Synthesis, antiproliferative activity, and DNA binding studies of nucleoamino acid-containing Pt(II) complexes

Article abstract of DOI:10.3390/ph13100284

We here report our studies on the reaction with the platinum(II) ion of a nucleoamino acid constituted by the l-2,3-diaminopropanoic acid linked to the thymine nucleobase through a methylenecarbonyl linker. The obtained new platinum complexes, characterized by spectroscopic and mass spectrometric techniques, were envisaged to exploit synergistic effects due to the presence of both the platinum center and the nucleoamino acid moiety. The latter can be potentially useful to protect the complexes from early deactivation, as well as to facilitate their cell internalization. The biological activity of the complexes in terms of antiproliferative effects was evaluated in vitro on different cancer cell lines and healthy cells, showing the best results on human cervical adenocarcinoma (HeLa) cells along with good selectivity for cancer over normal cells. In contrast, the metal-free nucleoamino acid did not show any cytotoxicity on both normal and cancer cell lines. Finally, the ability of the novel Pt(II) complexes to bind various DNA model systems was investigated by circular dichroism (CD) spectroscopy and polyacrylamide gel electrophoresis analyses proving that the newly obtained compounds can potentially target DNA, similarly to other well-known anticancer Pt complexes, with a peculiar G-quadruplex vs. duplex selectivity.

Full text of DOI:10.3390/ph13100284

pharmaceuticals
Article
Synthesis, Antiproliferative Activity, and DNA
Binding Studies of Nucleoamino Acid-Containing
Pt(II) Complexes
Claudia Riccardi 1,† , Domenica Capasso 2,† , Angela Coppola 1, Chiara Platella 1
Daniela Montesarchio 1 , Sonia Di Gaetano 3 , Giovanni N. Roviello 3 and
,
Domenica Musumeci 1,3,
*
1
Department of Chemical Sciences, University of Napoli Federico II, 80126 Napoli, Italy;
claudia.riccardi@unina.it (C.R.); angelacoppola94@gmail.com (A.C.); chiara.platella@unina.it (C.P.);
montesar@unina.it (D.M.)
CESTEV, University of Napoli Federico II, 80145 Napoli, Italy; domenica.capasso@unina.it
CNR, Institute of Biostructure and Bioimaging, 80134 Napoli, Italy; digaetan@unina.it (S.D.G.);
giroviel@unina.it (G.N.R.)
2
3
*
†
Correspondence: domenica.musumeci@unina.it; Tel.: +39-081-674143
These authors contributed equally to this work.
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
ꢀꢁꢂꢃꢄꢅꢆ
Received: 14 July 2020; Accepted: 28 September 2020; Published: 30 September 2020
Abstract: We here report our studies on the reaction with the platinum(II) ion of a nucleoamino
acid constituted by the l-2,3-diaminopropanoic acid linked to the thymine nucleobase through a
methylenecarbonyl linker. The obtained new platinum complexes, characterized by spectroscopic and
mass spectrometric techniques, were envisaged to exploit synergistic effects due to the presence of both
the platinum center and the nucleoamino acid moiety. The latter can be potentially useful to protect
the complexes from early deactivation, as well as to facilitate their cell internalization. The biological
activity of the complexes in terms of antiproliferative effects was evaluated in vitro on different cancer
cell lines and healthy cells, showing the best results on human cervical adenocarcinoma (HeLa) cells
along with good selectivity for cancer over normal cells. In contrast, the metal-free nucleoamino
acid did not show any cytotoxicity on both normal and cancer cell lines. Finally, the ability of the
novel Pt(II) complexes to bind various DNA model systems was investigated by circular dichroism
(CD) spectroscopy and polyacrylamide gel electrophoresis analyses proving that the newly obtained
compounds can potentially target DNA, similarly to other well-known anticancer Pt complexes,
with a peculiar G-quadruplex vs. duplex selectivity.
Keywords: Pt(II) complexes; nucleoamino acid ligand; NMR spectroscopy; antiproliferative activity;
DNA binding studies; CD spectroscopy
1. Introduction
Cisplatin (cis-diaminedichloro-platinum, CDDP) is one of the most active chemotherapeutic agents
used for the treatment of a large variety of malignancies, especially testicular and ovarian carcinomas,
even if its clinical utility is restricted by both toxicological and tumor resistance drawbacks [
1,2].
CDDP activity and toxicity is mainly due to DNA binding [ ], occurring via both inter- and intrastrand
3,4
crosslinks, that suppresses DNA replication and also RNA transcription. Specifically, CDDP interacts
with the DNA nucleobases forming stable platinum–nitrogen covalent bonds, which lead to irreversible
adducts responsible for cisplatin antitumor activity [1,4].
The drawbacks and side effects of cisplatin treatment [
1,2] have stimulated the design and
synthesis of new anticancer Pt-based drugs with the aim of obtaining compounds more effective and
Pharmaceuticals 2020, 13, 284; doi:10.3390/ph13100284
www.mdpi.com/journal/pharmaceuticals

