Inhibition of aflatoxin B1 biosynthesis and down regulation of aflR and aflB genes in presence of benzimidazole derivatives without impairing the growth of Aspergillus flavus

Article abstract of DOI:10.1016/j.toxicon.2019.09.018

Aflatoxins are mutagenic secondary metabolites produced by certain ubiquitous saprophytic fungi. These contaminate agricultural crops and pose a serious health threat to humans and livestock all over the world. Benzimidazole and its derivatives are biologically active heterocyclic compounds known for their fungicidal activity. In the present study, second and sixth position substituted benzimidazole derivatives are tested for their antifungal and anti-aflatoxigenic activity. Aflatoxigenic strain of Aspergillus flavus cultured in Yeast extract sucrose (YES) medium as well as in rice in the presence and absence of test compounds. 2-(2-Furyl) benzimidazole (FBD) showed complete inhibition of fungal growth at 50 μg/mL. However, the polar derivatives of FBD viz. 6-NFBD, 6-AFBD, 6-CAFBD, and 6-CFBD did not impair the fungal growth but effectively inhibited aflatoxin B₁ biosynthesis. Significant down-regulation of aflR gene involved in regulation and aflB structural gene for aflatoxin B₁ biosynthesis was observed in presence of 6-NFBD. These benzimidazole derivatives also showed good anti-aflatoxigenic activity in rice, though the IC₅₀ concentrations in rice were comparatively higher than those in YES medium. This study summarizes the most notable structure-activity relationship (SAR) of 2-(2-Furyl) benzimidazoles for anti-aflatoxigenic and anti-fungal activities. These molecules can be further studied for their applications in industrial fermentation processes vulnerable to mold growth and subsequent aflatoxin B₁ synthesis like koji fermentation, cheese production, etc.

Full text of DOI:10.1016/j.toxicon.2019.09.018

Toxicon 170 (2019) 60–67
Contents lists available at ScienceDirect
Toxicon
journal homepage: www.elsevier.com/locate/toxicon
Inhibition of aflatoxin B1 biosynthesis and down regulation of aflR and aflB
genes in presence of benzimidazole derivatives without impairing the
growth of Aspergillus flavus
a
b
a,∗
Dhanamjayulu P. , Boga Ramesh Babu , Mehta Alka
a
Department of Integrative Biology, School of Bio sciences and Technology, Vellore Institute of Technology, Vellore, 632014, Tamil Nadu, India
BogaR Laboratories, Peddapuram, 533437, Andhra Pradesh, India
b
A R T I C L E I N F O
A B S T R A C T
Keywords:
Mycotoxins
Fermentation process
Antifungal
Aspergillus flavus
Anti-Aflatoxigenic
Aflatoxins are mutagenic secondary metabolites produced by certain ubiquitous saprophytic fungi. These con-
taminate agricultural crops and pose a serious health threat to humans and livestock all over the world.
Benzimidazole and its derivatives are biologically active heterocyclic compounds known for their fungicidal
activity. In the present study, second and sixth position substituted benzimidazole derivatives are tested for their
antifungal and anti-aflatoxigenic activity. Aflatoxigenic strain of Aspergillus flavus cultured in Yeast extract su-
crose (YES) medium as well as in rice in the presence and absence of test compounds. 2-(2-Furyl) benzimidazole
(
FBD) showed complete inhibition of fungal growth at 50 μg/mL. However, the polar derivatives of FBD viz. 6-
NFBD, 6-AFBD, 6-CAFBD, and 6-CFBD did not impair the fungal growth but effectively inhibited aflatoxin B
biosynthesis. Significant down-regulation of aflR gene involved in regulation and aflB structural gene for afla-
toxin B biosynthesis was observed in presence of 6-NFBD. These benzimidazole derivatives also showed good
1
1
anti-aflatoxigenic activity in rice, though the IC50 concentrations in rice were comparatively higher than those in
YES medium. This study summarizes the most notable structure-activity relationship (SAR) of 2-(2-Furyl) ben-
zimidazoles for anti-aflatoxigenic and anti-fungal activities. These molecules can be further studied for their
applications in industrial fermentation processes vulnerable to mold growth and subsequent aflatoxin B
1
synthesis like koji fermentation, cheese production, etc.
1. Introduction
2016). Europe has been recorded the highest contamination level of
6
56 μg/kg in food grains (Binder et al., 2007).
Aflatoxins are a group of polyketide mycotoxins produced as sec-
Good agricultural and harvesting practices and storage in dry con-
ondary metabolites during fungal development (Herrman et al., 2002;
Erdogan, 2004). Since aflatoxins directly influence the DNA structure,
they are highly carcinogenic. Biosynthesis of aflatoxins by fungi de-
pends on the environmental conditions such as moisture, temperature,
and humidity during crop maturation and storage (Neme and
Mohammed, 2017; Pildain et al., 2004; Tarín et al., 2004). Con-
tamination of food, feed and agricultural commodities by aflatoxins
impose an enormous economic burden (Mitchell et al., 2016) and the
occurrence of aflatoxin in cereals causes trade issues between countries.
ditions are helpful in preventing fungal infestation and thus mycotoxin
synthesis (Magan and Aldred, 2007). These were expensive practices
(Alaniz Zanon et al., 2013), and AFB contamination remains a massive
1
issue in developing countries such as Southeast Asia and India (Toteja
et al., 2006). Alternatively, there are a number of physical and chemical
methods such as heating, ionizing radiations, spraying of pesticides and
1
fungicides for preventing fungal infestation and AFB contamination.
However, these methods can cause organoleptic changes to the product
and irreversible damage to the environment due to their non-biode-
gradable nature (Divakara et al., 2014; Karlovsky et al., 2016; Zoghi
et al., 2014). Thus the development of new methods for controlling
aflatoxigenic fungi by naturally occurring spices (Aiko and Mehta,
2013a, 2013b) including plant extracts (Panda and Mehta, 2013) and
plant compounds such as essential oils (Pandey et al., 2016) has been
Aflatoxin B
in various agricultural and dairy products. In Africa, about 50% of raw
cereal grains have AFB
1 1
(AFB ) contamination has been reported across the globe
1
with highest incidence of 1642 μg/kg in rice
and maize. In Asia and South America, these are reported to be 850 μg/
kg and 1400 μg/kg in maize respectively (Lee and Ryu, 2017; Ferre,
∗
Corresponding author.
E-mail address: alkamehta@vit.ac.in (A. Mehta).
https://doi.org/10.1016/j.toxicon.2019.09.018
Received 4 July 2019; Received in revised form 11 September 2019; Accepted 17 September 2019
Available online 18 September 2019
0041-0101/ © 2019 Elsevier Ltd. All rights reserved.

