Insight into the complete substrate-binding pocket of ThiT by chemical and genetic mutations

Article abstract of DOI:10.1039/c7md00079k

Energy-coupling factor (ECF) transporters are involved in the uptake of micronutrients in bacteria. The transporters capture the substrate by high-affinity binding proteins, the so-called S-components. Here, we present the analysis of two regions of the s

Full text of DOI:10.1039/c7md00079k

View Article Online
View Journal
MedChemComm
Accepted Manuscript
This article can be cited before page numbers have been issued, to do this please use: L. Swier, L.
Monjas, F. Reessing, R. Oudshoorn, A. Sachrap, T. Primke, M. M. Bakker, E. van Olst, T. Ritschel, I. Faustino,
S. J. Marrink, A. K. H. Hirsch and D. J. Slotboom, Med. Chem. Commun., 2017, DOI:
10.1039/C7MD00079K.
This is an Accepted Manuscript, which has been through the
Volume 7 Number 1 January 2016 Pages 1–204
Royal Society of Chemistry peer review process and has been
accepted for publication.
MedChemComm
Accepted Manuscripts are published online shortly after
acceptance, before technical editing, formatting and proof reading.
Broadening the field of opportunity for medicinal chemists
www.rsc.org/medchemcomm
Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. We will replace this Accepted Manuscript with the edited
and formatted Advance Article as soon as it is available.
You can find more information about Accepted Manuscripts in the
author guidelines.
Please note that technical editing may introduce minor changes
to the text and/or graphics, which may alter content. The journal’s
Themed issue: Antibiotic Resistance
ISSN 2040-2503
standard Terms & Conditions and the ethical guidelines, outlined
in our author and reviewer resource centre, still apply. In no
event shall the Royal Society of Chemistry be held responsible
for any errors or omissions in this Accepted Manuscript or any
consequences arising from the use of any information it contains.
rsc.li/medchemcomm

Please do not adjust margins
MedChemComm
Page 1 of 9
View Article Online
DOI: 10.1039/C7MD00079K
Journal Name
ARTICLE
Insight into the complete substrate-binding pocket of ThiT by
chemical and genetic mutations†‡
L. J. Y. M. Swier,§a L. Monjas,§b F. Reeßing,b R. C. Oudshoorn,a A. Sachrap,a T. Primke,a M. M.
Bakker,b E. van Olst,a T. Ritschel,c I. Faustino,a S. J. Marrink,a A. K. H. Hirsch*b and D. J. Slotboom*a
Received 00th January 20xx,
Accepted 00th January 20xx
DOI: 10.1039/x0xx00000x
Energy-coupling factor (ECF) transporters are involved in the uptake of micronutrients in bacteria. The transporters
capture the substrate by high-affinity binding proteins, the so-called S-components. Here, we present the analysis of two
regions of the substrate-binding pocket of the thiamine-specific S-component in Lactococcus lactis ThiT. First, interaction
of the thiazolium ring of thiamine with residues Trp34, His125 and Glu84 by π–π-stacking and cation-π is studied, and
second, the part of the binding pocket that extends from the hydroxyl group. We mutated either the transported ligand
(chemically) or the protein (genetically). Surprisingly, modifications in the thiazolium ring by introducing substituents with
opposite electronic effects had similar effects on the binding affinity. We hypothesize that the electronic effects are
superseeded by steric effects of the added substituents, which renders the study of isolated interactions difficult. Amino
acid substitutions in ThiT indicate that the electrostatic interaction facilitated by residue Glu84 of ThiT and thiamine is
necessary for picomolar affinity. Deazathiamine derivatives that explore the subpocket of the binding site extending from
the hydroxyl group of thiamine bind with high affinity to ThiT and may be developed into selective inhibitors of thiamine
transport by ECF transporters. Molecular-dynamics simulations suggest that two of these derivatives may not only bind to
ThiT, but could also be transported.
www.rsc.org/
component. Together with the two NBDs (known as EcfA and
EcfA’), EcfT forms the ECF module, also known as the
energizing module, which provides the energy and
Introduction
Energy-coupling factor (ECF) transporters belong to the family
of ATP-binding cassette (ABC) transporters.1–3 A common
feature among ABC transporters is their core structure,
consisting of two nucleotide-binding domains (NBDs) and two
transmembrane domains (TMDs). The NBDs bind and
hydrolyze ATP to ADP and Pi, and the energy released in this
process is used to drive transport of substrates across the
membrane. In classical ABC transporters, the TMDs are
identical or highly similar proteins and they form the
translocation pathway through the membrane. In the case of
ECF transporters, the two TMDs are completely unrelated. One
of them is called the S-component and binds the substrate
with very high affinity (in the low- to sub-nanomolar range).
The second TMD is called EcfT and is the domain that transfers
conformational changes between the NBDs and the S-
conformational changes for completing the transport cycle.
ECF transporters have only been identified in prokaryotes,
where they mediate the import of essential micronutrients
such as vitamins and their precursors, amino acids and the
transition metal ions Co2+ and Ni2+.4 Given that these
transporters are essential to many pathogenic bacteria that
lack biosynthetic routes to obtain these micronutrients,2,5 they
form a new target for the development of antibiotics. Over the
past decade, ECF transporters have been studied extensively,
and although some crystal structures of individual substrate-
bound S-components and full-length ECF transporters have
been reported, the knowledge about the mechanism of
substrate-binding and transport is still limited.
ThiT is the S-component for the transport of thiamine (1) in
Lactococcus lactis.6 The crystal structure of ThiT in complex
with thiamine (PDB ID: 3RLB)7 shows that thiamine interacts
with numerous residues lining the substrate-binding pocket
(Figure 1A): the aminopyrimidinyl moiety forms hydrogen
bonds with Glu84, His125, Tyr146 (via an ordered molecule of
water) and Asn151, as well as a π–π-stacking interaction with
Trp133; the thiazolium ring is involved in π–π-stacking and
cation–π interactions with Trp34 and His125; the positively
charged nitrogen atom of the same ring is forming an
electrostatic interaction with Glu84; and the hydroxyl group is
involved in a hydrogen bond with Tyr85.