Pharmaceuticals 2020, 13, 284
2 of 20
less toxic than CDDP. Thus, in the last decades, a wide variety of Pt complexes have been tested for
antiproliferative activity [
approved for clinical use.
5–7]. Some have also entered in clinical trials, but only a few have been
As ligands to be incorporated in Pt-based complexes, most studies focused on bioactive molecules,
such as peptides [ ], carbohydrates [ ], fatty acids [10 11], amino acids (both proteinogenic or
not) [ 12], nucleosides, nucleotides [13 15], and natural products [16], to obtain compounds with
8
7,9
,
8
,
–
enhanced activity thanks to the synergistic effects of the Pt ion and the bioactive ligand. Since the
aforementioned bioactive molecules are widespread in living organisms, when used as Pt(II) ligands,
the metal center can be masked, retarding the complex deactivation or avoiding its recognition by
a specific protein. Nucleosides or nucleobases represent an interesting class of molecules for drug
conjugation, due to the presence in vivo of specific proteins which can favor their delivery and cellular
internalization [17
remarkable biological properties. On the other side, amino acids may bind Pt(II) ions as bidentate
chelates, providing a five-membered ring, including the platinum center, the -amino, and the
-carboxylic acid functions [ 19 20]. Furthermore, polar and charged amino acids may also coordinate
,18]. Thus, their conjugation to a reactive Pt center can produce molecules with
α
α
8
,
,
platinum through their side chains [19]. The nature and length of the side chains can also influence the
solubility and membrane permeability of the resulting complexes and, consequently, the platinum
concentration inside the cell [21]. It is interesting to consider the reaction between the metallic center
and diamino acids, or, in general, amino acids containing in their side chains amino (lysine, arginine,
and histidine) or amide (asparagine and glutamine) groups, that also exploit the side-chain function for
the metal chelation [19
as in the case of the diamino acids ornithine, which binds platinum through the
functions [ 22], and l-2,3-diaminopropanoic acid (DAP-OH), yielding Pt(II) complexes with a square
planar structure in which both the - and -amino groups of the diamino acid, along with the -amino
and α-carboxylic functions, can bind the Pt ion forming a 5-membered ring (Figure 1a) [21,22,24].
,22
,
23]. Complexes with non-proteinogenic amino acids have also been realized,
α
-NH2 and -COOH
α
8
,
α
β
α
Figure 1.
(a) Platinum complexes of l-2,3-diaminopropanoic acid (DAP-OH); (b) general structure of a
nucleoamino acid.
Considering the capability of the platinum ion to bind both nucleobases and amino acids,
our novel design consisted of Pt(II) complexes, incorporating as ligands nucleoamino acids, constituted
by nucleobases linked to an amino acid through a suitable linker (Figure 1b), and thus, intrinsically
containing various potential platinum binding sites. To the best of our knowledge, this is the first report
on Pt complexes incorporating this kind of ligand. Nucleoamino acids have been widely explored in the
literature, mainly as building blocks for the assembly of nucleopeptides, compounds potentially able
to bind complementary nucleic acids in antisense/antigene strategies, or to give ordered self-assembly,
a useful property in the context of the development of new nanomaterials [25–31].
Recently, a 9-fluorenylmethoxycarbonyl (Fmoc)-protected nucleoamino acid, obtained connecting
the Fmoc-diaminopropanoic acid (Fmoc-DAP-OH) to the thymine acetic acid, was synthesized in our

Pharmaceuticals 2020, 13, 284
3 of 20
group and then used to obtain, via solid-phase peptide synthesis, a homothymine nucleopeptide for
potential biomedical applications [30].
Here we used the deprotected DAP(T)–OH nucleoamino acid for platinum complexation to
obtain new Pt complexes in which synergistic anticancer effects were envisaged for the presence
of both the nucleobase and the platinum center. The selected nucleoamino acid contained several
donor groups for platinum (i.e., the nitrogen atoms of the α-amino group, the nucleobase, or the
amide in the methylenecarbonyl linker, and the oxygens of the carboxylic function of the nucleoamino
acid) and could potentially form a large variety of Pt complexes. The compounds obtained from the
platination reaction of DAP(T)–OH were purified and characterized by nuclear magnetic resonance
(NMR), mass spectrometry, and ultraviolet–visible (UV-vis) techniques. Then, the antiproliferative
activity of the new Pt(II) complexes was evaluated in preliminary tests on different cancer cell lines and
normal human cells, using the starting nucleoamino acid as a reference compound. Finally, in analogy
to other metal complexes, the ability of the new Pt(II) complexes to bind DNA was also explored using
circular dichroism (CD) and polyacrylamide gel electrophoresis analyses on different DNA model
systems, both in random coil and in structured forms.
2. Results and Discussion
2.1. Preparation of the Nucleoamino Acid Ligand
The Fmoc-protected nucleoamino acid 3, based on l-2,3-diaminopropanoic acid and carrying
the nucleobase thymine attached through a methylenecarbonyl linker to its
obtained as previously reported [30]. In brief, commercially available Fmoc-L-DAP(Boc)-OH
, Scheme 1) was first treated with a trifluoroacetic acid (TFA)/CH2Cl2 (1:1, v/v) solution
for the selective removal of the tert-butoxycarbonyl (Boc) protecting group from the
-amino function (almost quantitative yield). Then, the desired product was coupled with
β-amino group, was
(1
β
2
thymine acetic acid using 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium
3-oxid hexafluorophosphate/N,N-diisopropylethylamine (HATU/DIEA) as the coupling agent,
obtaining compound
quantitatively achieved upon treatment with piperidine. The final deprotected nucleoamino acid
was purified by high-performance liquid-chromatography (HPLC) and characterized by mass
3 in 80% overall yield. Fmoc removal from the DAP-moiety in 3 was
4
spectrometry (MS), i.e., matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) and
liquid chromatography-electrospray ionization (LC-ESI) MS (Figure S1), and NMR spectroscopy
(Figures S2 and S3), which in all cases confirmed the identity and purity of the target compound.
2.2. Platination of the DAP(T)-Based Nucleoamino Acid
Analogously to previous works [
5,12], the platination reaction was carried out mixing DAP(T)–OH
(4, Scheme 1), as a Pt chelator, and K2PtCl4 in CH3OH:H2O (9:1, v/v) under stirring at room temperature
in the dark. Subsequently, the solvent was removed under vacuum at low temperature, and the dried
crude was sequentially treated with various organic solvents (see Materials and Methods) to dissolve
the yellow solid. In detail, a solid–liquid extraction, followed by washings and centrifugations, using
not significantly coordinating solvents with increasing polarity (CH2Cl2, CHCl3, CH3COCH3, CH3OH,
H2O), was performed. Neither the apolar solvents (CH2Cl2, CHCl3) nor acetone were able to dissolve
the solid allowing the recovery of the Pt complexes. In contrast, methanol was able to solubilize and
recover a yellow product and, subsequently, H2O dissolved the second and last complex (see Materials
and Methods).