P. Dhanamjayulu, et al.
Toxicon 170 (2019) 60–67
proposed as alternative fungicides to reduce AFB
1
(Hua et al., 2015;
2.1.1. 2-(2-Furyl) benzimidazole (FBD)
Kedia et al., 2014; Wright et al., 2000). Piperlongumine, pipernonaline,
-methylenedioxy-containing compounds identified from Piper nigrum,
1,2-phenylenediamine (0.1 mol) was mixed with Furfural (Furan-2-
carboxaldehyde) (0.12 mol) and nitrobenzene and then refluxed for
10 h. The reaction mixture was cooled and then poured into water. The
precipitated solid was filtered and washed with water and dried to
derive crude benzimidazole derivative, which crystallized from ethyl
acetate-chloroform (1:1) to give crystalline 2-(2-Furyl)benzimidazole
2
piperonal and piperine have been studied for their antifungal and an-
tiaflatoxigenic activities against A. flavus. 2-hydroxy-4-methox-
ybenzaldehyde isolated from Decalepis hamiltonii which exhibits antia-
flatoxigenic activity (Mohana and Raveesha, 2010). The coumarin
derivative, 7-hydroxy-6-nitro-2H-1-benzopyran-2-one, and benzimida-
zole derivatives are widely used because of their diverse biological
activity and clinical application. This benzimidazole heterocyclic ring
system presents fungicidal property (Janeczko et al., 2016; Guerra
et al., 2015). 2-(2-Furyl)benzimidazole (FBD) commercially marketed
as ‘Fuberidazole’ is well known for its fungicidal activity and commonly
used against candida infection (Del Poeta et al., 1998). In quest of
searching more potent fungicides, a number of more polar derivatives
of FBD were synthesized and screened for their fungicidal activity. In
the present work, the antifungal and anti-aflatoxigenic effects of ben-
zimidazole containing compounds 2-(2-Furyl)-6-nitrobenzimidazole (6-
NFBD), 2-(2-Furyl)benzimidazole-6-carbonitrile (6-CFBD), 2-(2-Furyl)
benzimidazole-6-carboxamidoxime (6-AFBD), and 2-(2-Furyl)benzimi-
dazole-6-carboxylic acid (6-CAFBD) were studied on Aspergillus flavus.
Studies were carried out in culture media as well as in rice to establish
and yield was 80%, m.p. 200 °C (dec), 1H-NMR (DMSO‑d
(aromatic protons, 7H), and 13.0 (imidazole amine-NH, 1H).
6
): δ 6.6–8.0
2.1.2. 2-(2-Furyl)-6-nitrobenzimidazole (6-NFBD)
Synthesized as described for FBD, except that 3,4-diaminoni-
trobenzene was used in place of the 1,2-phenylenediamine and yield
1
was ~80%, m. p. 195–200 °C, H-NMR (DMSO‑d ): δ 6.8–8.5 (aromatic
6
protons, 6H), and 13.6 (broad singlet for imidazole-NH, 1H).
2.1.3. 2-(2-Furyl)benzimidazole-6-carbonitrile (6-CFBD)
6-CFBD was Synthesized as described for FBD, except that 3,4-dia-
minobenzonitrile was used in place of 1,2-phenylenediamine and the
yield was ~90%, m.p. 149–152 °C, 1H-NMR (DMSO‑d
): δ 6.6–8.2
(aromatic protons, 6H), and 13.6 (broad singlet for imidazole-NH, 1H).
6
1
the efficacy of these compounds in controlling AFB contamination. The
cytotoxicity to the HeLa cells was used as the assay for evaluation of the
safety of the test compounds; FBD, 6-NFBD, 6-CFBD, 6-AFBD, 6-CAFBD.
2
.1.4. 2-(2-Furyl)benzimidazole-6-carboxamidoxime (6-AFBD)
The above-synthesized compound (6-CFBD) was dissolved in 1,4-
dioxane and then mixed with hydroxylamine solution and the reaction
mixture was stirred for 12 h. After completion of the reaction, the sol-
vent was evaporated under vacuum to dryness and then the derived
solid was crystallized. Crystalline product yield was ~70% and m.p.
2
. Material and methods
2.1. General chemical synthesis
15–220 °C, 1H-NMR (DMSO‑d
): δ 5.8 (amidoxime amine protons,
2
2
1
6
H), 6.7–8.0 (aromatic protons, 6H), 9.5 (amidoxime hydroxyl proton,
H), and 13.0 (imidazole-NH, 1H).
Most of the reagents and chemicals were obtained from Alfa Aesar
(
Ward Hill, MA), and Sigma-Aldrich (Milwaukee, WI). Benzimidazoles
were synthesized using reported methods (Bahrami et al., 2007; Hein
et al., 1957). The modified benzimidazoles synthesized at BogaR La-
boratories for this study include 2-(2-Furyl)benzimidazole (FBD), 2-(2-
Furyl)-6-nitrobenzimidazole (6-NFBD), 2-(2-Furyl)benzimidazole-6-
carbonitrile (6-CFBD), 2-(2-Furyl)benzimidazole-6-carboxamidoxime
2
.1.5. 2-(2-Furyl)benzimidazole-6-carboxylic acid (6-CAFBD)
6-CAFBD was synthesized as described for FBD, except that 3,4-
diaminobenzoic acid was used in place of 1,2-phenylenediamine and
the yield was ~80%, m.p. 200–204 °C, IR (KBr) spectrum showed a
−1
peak at 1680 cm
.2. A. flavus culture
A toxigenic strain of A. flavus was isolated in our laboratory and
for Carbonyl group.
(
6-AFBD), and 2-(2-Furyl)benzimidazole-6-carboxylic acid (6-CAFBD)
as shown in Fig. 1. Generally, all benzimidazole derivatives were pre-
pared by refluxing the respective 1,2-phenylenediamine derivatives
with 2-furfuraldehyde in nitrobenzene. The derived crude materials
were crystallized from ethanol or a suitable solvent to give pure 2-(2-
Furyl)benzimidazoles. All synthesized compounds were characterized
by TLC, IR, and NMR. The purity of each compound was determined by
TLC and NMR. The compounds used for our studies were well over 97%
purity range.
2
identified as Aspergillus flavus link 1809 on the basis of partial DNA
sequence similarity with NCBI sequence accession HQ14704 (Aiko and
Mehta, 2013b). The fungal culture was maintained on potato dextrose
agar slant at 4 °C and used for further experiments.
Fig. 1. Structures of Benzimidazoles. FBD: 2-(2-Furyl)benzimidazole; 6-NFBD: 2-(2-Furyl)-6-nitrobenzimidazole; 6-CFBD: 2-(2-Furyl)benzimidazole-6-carbonitrile; 6-
AFBD: 2-(2-Furyl)benzimidazole-6-carboxamidoxime; 6-CAFBD: 2-(2-Furyl)benzimidazole-6-carboxylic acid.
