Salivary aldehyde dehydrogenase: Activity towards aromatic aldehydes and comparison with recombinant ALDH3A1

Article abstract of DOI:10.3390/molecules14072363

A series of aromatic aldehydes was examined as substrates for salivary aldehyde dehydrogenase (sALDH) and the recombinant ALDH3A1. Para-substituted benzaldehydes, cinnamic aldehyde and 2-naphthaldehydes were found to be excellent substrates, and kinetic p

Full text of DOI:10.3390/molecules14072363

Molecules 2009, 14, 2363-2372; doi:10.3390/molecules14072363
OPEN ACCESS
molecules
ISSN 1420-3049
www.mdpi.com/journal/molecules
Article
Salivary Aldehyde Dehydrogenase: Activity towards Aromatic
Aldehydes and Comparison with Recombinant ALDH3A1
Joanna Giebułtowicz 1, Renata Wolinowska 2, Anna Sztybor 3, Monika Pietrzak 3, Piotr
Wroczyński 1 and Jacek Wierzchowski 3,*
1
Department of Drugs Analysis, Faculty of Pharmacy, Medical University of Warsaw, 1 Banacha
Street, PL-02-097, Warsaw, Poland; E-mail: joanna.giebultowicz@gmail.com (J.G.)
2
Department of Pharmaceutical Microbiology, Faculty of Pharmacy, Medical University of Warsaw,
3 Oczki Street, PL-02-007, Warsaw, Poland; E-mail: rwolinowska@wum.edu.pl (R.W.)
3
Department of Biophysics, University of Warmia and Mazury, 4 Oczapowskiego St., PL-10-719
Olsztyn, Poland
* Author to whom correspondence should be addressed; E-mail: jacek.wie@uwm.edu.pl;
Tel. +48-89-523-3324; Fax: +48-89-523-3408
Received: 11 May 2009; in revised form: 15 June 2009 / Accepted: 18 June 2009 /
Published: 2 July 2009
Abstract: A series of aromatic aldehydes was examined as substrates for salivary aldehyde
dehydrogenase (sALDH) and the recombinant ALDH3A1. Para-substituted benzaldehydes,
cinnamic aldehyde and 2-naphthaldehydes were found to be excellent substrates, and
kinetic parameters for both salivary and recombinant ALDH were nearly identical. It was
demonstrated that for the fluorogenic naphthaldehydes the only produced reaction product
after incubation in saliva is the carboxylate.
Keywords: saliva; aldehyde dehydrogenase; enzyme kinetics; aromatic aldehydes
1. Introduction
Human saliva exhibits significant activity of many detoxifying enzymes, including aldehyde
dehydrogenase (ALDH, E.C.1.2.1.3, cf. Scheme 1), which presumably protects the organism from
various aldehydes contained in food either as natural ingredients or as contaminants [1-4]. Salivary
aldehyde dehydrogenase probably consists of one isozyme, classified as ALDH3A1 [4,5], virtually

