Holemans, T., van Veen, S., Martin, S., Arslan, T., Haagendahl, I. W., Holen, H. W.,

Hamouda, N. N., Eggermont, J., Palmgren, M., and Vangheluwe, P. (2018) Parkinson disease related

ATP13A2 evolved early in animal evolution. PLoS One 13, 0193228

30.

31.

32.

Vanhoutte, R., Kahler, J. P., Martin, S., van Veen, S., and Verhelst, S. H. L. (2018) Clickable Polyamine

Derivatives as Chemical Probes for the Polyamine Transport System. ChemBioChem 19, 907-911

Saunders, N. A., Ilett, K. F., and Minchin, R. F. (1989) Pulmonary alveolar macrophages express a

polyamine transport system. Journal of Cellular Physiology 139, 624-631

Hammond, S., Kaplarevic, M., Borth, N., Betenbaugh, M. J., and Lee, K. H. (2012) Chinese hamster

genome database: An online resource for the CHO community at www.CHOgenome.org. Biotechnology

and Bioengineering 109, 1353-1356

33.

Schaum, N., Karkanias, J., Neff, N. F., May, A. P., Quake, S. R., Wyss-Coray, T., Darmanis, S., Batson,

J., Botvinnik, O., Chen, M. B., Chen, S., Green, F., Jones, R. C., Maynard, A., Penland, L., Pisco, A. O.,

Sit, R. V., Stanley, G. M., Webber, J. T., Zanini, F., Baghel, A. S., Bakerman, I., Bansal, I., Berdnik, D.,

Bilen, B., Brownfield, D., Cain, C., Chen, M. B., Chen, S., Cho, M., Cirolia, G., Conley, S. D., Darmanis,

S., Demers, A., Demir, K., de Morree, A., Divita, T., du Bois, H., Dulgeroff, L. B. T., Ebadi, H.,

Espinoza, F. H., Fish, M., Gan, Q., George, B. M., Gillich, A., Green, F., Genetiano, G., Gu, X., Gulati,

G. S., Hang, Y., Hosseinzadeh, S., Huang, A., Iram, T., Isobe, T., Ives, F., Jones, R. C., Kao, K. S.,

Karnam, G., Kershner, A. M., Kiss, B. M., Kong, W., Kumar, M. E., Lam, J. Y., Lee, D. P., Lee, S. E., Li,

G., Li, Q., Liu, L., Lo, A., Lu, W.-J., Manjunath, A., May, A. P., May, K. L., May, O. L., Maynard, A.,

McKay, M., Metzger, R. J., Mignardi, M., Min, D., Nabhan, A. N., Neff, N. F., Ng, K. M., Noh, J.,

Patkar, R., Peng, W. C., Penland, L., Puccinelli, R., Rulifson, E. J., Schaum, N., Sikandar, S. S., Sinha,

R., Sit, R. V., Szade, K., Tan, W., Tato, C., Tellez, K., Travaglini, K. J., Tropini, C., Waldburger, L., van

Weele, L. J., Wosczyna, M. N., Xiang, J., Xue, S., Youngyunpipatkul, J., Zanini, F., Zardeneta, M. E.,

Zhang, F., Zhou, L., Bansal, I., Chen, S., Cho, M., Cirolia, G., Darmanis, S., Demers, A., Divita, T.,

Ebadi, H., Genetiano, G., Green, F., Hosseinzadeh, S., Ives, F., Lo, A., May, A. P., Maynard, A., McKay,

M., Neff, N. F., Penland, L., Sit, R. V., Tan, W., Waldburger, L., Youngyunpipatkul, J., Batson, J.,

Botvinnik, O., Castro, P., Croote, D., Darmanis, S., DeRisi, J. L., Karkanias, J., Pisco, A. O., Stanley, G.