61

P. Dhanamjayulu, et al.
Toxicon 170 (2019) 60–67
2
.2.1. Evaluation of fungal growth and aflatoxin B
1
production in presence
1
treatment ÷ Mean concentration of AFB in control) × 100.
of test compounds
The growth of A. flavus and AFB
presence of test compounds in the culture medium. Stock solutions of
each test compounds (50 mg/mL) were prepared in Dimethyl sulfoxide
DMSO) and then diluted to 50 μg/mL of concentration in the yeast
extract sucrose (YES) medium. The spores of A. flavus were harvested
1
production were studied in the
2
.2.6. Determination of anti-aflatoxigenic activity of test compounds in rice
White polished rice that had no fungal or AFB contamination was
1
used for the experiment. Ten grams of rice was taken in a 100 mL
Erlenmeyer flask, and washed with distilled water and drained com-
pletely. Fifty μg/g of each compound was added separately to the wa-
shed rice and autoclaved at 121 °C for 20 min. The moisture content of
the rice at the time of inoculation was maintained at 20–25%. An ali-
quot 100 μL of A. flavus spore suspension (10 spores/mL) was in-
oculated into the flask and incubated at 27 °C ± 2 °C for 7 days (Aiko
1
and Mehta, 2013b). After incubation, AFB was extracted from the rice
culture directly with 30 mL chloroform by vigorous shaking and then
(
from the 9-day old culture on potato dextrose agar and counted using a
5
hemocytometer. Fifty μL of spore suspension (10 spores/mL) was then
5
inoculated into each flask containing 10 mL of YES medium. The flasks
were incubated at 27 ± 2 °C for a period of 7 days. At the end of the
incubation period, the fungal mass in terms of Dry Mycelia Weight
(
DMW) and AFB
mycelium was harvested by filtration using a Whatman filter paper and
the broth obtained was used for the extraction of AFB . The wet weight
1
production in spent media was determined. The
filtered using Whatman paper. Qualitative and quantitative analysis of
AFB
1
were carried out using TLC, Fluorescence spectrophotometry and
1
of the mycelium was recorded and then dried at 60 °C in a hot air oven
until it reached a constant weight and it was considered as DMW. The
spent media was extracted with an equal volume of chloroform. The
extraction was done thrice by wrist action using a separating funnel and
kept for phase separation. The lower chloroform layers were then
pooled, concentrated and analyzed by thin-layer chromatography, high-
performance liquid chromatography (HPLC), and fluorescence spec-
HPLC.
2.2.7. Determination of effective concentration of 6-NFBD and FBD in rice
To find the effective concentration for inhibition of AFB production
1
in rice, different concentration of test compounds (6-NFBD and FBD)
were taken, ranging from 10 to 50 μg/g and then tested according to the
procedure mentioned in above section 2.2.6. AFB level was quantified
1
by HPLC analysis and percent inhibition was calculated following the
formula mentioned in section 2.2.5.
1
troscopy for AFB .
2
.2.2. Thin-layer chromatography (TLC)
Qualitative analysis of AFB using thin-layer chromatography (TLC)
was performed along with a standard AFB (Supelco, Bellefonte, PA,
1
2.2.8. Study of specific inhibition of aflatoxin
1
B synthesis by test
1
compounds
USA). Ten microliters of the chloroform extract from the spent YES
medium was applied on activated TLC plate (silica gel on aluminum foil
Fluka, Munich, Germany) and chloroform-acetone mixture (85:15) was
used as a mobile phase. After developing the chromatogram, the plates
were viewed under UV light (365 nm) to detect the characteristic
In order to confirm test compound's effect on specific alteration of
the secondary metabolism, each test compound at 50 μg/mL con-
centration was added to the culture after three days of incubation
(
before sporulation). Initially, the experiment was set up as described in
above Section 2.2.1 without the addition of the test compounds. On the
th day of incubation and when white mycelium covered the entire
fluorescence and R
F 1 F
value of AFB . The R value of spots was then
4
compared with standard AFB
1
.
medium, the test compounds were added to the flask except for control
flask in a sterile condition and the incubation was continued up to 7
days under the same conditions as mentioned above. The antifungal
activity was determined for test compounds after 7 days incubation in
terms of Dry Mycelium Weight (DMW) and AFB1 production.
2.2.3. Fluorescence spectroscopic analysis
The fluorometric analysis was carried to qualitatively analyze the
emission peak for AFB1. The instrument used was HITACHI F-7000
fluorescence spectrophotometer equipped with a xenon lamp of both
the excitation at 365 nm and emission at 430 nm, and the slit width was
set at 5.0 nm. Instrumental parameters were controlled with FL Winlan
software. All samples were dissolved in chloroform.
2.3. Gene expression studies
Spores of A. flavus were harvested from the 9-day old culture on
potato dextrose agar and counted using a hemocytometer. Fifty μL of
spore suspension (105 spores/mL) was inoculated in 10 mL of YES
medium for control as well as test flask containing 50 μg/mL NFBD. The
flasks were incubated at 27 ± 2 °C. After 7 days of incubation, the
mycelium was harvested by filtration using a Whatman filter paper for
gene expression studies. The mycelium was then washed with PBS
buffer and stored at −80 °C for further use.
2
.2.4. High-performance liquid chromatography (HPLC) analysis
AFB was quantified using reversed-phase high-performance liquid
1
chromatography (YOUNGLIN INSTRUMENT Acme 9000) using C-18
column as per the standard supelco protocol. The chloroform extract
was evaporated to dryness and the residue was re-dissolved in benzene.
2
0 μL of the sample was injected into the HPLC sampler and acetoni-
trile: water: methanol (30:50:20 v/v/v) was used as mobile phase at a
flow rate of 1 mL/min. AFB was detected with a UV detector at 365 nm
wavelength. The amount of AFB was determined from the standard
and calculated as given (Aiko and Mehta, 2013b).
1
2.3.1. Total RNA extraction
1
Disruption of fungal mycelia (50 mg) was done using mortar and
pestle method, and the total RNA extraction was carried by RNeasy
Plant Mini Kit (Qiagen) according to the instructions given by the
manufacturers. Total RNA obtained was diluted with 50 μL of RNase
free water and stored at −80 °C for reverse transcription. Isolated RNA
was quantified by absorbance at 260 nm and the purity was assessed
using absorbance ratio A260/A280 measured using Nanodrop spec-
trophotometer (Eppendorf BioSpectrometer®, USA), and a final RNA
concentration was adjusted to 300 ng/μL.
1
1
AFB = (Peak area of sample ÷ Peak area of AFB standard) × Con-
centration of standard
2.2.5. Determination of IC50 concentration of 6-NFBD and FBD
1
To determine the IC50 values for inhibiting the synthesis of AFB in
YES medium, different concentrations of test compounds (6-NFBD and
FBD), ranging from 2 to 50 μg/mL were tested by the following pro-
cedure mentioned in section 2.2.1. AFB
1
level was quantified using
synthesis was calcu-
lated following formula (Aiko and Mehta, 2013b).
Inhibition (1- Mean concentration of AFB
2.3.2. RT-PCR assay
HPLC analysis and inhibition percentage of AFB
1
RT-PCR was used to amplify the structural gene aflB and the reg-
ulatory gene aflR of AFB
1
biosynthetic pathway as target genes, and
%
=
1
in
kept the gpdA gene as a housekeeping gene.
62

P. Dhanamjayulu, et al.
Toxicon 170 (2019) 60–67
Table 1
Sequences of the nucleotide primers used in this study.
Primer code
Gene
aflR
aflB
Primer Sequence (5′→3′)
PCR Product Size (bp)
AflR-1F
AflR-2R
AflB-1F
AflB-2R
GPD-1F
GPD-2R
ATGGTCGTCCTTATCGTTCT
CCATGACAAAGACGGATCC
ACAATCGAATGACAACACTGC
CCACCGAATCCACTACCTACA
GACATCAACGTCCTCTCTAA
GTCTTCTTGATGTCCTCGTA
627
580
356
gpdA
2
.3.3. PCR primers
The primer sequence of aflR and aflB were shown to be involved in
the AFB biosynthetic pathway (Chang et al., 2005). The primer pair of
1
the gpdA housekeeping gene was designed based on the genomic data of
the Aspergillus flavus strain NRRL3357 (GenBank accession number XM_
002373980) (Table 1). All primers were synthesized by GeNoRime (a
division of Shrimpex Biotech Services Pvt Ltd, Chennai, India).