Pharmaceuticals 2020, 13, 284
4 of 20
Scheme 1. Synthetic procedure for the preparation of the nucleoamino acid DAP(T)–OH(4) and its
platinum complexes. Reagents and conditions: (I) trifluoroacetic acid (TFA)/CH2Cl2 (1:1, v/v), 45 ◦C,
1.5 h (98% yield); (II) thymine acetic acid, 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-
b]pyridinium 3-oxid hexafluorophosphate/N,N-diisopropylethylamine (HATU/DIEA) in N,N-
dimethylformamide (DMF), 2 h, room temperature (r.t.) (80%); (III) piperidine (8 equiv.) in DMF/CH3OH
(9:1, v/v), r.t., 10 min (98%); (IV) K2PtCl4 in CH3OH/H2O (9:1, v/v), 6 h, r.t., in the dark; (V) dimethyl
sulfoxide (DMSO) dissolution of the platinum complexes obtained under conditions IV to favour
DMSO-exchange reaction.
The two obtained products were subjected to LC-ESI-MS analysis, showing a single
chromatographic peak in the total ion current (TIC) profile of the injection performed immediately after
their dissolution (t = 0, Figure S4a, left) with a complex mass spectrum denoting fragmentation during
the ionization process (Figure S4a, right). Both the complexes showed almost the same peaks in the mass
spectrum, evidencing that they followed the same fragmentation pattern and could probably be isomers
(as an example, in Figure S4, we reported the LC-ESI-MS analysis of the methanol-recovered complex).
From the analysis of the mass peaks of the complexes (Figure S4a, right), we could hypothesize that
they both contained in their structures a DAP(T)–OH unit, platinum(II) and chloride ions, and a water
molecule. The injection performed 10 min after the dissolution of both the compounds showed at
least three peaks in the TIC profiles, each associated with a mass spectrum very difficult to interpret,
evidencing that the Pt complexes are very unstable in aqueous solutions (Figure S4b) and, thus, difficult
to handle for both their characterization and subsequent in vitro assays.
Then, since the most commonly used NMR organic solvents (CDCl3, CD3OD, CD3COCD3) were
not able to solubilize the two products at the minimum concentration required for a complete NMR
characterization, we decided to dissolve the complexes in a highly solubilizing solvent, such as
N,N-dimethylformamide (DMF) or dimethyl sulfoxide (DMSO). Even if these solvents are well known
to trigger exchange reactions with various Pt(II) ligands (see [5,15] for DMSO and [13] for DMF), in
many cases, DMSO moieties were intentionally inserted in various bioactive platinum complexes to