M., Webber, J. T., Zanini, F., Baghel, A. S., Bakerman, I., Batson, J., Bilen, B., Botvinnik, O.,

Brownfield, D., Chen, M. B., Darmanis, S., Demir, K., de Morree, A., Ebadi, H., Espinoza, F. H., Fish,

M., Gan, Q., George, B. M., Gillich, A., Gu, X., Gulati, G. S., Hang, Y., Huang, A., Iram, T., Isobe, T.,

Karnam, G., Kershner, A. M., Kiss, B. M., Kong, W., Kuo, C. S., Lam, J. Y., Lehallier, B., Li, G., Li, Q.,

Liu, L., Lu, W.-J., Min, D., Nabhan, A. N., Ng, K. M., Nguyen, P. K., Patkar, R., Peng, W. C., Penland,

L., Rulifson, E. J., Schaum, N., Sikandar, S. S., Sinha, R., Szade, K., Tan, S. Y., Tellez, K., Travaglini, K.

J., Tropini, C., van Weele, L. J., Wang, B. M., Wosczyna, M. N., Xiang, J., Yousef, H., Zhou, L., Batson,

J., Botvinnik, O., Chen, S., Darmanis, S., Green, F., May, A. P., Maynard, A., Pisco, A. O., Quake, S. R.,

Schaum, N., Stanley, G. M., Webber, J. T., Wyss-Coray, T., Zanini, F., Beachy, P. A., Chan, C. K. F., de

Morree, A., George, B. M., Gulati, G. S., Hang, Y., Huang, K. C., Iram, T., Isobe, T., Kershner, A. M.,

Kiss, B. M., Kong, W., Li, G., Li, Q., Liu, L., Lu, W.-J., Nabhan, A. N., Ng, K. M., Nguyen, P. K., Peng,

W. C., Rulifson, E. J., Schaum, N., Sikandar, S. S., Sinha, R., Szade, K., Travaglini, K. J., Tropini, C.,

Wang, B. M., Weinberg, K., Wosczyna, M. N., Wu, S. M., Yousef, H., Barres, B. A., Beachy, P. A.,

Chan, C. K. F., Clarke, M. F., Darmanis, S., Huang, K. C., Karkanias, J., Kim, S. K., Krasnow, M. A.,

Kumar, M. E., Kuo, C. S., May, A. P., Metzger, R. J., Neff, N. F., Nusse, R., Nguyen, P. K., Rando, T.

17

A., Sonnenburg, J., Wang, B. M., Weinberg, K., Weissman, I. L., Wu, S. M., Quake, S. R., Wyss-Coray,

T., The Tabula Muris, C., Overall, c., Logistical, c., Organ, c., processing, Library, p., sequencing,

Computational data, a., Cell type, a., Writing, g., Supplemental text writing, g., and Principal, i. (2018)

Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature 562, 367-372

34.

Uhlén, M., Fagerberg, L., Hallström, B. M., Lindskog, C., Oksvold, P., Mardinoglu, A., Sivertsson, Å.,

Kampf, C., Sjöstedt, E., Asplund, A., Olsson, I., Edlund, K., Lundberg, E., Navani, S., Szigyarto, C. A.-

K., Odeberg, J., Djureinovic, D., Takanen, J. O., Hober, S., Alm, T., Edqvist, P.-H., Berling, H., Tegel,

H., Mulder, J., Rockberg, J., Nilsson, P., Schwenk, J. M., Hamsten, M., von Feilitzen, K., Forsberg, M.,

Persson, L., Johansson, F., Zwahlen, M., von Heijne, G., Nielsen, J., and Pontén, F. (2015) Tissue-based

map of the human proteome. Science 347, 1260419. Database: Human Protein Atlas, available from

http://www.proteinatlas.org

35.

36.

Mayle, K. M., Le, A. M., and Kamei, D. T. (2012) The intracellular trafficking pathway of transferrin.

Biochim Biophys Acta 1820, 264-281

van Veen, S., Sørensen, D. M., Holemans, T., Holen, H. W., Palmgren, M. G., and Vangheluwe, P.