Fig. 2. Influence of test compounds on growth of A. flavus and aflatoxin B
1
production in 10 mL of YES medium.
2.3.4. cDNA synthesis
Total RNA (2 μL) was used as a template to synthesize the first-
strand cDNA according to the Omniscript Reverse Transcription Kit
2.5. Statistical analysis
(
Qiagen) instructions given by the manufacturer and finally used for
In this study, the experiments were carried out in triplicate and
qPCR.
repeated thrice to confirm the results. The data were reported as
mean ± standard deviation and significant difference between mean
values was determined by one-way analysis of variance (ANOVA) at
P < 0.05.
2
.3.5. Analysis of the genes expression linked to aflatoxin B
1
biosynthesis
Gene expression analysis was performed using the Bio-Rad CFX96
RT PCR detection system (Bio-RAD, USA). Optimization was done using
gpdA gene. The reaction mixture was set up in triplicate each 10 μL
volume contains 5 μL of SYBR® Premix Ex Taq™ (Takara Bio Inc., Japan)
used as a fluorescent dye, 800 nM of each primer, and 1 μL of cDNA
template were taken in MicroAmp optical 96-well reaction plates and
sealed with adhesive covers (Bio-Rad). Three-step optimal thermal cy-
cling conditions were performed as follows: Initial denaturation at 95 °C
for 5 min, and then 40 cycles of amplification at 95 °C for 10s, 50 °C for
3
. Results
3.1. Growth and aflatoxin B production by A. flavus
1
A luxuriant growth of A. flavus and AFB
the control flask. In the presence of FBD, a known antifungal compound
Alasmary et al., 2015), complete inhibition of fungal growth at 50 μg/
1
production was noted in
(
mL concentration was observed. In contrast to FBD, other benzimida-
zoles of 6-NFBD, 6-AFBD, 6-CAFBD, and 6-CFBD did not show much
inhibition to fungal growth (Fig. 2). However, AFB1 synthesis was sig-
nificantly inhibited. The qualitative analysis with thin layer chroma-
10s, and 72 °C for 30s. A final extension at 95 °C for 10s, 60 °C for 10s,
and 95 °C for 15s to obtain melt curve analysis. Data were analyzed
TM
with the software CFX Maestro
Software (Bio-Rad). The quantifica-
tion of the expression of aflB and aflR genes was performed using the
housekeeping gene gpdA. The gene expression ratio was calculated
1
togram (Fig. 3) showed a fluorescent spot corresponding to AFB only
in lane C (control) and 4 (6-CFBD). The fluorescence spectroscopic
analysis (Fig. 4) of these samples showed typical fluorescence peak of
-
ΔΔCt
using the 2
method (Livak and Schmittgen, 2001). This method
permits calculation of the expression ratio of the target gene between a
tested sample and its control sample.
1
AFB at 430 nm in the control sample and 6-CFBD. Other samples did
2.4. Cytotoxicity assay for the test compounds
The HeLa cell line was obtained from NCCS Pune, India. MTT col-
orimetric method given by Mosmann (1983) and modified by Ben
Trivedi et al. (1990) was used for the assay. In brief, the compounds
were dissolved in DMSO and further diluted with Dulbecco's modified
Eagle's medium (DMEM, HiMedia, India). A hundred microliters of this
sample were then added to the 96 well microplate. HeLa cell suspension
5
of 1 × 10 cells/mL (100 μL) was added to each well. The plate was
incubated at 37 °C under 5% carbon dioxide and 95% atmospheric air.
The DMSO concentration was kept below 0.1% in the samples. Ob-
servations were taken after 48 h of incubation. The cell growth was
measured in terms of color development due to the formation of for-
mazan from a reduction of MTT by live cells. The absorbance was
measured with a microplate reader (Bio-Rad 680, USA) at 540 nm with
a reference wavelength of 600 nm. The percentage cytotoxicity was
calculated as given by Panda and Mehta (2013):
Fig. 3. Thin layer chromatogram of chloroform extracts of spent medium after
A. flavus growth in presence of test compounds showing blue fluorescent afla-
toxin B spots from control and treated samples (C and 1–5). (For interpretation
1
Cytotoxicity % = (1- absorbance of treated wells ÷ absorbance of un-
treated wells) × 100
of the references to color in this figure legend, the reader is referred to the Web
version of this article.)
63

P. Dhanamjayulu, et al.
Toxicon 170 (2019) 60–67
FBD or 6-NFBD at 40 μg/mL and above gives more than 95% inhibition,
whereas 50 μg/mL exhibits 99% inhibition of AFB synthesis.
1
3.3. Anti-aflatoxigenic activity of test compounds in rice
Experiments were performed on rice to find the practical applica-
tion of test compounds to control fungal growth and AFB synthesis. In
1
the experiment, it was found that a dose of 50 μg of test compound per
gram of rice delayed the growth of A. flavus by 2 days. However, the
fungus started to grow from the 4th day. At the end of incubation
period i.e. the 7th day, white fungal growth was noted in all the test
flasks (Fig. 6). In contrast to the test flasks, the rice in the control flasks
had mycelium growth and turned green due to spore formation. The
amount of AFB
trol is shown in Fig. 7. Similar to the observation in YES medium the
test compounds did not inhibit the fungal growth but the AFB synthesis
1
produced in the presence of test compounds and con-
1
was inhibited very effectively as in the case of 6-NFBD, 98% inhibition
was noted. Inhibition by other compounds ranged between 50 and 95%.
In contrast to study in YES medium, FBD did not show complete in-
hibition of fungal growth in rice, however, AFB
by 98%.
1
synthesis was inhibited
Fig. 4. Fluorescence spectrum of chloroform extracts of spent medium after A.
flavus growth in presence of test compounds showing aflatoxin B
30 nm.
1
peak at
4
3.4. The effective concentration of 6-NFBD and FBD in rice
not show AFB
quantitative analysis from HPLC showed that 6-CAFBD inhibited less
than 13% fungal growth but AFB production was reduced by 81%.
Similarly, 6-AFBD and 6-NFBD inhibited 84 and > 95% AFB synth-
esis, respectively (Fig. 2). These data show that 6-NFBD, 6-AFBD, and 6-
CAFBD specifically inhibiting the AFB synthesis by hindering sec-
1
peak, confirming the observations of TLC analysis. The
Since the test compounds, 6-NFBD and FBD showed more than 95%
inhibition in the synthesis of AFB1 from A. flavus at 50 μg/g in rice,
further studies were carried out with lower concentrations to determine
the IC50 values (Table 2). A gradual inhibition in AFB1 synthesis was
observed with increasing concentration of test compounds. The IC50
values of 6-NFBD (23 μg/g) and FBD (22 μg/g) were noted. These are
higher than the IC50 found in YES (9.49 and 9.67 μg/mL, respectively).
1
1
1
ondary metabolism of polyketide biosynthesis pathway. However, 6-
CFBD found to be less effective compared to other compounds used, as
it inhibited fungal growth only by 2% and AFB
1
synthesis by 33%.