Molecules 2009, 14
2364
inactive toward acetaldehyde, but active toward aromatic and long aliphatic aldehydes, including the
most toxic 4-hydroxy-2-nonenal [5-8], formed during the process of lipid autooxidation. This dimeric
isozyme is selectively expressed in various human organs, the highest activities found in eye cornea,
stomach and lungs [9]. Occasionally, it undergoes overexpression in neoplastic tissues [5,10], leading
to increased resistance to oxazaphosphorine chemotherapy [11]. Still another ALDH isozyme, known
as ALDH6 or ALDH1A3, which is tetrameric, has been found in the salivary glands [12,13], but its
participation in the salivary ALDH activity remains uncertain.
Substrate specificity of the recombinant human ALDH3A1 has been previously studied by Pappa et
al. [14], who indicated benzaldehyde as the best substrate (in terms of Vmax), and saturated aliphatic
aldehydes as exhibiting the highest Vmax/Km values, due to very low Km. However, no aromatic
aldehydes, except for benzaldehyde, were examined.
We have previously shown that some highly fluorogenic aromatic aldehydes, particularly
substituted 2-naphthaldehydes, are excellent substrates for salivary ALDH [15-16], allowing sensitive
fluorimetric detection of its activity, applicable for population studies [17,18]. These investigations are
important due to known variability of the salivary ALDH activity [18], and may be useful for food
safety and nutrition research. We presently compare salivary ALDH activity towards a series of
aromatic aldehydes (Scheme 1), including those known as food components, with that of the
recombinant ALDH3A1 enzyme, with the aim of identifying isozyme(s) responsible for the salivary
activity and to further characterize their substrate preferences.
An additional goal of this work was to check the validity and specificity of the naphthaldehyde-
based fluorimetric assay of the ALDH activity [15], in particular with a view to application in human
saliva studies. We here address two questions, related to saliva reaction with the naphthaldehydes: (a)
are there any other fluorescent products of the reaction except the carboxylates; and (b), do the
reaction kinetics agree with that of the purified ALDH3A1.
Scheme 1. Enzymatic oxidation of aryl aldehydes, catalyzed by ALDH.
CONH2
CONH2
O
ALDH
O
+
O
+
+
H
+H2O,- 2H+
Ar
N
Ar
N
rppA
rppA
2. Results and Discussion
2.1. Salivary ALDH activity – apparent kinetics and product analysis
As shown previously, human saliva is able to oxidize a variety of aromatic aldehydes, like
benzaldehyde, and various naphthaldehyde derivatives [16], and this activity has been ascribed to a
dimeric ALDH3A1 isozyme [1,5]. The aromatic substrates, particularly highly fluorogenic 2-
naphthaldehydes, like 6-methoxy-2-naphthaldehyde (MONAL) and 6-dimethylamino-2-
naphthaldehyde (DANAL), have been previously reported as excellent salivary ALDH substrates
[15,16]. Their oxidation was characterized by submicromolar or low micromolar apparent Km values
[16], and high catalytic constants, comparable to that of benzaldehyde (see Table 1). In contrast,

Molecules 2009, 14
2365
1-naphthaldehydes were almost completely inactive [16], although they occasionally reacted
chemically with saliva. Benzaldehyde and its derivatives are also good substrates for salivary ALDH,
and their oxidation can be followed using the increase of the NADH fluorescence at 460 nm. Using
this method, we have found that both anisaldehyde (4-methoxybenzaldehyde) and cinnamic aldehyde
(trans-3-phenylacrylaldehyde) are excellent substrates for salivary ALDH (see Table 1), with the latter
compound exhibiting a catalytic constant (kcat) almost twice as large as that for benzaldehyde.
To cross-check the validity of the foregoing results, obtained using fluorimetric method with crude,
diluted saliva [13,15], we analyzed products of MONAL transformation by saliva samples in the
presence of 100 μM NAD+ using HPLC with fluorimetric detection. A typical HPLC profile of the
reaction mixture after 5-20 min of reaction at 25°C, recorded using a fluorescence detector, is
presented in Figure 1. It is evident that the carboxylate is the only fluorescent product of this reaction
and its concentration linearly depends on reaction time, thus supporting our previous kinetic analysis.
Further support comes from comparison of the kinetic parameters obtained for reactions catalyzed by
salivary ALDH and purified recombinant ALDH3A1 (see next section).
Figure 1. HPLC elution profiles for oxidation of aromatic aldehydes with salivary ALDH,
recorded with fluorimetric detector at 360 nm, with excitation at 315 nm. Reaction time
was 5 (lowest curve), 10, 15 and 20 minutes (----).
2.2. Kinetic properties of ALDH3A1 towards aromatic aldehydes – comparison with salivary ALDH
The kinetic oxidation parameters of several aldehydes by the recombinant ALDH3A1 have been
determined using fluorimetric and/or spectrophotometric methods. The purified enzyme has been
found active towards a series of para-substituted benzaldehydes and 2-naphthaldehydes, but was
virtually inactive towards substituted 1-naphthaldehydes. Comparison of kinetic parameters estimated
for the recombinant enzyme and salivary ALDH is shown in Table 1.
The most interesting are the submicromolar Km values for enzymatic oxidation of 2-naphthaldehyde
and MONAL. Such low Km values, previously reported for the same, and isomeric naphthaldehydes
oxidized by ALDH1A1 from the erythrocytes and human liver [19], and recently for oxidation of