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 1
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 2 of 9
View Article Online
DOI: 10.1039/C7MD00079K
ARTICLE
Journal Name
be crucial for substrate transport. The new compounds could
provide us with information about the mechanism of substrate
binding and transport. In addition, they hold the potential to
block thiamine transport and could therefore be developed
into antibiotics. We adopted a two-pronged approach in order
to obtain the new compounds: we performed de novo design
and used the KRIPO (Key Representation of Interactions in
POckets) software.11 This software creates a pharmacophore
fingerprint of the binding site to identify similar pockets in
unrelated proteins that are available in the PDB, resulting in
the proposal of the cocrystallized ligands as potential binders
of our protein of interest. Molecular-dynamics simulations
enabled us to predict whether binding of two of these new
compounds would induce conformational changes within ThiT.
Results and discussion
Chemical mutations
When the thiazolium ring of thiamine (
binding affinities of the thiamine derivatives changed: in the
case of a thiophenyl ring (compounds and ), the KD values
increased about 30-fold, and in the case of a phenyl ring
(compounds and ) about 2000- to 4000-fold in comparison
to thiamine (Figure 1B).9 In previously reported crystal
structures,9 we observed that the π–π-stacking interactions of
these aromatic rings with Trp34 were slightly different. In
order to understand these differences in affinity, we
investigated if the electronic properties of the aromatic ring
could be responsible for the differences observed in affinity.
1) was modified, the
2
3
Figure 1. A) Binding mode of thiamine in the binding pocket of ThiT
(PDB ID: 3RLB).7 Thiamine and the residues involved in binding are
shown in stick representation, with the following color code: C: green
(thiamine) and gray (ThiT), O: red, N: blue and S: yellow. This color
code will be maintained throughout the text. The red spheres
represent water molecules and the dashed lines indicate hydrogen
bonds (distance 2.7 to 3.1 Å) and an electrostatic interaction (distance
3.2 Å). This figure and other figures throughout the article were
5
6
generated with PyMOL.8 B) Structure of thiamine (
1
) and five of the
To do so, we designed two derivatives of compound
modifications in the phenyl ring based on the crystal structure
of ThiT in complex with this thiamine analogue ( ) (Figure 2A).
5 with
previously reported thiamine analogues
affinities for ThiT.6,9
(2–6) with their binding
5
In our previous work, we described the binding of thiamine
analogues with modifications in the thiazolium ring,
hydroxyethyl side chain and methyl group of the pyrimidinyl
ring, and we showed that ThiT still binds these designed
compounds with high affinity (Figure 1B).9,10 Here, we expand
the exploration of the binding site and rationalize ligand
binding to ThiT by chemical modification and amino acid
substitution in the ligand and in ThiT, respectively. We focused
on the interactions of two parts of the thiamine molecule with
ThiT. First, we explored the π–π-stacking interaction of the
thiazolium ring of thiamine with residues Trp34 and His125,
and the cation-π interaction with Glu84.
Second, we extended the scaffold of compounds
2 and 3
(Figure 1B) at the hydroxyl group. We chose this scaffold
because it lacks the positive charge present in thiamine.
Therefore, it may have lower chances of inhibiting human
thiamine binding proteins than compound
Even though compound binds more tightly to ThiT,
compounds and still have binding affinities in the low
4 (pyrithiamine).
4
2
3
Figure 2. A) Binding mode of compound
(PDB ID: 4N4D),9 shown as in Figure 1A, with the C atoms of
compound colored orange. The arrow indicates the potential
extension point. B) Chemical structure of compound , its derivatives
and and the triazole derivative
5 in the binding pocket of ThiT
nanomolar range. In addition, this scaffold is not charged,
which simplifies the synthesis and may provide access to more
selective compounds over other thiamine- or thiamine-
diphosphate-dependent proteins. This part of the substrate-
binding pocket of ThiT has not been explored before and may
5
5
7
8
9.
2 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 3 of 9
View Article Online
DOI: 10.1039/C7MD00079K
Journal Name
ARTICLE
Inspection of the binding mode of
5
in the pocket of ThiT binder than compound
5
, and the other one to be a weaker
(PDB ID: 4N4D)9 revealed that most of the interactions binder based on the different electronic properties of the new
observed for thiamine (PDB ID: 3RLB)7 are maintained (Figure aromatic substituents. Both compounds, however, turned out
2A vs Figure 1A). The only difference is that in compound
the phenyl ring has flipped over in such a way that the identical KD values of 1.99 ± 0.636 μ
hydroxymethyl substituent is pointing towards Asn151 and is and , respectively (the errors represent the standard
5,
to be weaker binders than compound
5, and displayed nearly
M
and 2.30 ± 1.81 μ
M
for 7
8
now forming a hydrogen bond with Asn151 instead of with deviation from four experiments). Therefore, electronic effects
Tyr85. In this way, there is space to extend the molecule in the cannot explain why a thiamine analogue bearing a thiophenyl
direction of Tyr85 (from the carbon atom highlighted with an ring binds stronger to ThiT than a phenyl derivative. Possibly,
arrow in Figure 2A), which is usually occupied by the steric effects of the substituents play an important role,
hydroxyethyl group of thiamine, thereby avoiding steric making it difficult to study one non-covalent interaction in
hindrance with the residues in the pocket. We introduced two isolation.
substituents with opposite electronic effects: an electron-
donating methyl group and an electron-withdrawing analogue bearing a triazolyl ring instead of the thiazolium ring
trifluoromethyl group (compounds and , Figure 2B). , Figure 2B). We synthesized compound following a
We synthesized compounds and
by following the same previously described route,12 and we determined the binding
route used to synthesize compound 59 with an additional step affinity of ThiT for compound
by ITC, yielding a KD value of
(Scheme 1). Commercially available aldehydes 10 and 11 were 28.6 ± 10.1 μ (the error represents the standard deviation
reduced to the corresponding alcohols using NaBH4, in 91% from three experiments). Taken together, we conclude that
and 87% yield for 12 and 13, respectively. Treatment with the high binding affinity of the thiophenyl derivatives and
To further study this effect, we designed a new thiamine
7
8
(
9
9
7
8
9
M
2
3
iPrMgCl to achieve the in situ protection of the hydroxyl group, are most likely ascribed to the sulfur atom, which engages in
followed by formylation, afforded aldehydes 14 and 15 in 65% favorable S–π interactions with the aromatic residues Trp34
and 66% yield, respectively. These aldehydes were condensed and His125.
with 3-anilinopropionitrile under basic conditions to form
enamines 16 and 17 in 28% and 13% yield, respectively. In the
Biochemical mutations
final step, reaction with acetamidine under basic conditions
Mutagenesis of four residues lining the binding site of ThiT
afforded the products
respectively.