3.5. Specific inhibition of aflatoxin B1 production
The addition of test compounds to the culture after three days of
vegetative growth showed that DMW from test flask is almost similar to
that in control (Table 3), but AFB production was inhibited in com-
1
3
.2. Minimum inhibitory and IC50 concentration of 6-NFBD and FBD in
culture medium
parison to the control. Addition of FBD and 6-NFBD at the concentra-
tion of 50 μg/mL of medium showed about 98 and 96% decrease in
1 1
AFB content. 6-CAFBD showed a 79% reduction in AFB . In the pre-
1
As the highest inhibition of AFB was noted in the presence of test
compounds FBD and 6-NFBD, further studies were carried out to de-
termine the IC50 value and minimum inhibitory concentration. Fig. 5
shows the correlation between the concentration of the compound and
the inhibition of AFB . The IC50 value obtained from the graph is 9.49
1
and 9.67 μg/mL for FBD and 6-NFBD respectively. The concentration of
sence of 6-AFBD and 6-CFBD, only 47 and 34% reductions in AFB
1
production were noted when compared to the control. The chromato-
graphic analysis of the culture extracts showed diminishing fluores-
cence of the AFB
1
spot on TLC. These results were also confirmed by the
fluorescence spectroscopic analysis.
1
3.6. Analysis of the genes expression linked to aflatoxin B biosynthesis
To confirm the observed changes in AFB
sence of benzimidazole, the change in expression of genes involved in
AFB biosynthesis Fluorescence. Expression of a regulatory gene aflR
1
biosynthesis in the pre-
1
and a structural gene aflB was compared with respect to housekeeping
gene gpdA using real-time PCR. gpdA expression in the presence and
absence of NFBD was the same; however, expression of aflR and aflB
gene was strongly downregulated in the presence of 6-NFBD (Fig. 8).
3.7. Effect of test compounds on HeLa cell lines
Preliminary safety studies of the test compounds were carried out
using in-vitro tests on the animal cell line. For this purpose, HeLa cells
were incubated for 48 h with a test compound and the cell proliferation
was checked in terms of blue formazan formation from the reduction of
MTT by live cells. The color intensity measured by colorimeter is pro-
portionate to the number of live cells in the sample. Control well
showed confluent HeLa cells after 48 h incubation. However, all cells
Fig. 5. Correlation between concentration of test compounds (2-(2-Furyl)
benzimidazole (FBD), 2-(2-Furyl)-6-nitrobenzimidazole (6-NFBD) and inhibi-
tion of aflatoxin B
1
synthesis in YES medium. Graphical representation of IC50
values of 6-NFBD and FBD.
1
were found dead in the presence of 8 μg/mL AFB indicating high
64

P. Dhanamjayulu, et al.
Toxicon 170 (2019) 60–67
Fig. 6. Growth of A. flavus in presence of test compounds in rice on 7th day of incubation.
Table 3
Aflatoxin B
1
Synthesis from A. flavus in YES medium when Test Compounds are
added after 3 days of culture.
Compound
50 μg/mL)
DMW (g)
% Inhibition Total AFB
1
% Inhibition
(
produced in YES
b
medium (μg)
a
Control
0.37 ± 0.08
0
2.85 ± 0.12
0.11 ± 0.09
0.58 ± 0.15
1.49 ± 0.21
1.86 ± 0.12
0.03 ± 0.02
0
a
6
6
6
6
-NFBD
-CAFBD
-AFBD
-CFBD
0.32 ± 0.14 11.55
0.34 ± 0.16 6.98
0.37 ± 0.15 −1.34
0.39 ± 0.13 −6.18
0.31 ± 0.11 16.66
96.11
79.50
47.63
34.62
98.84
a
a
a
a
FBD
Values are mean (n = 3) ± SD.
SD, standard deviation.
a
Means with the same superscript in the same column for each variable
showing no significant difference at (P ≤ 0.05).
b
YES medium-10mL.
1
Fig. 7. Influence of test compounds on production of aflatoxin B in rice. A
flavus cultured in rice in presence of test compounds (50 μg/mL) for 7 days.
Table 2
1
Effective concentration of 6-NFBD and FBD for inhibition of aflatoxin B in rice.
Compound
Concentration (μg/
g)
Total AFB
(μg)
1
produced in riceb
% Inhibition
Control
–
10
3
5
10
15.59 ± 0.15a
0
a
6
-NFBD
15.23 ± 1.02
2.30
75.11
98.78
3.65
75.75
98.84
a
0
0
3.88 ± 0.33
0.19 ± 0.11a
a
FBD
15.02 ± 1.16
3
5
0
0
3.78 ± 0.13a
0.18 ± 0.09a
Values are mean (n = 3) ± SD.
SD, standard deviation.
a
Means with the same superscript in the same column for each variable
showing no significant difference at (P ≤ 0.05).
b
Rice −10 g.
1
cytotoxicity of AFB which is used as a positive control. The test wells of
FBD, 6-CFBD, and 6-NFBD showed fully confluent healthy cells in-
dicating no adverse effects on HeLa cells at the concentration of 100 μg/
mL 6-AFBD well showed less growth when compared to the control but
the cells were growing and appeared healthy (Fig. S1, Table 4).
Therefore, these preliminary experiments showed that the test com-
pounds are not toxic to HeLa cells at 100 μg/mL concentration, and to
ensure the safe usage of test compounds, further experiments on ani-
mals are required.
Fig. 8. Effect of NFBD on the expression of aflatoxin B
gene aflR and structural gene aflB. **p-value < 0.01.
1
synthesis regulatory
4. Discussion
The anti-aflatoxigenic activity is generally thought to be the out-
come of the fungicidal action, and it was clearly demonstrated by the
direct correlation between the degree of fungal growth and aflatoxin
production (Ni et al., 2010). Benzimidazoles are known to exert
65

P. Dhanamjayulu, et al.
Toxicon 170 (2019) 60–67
these compounds can be added prior to processing or during storage as
antifungal or anti-aflatoxigenic agents.
Many fermentation processes are carried out by species of Aspergillus
and Penicillium having the potential to synthesize mycotoxins. Not only
the organisms involved but contamination carried with raw material
also has the chance to grow due to suitable physiological and nutri-
tional conditions and produce mycotoxins including aflatoxins during
the fermentation process. Aspergillus oryzae, the main organism for koji
fermentation is an atoxigenic strain of A. flavus developed by domes-
tication having 99.5% genomic similarity including the genes involved
biosynthesis (Gibbons et al., 2012; Yin et al., 2018). Though
, longer incubation may result in
mycotoxin synthesis (Ciegler and Vesonder, 1987). Long ago, Kinosita
et al. (1968) reported the toxigenic strains of A. flavus and other As-
pergillus genus from koji.
Table 4
Effect of test compounds on HeLa cells after 48 h of culture in DMEM medium
and 10% FBS.
Compound
μg/well
% Cytotoxicity
Control
–
0.8
1
0
b
94.24 ± 1.00a
−8.17 ± 0.78
−4.29 ± 0.80
AFB
1
6-NFBD
6-CAFBD
6-AFBD
10
1
10
1
10
1
10
a
1.83 ± 0.58
3.28 ± 0.34
7.46 ± 0.46
9.38 ± 0.72
a
a
in AFB
1
a
this strain does not produce AFB
1
FBD
−32.61 ± 1.07
0.57 ± 0.63a
Values are mean (n = 3) ± SD.