Pharmaceuticals 2020, 13, 284
5 of 20
increase their activity and stability [
5
,15]. The compounds obtained after DMSO treatment (Scheme 1)
were named T1 and T2. They were derived, respectively, from the Pt complexes originally recovered
with CH3OH and H2O.
As expected, in the ESI mass spectra (positive ion-mode) of the DMSO-solubilized complexes,
we effectively verified the occurrence of the exchange reaction realized by the solvent. Indeed, for
both complexes, the found mass peaks were attributed to molecules containing a DAP(T)–OH unit, a
platinum(II) ion, a chloride ion, and a DMSO molecule (m/z ca. 579, Figure S5a), indicating that the two
complexes were either constitutional or geometrical isomers. In the recorded mass spectra, T1- and
T2-adducts with Na+ and K+ ions were also found, respectively, at ca. 601 and 617 m/z (Figure S5a).
The peak isotopic distribution for each species found in the mass spectra of the two isomers
was almost superimposable to the theoretical one calculated with the Isotope Distribution Calculator
program (http://www.sisweb.com/mstools/isotope.htm). As an example, we reported the comparison
between the theoretical and experimental peak at ca. 579 m/z of T1 (Figure S5b).
To verify how the nucleoamino acid ligand coordinated the platinum(II) ion in these isomers,
mono- and bi-dimensional NMR experiments were carried out, recording all the spectra in DMSO-d6
(Figures S6–S8). The 1H and 13C-NMR spectra of DAP(T)–OH were used as references to evaluate the
shifts of the corresponding signals in the complexes, thus obtaining information on the atoms directly
involved in the coordination or influenced in their spectral properties by the proximity to the metal
center. In Table 1, the 1H and 13C NMR chemical shift values for T1 and T2 were reported in comparison
to the starting ligand. Assignments were based on correlation spectroscopy (COSY), heteronuclear
single quantum correlation (HSQC), and heteronuclear multiple-bond correlation (HMBC) experiments
(Tables S1–S3).
Table 1. Nuclear magnetic resonance (NMR)-chemical shift assignments for T1 and T2 metal complexes
compared to those of the starting nucleoamino acid DAP(T)–OH (spectra recorded in dimethyl
sulfoxide-d6 (DMSO-d6). Chemical shift values in blue for T1 and T2 indicate signals very similar
to those of the starting ligand, whereas those in red are the most diverging ones; green-colored
chemical shift values evidence proton and carbon signals of T1 and T2 not present in the starting
nucleoamino acid.
1H-NMR
DAP(T)–OH
13C-NMR
DAP(T)–OH
ppm
T1
1.75
T2
1.75
11.30
7.43
4.34
8.43
3.55
3.29
3.51
6.25
5.63
3.16
ppm
T1
T2
CH3-5(T)
1.75
11.25
7.41
4.31
8.35
3.53
3.33
3.27
-
CH3-5(T)
11.87
151.05
164.36
108.01
142.31
49.16
11.93/11.91
151.05
11.94
H-3 (T)
11.29/11.28
7.44/7.43
4.35
C-2 (T)
151.07
164.47
108.16
142.23
49.27
H-6 (T)
C-4 (T)
164.44/164.42
108.10/107.98
142.24
A
C-5 (T)
C
8.58/8.48
3.64/3.56
3.49/3.28
3.90/3.52
6.29
C-6 (T)
D1
A
49.22
D2
B
167.77
39.62
168.86/168.31
41.66/38.58
56.78/52.40
181.33
168.44
41.69
E
D
G1
E
54.04
56.90
G2
-
5.68
F
168.82
181.38
48.61
CH3 (DMSO-Pt)
3.16
CH3 (DMSO-Pt)
49.02
In particular, in the 1H NMR spectra of T1 and T2 complexes, two signals, i.e., broad multiplets at
5.68 and 6.29 ppm (for T1, Figure S6, up) and 5.63 and 6.25 ppm (for T2, Figure S7), were diagnostic
of protons belonging to a nitrogen bound to platinum(II) center, in accordance with other complexes
reported in the literature [32]. The two amino protons, equivalent and easily exchangeable in the
starting compound, became not equivalent and not easily exchangeable when the α-amino group

Pharmaceuticals 2020, 13, 284
6 of 20
coordinated the Pt ion. In addition, both proton and carbon signals of the CH-
α
(indicated as E) in
T1 and T2 were markedly downfield shifted with respect to the corresponding signal in the starting
amino acid (Table 1), indicating the presence of platinum in the proximity of this group. In the 13
C
NMR spectra of both complexes, a downfield shift from 168 to about 181 ppm of the carboxylic
carbon F was observed, indicating the coordination of the carboxylic group to the metal center. Strong
evidence of the presence of DMSO as a platinum ligand in both Pt complexes came from new proton
and carbon signals in T1 and T2, attributable to the methyl groups linked to the Pt-bound sulfur
(downfield-shifted with respect to free DMSO), in agreement with chemical shifts reported in the
literature for DMSO-containing Pt complexes [5,15].
Notably, in the explored conditions, only for T1 and not for T2, the presence of two rotamers
(doubling of some proton/carbon signals) was observed. Rotamers, which are generally reported
for peptide nucleic acid (PNA) or some nucleoamino acid monomers [33,34], are due to a restricted
rotation around the amide bond. Thus, it can be deduced that the rotation of the nucleobase around
the methylene group occurred more rapidly for T2 than for T1 in the NMR time scale.
All the NMR data indicated that both complexes coordinate platinum through the
α-NH2 and
α
-COOH groups, whereas the nucleobase, the methylenecarbonyl linker, and the amidic nitrogen
were not involved in the metal center complexation. Thus, T1 and T2 can differ only for the relative
position of the DMSO and chloride ligands. To confirm the exact position of these ligands in T1 and
T2, nuclear Overhauser effect spectroscopy (NOESY) experiments were also performed. A diagnostic
cross peak between the proton of the amino group coordinating the platinum and the DMSO-methyl
groups was found in T2 NOESY spectrum but not in T1 (Table S4 and Figure S9). Finally, molecular
modeling analysis of the Pt complexes, by applying the MMFF94 energy minimization method [35,36],
confirmed the observed NOESY correlations (Figures S10 and S11, realized using the MOLVIEW
program [35]). Taken together, the obtained data concurred to define for T1 and T2 the structures
reported in Scheme 1, whereas for the initially obtained complexes, we hypothesize the structures
depicted in Figure S11 (bottom).
To definitively confirm the structures of T1 and T2, as well as of their precursors, we tried to
crystalize them in different ways to perform X-ray diffraction studies. Unfortunately, attempts to
obtain good quality crystals were unsuccessful, and only decomposition products were observed.
2.3. UV-Vis Analysis of T1 and T2 Platinum Complexes in Aqueous Solution
Before analyzing the UV-vis behavior of T1 and T2 in aqueous solution, we first characterized
the absorption spectral properties of the starting nucleoamino acid DAP(T)-OH. The UV spectrum
of DAP(T)-OH, dissolved at 80
KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4), showed an intense band at 268 nm, characteristic of the
thymine nucleobase (
260 = 8560 M−1cm−1) [37]. The UV signal was monitored over time up to 96 h.
µM conc. in PBS (phosphate-buffered saline, 137 mM NaCl, 2.7 mM
ε
Apart from a very slight increase in the 268-nm band in the first 24 h, no significant spectral changes
were observed over a longer monitoring time, indicating good stability of DAP(T)–OH in the tested
buffer solution (Figure S12).
The UV-vis spectra of T1 and T2 complexes in PBS showed, in both cases, the main band relative
to the thymine chromophore almost overlapped to that of DAP(T)-OH, further confirming that the
nucleobase does not participate to the Pt coordination. This band, having a high extinction molar
coefficient, probably submerged possible absorption bands relative to metal/ligands charge-transfer
transitions. Indeed, only a weak band at about 330 nm, which proved the presence of the metal in the
complexes, was detected (Figure 2).