(2014) Cellular function and pathological role of ATP13A2 and related P-type transport ATPases in

Parkinson's disease and other neurological disorders. Frontiers in molecular neuroscience 7, 48-48

37.

38.

Loizides-Mangold, U. (2005) The antizyme family: Polyamines and beyond. IUBMB life 57, 671-676

Gamble, L. D., Purgato, S., Murray, J., Xiao, L., Yu, D. M. T., Hanssen, K. M., Giorgi, F. M., Carter, D.

R., Gifford, A. J., Valli, E., Milazzo, G., Kamili, A., Mayoh, C., Liu, B., Eden, G., Sarraf, S., Allan, S., Di

Giacomo, S., Flemming, C. L., Russell, A. J., Cheung, B. B., Oberthuer, A., London, W. B., Fischer, M.,

Trahair, T. N., Fletcher, J. I., Marshall, G. M., Ziegler, D. S., Hogarty, M. D., Burns, M. R., Perini, G.,

Norris, M. D., and Haber, M. (2019) Inhibition of polyamine synthesis and uptake reduces tumor

progression and prolongs survival in mouse models of neuroblastoma. Science Translational Medicine

11, eaau1099

39.

40.

Madan, M., Patel, A., Skruber, K., Geerts, D., Altomare, D. A., and Iv, O. P. (2016) ATP13A3 and

caveolin-1 as potential biomarkers for difluoromethylornithine-based therapies in pancreatic cancers. Am

J Cancer Res 6, 1231-1252

Gräf, S., Haimel, M., Bleda, M., Hadinnapola, C., Southgate, L., Li, W., Hodgson, J., Liu, B., Salmon, R.

M., Southwood, M., Machado, R. D., Martin, J. M., Treacy, C. M., Yates, K., Daugherty, L. C.,

Shamardina, O., Whitehorn, D., Holden, S., Aldred, M., Bogaard, H. J., Church, C., Coghlan, G.,

Condliffe, R., Corris, P. A., Danesino, C., Eyries, M., Gall, H., Ghio, S., Ghofrani, H.-A., Gibbs, J. S. R.,

Girerd, B., Houweling, A. C., Howard, L., Humbert, M., Kiely, D. G., Kovacs, G., MacKenzie Ross, R.

V., Moledina, S., Montani, D., Newnham, M., Olschewski, A., Olschewski, H., Peacock, A. J., Pepke-

Zaba, J., Prokopenko, I., Rhodes, C. J., Scelsi, L., Seeger, W., Soubrier, F., Stein, D. F., Suntharalingam,

J., Swietlik, E. M., Toshner, M. R., van Heel, D. A., Vonk Noordegraaf, A., Waisfisz, Q., Wharton, J.,

Wort, S. J., Ouwehand, W. H., Soranzo, N., Lawrie, A., Upton, P. D., Wilkins, M. R., Trembath, R. C.,

and Morrell, N. W. (2018) Identification of rare sequence variation underlying heritable pulmonary

arterial hypertension. Nature communications 9, 1416-1416

41.

Barozzi, C., Galletti, M., Tomasi, L., De Fanti, S., Palazzini, M., Manes, A., Sazzini, M., and Galiè, N.

(2019) A Combined Targeted and Whole Exome Sequencing Approach Identified Novel Candidate Genes

Involved in Heritable Pulmonary Arterial Hypertension. Scientific Reports 9, 753

18

42.

43.

Morrell, N. W., Aldred, M. A., Chung, W. K., Elliott, C. G., Nichols, W. C., Soubrier, F., Trembath, R.

C., and Loyd, J. E. (2019) Genetics and genomics of pulmonary arterial hypertension. The European

respiratory journal 53, 1801899

Di Fonzo, A., Chien, H. F., Socal, M., Giraudo, S., Tassorelli, C., Iliceto, G., Fabbrini, G., Marconi, R.,

Fincati, E., Abbruzzese, G., Marini, P., Squitieri, F., Horstink, M. W., Montagna, P., Libera, A. D.,

Stocchi, F., Goldwurm, S., Ferreira, J. J., Meco, G., Martignoni, E., Lopiano, L., Jardim, L. B., Oostra, B.