7 and 8 in 87% and 30% yield,
(Trp34, Trp133, Tyr146 and Asn151), which are all involved in
the interactions with the pyrimidinyl ring of thiamine, had
been reported previously.6 Here, we are interested in the
residues that interact with the thiazolium ring of thiamine (1):
Trp34, Glu84 and His125 (Figure 1A). Previously, the Trp34Ala
mutant proved to affect binding only to a minimal extent
(Table 1).6 We now focused on the binding of thiamine to six
new ThiT mutants, in which we have modified residues Glu84
and His125 (Table 1).
Table 1. Binding affinities of different ThiT mutants for thiamine, with
the errors indicating the standard deviations.
Mutation
- (wild type)6
Trp34Ala6
Glu84Asp
Glu84Gln
KD ± S.D. (nM)
0.122 ± 0.013
0.35 ± 0.05
2.21 ± 0.78a
(13.6 ± 3.7)*103 b
(3.65 ± 1.71)*103 b
13.6 ± 8.1b
Glu84Ala
Scheme 1. Synthesis of compounds
7 and 8. Reagents and conditions:
His125Asn
His125Ala
His125Phe
a) NaBH4, MeOH, room temperature, 30–60 min, 91% (for compound
i
12) and 87% (for compound 13). b) i: PrMgCl, THF, 0 °C, 10 min, ii:
14.9 ± 5.1a
nBuLi, –78 to –40 °C, 1 h, iii: DMF, –78 °C to room temperature, 18 h,
no binding observed
a,b
a
The error represents the standard deviation obtained from 4 or 5
b
65% (for compound 14
anilinopropionitrile, NaOMe, DMSO, microwave, 100 W, 70 °C, 30 min,
28% (for compound 16 and 13% (for compound 17); d)
acetamidine·HCl, NaOMe, MeOH, reflux, 2 d, 87% (for compound
and 30% (for compound ).
) and 66% (for compound 15); c) 3-
experiments.
)
Glu84 forms an electrostatic interaction with the positively
7
)
charged nitrogen atom of the thiazolium ring of thiamine, as
well as hydrogen bonds with the amino group of the
pyrimidinyl ring and with His125 (Figure 1A). Replacing Glu84
by an aspartate shortens the amino acid side chain by one
carbon atom, possibly increasing the distance to thiamine and
8
We determined the binding affinities of ThiT for
compounds and by isothermal titration calorimetry (ITC).
7
8
We expected one of the new compounds to be a stronger
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 3
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 4 of 9
View Article Online
DOI: 10.1039/C7MD00079K
ARTICLE
Journal Name
thereby weakening the interaction, which could explain the compounds that extent into it may be selective for the S-
18-fold increase in KD value. However, when mutating into a component, and may not interact with human thiamine
glutamine or alanine, the interaction with thiamine becomes transporters or thiamine-dependent enzymes. Therefore, such
much weaker, leading to KD values in the micromolar range. compound could be the basis for development of new
These results highlight the importance of the negative charge antimicrobial agents.
on this residue and show that the resulting electrostatic
interaction with thiamine appears to be the main contributor
to the picomolar affinity.
Within the thiamine-binding site, the side chain of His125
can form cation–π and π–π-stacking interactions with the
thiazolium ring of thiamine as well as a hydrogen bond with
the carbonyl side chain of Glu84 (Figure 1A). In case of the
His125Asn mutant, the hydrogen bond with the carbonyl
group in the side chain of Glu84 can still be conserved, while
this hydrogen bond is disrupted in the His125Ala mutant. The
similar KD values for thiamine in both mutants (low-nanomolar
range), suggest little or no contribution of this hydrogen bond
Figure 3. Structure of ThiT in complex with thiamine (PDB ID: 3RLB).7
to substrate binding (Table 1). In both mutants the KD values
The surface of ThiT is shown in gray, with the surface of the loop L1
for thiamine are 100-fold higher compared to wild-type ThiT.
(residues Leu26–Ile39) shown in pale yellow and Trp34 shown in stick
The loss in affinity seems to be due to the disruption of the
representation to facilitate visualization of the substrate-binding
cation–π and π–π-stacking interactions with the thiazolium
pocket.
ring of thiamine. When mutating His125 to a phenylalanine, no
binding was observed. Compared to histidine, phenylalanine is
Design of thiamine derivatives to occupy the subpocket. In
unable to form hydrogen bonds. Besides, phenylalanine is
order to design compounds that would form additional
bigger and could partially occupy the thiazolium-binding
interactions with this subpocket, we used the software
pocket, thereby preventing thiamine from binding. We tried to
MOLOC14 for molecular modeling and the FlexX docking
confirm these hypotheses by structural characterization but
module15 and HYDE scoring function16,17 of the LeadIT suite to
co-crystallization attempts were unsuccessful.
predict binding poses and to estimate the Gibbs free energies
From these mutagenesis studies, we conclude that Glu84 is
of binding of such compounds. In our design, we maintained
very important for high-affinity binding. Modification of the
the thiophenyl ring of our previously reported best binders
interaction with Trp34 or His125 has a smaller effect, most
(compounds
2 and 3, Figure 1B). ThiT has high binding affinity
probably because these residues both form cation–π and π–π-
stacking interactions with the thiazolium ring, enabling one to
compensate for loss of interaction by the other one. These
results support the hypothesis that thiamine binds to ThiT with
high affinity when the loop L1 is ‘open’.13 As a result, even if
the π–π-stacking interaction with Trp34 stabilizes the ligand in
the substrate-binding pocket, the interaction is not crucial for
subnanomolar affinity given that His125 can form cation–π
and π–π-stacking interactions with the thiazolium ring as well.