Pharmaceuticals 2020, 13, 284
7 of 20
Figure 2. Overlapped ultraviolet-visible (UV-vis) spectra of the two platinum complexes (T1 and
T2) and the starting ligand DAP(T)–OH dissolved at 80 µM concentration in phosphate-buffered
saline (PBS).
The stability of the complexes was evaluated by monitoring their UV spectra in PBS over time for
48 h. In the first hour of monitoring, an increase in both the 268 and 330 nm bands occurred with a
concomitant 1 nm red-shift of the maximum of the 268-nm band (Figures S13a and S14a). Then, after
1 h, the weak metal-to-ligand charge transfer (MLCT) band started to decrease, probably due to the
exchange reactions between water and the labile ligands. The overall UV signal stabilized after 48 h
(Figures S13b and S14b).
Overall, the variations in the UV-vis spectra of both metal complexes were barely detectable,
resulting in a slight hyperchromic- and red-shift of the band at 268 nm and a small decrease in the
330 nm band (Figures S13c and S14c).
2.4. NMR Analysis of T1 and T2 Platinum Complexes in Aqueous Solution
Since only moderate changes were detected in the UV-vis spectra of T1 and T2 in aqueous solution
during the time-course experiments, due to the strong absorption of the nucleobase with respect to
the weak MLCT bands of the metal complexes, we followed their stability over time using another
technique. In particular, by using 1H-NMR experiments, we observed that both the platinum complexes
were stable for months in DMSO-d6. By adding 10% D2O to the DMSO-d6 solution of T1 and T2
,
we evidenced the appearance of new signals and the intensity reduction of others, denoting that more
than one species was formed from the original ones. However, with only 10% water, the complexes
were still quite stable. Indeed, the new species started appearing after 8 h, and intact T1 and T2 were
still present in the solution for almost 50% of their initial amount after 48 h (see Figure S15a for T2).
Probably, the first exchanged ligand by water was chloride, followed (after at least 24 h) by DMSO,
as evidenced by the appearance of the free DMSO signal (at 2.23 ppm). The hydrolysis of the Pt
complexes was also monitored by dissolving them directly in D2O. Obviously, in this case, the process
was faster, affording the complete exchange of the DMSO ligand after 48 h, and the detachment from the
metal also of the DAP(T)–OH ligand after 96 h (see Figure S15b for T2 complex). Even if monitoring T1
behavior was complicated by the presence of the rotamers, which rendered the spectra interpretation
more difficult, by following the appearance of the free DMSO signal in both the complexes dissolved
in D2O, we observed a slightly faster exchange of this ligand for T2 than for T1 (Figure S16).
2.5. Antiproliferative Activity of the T1 and T2 Platinum Complexes
The antiproliferative effects of T1 and T2 complexes were evaluated on three different tumor
cell lines (i.e., HeLa, human cervical adenocarcinoma; WM266, metastatic melanoma; MCF-7, breast
adenocarcinoma) and one healthy cellular model (HDF, human fibroblasts). Cells were treated with