Molecules 2009, 14
2366
pyrene aldehydes with ALDH3A1 [20], are hardly measurable using standard spectrophotometric
procedures, but may be estimated from reaction progress curves with variable initial concentration of
the substrate (cf. Figures 2 and 3), thanks to highly fluorogenic behaviour of the naphthaldehydes [15].
It is evident that aromatic aldehydes, particularly those with extended aromatic systems and/or
electron donating substituents, bind tightly to the enzyme and are effectively oxidized. The best
substrates are cinnamic aldehyde, with a Vmax twice as large as that for benzaldehyde, and 2-
naphthaldehyde, exhibiting the highest Vmax/Km. There is considerable selectivity in substrate
geometry, since various substituted 1-naphthaldehydes are not oxidized, and 1-naphthaldehyde is
oxidized very slowly (Table 1), undoubtedly due to steric factors within the binding site. By contrast,
long aliphatic unsaturated aldehydes, like trans-hexenal, trans-octenal, and acrolein, which are good
substrates for ALDH3A1, are characterized by much higher Km values, typically >100 μM [14].
Kinetic parameters of the reaction, particularly Km values, obtained for ALDH3A1, are virtually
identical to those previously measured for salivary ALDH [16,18], thus confirming that at least in
relation to aromatic aldehydes, the salivary ALDH activity is exclusively due to the ALDH3A1
isozyme. This also constitutes final proof of the validity of the fluorimetric method of the salivary
ALDH detection, based on oxidation of the fluorogenic naphthaldehydes [15-18].
Table 1. Kinetic parameters, determined spectrophotometrically or fluorimetrically, for
enzymatic oxidation of aromatic aldehydes by recombinant ALDH3A1, compared to those
for salivary ALDH. Maximal rates are measured relative to that of benzaldehyde (100).
Recombinant ALDH3A1 salivary ALDH
Aldehyde
Km
Vmax
Km
Vmax
obs [nm]
[μM]
[relative]
[μM]
[relative] (Δ [M-1cm-
1])
Benzaldehyde
4-methoxybenzaldehyde
(anisaldehyde)
148
19
100
73
160a
nd
100
~45
340 (6,200)
340 (6,200)
4-
4.2
155
6
8
6
nd
nd
nd
nd
nd
350 (-22,000)
310 (-7,000)
340 (6,200)
dimethylaminobenzaldehyde
4-hydroxy-3-methoxy-
benzaldehyde (vanillin)
cinnamic aldehyde
160
190
2-naphthaldehyde
6-methoxy-2-naphthaldehyde
(MONAL)
6-dimethylamino-2-
naphthaldehyde (DANAL)
1-naphthaldehyde
4-methoxy-1-naphthaldehyde
4-dimethylamino-1-
naphthaldehyde
0.4
0.16
101
47
0.46a
105
52
330 (3,900)
315 (-7,600)
0.2a
~20
~21
7.2a
21a
380 (-11,000)
nd
-
-
~1.5
<1
<1
-
-
-
<25b
<8a
320 (-4,000)
360 (-9,000)
400 (-10,000)
<9a
7-methoxy-1-naphthaldehyde
-
<1
-
<1a
360 (-4,000)
a
b
Data from refs [13,15], determined fluorimetrically, cross-checked in this work; This substrate
reacted chemically with saliva constituents giving unstable fluorescence background.

Molecules 2009, 14
Figure 2. Reaction progress curves, recorded fluorimetrically, for enzymatic oxidation of
2367
2-naphthaldehde (left) and MONAL (right) with the recombinant ALDH3A1 as catalyst.
Initial naphthaldehyde concentrations were 5, 2 and 1 μM. Concentration of NAD+ was
100 μM.
5
4
3
2
1
0
5
4
3
2
1
0
0
100
200
300
400
500
600
0
100
200
300
time [s]
time [s]
Figure 3. The Lineweaver-Burk plot for the enzymatic oxidation of 2 μM MONAL
catalyzed by the recombinant ALDH3A1. Rates were obtained by numerical differentiation
of the progress curve from Fig. 2. The fitted Km is 0.16 μM.
300
y = 7.436x + 44.16
250
R2 = 0.9749
200
150
100
50
0
-10
0
10
20
30
40
1/[S]
It is important to notice that some of the examined aldehydes are natural constituents of food,
particularly of plant origin [2]. This refers, in particular, to anisaldehyde, benzaldehyde, and cinnamic
aldehyde, all three being excellent substrates for ALDH3A1, and to vanillin, which is a moderate
substrate. The postulated role of the salivary ALDH in protection against these highly reactive
aldehydes, suspected as risk factors in the development of cancer of the digestive tract [6,7,8,10,20,21]
is therefore plausible. Furthermore, the same isozyme, when expressed in neoplastic cells, is known to
impair the oxazaphosphorine chemotherapy by inactivating the key intermediate aldophosphamide