When thiamine is bound and the loop L1 closes over the
substrate-binding pocket, Trp34 now participates in this
cation–π and π–π-stacking interaction network too, possibly
helping to keep the S-component in the closed state until it
has toppled over and substrate release on the other side of the
membrane is triggered.
for thiamine diphosphate (KD = 1.6 ± 0.0 nM),6 which carries
two additional phosphate groups at the end of the original
hydroxyethyl side chain of thiamine. When adding these
phosphate groups to our compound
diphosphate 18 (Figure 4), the binding affinity decreases 50-
fold compared to the affinity for compound , to a KD value of
3 to form deazathiamine
3
209 ± 98 nM (Table 2). This result suggests that extension of
the thiophenyl ring into the large subpocket is possible, and
even though we do not improve the affinity, the compounds
might interfere with transport and be more selective. Our first
approach to develop extended molecules with nanomolar
affinity was de novo design, by performing modeling and
docking using the crystal structure of ThiT in complex with its
natural substrate thiamine (1
) (PDB ID: 3RLB).7 Given that the
unexplored subpocket is rather big, we first investigated if one
aromatic ring would improve binding or interfere with the loop
L1. This led to the design of compounds 19 and 20 (Figure 4),
bearing a phenyl or an indolyl ring. These rings engage in π–π-
stacking interactions with Trp63 and Tyr85, or with Trp34,
respectively, as predicted by modeling and docking (Table 2,
ΔGest = –55 and –56 kJ mol–1, respectively). Careful visual
inspection revealed several small cavities in the pocket. In
order to expand into two of those cavities at the same time
within one molecule, we designed compound 21 (ΔGest = –
61 kJ mol–1).
Thiamine derivatives to explore an unoccupied subpocket
When we analyzed the substrate-binding pocket of ThiT, we
observed that the large pocket is only partially occupied by
thiamine and extends in the direction of the hydroxyethyl
substituent of thiamine (Figure 3). It is of interest to know
whether this empty subpocket plays an important role in
substrate transport, given that molecules occupying this part
of the substrate-binding pocket may block transport.
Considering that this subpocket is unique for ThiT, new
4 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 5 of 9
View Article Online
DOI: 10.1039/C7MD00079K
Journal Name
ARTICLE
NH2
N
In case of subpocket A, mainly hydrophobic fragments
were found, and we selected an adamantyl moiety as the best
fitting fragment. For subpocket B, we observed that a lot of
hits were heterocycles containing nitrogen atoms and sugar
moieties. As a result, we selected a pyridyl ring and a glucose
moiety as representative fragments. The search with
subpocket C led to a large variety of compounds, but when we
modeled and docked these compounds into ThiT, we observed
numerous repulsions with several residues. Therefore, we
decided to focus on subpockets A and B. Taking into account
the distance between our deazathiamine scaffold (compounds
R
N
S
O
P
O
P
O
O
O
O
O
18
O
Ph
H
N
O
Ph
O
Ph
R
NH
19
20
21
2
and 3) and the fragments identified by KRIPO, we designed
OH
synthetically accessible linkers, resulting in compound 22 (for
pocket A, ΔGest = –57 kJ mol–1) as well as compounds 23 and 24
(both for pocket B, with ΔGest = –48 and –59 kJ mol–1,
respectively) (Figure 4).
S
O
N
H
H
N
N
HO
OH
OH
24
22
23
Figure 4. Structure of deazathiamine diphosphate (18) and the
Synthesis. We synthesized the designed compounds 19
–24
compounds chosen to interact with the subpocket of ThiT obtained by
using and as starting materials, which were synthesized
2
3
following previously reported procedures.9 In all cases, we
performed the reactions once in order to obtain sufficient
amount of compounds for the biological evaluation and the
conditions are not optimized.
de novo design (19
–21) or by using KRIPO (22–24).
Table 2. Binding affinities of ThiT for compounds 18
–24, with the
errors indicated as standard deviations, together with the
experimental (ΔGexp) and the estimated Gibbs free energies of binding
(ΔGest). The estimated values are based on the scoring function HYDE.
We synthesized compounds 19 and 21
–23 starting from
compound 2 (Scheme 2). Reaction of 2 and benzyl bromide
using NaH afforded compound 19 in 27% yield (N-benzylated
ΔGexp
ΔGest
Compound
KD ± S.D. (nM)
and dibenzylated compounds were also obtained as side
(kJ mol–1)
(kJ mol–1)
products). Aldehyde 25 was obtained by oxidation of
MnO2, as previously described.9 This aldehyde was used for
the synthesis of compounds 21 23, which were synthesized by
2 with
18
19
20
21
22
23
24
209 ± 98a,e
40.3 ± 15.7a,c
20.1 ± 3.3a,c
–42
–44
–39
–25
–40
–38
–55
–56
–61
–57
–48
–59
–
reductive amination, using the corresponding amine followed
by treatment with NaBH4, in 32–66% yield.
168 ± 113a,d
(49.8 ± 27.3)*103 b,c
96.7 ± 23.7a,d
183 ± 17a,d
a
Binding affinity measured by intrinsic-protein-fluorescence titration
assay.
b Binding affinity measured by ITC.
c–e
d
The error represents the standard deviation obtained from c3, 4 or
e5 experiments.
With the aim of improving our initial design, we used the
software KRIPO11 to identify fragments that could bind with
high affinity in the unexplored subpocket. We performed three
individual searches with KRIPO by dividing the unoccupied part
of the pocket into three smaller subpockets (Figure 5).