Pharmaceuticals 2020, 13, 284
8 of 20
solutions of Pt(II) complexes and DAP(T)–OH freshly diluted in growth medium at 25 and 50 µM
concentrations, and after 48 h, the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)
assay was performed. The percentage of living cells with respect to the control (cells treated only with
the vehicle) for each compound is reported in Figure 3.
Figure 3. Cell viability assay on human cervical adenocarcinoma (HeLa), metastatic melanoma
(WM266), breast adenocarcinoma (MCF-7), and human fibroblasts (HDF). Cells were incubated with T1
,
T2, or DAP(T)–OH at 25 ( ) or 50 (
a
b) µ
M concentration at 37 ◦C for 48 h. Cell viability was measured
by using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The results are
presented as the percentage of living cells with respect to the control (vehicle-treated cells) and are
expressed as means ± SE of at least three independent experiments performed in triplicate.
The results indicated that the complexes showed a good antiproliferative activity on HeLa cells
with a cell viability reduction of 23% and 29%, at 25
and T2. The target complexes were less active on WM266 and MCF-7 cells, reducing their viability
by about 20% at the highest concentration tested (50 M). In turn, the free ligand DAP(T)–OH did
µM, and 55% and 54% at 50 µM, respectively, for T1
µ
not affect the proliferation of all the tested cells, indicating that the activity found for T1 and T2 is
essentially due to the presence of platinum.
However, T1 and T2 complexes proved to be less active than cisplatin (used as positive control)
on the treated tumor cells, but, remarkably, more selective with respect to the healthy ones (Figure S17).
In fact, T1 and T2 did not interfere with the HDF proliferation at the tested concentrations (Figure 3).
2.6. CD-Monitored Binding Experiments of the New Platinum Complexes with DNA Model Systems
Subsequently, the novel Pt(II) complexes T1 and T2, as well as the nucleoamino acid DAP(T)–OH,
were studied by CD spectroscopy in their interaction in solution with DNA sequences representing
useful model systems [38,39]. In detail, we used a 12-mer random coil single strand (ODN1)
containing a central box with two contiguous guanines (GG box), and three secondary structure-forming
oligonucleotides (ODNs), i.e., two hairpin duplexes of 12 base-pairs (one with and the other without a
central GG box), and a unimolecular G-quadruplex (G4) model with three G-quartets. The hairpin
duplexes were formed by two 27-mer self-complementary single strands, classical models for B
DNA duplexes (ds27: two tracts of the Dickerson sequence joined by a central three-thymine (TTT)
loop [40,41]; and dsGG: two 12-mer tracts, one of which contained a GG box, joined by a central TTT
loop), whereas the unimolecular G4 was derived from the 26-mer human telomere sequence (tel26),
which can form in proper conditions G-quadruplex structures. The strong interest for G-quadruplexes
is due to the formation of these non-canonical DNA structures in some regions of the human genome,
especially in telomeres and in regulatory regions of some oncogenes [42–44].
All the CD-binding experiments were performed in a K+-rich buffered solution (100 mM KCl,
7 mM Na2HPO4/NaH2PO4, pH = 7.2) to mimic the intracellular physiological conditions. The ODNs
used as DNA model systems were subjected to the annealing procedure taking the sequences in the
selected buffer at high temperature (95 ◦C) for 5 min, and then leaving them to slowly cool to room

Pharmaceuticals 2020, 13, 284
9 of 20
temperature. This procedure allows structuring either the duplexes and G4 structures, as verified by
the CD spectra (Figure S18). The conformation adopted by tel26 after annealing in the selected buffer
was essentially a hybrid-2 type structure, as evidenced by the comparison of its CD spectrum in Figure
S18d with those reported in the literature [45,46].
Since the contribution to the CD signal of the starting nucleoamino acid and the Pt complexes was
negligible at the concentration used for the experiments (Figure S19), we monitored the CD profiles of
the ODN systems before and after incubation with the target molecules (10 equiv.) dissolved in DMSO,
at different time periods (0, 2, 24, and 48 h) after the addition. As a reference, we also monitored upon
time the CD signal of the ODN solutions after the addition of pure DMSO (same volume as the one
added in previous incubations with the compounds) without evidencing significant changes in the
overall CD spectra.
As shown in Figure 4a,b, significant changes in the CD spectrum of ODN1 were observed when
this was treated with T1 and T2, evidencing that both complexes interacted with this single strand
oligonucleotide. In contrast, the starting nucleoamino acid did not produce relevant CD variations on
ODN1 (Figure 4c). In detail, in the presence of T1, the CD spectrum of ODN1 showed a decrease over
time of the band at 275 nm accompanied by a red-shift of the band maximum reaching the highest
effects 48 h after the complex addition (∆CD275 = 1.3 mdeg, 5 nm red-shift). More marked changes in
the CD band were observed when complex T2 was added to the ODN1 solution. Upon time, the CD
spectrum exhibited a dramatic decrease in the CD signal at 275 nm (ca 70%) accompanied by a 10 nm
red-shift of the band maximum.
Figure 4. Overlapped circular dichroism (CD) spectra of oligonucleotide 1 (ODN1) (2
in the absence (black lines) and presence of T1 ), T2 ), and DAP(T)–OH ( ) (20 M each) at different
times (0, 2, 24, 48 h) after the addition of the target molecules. ( ) Differences in the CD signal at
µM concentration),
(a
(b
c
µ
d
275 nm between the CD spectra of ODN1 before and after 48 h incubation with each added compound.
◦
The experiments were carried out in 100 mM KCl, 7 mM Na2HPO4/NaH2PO4, pH = 7.2, at 20 C
(optical path = 1 cm).
Similarly to ODN1, CD spectroscopy was used to evaluate the interaction of T1, T2,
and DAP(T)–OH with the selected duplex DNA models. In these cases, small changes in the
CD spectra of the duplexes were observed when T1 and T2 were added to the oligonucleotide