A., Barbosa, E. R., and Bonifati, V. (2007) ATP13A2 missense mutations in juvenile parkinsonism and

young onset Parkinson disease. Neurology 68, 1557

44.

45.

46.

Ramirez, A., Heimbach, A., Gründemann, J., Stiller, B., Hampshire, D., Cid, L. P., Goebel, I., Mubaidin,

A. F., Wriekat, A.-L., Roeper, J., Al-Din, A., Hillmer, A. M., Karsak, M., Liss, B., Woods, C. G.,

Behrens, M. I., and Kubisch, C. (2006) Hereditary parkinsonism with dementia is caused by mutations in

ATP13A2, encoding a lysosomal type 5 P-type ATPase. Nature Genetics 38, 1184-1191

Holemans, T., Sørensen, D. M., van Veen, S., Martin, S., Hermans, D., Kemmer, G. C., Van den Haute,

C., Baekelandt, V., Günther Pomorski, T., Agostinis, P., Wuytack, F., Palmgren, M., Eggermont, J., and

Vangheluwe, P. (2015) A lipid switch unlocks Parkinson's disease-associated ATP13A2. Proc Natl Acad

Sci U S A 112, 9040-9045

Gitler, A. D., Chesi, A., Geddie, M. L., Strathearn, K. E., Hamamichi, S., Hill, K. J., Caldwell, K. A.,

Caldwell, G. A., Cooper, A. A., Rochet, J.-C., and Lindquist, S. (2009) Alpha-synuclein is part of a

diverse and highly conserved interaction network that includes PARK9 and manganese toxicity. Nature

genetics 41, 308-315

47.

48.

49.

Martin, S., van Veen, S., Holemans, T., Demirsoy, S., van den Haute, C., Baekelandt, V., Agostinis, P.,

Eggermont, J., and Vangheluwe, P. (2016) Protection against Mitochondrial and Metal Toxicity Depends

on Functional Lipid Binding Sites in ATP13A2. Parkinson's disease 2016, 9531917-9531917

Rinaldi, D. E., Corradi, G. R., Cuesta, L. M., Adamo, H. P., and de Tezanos Pinto, F. (2015) The

Parkinson-associated human P5B-ATPase ATP13A2 protects against the iron-induced cytotoxicity.

Biochimica et Biophysica Acta (BBA) - Biomembranes 1848, 1646-1655

Schmidt, K., Wolfe, D. M., Stiller, B., and Pearce, D. A. (2009) Cd2+, Mn2+, Ni2+ and Se2+ toxicity to

Saccharomyces cerevisiae lacking YPK9p the orthologue of human ATP13A2. Biochemical and

Biophysical Research Communications 383, 198-202

50.

51.

52.

Das, K. C., and Misra, H. P. (2004) Hydroxyl radical scavenging and singlet oxygen quenching properties

of polyamines. Molecular and Cellular Biochemistry 262, 127-133

LØVaas, E. (1996) Antioxidative and Metal-Chelating Effects of Polyamines. in Advances in

Pharmacology (Sies, H. ed.), Academic Press. pp 119-149

Osório, L., Gijsbers, R., Oliveras-Salvá, M., Michiels, A., Debyser, Z., Van den Haute, C., and

Baekelandt, V. (2014) Viral vectors expressing a single microRNA-based short-hairpin RNA result in

potent gene silencing in vitro and in vivo. Journal of Biotechnology 169, 71-81

53.

Brown, A. J., Gibson, S., Hatton, D., and James, D. C. (2018) Transcriptome-Based Identification of the

Optimal Reference CHO Genes for Normalisation of qPCR Data. Biotechnology Journal 13, 1700259

19

54.