Molecules 2009, 14
2368
[4,11,22-24], and a mutated form of ALDH3A1 has been recently reported to increase risk of
haemorrhagic cystitis during the chemotherapy [25]. Therefore, the detailed kinetic characterization of
ALDH3A1 may be useful for further pharmacological studies.
3. Experimental
3.1. General
Benzaldehyde, 4-dimethylaminobenzaldehyde, 1- and 2-naphthaldehydes, 6-methoxy-2-
naphthaldehyde, 4-methoxy-1-naphthaldehyde, 4-dimethylamino-1-naphthaldehyde and the
corresponding carboxylic acids were from Aldrich. Anisaldehyde, cinnamic aldehyde and vanillin
were purchased from Sigma. DANAL and 7-methoxy-1-naphthaldehyde were synthesized previously
[19]. Coenzymes NAD+ and NADH, as well as dithiothreitol, were from Sigma. All other chemicals
were of analytical grade.
All assays were run in 50 mM phosphate buffers, pH 7.5, at 25°C, in the presence of 0.5 mM EDTA
and 0.5 mM DTT. Concentration of NAD+ was kept constant at 100 μM. Fluorimetric assays were run
on a thermostated Perkin-Elmer LS-50B instrument. Instrumental settings for DANAL oxidation were:
excitation wavelength, 320 nm, emission monitored at 420 nm, and for 2-naphthaldehyde and
MONAL 315 nm and 360 nm, respectively, with spectral bandwidths 7 and 10 nm for the excitation
and emission beams. For non-fluorescent carboxylates, fluorescence of NADH was followed at 460
nm, with excitation at 340-350 nm, and spectral resolution of 10-15 nm. Purified reaction products
(carboxylates or NADH) at the concentrations of 2-5 μM were used as internal standards in the
fluorimetric assays to obtain absolute reaction rates, which were calculated according to the
formula [15]:
C
dF
st
v =
dt Fst
where Cst is standard concentration, Fst its fluorescence and dF/dt slope of the fluorescence time-
dependence.
UV absorption was measured using a Cary 219 spectrophotometer. Optimum wavelengths and Δ
values for oxidation of aromatic aldehydes with NAD+ were determined and collected in Table 1.
Kinetic parameters for enzymatic reactions were calculated according to Lineweaver-Burke standard
procedure, except those cases where Km values were very low, where progress reaction curve analysis
was applied.
HPLC was performed on a Shimadzu chromatograph consisting of a LC-10AD pump and
RF10AXL fluorescence detector. Twenty microliters of the deproteinized incubation mixtures were
introduced to the column. Separation was performed on the Supelcosil LC-18-DB 25 cm × 4.6 mm,
5 µm column (Supelco) under isocratic conditions. The mobile phase consisted of an acetonitrile-water
mixture 65:35 (v/v) at pH of 2.8. The mobile phase was pumped at a flow-rate of 1 mL/min.
Chromatography was performed at 30 °C. Fluorescence excitation and emission wavelengths were set
at 310 and 360 nm, respectively. All eluents were of HPLC purity grade.

Molecules 2009, 14
2369
3.2. Saliva collection
Human saliva samples were obtained from healthy adult volunteers, all of them declaring non-
smoking and non-drinking behaviour. Saliva samples were collected before first meal, after thoroughly
washing mouths, directly to test tubes containing cooled 50 mM phosphate buffer, pH 7.5, with
addition of 0.5 mM EDTA and 0.5 mM DTT. Final dilution of the saliva with buffer was ca. 1:1. The
saliva samples were centrifuged at 3,500 rpm for 5-10 minutes and the supernatant was gently
collected and stored in ice [17]. After 1 – 5 hours of incubation the ALDH activity of the supernatant
was measured after diluting 1:20 with buffer in the presence of the appropriate aldehyde and NAD+.
3.3. Cloning of the cDNA for ALDH3A1 and its overexpression
The full- length human ALDH3A1 gene was PCR amplified from “TrueClone”, cDNA clone in
pCMV6-AC vector purchased in OriGene (Rockville, MD, U.S.A.). The sequence of the 5’ and 3’
PCR primers were: 5’CTAGCTAGCATGAGCAAGATCAGCGAGGCC3’ and 5’CCGGAATTCTC
AGTGCTGGGTCATCTTGGC 3’, respectively.
Figure 4. SDS/PAGE of recombinant ALDH3A1 after purification: lane 1, PageRuler
(Fermantas) molecular mass marker proteins (from bottom to top: 26, 34, 43, 55, 72, 95,
130, 170 kDa); lane 2, solution from the first elution; lane 3, solution from the second
elution; lane 4, eluate after dialysis. The gel was stained with Coomassie Brilliant Blue.
1
2
3
4
A NheI site was introduced by the PCR primer on the 5’ end, whereas a EcoRI site on 3’ end. The
resulting 1.5-kb PCR-amplified fragment was digested with NheI and EcoRI, gel-purified using the