Pharmaceuticals 2020, 13, 284
10 of 20
solutions (Figure S20a,b,e,f), whereas no changes were recorded for the incubation with DAP(T)–OH
(Figure S20c,g). In particular, with both the duplex systems, a reduction in the CD signal of about
1 mdeg was observed after incubation with T1 (Figure S20a,d for ds27, and Figure S20e,h for dsGG).
T2 also produced a red-shift of the band maximum of the duplexes of ca. 2 nm, along with a CD
intensity decrease, which, however, was more pronounced for the duplex containing the GG box
compared to ds27 (Figure S20b,d for ds27 and Figure S20f,h for dsGG).
As far as the interactions with the G4 was concerned, only slight differences between the CD
spectrum of tel26 in the absence and presence of the nucleoamino acid DAP(T)–OH were observed up
to 48 h (Figure 5c). In contrast, after the addition of T1 or T2 to the G4 solution, both the main band
at 290 nm and the shoulder at 267 nm significantly decreased over time, reaching, also in this case,
the maximum effects after 48 h incubation (Figure 5a,b).
Figure 5. Overlapped CD spectra of the G-quadruplex (G4) tel26 (2
(black lines) and presence of T1 ), T2 ), and DAP(T)–OH ( ) (20
24, 48 h) after the addition of the target molecules. ( ) Differences in the CD signal at 290 and 267 nm
µM concentration), in the absence
(
a
(
b
c
µM each) at different times (0, 2,
d
between the CD spectra of the G4, before and after 48 h incubation with each added compound.
◦
The experiments were carried out in 100 mM KCl, 7 mM Na2HPO4/NaH2PO4, pH = 7.2, at 20 C
(optical path = 1 cm).
Taken together, the CD data suggested that DNA can be a possible target of the newly obtained
compounds, similar to other well-known anticancer Pt complexes [6,7,12,21,23,47,48], with the
DAP(T)-based Pt complexes inducing important conformational changes in G4 structures and single
stranded ODNs upon binding, contrarily to the duplex structure (either containing or not the GG box).
To compare the ability of the complexes to bind the different DNA systems with that of cisplatin,
the same CD experiments performed with T1 and T2 were also carried out with CDDP under
identical experimental conditions. In agreement with our previous work [47], CDDP proved to
significantly interact with the random-coil single strand containing a GG box (ODN1, Figure S21a)
and the GG-containing duplex (dsGG, Figure S21c), whereas it was not able to perturb or disrupt the
compact G4 structure of tel26 (Figure S21d) nor the duplex not-containing the GG box (Figure S21b).
Furthermore, while CDDP evidenced a clear selectivity towards duplex structures containing a GG box

Pharmaceuticals 2020, 13, 284
11 of 20
(dsGG vs. ds27, Figure S21b,c), T1 and T2 did not efficiently interact with duplex structures, either
containing or not a GG-box element (Figure S20b,c).
Finally, since the UV bands of T1, T2, and DAP(T)–OH significantly overlapped with those of the
selected ODN systems, contrarily to CD analysis, UV data were not useful to interpret the binding
behavior of these complexes towards different DNA structures.
2.7. PAGE-Monitored Binding Experiments of the New Platinum Complexes with DNA Model Systems
The structured DNA model systems that had evidenced, from the CD studies, the higher
conformational variations upon binding with the Pt complexes, were selected for native polyacrylamide
gel electrophoresis (PAGE) experiments to obtain qualitative data on DNA platination and compare the
behavior of T1 and T2 with that of CDDP. In particular, the G4 tel26 and the duplex containing the GG
box (dsGG) were incubated separately for 48 h with 10 equiv. of T1
Inspection of the gel, reported in Figure 6a, evidenced that DNA platination on the GG-duplex occurred
efficiently by CDDP, as expected, and to a less extent by T1 and T2 (with T2 T1), whereas the G4
tel26 was platinated more by T1 and T2 T2 T1) than by CDDP (Figure 6b). Thus, PAGE data were in
, T2, and CDDP at room temperature.
>
(
>
perfect agreement with the CD results (Figure S20e,f, Figure 5a,b, and Figure S21c,d).
Figure 6. Representative 25% polyacrylamide gel electrophoresis (PAGE) under native conditions
relative to the GG-duplex (a) and the G-quadruplex (b) DNA systems (2 µM concentration), alone (lanes 1)
or incubated for 48 h with 10 equiv. of CDDP, T1 and T2 in 100 mM KCl, 7 mM Na2HPO4/NaH2PO4,
pH = 7.2. Gel was run at 80 V, at r.t. for 3.3 h in TBE 1× buffer.
To exclude the contribution of DMSO in the appearance of additional, smeared DNA bands after
ligand incubation, the oligonucleotides were also treated in the same conditions with equal amounts of
this solvent without the ligands. In these experiments, no difference with the reference DNA bands
was evidenced, demonstrating that the observed effects were not due to the solvent (Figure S22).