Dardonville, C., Fernandez-Fernandez, C., Gibbons, S.-L., Ryan, G. J., Jagerovic, N., Gabilondo, A. M.,

Meana, J. J., Callado, L. F., and Callado, L. F. (2006) Synthesis and pharmacological studies of new

hybrid derivatives of fentanyl active at the mu-opioid receptor and I2-imidazoline binding sites.

Bioorganic & medicinal chemistry 14, 6570-6580

55.

56.

Chan, E. W. C., Baek, P., Barker, D., and Travas-Sejdic, J. (2015) Highly functionalisable polythiophene

phenylenes. Polymer Chemistry 6, 7618-7629

Ning, Z., Hawley, B., Seebun, D., and Figeys, D. (2014) APols-Aided Protein Precipitation: A Rapid

Method for Concentrating Proteins for Proteomic Analysis. The Journal of Membrane Biology 247, 941-

947

57.

58.

Ning, Z., Seebun, D., Hawley, B., Chiang, C.-K., and Figeys, D. (2013) From Cells to Peptides: “One-

Stop” Integrated Proteomic Processing Using Amphipols. Journal of Proteome Research 12, 1512-1519

Cox, J., Hein, M. Y., Luber, C. A., Paron, I., Nagaraj, N., and Mann, M. (2014) Accurate Proteome-wide

Label-free Quantification by Delayed Normalization and Maximal Peptide Ratio Extraction, Termed

MaxLFQ. Molecular &amp; Cellular Proteomics 13, 2513

59.

60.

Cox, J., and Mann, M. (2008) MaxQuant enables high peptide identification rates, individualized p.p.b.-

range mass accuracies and proteome-wide protein quantification. Nature Biotechnology 26, 1367-1372

Tyanova, S., Temu, T., Sinitcyn, P., Carlson, A., Hein, M. Y., Geiger, T., Mann, M., and Cox, J. (2016)

The Perseus computational platform for comprehensive analysis of (prote)omics data. Nature Methods 13,

731-740

61.

62.

Andrews, S. (2010) FastQC: a quality control tool for high throughput sequence data.

Li, H., and Durbin, R. (2009) Fast and accurate short read alignment with Burrows-Wheeler transform.

Bioinformatics (Oxford, England) 25, 1754-1760

63.

64.

Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R.,

and Genome Project Data Processing, S. (2009) The Sequence Alignment/Map format and SAMtools.

Bioinformatics (Oxford, England) 25, 2078-2079

Poplin, R., Ruano-Rubio, V., DePristo, M. A., Fennell, T. J., Carneiro, M. O., Van der Auwera, G. A.,

Kling, D. E., Gauthier, L. D., Levy-Moonshine, A., Roazen, D., Shakir, K., Thibault, J., Chandran, S.,

Whelan, C., Lek, M., Gabriel, S., Daly, M. J., Neale, B., MacArthur, D. G., and Banks, E. (2018) Scaling

accurate genetic variant discovery to tens of thousands of samples. bioRxiv, 201178

65.

66.

McLaren, W., Gil, L., Hunt, S. E., Riat, H. S., Ritchie, G. R. S., Thormann, A., Flicek, P., and

Cunningham, F. (2016) The Ensembl Variant Effect Predictor. Genome Biol 17, 122

Perez-Riverol, Y., Csordas, A., Bai, J., Bernal-Llinares, M., Hewapathirana, S., Kundu, D. J., Inuganti,

A., Griss, J., Mayer, G., Eisenacher, M., Pérez, E., Uszkoreit, J., Pfeuffer, J., Sachsenberg, T., Yilmaz, S.,

Tiwary, S., Cox, J., Audain, E., Walzer, M., Jarnuczak, A. F., Ternent, T., Brazma, A., and Vizcaíno, J.