SD, standard deviation.
Cheese is another common fermented product, which has the risk of
mycotoxin contamination. Hymery et al. (2014) in their comprehensive
a
Means with the same superscript in the same column for each variable
showing no significant difference at (P ≤ 0.05).
review on mycotoxins in cheese stated that even though the risk of AFB
contamination is low in cheese, it should be controlled. Cheese is
contaminated with various toxigenic fungi including AFB -producing
strains of Aspergillus but it is a poor substrate for AFB production.
Apart from AFM , other aflatoxins had not been reported from cheese,
but there were other reports of sterigmatocystin contamination (Scott,
989; Nasser, 2001), which is a precursor and structurally similar to
1
b
1
Standard AFB Used as a positive control.
1
fungicidal effect and more commonly studied against pathogenic strains
like Candida albicans, and Aspergillus fumigatus (Del Poeta et al., 1998).
Generally antifungal agents work by impairing or disrupting the er-
gosterol, chitin synthesis, targeting nucleic acids, protein synthesis and
microtubule synthesis (Kathiravan et al., 2012), and however the me-
chanism of fungicidal activity of benzimidazoles is not yet clear (Can
et al., 2017; Thamban Chandrika et al., 2018). Apart from pathogenic
fungi, these compounds are also found to be effective against sapro-
phytic strains like Aspergillus flavus (Chandrika et al., 2016). Moon et al.
1
1
1
aflatoxins. However, it is less toxic than aflatoxins (Sweeney and
Dobson, 1998).
The mycotoxin risks in the fermented food can be prevented with
the use of benzimidazole derivatives 6-NFBD, 6-AFBD and 6-CAFBD as
established through this study. These compounds impaired the AFB
1
(
2016) have reported that 1,3-benzodioxole and compounds containing
synthesis without affecting the mold growth. Since mold growth is
necessary for the fermentation process, these compounds may be better
candidates as AFB inhibitors when compared to other known fungi-
1
cides. Safety is an important aspect for the compounds to be used in
food processing. Many benzimidazole derivatives are already in use as
therapeutics, and our preliminary assay with animal cell line also
showed of their non-toxic nature, at the concentrations used, making
1
them promising candidates to be used for the control of AFB during
food processing. However, more animal experiments are necessary to
confirm the safety of these compounds.
methylenedioxy are fungicidal at 1000 μg/mL concentration. However,
the activity decreased drastically at lower concentrations. In the present
study, we found complete inhibition of fungal growth by FBD at 50 μg/
mL and at 9 μg/mL 50% inhibition was noted. More polar derivatives of
FBD (6-NFBD, 6-AFBD, 6-CAFBD, and 6-CFBD) did not impair the
fungal growth but effectively inhibited the AFB biosynthesis.
1
While studying the gene expression of A. flavus in control and in the
presence of 6-NFBD, a significant down-regulation of regulatory aflR
1
and structural aflB gene was observed. 6-NFBD, a strong AFB inhibitor
did not show any effect on the expression of the housekeeping gene
gpdA. The same level of gpdA expression was noted in the presence or
absence of 6-NFBD. This shows that 6-NFBD does not alter the primary
metabolism of A. flavus. aflR gene is a positive regulator for many genes
involved in the secondary metabolism, especially genes coding for the
In conclusion, present study reports that test compounds; 6-NFBD,
6
-AFBD and 6-CAFBD derivatives of a known fungicide, FBD, do not
impair the growth of A. flavus, but specifically inhibit the biosynthesis
of AFB . Test compounds are active even after autoclaving with YES
medium or rice showing their thermal stability. In-vitro testing on HeLa
cell line showed no toxic effect of the compounds at the concentrations
1
1
enzymes involved in AFB synthesis cascade. Absence of aflR gene
product resulted in the inhibition of aflatoxins (Al-Saad et al., 2016; Liu
and Chu, 1998; Yu et al., 2004), and we observed the down-regulation
of aflR in presence of 6-NFBD that can be correlated with the down-
regulation of aflB. The structural gene for the beta subunit of fatty acid
synthase enzyme part of the gene cluster that mediates AFB
synthesis. These observations can explain the inhibition of AFB
1
0 times higher than used in present study. Due to their non-toxic
nature, thermal stability and specific inhibition of AFB synthesis, these
1
compounds can be added during fermentation, food processing or sto-
rage as anti-aflatoxigenic agents.
1
bio-
in
1
presence of 6-NFBD without having any adverse effect on the fungal
growth.
Conflicts of interest
It was reported that the membrane permeability pattern of a dif-
ferent set of benzimidazoles correlates with the polarity and hydro-
philicity factors (Alvarez-Figueroa et al., 2011). Therefore, our results
The authors declare that they have no conflict of interest in the
publication.
predict that such polar derivatives of FBD are controlling the AFB
synthesis.
1
Acknowledgments
It is noted from many studies that compounds found to be effective
in laboratory conditions, like culture medium, have failed in the field
when tested with food grains. However, these benzimidazole deriva-
tives used in the study have also shown good anti-aflatoxigenic activity
in rice. Though the IC50 concentrations were comparatively higher than
that in YES medium (Fig. 5). The test compounds utilized in this study
were found to be quite stable in nature even during autoclaving along
with culture medium (YES) or rice that is done to ensure sterility. Hence
The authors wish to thank the management of the VIT University for
providing the VIT SEED GRANT and facilities for carrying out the work.
The financial support to one of the authors (Dhanamjayulu P) from the
VIT is also gratefully acknowledged. The thanks are due to Dr
Vijayalakshmi S, Associate professor and Dr Ajanta Sircar, Professor,
School of Social Science and Languages, VIT, Vellore, India, for their
help in the editing of the manuscript.
66

P. Dhanamjayulu, et al.
Toxicon 170 (2019) 60–67
Appendix A. Supplementary data
Karlovsky, P., Suman, M., Berthiller, F., De Meester, J., Eisenbrand, G., Perrin, I., Oswald,
I.P., Speijers, G., Chiodini, A., Recker, T., Dussort, P., 2016. Impact of food processing
and detoxification treatments on mycotoxin contamination. Mycotoxin Res. 32,
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.toxicon.2019.09.018.
1
79–205. https://doi.org/10.1007/s12550-016-0257-7.
Kathiravan, M.K., Salake, A.B., Chothe, A.S., Dudhe, P.B., Watode, R.P., Mukta, M.S.,
Gadhwe, S., 2012. The biology and chemistry of antifungal agents: a review. Bioorg.
Med. Chem. 20, 5678–5698. https://doi.org/10.1016/j.bmc.2012.04.045.
Kedia, A., Prakash, B., Mishra, P.K., Dubey, N.K., 2014. Antifungal and antiaflatoxigenic
properties of Cuminum cyminum (L.) seed essential oil and its efficacy as a pre-
servative in stored commodities. Int. J. Food Microbiol. 168–169, 1–7. https://doi.
org/10.1016/j.ijfoodmicro.2013.10.008.
Kinosita, R., Lshiko, T., Sugiyama, S., Seto, T., Lgarasi, S., Goetz, I.E., 1968. Mycotoxins in
fermented food. Cancer Res. 28, 2296–2311.