Molecules 2009, 14
2370
QIAquick Gel Extraction Kit (Qiagen), and ligated with pET-28a (Novagene) that had been digested
with the same enzymes and gel-purified. The ligation reaction was used to transform E.coliBL21(DE3)
competent cells (Invitrogen). The sequence of the entire inset of the pET28a-ALDH3A1 plasmid was
verified by sequencing.
The cultures of the overproducing stain were grown at 37°C in LB broth (35 g/L tryptone, 20 g/L
yeast extract, 5g/L NaCl) supplemented with 50 µg/mL kanamycin to an OD600 of 0.6. The expression
was induced by adding IPTG to a final concentration of 1 mM. Recombinant ALDH3A1 was isolated
(see Figure 4) with Ni-NTA Fast Start Kit (Qiagen) and dialyzed overnight to 50 mM pyrophosphate
buffer containing 1 mM EDTA and 1 mM DTT.
4. Conclusions
Aromatic aldehydes, particularly para-substituted benzaldehydes and 2-naphthaldehydes, are
excellent substrates for both salivary ALDH and the recombinant ALDH3A1. The obtained Km values
for various aldehydes are virtually identical with both activities, confirming that ALDH3A1, as an
isozyme particularly reactive toward aromatic aldehydes, is primarily responsible for the salivary
ALDH activity. Consequently, full specificity of the fluorimetric assay of the salivary ALDH3A1,
based on oxidation of the fluorogenic 2-naphthaldehydes, is confirmed.
Acknowledgement
This work was supported by a grant from the Polish Ministry of Science and Higher Education nr.
N312 035 31/2169.
References and Notes
1. Dyck, L.E. Polymorphism of a class 3 aldehyde dehydrogenase present in human saliva and in
hair roots. Alcohol. Clin. Exp. Res. 1995, 19, 420-426.
2. Feron, V.J.; Til, H.P.; de Vrijer, F.; Woutersen, R.A.; Cassee, F.R.; van Bladeren, P.J. Aldehydes:
Occurence, carcinogenic potential, mechanism of action and risk assessment. Mutat. Res. 1991,
259, 363-385.
3. Vasiliou, V.; Pappa, A.; Estey, T. Role of human aldehyde dehydrogenases in endobiotic and
xenobiotic metabolism. Drug Metab. Rev. 2004, 36, 279-299.
4. Sládek, N.E. Human aldehyde dehydrogenases: Potential pathological, pharmacological, and
toxicological impact. J. Biochem. Mol. Toxicol. 2003, 17, 7-23.
5. Sreerama, L.; Hedge, M.W.; Sladek N.E. Identification of a class 3 aldehyde dehydrogenase in
human saliva and increased levels of this enzyme, glutathione S-transferases, and DT-diaphorase
in the saliva of subjects who continually ingest large quantities of coffee or broccoli. Clin. Cancer
Res. 1995, 1, 1153-1165.
6. Ellis, E.M. Reactive carbonyls and oxidative stress: Potential for therapeutic intervention.
Pharmacol. Therap. 2007, 115, 13-24.