A. (2019) The PRIDE database and related tools and resources in 2019: improving support for

quantification data. Nucleic Acids Res 47, D442-D450

20

Gene

NCBI Accession Number

Primer Sequence

ATP13A1

XM_007638292.1

TCATCCTCACCTCGGTTGTA

ACACTGGGGTCACCTCTTTC

GCAGAAGACACATGGGAGGAC

CACCAGTAGCTGCAGGTAGGA

GGTGGCAACTCATAGTACCG

ACTGCATCACAAGGCATGA

CCAGAAAGTCTGGGATGGTT

AAGTCCCTTCTCTGCCGTTA

CTCTCGGGACAGAAACAAGC

GACCTACACTCATCTGGGCTAC

ATP13A2

ATP13A3

ATP13A4

FKBP1A*

XM_016963097.1

XM_007652544.2

XM_007648363.1

XM_003499952.2

Table 1. Gene accession numbers and primer sequences.

*Primer sequence was taken from (53).

21

Main Figure Legends

Figure 1. CHO-MG cells exhibit MGBG resistance and impaired BODIPY-PUT uptake. A, C, Cells were

treated for 24 h with the indicated concentrations of MGBG alone (A), or PUT with or without 50 µM MGBG (C).

CellTiter 96^®AQ_ueousOne Solution Cell Proliferation Assay (MTS) was used to assess cell viability and dose-

response curves were plotted (n=3). B, Cells were treated with 5 µM BODIPY-polyamines for 90 min at 37°C with

or without 90 min of 1 mM BV pre-treatment to inhibit polyamine uptake. Uptake was measured in terms of mean

fluorescence intensity (MFI) up to 1 x 10⁴events (debris-free) per condition on the flow cytometer (n=3). Data

represent mean ± SEM (A, C) or mean ± SD (B) and individual data points (representing replicates) are overlaid on

€€€€

bar graph plots (^€P<0.05, ****^{/€€€€}P<0.0001, **** vs CHO-WT(+MGBG) and

vs CHO-MG(+MGBG)).

Analyses were performed using two-way ANOVA and Bonferroni post hoc corrections. BODIPY, boron

dipyrromethene; BV, benzyl viologen; MGBG, methylglyoxal bis-(guanyl hydrazone); SPM, spermine; SPD,

spermidine; PUT, putrescine

22

Figure 2. ATP13A3 is downregulated in CHO-MG cells. A, ATP13A1-3 mRNA levels were measured with q-

RT-PCR using SYBR Green master mix (n=4). B, Protein expression of ATP13A3 was checked via proteomic

analysis (n=4). C, ATP13A3 topology model with the identified mutations in CHO-MG cells. Data represent mean

± SD (A,B) and individual data points (representing replicates) are overlaid on bar graph plots (*P<0.05, **P<0.01,

***P<0.001, and ****P<0.0001). Analyses were performed using one-way ANOVA and Bonferroni post hoc

corrections (A) and unpaired t-test (B). A1-A3, ATP13A1-3; FKBPA1, FKBP prolyl isomerase 1A; GAPDH,

Glyceraldehyde 3-phosphate dehydrogenase

23

Figure 3. Expression of wild-type ATP13A3 restores the CHO-MG phenotype. A, Stable cell lines were

generated by lentiviral transduction to overexpress wild type (A3-WT) or a catalytically dead mutant (A3-DN) of

ATP13A3. Expression of the viral vectors was verified by immunoblotting using an ATP13A3 selective antibody,

while the loading was monitored by a selective antibody of the house-keeping protein, GAPDH. B, Cells were

treated with 5 µM BODIPY-polyamines for 90 min at 37°C with or without 90 min of 1 mM BV pre-treatment to

inhibit polyamine uptake. Uptake was measured in terms of mean fluorescence intensity (MFI) up to 1 x 10⁴events

(debris-free) per condition on the flow cytometer (n=5-9). C, Cells were treated for 24 h with different doses of

MGBG. Cell viability was assessed using CellTiter 96^®AQ_ueousOne Solution Cell Proliferation Assay (MTS) and

dose-response curves were plotted (n=3). Data represent mean  SD (B) and individual data points (representing

replicates) are overlaid on bar graph plots, or mean  SEM (C) (****^{/€€€€}P<0.0001, ns= not significant, **** vs