Lee, H.J., Ryu, D., 2017. Worldwide occurrence of mycotoxins in cereals and cereal-de-
rived food products: public health perspectives of their Co-occurrence. J. Agric. Food
Chem. 65, 7034–7051. https://doi.org/10.1021/acs.jafc.6b04847.
Liu, B.H., Chu, F.S., 1998. Regulation of aflR and its product, AflR, associated with
aflatoxin biosynthesis? Appl. Environ. Microbiol. 64, 3718–3723.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2-ΔΔCT method. Methods 25, 402–408. https://doi.
org/10.1006/meth.2001.1262.
Magan, N., Aldred, D., 2007. Post-harvest control strategies: minimizing mycotoxins in
the food chain. Int. J. Food Microbiol. 119, 131–139. https://doi.org/10.1016/j.
ijfoodmicro.2007.07.034.
Mitchell, N.J., Bowers, E., Hurburgh, C., Wu, F., 2016. Potential economic losses to the US
corn industry from aflatoxin contamination. Food Addit. Contam. Part A Chem. Anal.
Control. Expo. Risk Assess. 33, 540–550. https://doi.org/10.1080/19440049.2016.
References
Aiko, V., Mehta, A., 2013a. Inhibitory effect of clove (Syzygium aromaticum) on the
growth of penicillium citrinum and citrinin production. J. Food Saf. 33, 440–444.
https://doi.org/10.1111/jfs.12074.
Aiko, V., Mehta, A., 2013b. Control of Aspergillus flavus and aflatoxin production with
spices in culture medium and rice. World Mycotoxin J. 6, 43–50. https://doi.org/10.
3
920/WMJ2012.1437.
Al-Saad, L.A., Al-Badran, A.I., Al-Jumayli, S.A., Magan, N., Rodríguez, A., 2016. Impact of
bacterial biocontrol agents on aflatoxin biosynthetic genes, aflD and aflR expression,
and phenotypic aflatoxin B1 production by Aspergillus flavus under different en-
vironmental and nutritional regimes. Int. J. Food Microbiol. 217, 123–129. https://
doi.org/10.1016/j.ijfoodmicro.2015.10.016.
Alaniz Zanon, M.S., Chiotta, M.L., Giaj-Merlera, G., Barros, G., Chulze, S., 2013.
Evaluation of potential biocontrol agent for aflatoxin in Argentinean peanuts. Int. J.
Food Microbiol. 162, 220–225. https://doi.org/10.1016/j.ijfoodmicro.2013.01.017.
Alasmary, F.A.S., Snelling, A.M., Zain, M.E., Alafeefy, A.M., Awaad, A.S., Karodia, N.,
2
015. Synthesis and evaluation of selected benzimidazole derivatives as potential
antimicrobial agents. Molecules 20, 15206–15223. https://doi.org/10.3390/
molecules200815206.
1
138545.
Alvarez-Figueroa, M.J., Pessoa-Mahana, C.D., Palavecino-González, M.E., Mella-Raipán,
J., Espinosa-Bustos, C., Lagos-Muñoz, M.E., 2011. Evaluation of the membrane per-
meability (PAMPA and skin) of benzimidazoles with potential cannabinoid activity
and their relation with the Biopharmaceutics Classification System (BCS). AAPS
PharmSciTech 12, 573–578. https://doi.org/10.1208/s12249-011-9622-1.
Bahrami, K., Khodaei, M.M., Kavianinia, I., 2007. A simple and efficient one-pot synthesis
of 2-substituted benzimidazoles. Synthesis (Stuttg). https://doi.org/10.1055/s-2007-
Moon, Y.S., Choi, W.S., Park, E.S., Bae, I.K., Choi, S.D., Paek, O., Kim, S.H., Chun, H.S.,
Lee, S.E., 2016. Antifungal and antiaflatoxigenic methylenedioxy-containing com-
pounds and piperine-like synthetic compounds. Toxins 8. https://doi.org/10.3390/
toxins8080240.
Mohana, D., Raveesha, K., 2010. Antimycotic, anti-biodeteriorative and antiaflatoxigenic
potency of 2-hydroxy-4-methoxybenzaldehyde isolated from Decalepis hamiltonii on
fungi causing biodeterioration of maize and sorghum grains. J. Mycol. Plant Pathol.
9
65878 547-550.
4
0, 197–206.
Ben Trivedi, A., Kitabatake, N., Doi, E., 1990. Toxicity of dimethyl sulfoxide as a solvent
in bioassay system with HeLa cells evaluated colorimetrically with 3-(4,5-di-
methylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide. Agric. Biol. Chem. 54,
Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival: application
to proliferation and cytotoxicity assays. J. Immunol. Methods 65, 55–63. https://doi.
org/10.1016/0022-1759(83)90303-4.
Nasser, Laila A., 2001. Fungal contamination of white cheese at the stage of consumption
in Saudi Arabia. Pak. J. Biol. Sci. 4.6, 733–735.
Neme, K., Mohammed, A., 2017. Mycotoxin occurrence in grains and the role of post-
harvest management as a mitigation strategies. A review. Food Control 78, 412–425.
https://doi.org/10.1016/j.foodcont.2017.03.012.
Ni, M., Gao, N., Kwon, N.-J., Shin, K.-S., Yu, J.-H., 2010. Regulation of Aspergillus
Conidiation. Cellular and Molecular Biology of Filamentous Fungi. American Society
of Microbiology, pp. 559–576.
Panda, P., Mehta, A., 2013. Aflatoxin detoxification potential of ocimum tenuiflorum. J.
Food Saf. 33, 265–272. https://doi.org/10.1111/jfs.12048.
Pandey, A.K., Sonker, N., Singh, P., 2016. Efficacy of some essential oils against Aspergillus
flavus with special reference to lippia alba oil an inhibitor of fungal proliferation and
aflatoxin B1 production in green gram seeds during storage. J. Food Sci. 81,
M928–M934. https://doi.org/10.1111/1750-3841.13254.
Pildain, M.B., Vaamonde, G., Cabral, D., 2004. Analysis of population structure of
Aspergillus flavus from peanut based on vegetative compatibility, geographic origin,
mycotoxin and sclerotia production. Int. J. Food Microbiol. 93, 31–40. https://doi.
org/10.1016/j.ijfoodmicro.2003.10.007.
Scott, P.M., 1989. Mycotoxigenic fungi contaminants of cheese and other dairy products.
In: Van Egmond, H.P. (Ed.), Mycotoxin in Dairy Products. Elsevier Applied Science,
New York, pp. 193–259.
2
961–2966. https://doi.org/10.1080/00021369.1990.10870409.
Binder, E.M., Tan, L.M., Chin, L.J., Handl, J., Richard, J., 2007. Worldwide occurrence of
mycotoxins in commodities, feeds and feed ingredients. Anim. Feed Sci. Technol.
1
37, 265–282. https://doi.org/10.1016/j.anifeedsci.2007.06.005.
Can, N.Ö., Acar Çevik, U., Saǧlik, B.N., Levent, S., Korkut, B., Özkay, Y., Kaplancikli, Z.A.,
Koparal, A.S., 2017. Synthesis, molecular docking studies, and antifungal activity
evaluation of new benzimidazole-triazoles as potential lanosterol 14α -demethylase
inhibitors. J. Chem 2017. https://doi.org/10.1155/2017/9387102.