Molecules 2009, 14
2371
7. Townsend, A.J.; Leone-Kabler, S., Haynes, R.L.; Wu, Y., Szweda, L., Bunting, K.D. Selective
protection by stably transfected human ALDH3A1 (but not human ALDH1A1) against toxicity of
aliphatic aldehydes in V79 cells. Chem. Biol. Interact. 2001, 130-132, 261-273.
8. Pappa, A.; Chen, C.; Koutalos, Y.; Townsend, A.J.; Vasiliou, V. ALDH3A1 protects human
corneal epithelial cells from ultraviolet- and 4-hydroxy-2-nonenal-induced oxidative damage.
Free Radical Bio. Med. 2003, 34, 1178-1189.
9. Estey, T.; Piatigorsky, J.; Lassen, N.; Vasiliou, V. ALDH3A1: a corneal crystallin with diverse
functions. Exp. Eye Res. 2007, 84, 3-12.
10. Jelski, W.; Szmitkowski, M. Alcohol dehydrogenase (ADH) and aldehyde dehydrogenase
(ALDH) in the cancer diseases. Clin. Chim. Acta 2008, 395, 1-5.
11. Sladek, N.E. Aldehyde dehydrogenase-mediated cellular relative insensitivity to the
oxazaphosphorines. Curr. Pharm. Des. 1999, 5, 607-625.
12. Hsu, L.C.; Chang, W.C.; Hiraoka, L.; Hsieh, C.L. Molecular cloning, genomic organization, and
chromosomal localization of an additional human aldehyde dehydrogenase gene, ALDH6.
Genomics 1994, 24, 333-341.
13. Aldehyde dehydrogenase gene superfamily database, www.aldh.org.
14. Pappa, A.; Estey, T.; Manzer, R.; Brown, D.; Vasiliou, V. Human aldehyde dehydrogenase 3A1
(ALDH3A1): Biochemical characterization and immunohistochemical localization in the cornea.
Biochem. J. 2003, 376, 615-623.
15. Wierzchowski, J.; Wroczynski, P.; Laszuk, K.; Interewicz, E. Fluorimetric detection of aldehyde
dehydrogenase activity in human blood, saliva and organ biopsies, and kinetic differentiation
between class I and class III isozymes. Anal. Biochem. 1997, 245, 68-75.
16. Wroczyński, P.; Wierzchowski, J. Aromatic aldehydes as fluorogenic indicators for human
aldehyde dehydrogenases and oxidases. Analyst 2000, 125, 511-516.
17. Wroczyński, P.; Wierzchowski, J.; Rakowska, A.; Chimkowska, M.; Targoński, J. Aldehyde
dehydrogenase in human saliva – evaluation of its oxidation status. Acta Pol. Pharm. 2004, 61
Suppl., 62-64.
18. Wierzchowski, J.; Pietrzak, M.; Szeląg, M.; Wroczyński, P. Salivary aldehyde dehydrogenase –
reversible oxidation of the enzyme and its inhibition by caffeine, investigated using fluorimetric
method. Arch. Oral Biol. 2008, 53, 423-428.
19. Wierzchowski, J.; Interewicz, E.; Wroczynski, P.; Orlanska, I. Continuous fluorimetric assay for
human aldehyde dehydrogenase and its application to blood analysis. Anal. Chim. Acta 1996, 319,
209-219.
20. Glatt, H.; Rost, K.; Frank, H.; Seidel, A.; Kollock, R. Detoxification of promutagenic aldehydes
derived from methylpyrenes by human aldehyde dehydrogenases ALDH2 and ALDH3A1. Arch.
Biochem. Biophys. 2008, 477, 196-205.
21. Seitz, H.K.; Matsuzaki, S.; Yokoyama, A.; Homann, N.; Vaekaevainen, S.; Wang, X.D. Alcohol
and cancer. Alcohol. Clin. Exper. Res. 2001, 25, 137S-143S.
22. Sládek, N.E.; Kollander, R; Sreerama, L.; Kiang, D.T. Cellular levels of aldehyde dehydrogenases
(ALDH1A1 and ALDH3A1) as predictors of therapeutic responses to cyclophosphamide-based
chemotherapy of breast cancer: A retrospective study. Cancer Chemother. Pharmacol. 2002, 49,
309-321.

Molecules 2009, 14
2372
23. Moreb, S.J.; Muhoczy, D.; Ostmark, B.; Zucali, J.R., RNAi-mediated knockdown of aldehyde
dehydrogenase class-1A1 and class-3A1 is specific and reveals that each contributes equally to
the resistance against 4-hydroperoxycyclophosphamide. Cancer Chemother. Pharmacol . 2007,
59, 127-136.
24. Ho, K.K., Mukhopadhyay, A., Li, Y.F., Mukhopadhyay, S., Weiner, H. A point mutation
produced a class 3 aldehyde dehydrogenase with increased protective ability against the killing
effect of cyclophosphamide. Biochem. Pharmacol. 2008, 76, 690-696.
25. Ekhart, C.; Rodenhuis, S.; Smits, P.H.M.; Beijnen, J.H.; Huitema, A.D.R. Relations between
polymorphisms in drug-metabolising enzymes and toxicity of chemotherapy with
cyclophosphamide, thiotepa and carboplatin. Pharmacogenet. Genomics 2008, 18, 1009-1015.
Samples Availability: Available from the authors.
© 2009 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland.
This article is an open-access article distributed under the terms and conditions of the Creative
Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).