€€€€

CHO-WT+A3-WT and

vs CHO-MG and CHO-MG+A3-DN). Analyses were performed using two-way

ANOVA and Bonferroni post hoc corrections. A3-WT, overexpression of wild type ATP13A3; A3-DN,

overexpression of ATP13A3 catalytically dead mutant D498N; BODIPY, boron dipyrromethene; BV, benzyl

viologen; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; MGBG, methylglyoxal bis-(guanyl hydrazone);

PUT, putrescine

24

Figure 4. Depletion of ATP13A3 in CHO-WT cells causes a CHO-MG phenotype. A, Stable cell lines were

generated by lentiviral transduction to knock down ATP13A3 in CHO-WT cells. Efficiency of the knockdown was

verified by at mRNA level with qPCR (n=3). B, Cells were treated with 5 µM BODIPY-polyamines for 90 min at

37°C with or without 90 min of 1 mM BV pre-treatment to inhibit polyamine uptake. Uptake was measured in terms

of mean fluorescence intensity (MFI) up to 1 x 10⁴events (debris-free) per condition on the flow cytometer (n=3).

C, Cells were treated for 24 h with different doses of MGBG. Cell viability was assessed using CellTiter 96^®AQ_ueous

One Solution Cell Proliferation Assay (MTS) and dose-response curves were plotted (n=3). Data represent mean 

SD (A, B) and individual data points (representing replicates) are overlaid on bar graph plots, or mean  SEM (C)

(*^/€P<0.05, **^/€€P<0.01, ***^/€€€P<0.001, ****^{/€€€€}P<0.0001, **** vs CHO-WT+A3-KD1 and ^€€€€vs CHO-WT+A3-

KD2). Analyses were performed using two-way ANOVA and Bonferroni post hoc corrections. A3, ATP13A3; A3-

KD, knockdown of ATP13A3; BODIPY, boron dipyrromethene; BV, benzyl viologen; FKBPA1, FKBP prolyl

isomerase 1A; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; MGBG, methylglyoxal bis-(guanyl

hydrazone); miR-fluc, expression of micro-RNA against firefly luciferase; PUT, putrescine

25

Figure 5. ATP13A3-dependent transport exhibits a broad specificity towards PUT, SPD and SPM. A-D, Cells

were treated with only 5 µM BODIPY-PUT, -SPD or -SPM (n=4) (A), or with 5 µM BODIPY-PUT combined with

different concentrations (1 µM, 5 µM, 10 µM or 50 µM) of MGBG (n=4) (B), non-fluorescent PUT (n=3-6) (C), or

non-fluorescent SPD/SPM (n=3) (D) for 90 min at 37°C. Uptake was measured in terms of mean fluorescence

intensity (MFI) up to 1 x 10⁴events (debris-free) per condition on the flow cytometer. E-G, Cells were treated for

26

72 h with the indicated concentrations of PUT (E), SPD (F), SPM (G) combined with 1 mM DFMO. CellTiter 96^®

AQ_ueousOne Solution Cell Proliferation Assay (MTS) was used to assess cell viability and dose–response curves

were plotted (n=3). Data represent mean  SD (A-D) and individual data points (representing replicates) are overlaid

on bar graph plots, or mean  SEM (E-G) (*P<0.05, **P<0.01, ***P<0.001, ****P <0.0001, and ns = not

significant). Analyses were performed using two-way ANOVA and Bonferroni post hoc corrections. A3-WT,

overexpression of wild type ATP13A3; A3-DN, overexpression of ATP13A3 catalytically dead mutant D498N;