Scheme 2. Synthesis of compounds 19 and 21–23, using 2 as starting
Figure 5. Pharmacophore features of the three small subpockets A, B
material. Reagents and conditions: a) i:NaH, DMF, room temperature,
1 h; ii: BnBr, DMF, room temperature, 1 h, 27%; b) MnO2, DMF, room
temperature, 2 h, 70%; c) i: amine = 2,2-diphenylethylamine (for 21),
and C within ThiT.
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 5
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 6 of 9
View Article Online
DOI: 10.1039/C7MD00079K
ARTICLE
Journal Name
1-adamantanemethylamine (for 22) or 2-(aminomethyl)pyridine (for structure remains stable when thiamine or 21 are bound.
23); DMF, MeOH, MgSO4, 60 °C, 20 h; ii: NaBH4, room temperature, 20 However, 22 generates changes in the conformation of ThiT
h, 61% (for 21), 32% (for 22), 66% (for 23).
with respect to the original crystal structure (PDB ID: 3RLB)
(Figure 6A). The same trend is observed when we look at the
We synthesized compounds 20 and 24 starting from RMSD variations of the ligands (Figure 6A). While thiamine and
deazathiamine (Scheme 3). For the synthesis of 21 show on average relative stability, 22 shows higher dynamic
compound 20, tosylation of as described to obtain tosylate behavior compared to thiamine and compound 21. These
26 18
followed by reaction of the resulting compound with results indicate that in the case of compound 22, both the
(3)
3
,
indole-3-carboxylic acid using 1,8-diazabicyclo[5.4.0]undec-7- protein and the ligand need some time to rearrange. In fact,
ene (DBU) and tetrabutylammonium iodide (TBAI), afforded 20 when we look at the dynamics of loops L1, L3 and L5 of ThiT
in 6% yield after purification by preparative HPLC. We (Figure 6B), we see some movement of loop L3 in the
synthesized the glucose derivative 24 using the same simulation of 22-bound ThiT. This observation can be
intermediate 26
,
by reaction with 1-thio-β-D-glucose explained by the fact that the adamantyl fragment mainly
tetraacetate, DBU and TBAI, which afforded compound 27 in interacts with residues in helix 3 (Trp63, Ser67), helix 4 (Glu84,
32% yield. After deprotection of the acetate groups under Tyr85) and loop L3 (His72, Ala73, Tyr74) (Figure 6C). Evaluation
basic conditions, we obtained compound 24 in 45% yield.
of the MD simulation suggests that the main difference after
40 ns is a conformational change of the side chain of Tyr74
moving away from 22. Interestingly, a conformational change
of this loop L3 plays a role during the transport cycle of the
ECF-FolT transporter for folate from Lactobacillus delbrueckii.19
The fact that it seems to be more difficult for 22 to
accommodate in the substrate-binding pocket of ThiT might
explain the weaker affinity of ThiT for this compound (KD value
in the upper micromolar range).
Scheme 3. Synthesis of compounds 20 and 24, using
material. Reagents and conditions: a) -TsCl, pyridine, 0 °C, 1 h, 73%;
b) indole-3-carboxylic acid, DBU, TBAI, CH3CN, room temperature, 3 d,
6%; c) 1-thio-β- -glucose tetraacetate, DBU, TBAI, CH3CN, room
3 as starting
p
D
temperature, 4 d, 32%; d) NaOMe, MeOH, room temperature, 17 h,
45%.
Binding-affinity determination. We determined the binding
affinities of ThiT for the new compounds by an intrinsic-
protein-fluorescence titration assay (compounds 18–21, 23
and 24) or by ITC (compound 22) (Table 2). Most of the
compounds bind to ThiT with high affinity, featuring KD values
in the nanomolar range, despite the large modifications
introduced with respect to the structure of thiamine. The
binding affinities observed experimentally, however, do not
match our prediction as well as in our previous work. A
possible explanation for the observed discrepancy is that upon
ligand binding, the explored subpockets may display greater
flexibility compared with the rigid thiamine-binding pocket.
Figure 6. A) Dynamics of ThiT and the bound ligands (thiamine (1):
black, 21: blue, 22: red), with RMSD variations of the backbone atoms
of ThiT and the ligand atoms plotted as a function of the simulation
time of 50 ns. B) Dynamics of the residues in loops L1 (black), L3 (red)
and L5 (blue), with the RMSD variations plotted as in A. C) Final
snapshot of simulation of 22 bound to ThiT, with the residues
predicted to be involved in hydrogen bonding with 22 shown in sticks.
The residues involved in interactions with the adamantyl moiety of 22
Molecular-dynamics simulations
.
We have performed
) and
molecular dynamics (MD) simulations of thiamine (
1
are indicated. D) Overlay of the most abundant poses of thiamine (1)-,
compounds 21 and 22 in the substrate-binding pocket of ThiT
to gain further insight into the ligand–protein interactions. We
observed that during the simulation time (50 ns), the protein
21- and 22-bound to ThiT observed during the simulations, shown in
ribbon representation and colored lime green, teal and gray,
6 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 7 of 9
View Article Online
DOI: 10.1039/C7MD00079K
Journal Name
ARTICLE
respectively. Compound 21 is shown in sticks and its carbon atoms are occupying the new subpocket and binds in the upper
colored dark teal. The loops L1, L3 and L5 are indicated.
micromolar range. It is remarkable that these extended
thiamine derivatives are still able to bind with such a high
In agreement with our predicted binding poses from affinity. Given that the concentration of thiamine in many
modeling and docking, compounds 21 and 22 display a similar natural environments of prokaryotes is rather low, it might be
binding mode in the simulations, maintaining the thiamine possible for the thiamine analogues to efficiently compete for
scaffold in the same conformation as in the case of the MD binding to the S-component, despite its lower affinity.
simulation and X-ray structure of thiamine. The new fragments
(two phenyl rings and one adamantyl moiety for 21 and 22
The MD simulations provided insight into the binding of 22
,
to ThiT, showing that ThiT has to be more flexible in order to
respectively) occupy the new subpocket (Figure 6C-D). We accommodate 22 in the binding pocket compared to the
have tried to confirm the binding pose of compound 21 by co- simulations with thiamine and 21 Comparing the
.
crystallizing of ThiT with this compound, but no crystals were superimposition, however, revealed no significant differences,
obtained. Co-crystallization have been performed with suggesting that the ECF-ThiT transporter should be able to
compounds 19
compounds 20 and 23 crystals have been obtained, which
diffracted up to 8 Å resolution. Attempts to improve this molecules into the new subpocket of ThiT, and we already
,
20,
23 and 24 too, but only in the case transport 22 into the cell.