Chandrika, N.T., Shrestha, S.K., Ngo, H.X., Garneau-Tsodikova, S., 2016. Synthesis and
investigation of novel benzimidazole derivatives as antifungal agents. Bioorg. Med.
Chem. 24, 3680–3686. https://doi.org/10.1016/j.bmc.2016.06.010.
Chang, P.K., Horn, B.W., Dorner, J.W., 2005. Sequence breakpoints in the aflatoxin
biosynthesis gene cluster and flanking regions in nonaflatoxigenic Aspergillus flavus
isolates. Fungal Genet. Biol. 42, 914–923. https://doi.org/10.1016/j.fgb.2005.07.
0
04.
Ciegler, A., Vesonder, F., 1987. CRC Handbook of Microbiology. CRC Press, Boca Raton.
Del Poeta, M., Schell, W.A., Dykstra, C.C., Jones, S.K., Tidwell, R.R., Kumar, A., Boykin,
D.W., Perfect, J.R., 1998. In vitro antifungal activities of a series of dication-sub-
stituted carbazoles, furans, and benzimidazoles. Antimicrob. Agents Chemother. 42,
2
503–2510.
Divakara, S.T., Aiyaz, M., Hariprasad, P., Nayaka, S.C., Niranjana, S.R., 2014. Aspergillus
flavus infection and aflatoxin contamination in sorghum seeds and their biological
management. Arch. Phytopathol. Plant Prot. 47, 2141–2156. https://doi.org/10.
Sweeney, M.J., Dobson, A.D.W., 1998. Mycotoxin production by Aspergillus, Fusarium and
Penicillium species. Int. J. Food Microbiol. 43, 141–158. https://doi.org/10.1016/
S0168-1605(98)00112-3.
Tarín, A., Rosell, M.G., Guardino, X., 2004. Use of high-performance liquid chromato-
graphy to assess airborne mycotoxins: aflatoxins and ochratoxin A. J. Chromatogr., A
1
080/03235408.2013.869892.
Erdogan, A., 2004. The aflatoxin contamination of some pepper types sold in Turkey.
Chemosphere 56, 321–325. https://doi.org/10.1016/j.chemosphere.2004.02.020.
Ferre, F.S., 2016. Worldwide occurrence of mycotoxins in rice. Food Control 62, 291–298.
https://doi.org/10.1016/j.foodcont.2015.10.051.
Gibbons, J.G., Salichos, L., Slot, J.C., Rinker, D.C., McGary, K.L., King, J.G., Klich, M.A.,
Tabb, D.L., McDonald, W.H., Rokas, A., 2012. The evolutionary imprint of domes-
tication on genome variation and function of the filamentous fungus Aspergillus or-
yzae. Curr. Biol. 22, 1403–1409. https://doi.org/10.1016/j.cub.2012.05.033.
Guerra, F.Q.S., Araújo, R.S.A. De, Sousa, J.P. De, Pereira, F.D.O., Mendonça-Junior,
F.J.B., Barbosa-Filho, J.M., De Oliveira Lima, E., 2015. Evaluation of antifungal ac-
tivity and mode of action of new coumarin derivative, 7-Hydroxy-6-nitro-2H-1-ben-
zopyran-2-one, against Aspergillus spp. evidence-based complement. Altern. Med
1
047, 235–240. https://doi.org/10.1016/j.chroma.2004.06.094.
Thamban Chandrika, N., Shrestha, S.K., Ranjan, N., Sharma, A., Arya, D.P., Garneau-
Tsodikova, S., 2018. New application of neomycin B-bisbenzimidazole hybrids as
antifungal agents. ACS Infect. Dis. 4, 196–207. https://doi.org/10.1021/acsinfecdis.
7
b00254.
Toteja, G.S., Mukherjee, A., Diwakar, S., Singh, P., Saxena, B.N., Sinha, K.K., Sinha, A.K.,
Kumar, N., Nagaraja, K.V., Bai, G., Prasad, C.A.K., Vanchinathan, S., Roy, R., Sarkar,
S., 2006. Aflatoxin B1 contamination of parboiled rice samples collected from dif-
ferent states of India: a multi-centre study. Food Addit. Contam. 23, 411–414.
https://doi.org/10.1080/02652030500442490.
2
015. https://doi.org/10.1155/2015/925096.
Wright, M.S., Greene-Mcdowelle, D.M., Zeringue, H.J., Bhatnagar, D., Cleveland, T.E.,
Hein, D.W., Alheim, R.J., Leavitt, J.J., 1957. The use of polyphosphoric acid in the
synthesis of 2-aryl- and 2-Alkyl-substituted benzimidazoles, benzoxazoles and ben-
zothiazoles. J. Am. Chem. Soc. 79, 427–429. https://doi.org/10.1021/ja01559a053.
Herrman, T.J., Trigo-Stockli, D., Pedersen, J.R., 2002. Mycotoxins in Feed Grains and
Ingredients: Cooperative Extension Service. Kansas State University.
Hua, S.S.T., Hernlem, B.J., Yokoyama, W., Sarreal, S.B.L., 2015. Intracellular trehalose
and sorbitol synergistically promoting cell viability of a biocontrol yeast, Pichia
anomala, for aflatoxin reduction. World J. Microbiol. Biotechnol. 31, 729–734.
https://doi.org/10.1007/s11274-015-1824-3.
Hymery, N., Vasseur, V., Coton, M., Mounier, J., Jany, J.L., Barbier, G., Coton, E., 2014.
Filamentous fungi and mycotoxins in Cheese: a review. Compr. Rev. Food Sci. Food
Saf. 13, 437–456. https://doi.org/10.1111/1541-4337.12069.
Janeczko, M., Kazimierczuk, Z., Orzeszko, A., Niewiadomy, A., Krol, E., Szyszka, R.,
Masłyk, M., 2016. In search of the antimicrobial potential of benzimidazole deriva-
tives. Pol. J. Microbiol. 65, 359–364.
2
000. Effects of volatile aldehydes from Aspergillus-resistant varieties of corn on
Aspergillus parasiticus growth and aflatoxin biosynthesis. Toxicon 38, 1215–1223.
https://doi.org/10.1016/S0041-0101(99)00221-4.
Yin, Z., Wu, W., Sun, C., Lei, Z., Chen, H., Liu, H., Chen, W., Ma, J., Min, T., Zhang, M.,
Wu, H., 2018. Comparison of releasing bound phenolic acids from wheat bran by
fermentation of three Aspergillus species. Int. J. Food Sci. Technol. 53, 1120–1130.
https://doi.org/10.1111/ijfs.13675.
Yu, J., Chang, P.K., Ehrlich, K.C., Cary, J.W., Bhatnagar, D., Cleveland, T.E., Payne, G.A.,
Linz, J.E., Woloshuk, C.P., Bennett, J.W., 2004. Clustered pathway genes in aflatoxin
biosynthesis. Appl. Environ. Microbiol. 70, 1253–1262. https://doi.org/10.1128/
AEM.70.3.1253-1262.2004.
Zoghi, A., Khosravi-Darani, K., Sohrabvandi, S., 2014. Surface binding of toxins and
heavy metals by probiotics. Mini Rev. Med. Chem. 14, 84–98. https://doi.org/10.
2
174/1389557513666131211105554.
67