BODIPY, boron dipyrromethene; BV, benzyl viologen; DFMO, difluoromethylornithine; MGBG, methylglyoxal

bis-(guanyl hydrazone); PUT, putrescine; SPD, spermidine; SPM, spermine

27

28

Figure 6. BODIPY-PUT is taken up via endocytosis. A, Cells were treated with 5 µM BODIPY-PUT for 90 min

at 37 °C with or without 30 min pre-treatment of 1 mM BV or endocytosis inhibitors (100 μM Dynasore, 50 μM

genistein and 50 μM Pitstop-2). Uptake was measured in terms of mean fluorescence intensity (MFI) up to 1 x 10⁴

events (debris-free) per condition on the flow cytometer (n=3-4). B, Cells were treated with BV or endocytosis

inhibitors, while being starved for 30 min. Afterward, they were incubated at 4°C for 15 min, treated with 50 µg/mL

Alexa647-transferrin for 20 min and incubated at 37°C, 5% CO₂for 15 min. Uptake was measured in terms of

mean fluorescence intensity (MFI) up to 1 x 10⁴events (debris-free) per condition on the flow cytometer (n=5). C,

E, Cells were treated with BODIPY-PUT for 90 min at 37°C with or without 30 min pre-treatment of 1 mM BV

and incubated with primary antibodies for EEA1, RAB11, RAB7 and LAMP1 (1:200) followed by staining with

Alexa Fluor 594 goat anti-rabbit antibody (1:1000) for 60 min and the nuclear stain DAPI (200 ng/mL) for 15 min

(n=3-5). Confocal microscopy images (scale bar = 20 μm; boxed areas are enlarged in the inset with scale bar = 5

μm) of BODIPY-PUT in CHO-WT  BV and CHO-MG (C), and BODIPY-PUT co-localization with endosomal

markers in CHO-MG (E) are shown. D, BODIPY-PUT, represented in C, was quantified by measuring the mean

fluorescence intensities (MFI) of BODIPY normalized to that of DAPI (CHO-WT+BODIPY-PUT = 29 images;

CHO-WT BODIPY-PUT+BV = 39 images; CHO-MG BODIPY-PUT = 25 images). F, Co-localization of

BODIPY-PUT with endosomal markers, demonstrated in E, was analyzed in terms of Pearson’s coefficient of

BODIPY-PUT with EEA1 (49 images), RAB11 (30 images), RAB7 (29 images) and LAMP1 (30 images). Data

represent mean  SD and individual data points (representing replicates) are overlaid on bar graph plots (**P<0.01,

***P<0.001, ****P <0.0001), generated with two-way ANOVA and Bonferroni post hoc corrections. A3-WT,

overexpression of wild type ATP13A3; A3-DN, overexpression of ATP13A3 catalytically dead mutant D498N;

BODIPY, boron dipyrromethene; BV, benzyl viologen; EEA1, early endosomal antigen 1; LAMP1, lysosomal-

associated membrane protein 1; PUT, putrescine; RAB7/11, ras-associated binding protein 7/11; A3-WT,

overexpression of wild type ATP13A3; A3-DN, overexpression of ATP13A3 catalytically dead mutant D498N

29

ATP13A3 is a major component of the enigmatic mammalian polyamine transport

system

Norin Nabil Hamouda, Chris Van den Haute, Roeland Vanhoutte, Ragna Sannerud,

Mujahid Azfar, Rupert Mayer, Álvaro Cortés Calabuig, Johannes V. Swinnen, Patrizia

Agostinis, Veerle Baekelandt, Wim Annaert, Francis Impens, Steven H. L. Verhelst, Jan

Eggermont, Shaun Martin and Peter Vangheluwe

J. Biol. Chem. published online December 11, 2020

Access the most updated version of this article at doi: 10.1074/jbc.RA120.013908

Alerts:

• When this article is cited

• When a correction for this article is posted

Click here to choose from all of JBC's e-mail alerts

Article Doi

ATP13A3 is a major component of the enigmatic mammalian polyamine transport system

DOI: 10.1074/jbc.RA120.013908

Source and publish data:

Authors:

Article abstract of DOI:10.1074/jbc.RA120.013908

Full text of DOI:10.1074/jbc.RA120.013908

Products guided by the article

R&D Labs maybe for 153207-76-2

Relevant to this article

Hot Product