To conclude, we have shown that it is possible to extend
resolution have not been successful.
obtained KD values in the nanomolar range for compounds
that explore this new pocket. These results show that with the
information on substrate binding and our workflow of design,
synthesis, biochemical evaluation and MD simulations of the
thiamine derivatives, we have obtained tools to successfully
extend thiamine derivatives in such a way that substrate
binding and probably transport are still possible. These tool
compounds, including the thiamine derivatives that we have
described, are useful for further studies on vitamin transport,
not only by ECF transporters but also by unrelated protein
families.20,21
Conclusions
The chemical modifications of thiamine indicate that the
electronic properties of the aromatic ring occupying the
thiazolium-binding pocket are not the only crucial factor for
high binding affinity, given that analogues bearing groups with
opposite electronic properties (compounds
nearly the same binding affinity for ThiT. The fact that these
compounds are bulkier than our reference compound cannot
7 and 8) display
5
be the only reason why their binding affinities decrease, given
that an analogue of thiamine bearing a triazolyl ring
Experimental part
(compound 9), also shows a binding affinity in the micromolar
range. Therefore, the sulfur atom of the thiophenyl ring Modeling and docking
(compounds and ) appears to be crucial for high-affinity
2
3
The crystal structure of ThiT in complex with thiamine (PDB ID:
3RLB) was used.7 Thiamine derivatives were designed by using
the program MOLOC,14 and the energy of the system was
minimized by use of the MAB force field implemented in this
software, while the protein coordinates and the
crystallographically localized water molecule (HOH196) were
kept fixed. Hydrogen bonds and hydrophobic interactions
were measured in MOLOC. The designed thiamine derivatives
were subsequently docked into the binding pocket of ThiT with
the aid of the FlexX docking module in the LeadIT suite.15
During docking, the binding site in the protein was restricted
binding, probably due to S–π interactions that it undergoes
with Trp34 and His125.
The amino acid substitutions in ThiT indicate that Glu84 is
crucial for high-affinity binding. We observed that when the
electrostatic interaction with the positively charged nitrogen
atom of thiamine is disrupted or weakened, the binding
affinity decreases by one to five orders of magnitude. This
result is consistent with the binding affinity of wild-type ThiT
for deazathiamine (3), in which the electrostatic interaction is
not possible either.9 His125 can, however, be replaced by
small residues without aromatic properties, although the
binding affinity decreases about 18-fold when the cation–π
and π–π-stacking interactions are abolished. To study if any
aromatic residue in this position would maintain the
subnanomolar affinity, we mutated His125 to a phenylalanine,
but no binding was observed, probably because phenylalanine
is bigger and does not allow thiamine to fit into the pocket.
We have shown that de novo design and the use of KRIPO
are efficient methods for the design of ligands for ThiT. The
new compounds were predicted to bind in the thiamine-
to 8.0 Å (for compounds 7–9) or to 12.5 Å (for compounds 19–
24) around the cocrystallized thiamine, the 30 top-scored
solutions were retained and subsequently post-scored with
the scoring function HYDE.16,17 After careful visualization to
exclude poses with significant inter- or intramolecular clash
terms or unfavorable conformations, the resulting solutions
were subsequently ranked according to their binding energies.
KRIPO search
binding pocket, and at the same time, the substituents were For the KRIPO search,11 the March 2013 version of the KRIPO
appended onto the deazathiamine scaffold to occupy a database of target–ligand complexes was used, which
subpocket of ThiT that had not been studied up to now. Most contained all protein–ligand complexes deposited in the PDB
of the novel compounds bind to ThiT in the nanomolar range, at that time. The pocket of ThiT was divided in three
except for compound 22 that has an adamantyl group
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 7
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 8 of 9
View Article Online
DOI: 10.1039/C7MD00079K
ARTICLE
Journal Name
subpockets, and the pharmacophore used by KRIPO in the converted to mutated pNZnHis ThiT plasmids using the vector
three queries consisted of the following features:
backbone exchange protocol in order to be used as expression
-Subpocket A: hydrophobic contacts from Phe22 and vectors in L. lactis.22
Leu26; negative charge from Glu38; hydrogen bond acceptors
from Ser25 (OH side chain and CO backbone), Glu38, Ser67, Table 3. Primers for mutagenesis of wild type ThiT, with the mutated
His72 (N imidazole side chain and CO backbone), Tyr74 and bases underlined.
Mutation
Glu84Asp
Glu84Gln
Glu84Ala
Forward primer
Reverse primer
Tyr85; and hydrogen bond donors from Trp63.
tcccaagctttccttgattatcttg
tcccaagctttccttcaatatcttg
tcccaagctttccttgcatatcttg
cttaaatactttttctttttcattgccggaattattttctg
gagcc
caagataatcaaggaaagcttggga
caagatattgaaggaaagcttggga
caagatatgcaaggaaagcttggga
ggctccagaaaataattccggcaatgaaaaagaaaa
agtatttaag
- Subpocket B: hydrophobic contacts from Trp63, Ala88
and Pro89; positive charge from Lys121; negative charge from
Glu38; hydrogen bond acceptors from Glu38, Ser67 and Glu85
(CO backbone); and aromatic interactions from Trp63, Tyr85
and His125.
His125Phe
His125Asn
His125Ala
cttaaatactttttcaatttcattgccggaattattttct
ggagcc
ggctccagaaaataattccggcaatgaaattgaaaa
agtatttaag
cttaaatactttttcgctttcattgccggaattattttct
ggagcc
ggctccagaaaataattccggcaatgaaagcgaaaa
agtatttaag
- Subpocket C: hydrophobic contacts from Trp34, Ile36,
Ile39, Ala40, Trp63 and Tyr74; negative charge from Glu38;
hydrogen bond acceptors from Ser25 (CO backbone) and
Tyr85; hydrogen bond donors from Asn29 and Ala47 (NH
backbone).
Expression and purification of wild-type ThiT and ThiT mutants
The expression and purification of substrate-free wild-type
ThiT and the ThiT mutants were performed as described
previously,9 with the cultivation and expression of the ThiT
mutants being performed semi-anaerobically in 2 L of
chemically defined medium23 without thiamine and
supplemented with glucose (2.0%, w/v) and chloramphenicol
(5 mg L–1) in a 3 L bioreactor (Applikon) instead of a 10 L
bioreactor.
Synthesis
General methods: All reagents were purchased from Sigma-
Aldrich, Acros Organics, TCI Europe or Fluorochem, and were
used without further purification unless noted otherwise. All
solvents were reagent-grade, and if necessary, dried and
distilled prior to use. All reactions were carried out under a
nitrogen atmosphere (if not otherwise indicated), with use of
dried glassware. Reactions were monitored either by GC-MS
(GCMS-QP2010 Shimadzu) with a HP-5 column (Agilent
Technologies) or by thin-layer chromatography (TLC) on silica-
gel-coated aluminum foils (silica gel 60/Kieselguhr F254,
Merck). Flash-column chromatography was performed on silica
gel (SiliCycle 40–63 μm). Melting points were determined with
a Büchi B-545 apparatus. NMR spectra were recorded on a
Varian AMX400 spectrometer at 25 °C. Chemical shifts (δ) are
reported in ppm relative to the residual solvent peak. Splitting
patterns are indicated as (s) singlet, (d) doublet, (t) triplet, (q)
quartet, (m) multiplet and (br) broad. Coupling constants (J)
are reported in Hertz (Hz). FT-IR spectra (neat) were recorded
on a Perkin Elmer FT-IR spectrometer. High-resolution mass
spectra (HRMS) were recorded on a Thermo Scientific LTQ
Binding-affinity determination
For compounds 18
determined using the intrinsic-protein-fluorescence titration
assay described previously,9 with 50 n
of ThiT in a final
volume of 1000 µL of buffer (KPi (pH 7.0, 50 m ), KCl (150
), n-decyl-β- -maltopyranoside (DM, Anatrace, 0.15%,
w/v)). For compounds and 22, as well as for the ThiT
mutants, the binding affinity was determined by ITC as
described previously10 with 4.80–26.0 µ
of ThiT. Various
–21, 23 and 24, the binding affinity was
M
M
m
M
D
7, 8, 9
M
concentrations of the compounds, or thiamine in case of the
ThiT mutants, were added in steps of 1 µL (Table 4), while
maintaining equal volume percentages of DMSO in both the
protein and the substrate solution when determining the
binding affinities for the compounds.
Orbitrap-XL mass spectrometer. Compounds 2 9 3 9 9 12 259
, , ,
Table 4. Conditions under which ITC measurements were performed.
and 2618 were synthesized according to reported procedures
and their spectroscopic data are in agreement. Compound 18
was kindly provided by Prof. F. J. Leeper (University of
Cambridge, UK) and it was synthesized according to a reported
procedure.18 Details of the synthesis and characterization of
[substrate]:
Compound/
mutation
[protein]
(µ
[substrate]
(µ
[protein]
ratio
M
)
M)
7
9.02–14.7
10.2–16.8
3.54–9.42
16.1
250–375
204–322
354–952
1.67*103
9.6–120
806–1.38*103
200–350
162–974
121–260
95.2–140
20–30
20
8
compounds 7, 8, 19–24 and their intermediates are described
9
100–101
103
in the Electronic Supplementary Information.
22
Glu84Asp
Glu84Gln
Glu84Ala
His125Phe
His125Asn
His125Ala
4.80–9.04
8.06–13.8
6.19–10.7
9.48–16.2
12.1–26.0
9.28–9.52
2–13.3
100
Mutagenesis of wild-type ThiT
20–35
10–100
10
For cloning and mutagenesis purposes, the gene encoding ThiT
was placed in the pREnHis plasmid containing an N-terminal
His8-tag.6 In order to introduce the desired mutations, site-
directed mutagenesis was performed with the primers given in
Table 3. After verification by DNA sequencing (Seqlab and
GATC, Germany), the mutated pREnHis ThiT plasmids were
10–15.1
Molecular-dynamics simulations
8 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
MedChemComm
Page 9 of 9
View Article Online
DOI: 10.1039/C7MD00079K
Journal Name
ARTICLE
3
4
D. J. Slotboom, Nat. Rev. Microbiol., 2014, 12, 79–87.
T. Eitinger, D. A. Rodionov, M. Grote and E. Schneider,
FEMS Microbiol. Rev., 2011, 35, 3–67.
C. T. Jurgenson, T. P. Begley and S. E. Ealick, Annu. Rev.
Biochem., 2009, 78, 569–603.
G. B. Erkens and D. J. Slotboom, Biochemistry, 2010, 49
Atomistic MD simulations were performed with three ThiT
ligands (thiamine (1), 21 and 22). The X-ray structure PDB ID:
3RLB (thiamine) and the predicted docking binding poses of
compounds 21 and 22 were used as initial structures and
embedded in a lipid bilayer. To this purpose, the CHARMM
Membrane Builder GUI24 was used to build the systems and
5
6
7
,
3203–3212.
G. B. Erkens, R. P.-A. Berntsson, F. Fulyani, M.
Majsnerowska, A. Vujičić-Žagar, J. ter Beek, B. Poolman and
D. J. Slotboom, Nat. Struct. Mol. Biol., 2011, 18, 755–760.
W. L. DeLano, 2002, http://www.pymol.org.
L. J. Y. M. Swier, L. Monjas, A. Guskov, A. R. de Voogd, G. B.
Erkens, D. J. Slotboom and A. K. H. Hirsch, ChemBioChem,
2015, 16, 819–826.
L. Monjas, L. J. Y. M. Swier, A. R. de Voogd, R. C.
Oudshoorn, A. K. H. Hirsch and D. J. Slotboom, Med. Chem.
Commun., 2016, 7, 966–971.
converted
to
the
AMBER
format
using
the
charmmlipid2amber.x script.25 The lipid bilayer was composed
of 150 1-palmitoyl-2-oleoylphosphatidylcholine (POPC) lipids
8
9
and the systems used TIP3P26 water model and had 0.15
M
NaCl concentration added to the water layer. The ligands were
parameterized using the GAFF force field and the antechamber
module included the AmberTools package (version 15).27,28 The
prepared systems were minimized and equilibrated by initially
fixing the coordinates of the complex (10 kcal/mol/Å) and
reducing the constraints gradually until complete relaxation.29
Both the equilibration and production phases were run with
AMBER1425 using the NPT ensemble (1 atm, 303 K) with
periodic boundary conditions and the Langevin thermostat and
semi-isotropic pressure scaling. Bonds involving hydrogens
were constrained using the SHAKE algorithm30, allowing a 2 fs
time step. PME was used to account for the electrostatic
interactions beyond a cutoff of 10 Å.
10
11
12
13
D. J. Wood, J. de Vlieg, M. Wagener and T. Ritschel, J.
Chem. Inf. Model., 2012, 52, 2031–2043.
K. M. Erixon, C. L. Dabalos and F. J. Leeper, Org. Biomol.
Chem., 2008, 6, 3561–3572.
M. Majsnerowska, I. Hänelt, D. Wunnicke, L. V. Schäfer, H.
J. Steinhoff and D. J. Slotboom, Structure, 2013, 21, 861–
867.
P. R. Gerber and K. Müller, J. Comput.-Aided Mol. Des.,
1995, 9, 251–268.
LeadIT (version 2.1.8). BioSolveIT GmbH, An Der Ziegelei
79, 53757 St. Augustin, Germany. 2014.
I. Reulecke, G. Lange, J. Albrecht, R. Klein and M. Rarey,
14
15
16
17
ChemMedChem, 2008, 3, 885–897.
Acknowledgements
N. Schneider, S. Hindle, G. Lange, R. Klein, J. Albrecht, H.
Briem, K. Beyer, H. Claußen, M. Gastreich, C. Lemmen and
M. Rarey, J. Comput.-Aided Mol. Des., 2012, 26, 701–723.
S. Mann, C. Perez Melero, D. Hawksley and F. J. Leeper,
The authors acknowledge Prof. F. J. Leeper (University of
Cambridge, UK) for providing compound 18. The research
leading to these results has received funding from the
European Community's Seventh Framework Programme
(FP7/2007-2013) under BioStruct-X (grant agreement no.
283570), the Ministry of Education, Culture and Science
(Gravitation program 024.001.035), the Netherlands
18
19
20
Org. Biomol. Chem., 2004,
L. J. Y. M. Swier, A. Guskov and D. J. Slotboom, Nat.
Commun., 2016, , 11072.
2, 1732–1741.
7
H. J. Genee, A. P. Bali, S. D. Petersen, S. Siedler, M. T.
Bonde, L. S. Gronenberg, M. Kristensen, S. J. Harrison and
M. O. A. Sommer, Nat. Chem. Biol., 2016, 12, 1015.
M. Jaehme and D. J. Slotboom, Biochim. Biophys. Acta,
2015, 1850, 565–576.
E. R. Geertsma and B. Poolman, Nat. Methods, 2007, 4,
705–707.
R. P.-A. Berntsson, N. Alia Oktaviani, F. Fusetti, A.-M. W. H.
Thunnissen, B. Poolman and D. J. Slotboom, Protein Sci.,
2009, 18, 1121–1127.
Organisation for Scientific Research (NWO) (NWO ChemThem 21
grant 728.011.104, NWO Vidi grant 723.014.008 and NWO Vici
22
grant 865.11.001) and the European Research Council (ERC)
(ERC Starting Grant 282083).
23
Author contributions
24
S. Jo, J. B. Lim, J. B. Klauda and W. Im, Biophys. J., 2009, 97
50–58.
,
L.J.Y.M.S, L.M., A.K.H.H and D.J.S. designed the experiments.
L.M., F.R. and M.M.B performed modeling, docking and
synthesis. L.J.Y.M.S., A.S. and R.C.O. performed mutagenesis
experiments. L.J.Y.M.S., R.C.O., A.S., T.P. and E.O. performed
protein expression and purification, and determination of
binding affinities. T.R. performed the KRIPO search. I.F. and
S.J.M. performed MD simulations. L.J.Y.M.S, L.M., A.K.H.H. and
D.J.S. analyzed the data and wrote the manuscript.
25
26
D.A. Case et al., AMBER14, Univ. California, S. F.
W. L. Jorgensen, J. Chandrasekhar, J. D. Madura, R. W.
Impey and M. L. Klein, J. Chem. Phys., 1983, 79, 926–935.
J. Wang, W. Wang, P. A. Kollman and D. A. Case, J. Mol.
Graph. Model., 2006, 25, 247–260.
J. Wang, R. M. Wolf, J. W. Caldwell, P. A. Kollman and D. A.
Case, J. Comput. Chem., 2004, 25, 1157–1174.
C. J. Dickson, B. D. Madej, A. A. Skjevik, R. M. Betz, K.
Teigen, I. R. Gould and R. C. Walker, J. Chem. Theory
Comput., 2014, 10, 865–879.
27
28
29
30
J.-P. Ryckaert, G. Ciccotti and H. J. . Berendsen, J. Comput.
Phys., 1977, 23, 327–341.
References
1
D. A. Rodionov, P. Hebbeln, M. S. Gelfand and T. Eitinger, J.
Bacteriol., 2006, 188, 317–327.
2
D. A. Rodionov, P. Hebbeln, A. Eudes, J. ter Beek, I. A.
Rodionova, G. B. Erkens, D. J. Slotboom, M. S. Gelfand, A. L.
Osterman, A. D. Hanson and T. Eitinger, J. Bacteriol., 2009,
91, 42–51.
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 9
Please do not adjust margins