Pharmaceuticals 2020, 13, 284
12 of 20
3. Materials and Methods
3.1. Reagents, Instruments, and General Methods
All the reagents and solvents were of the highest commercially available quality and were used as
received. The coupling reactions were performed under an argon atmosphere, and all the reagents
were previously co-evaporated with anhydrous CH3CN. Thin layer chromatography (TLC) analyses
were carried out on silica gel plates from Macherey–Nagel (60, F254). Reaction products on TLC
plates were visualized by 254 nm UV-light. DNA sequences were provided by Biomers.net GmbH
(Ulm, Germany).
NMR spectra were recorded on Bruker Avance III HD 400 MHz and Varian Inova 500 MHz NMR
1
spectrometers, as specified. All the chemical shifts (
δ
) in H- and 13C-NMR spectra are expressed
in ppm with respect to the residual solvent (CHD2SOCD3, DMSO-d5,
δ = 2.50 ppm, quintet) or
tetramethylsilane (TMS) signals. All the coupling constants (J) are quoted in Hertz (Hz). The following
abbreviations were used to explain the multiplicities: s = singlet; d = doublet; t = triplet; q = quartet;
quin = quintet; m = multiplet; b = broad.
MALDI-TOF mass spectrometric analyses were performed on a TOF/TOF
™ 5800 System in a
positive mode, using 2,5-dihydroxybenzoic acid (DHB) or -cyano-4-hydroxycinnamic acid (CHCA)
α
as the matrices. For the deposition on the MALDI plate, the droplet spotting method was used.
The sample (1 mg/mL in CH3CN/CH3OH or CH3CN/H2O, 7:3, v/v) was first deposited on the plate
(0.5 µL) followed by matrix deposition (10 mg/mL in the same solvent mixture of the sample) and
properly mixed before drying the components.
LC-ESI-MS analyses were performed on an Agilent 6230B TOF LC/MS instrument, equipped
with a 1260 Infinity HPLC analytical system with binary pump coupled with a 6230 time of flight
mass spectrometer as a detector and an Electrospray source; an Agilent ZORBAX C18 column (1.8 µm,
50 × 4.6 mm) for reverse-phase liquid chromatography were used. Stock solutions of the samples were
prepared at 2 mg/mL concentration in HPLC grade CH3CN/H2O. The injections were carried out at
a final concentration of 4 ng/µL in CH3CN/H2O, using a flow rate of 0.4 mL/min. Column elution
was performed using H2O (A) (with or without 0.05% TFA, as specified) and CH3CN (B) as eluents.
An isocratic elution of B in A for 3 min was followed by a gradient elution increasing B over 10 min.
The ESI/TOF-MS was operated in positive ion mode (100–1500 m/z values).
The semipreparative purifications were carried out on a Hewlett Packard/Agilent 1100 series
HPLC system, equipped with a UV detector, using a Phenomenex Luna C18 100 Å (5
µ
m, 4.6 × 150 mm
)
column. Gradient elution was carried out at 25 ◦C (monitoring at 254 nm) by using a gradient that
started with buffer A (0.05% TFA in water) and applying buffer B (0.05% TFA in acetonitrile) with a
flow rate of 1 mL min−1
.
Samples were lyophilized in an FD4 Freeze Dryer (Heto Lab Equipment) for 16 h.
UV-vis measurements were performed on a JASCO V-550 UV-vis spectrophotometer equipped
with Peltier Thermostat JASCO ETC-505T.
CD spectra were recorded with a Jasco J-715 spectropolarimeter equipped with a Peltier-type
temperature control system (model PTC-348WI).
Energy-minimized 3D structure models (random low energy conformers) were obtained by using
the 3D rendering engine JSmol and applying the MMFF94 energy minimization method [36] coded in
MolView v2.4 (http://molview.org) software [35].
Acrylamide/bis-acrylamide (19:1) 40% solution, GelGreen Nucleic Acid Stain, and Tris-Borate-
Ethylenediaminetetraacetic Acid (EDTA) (TBE) 10X were purchased from VWR. Ammonium persulfate
(APS) and tetramethylethylenediamine (TEMED) were purchased from Sigma–Aldrich.

Pharmaceuticals 2020, 13, 284
13 of 20
3.2. Synthesis of the DAP(T)–OH Nucleoaminoacid
3.2.1. Fmoc-DAP(T)–OH, (S)-2-[(9H-fluoren-9-yl)methoxycarbonylamino]-3-{2-[5-methyl-2,4-dioxo-
3,4-dihydropyrimidin-1(2H)-yl]acetamido} propanoic acid (2)
Fmoc-protected nucleoamino acid
3 (Scheme 1) was obtained as previously reported, with minor
modifications [30]. Briefly, commercially available Fmoc/Boc-protected l-2,3-diaminopropanoic acid
1
(Fmoc-l-Dap(Boc)-OH: 51 mg, 0.120 mmol; Scheme 1) was treated with a 1:1 TFA/CH2Cl2 solution
(2 mL), and the mixture was left under stirring at 45 ◦C for 1.5 h. Then, the solvent was removed in
vacuo, and the crude was treated with cold diethyl ether. A white precipitate, recovered by filtration,
was repeatedly washed with cold diethyl ether and finally dried in vacuo. This product corresponded
to desired Fmoc-DAP-OH (
2, 38 mg, 0.118 mmol, almost quantitative yield), as confirmed by TLC and
NMR analysis [30]. Compound
2
was then dissolved in anhydrous DMF (1 mL), treated with DIEA
(1 equiv., 0.118 mmol, 21 µL) and reacted with commercially available thymine acetic acid (2.2 equiv.,
0.260 mmol, 48 mg), previously activated with HATU (2.0 equiv., 0.230 mmol, 89 mg) and DIEA
(4.0 equiv., 0.470 mmol, 82 µL) in DMF (1 mL) for 3 min. After 3 h at room temperature, under magnetic
stirring and argon atmosphere, the solvent was removed in vacuo. The crude material was treated
with a 0.1% TFA aq. solution and filtered off to remove the aqueous solution from the white precipitate.
This solid was resuspended in a mixture of H2O/CH3CN (7:3, v/v) containing 0.1% TFA and purified
by semipreparative HPLC according to a gradient elution starting from H2O/CH3CN (both containing
0.1% TFA) = 78:22, and increasing the amount of CH3CN to 70% in 20 min. The desired product (3),
whose identity was confirmed by TLC, MS, and NMR analysis [30], was obtained as a pure compound
in good yield (46 mg, 0.094 mmol, 80% yield).
3.2.2. DAP(T)–OH, (S)-2-amino-3-{2-[5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl]acetamido}
propanoic acid (4)
Isolated product
3 (46 mg, 0.094 mmol) was dissolved in 2 mL of a 10% piperidine solution
in DMF:CH3OH (9:1, v/v). After 10 min stirring at room temperature, TLC analysis indicated the
complete removal of the Fmoc group. Then the solvent was removed under vacuum and the crude
was resuspended with cold diethyl ether obtaining a white precipitate. This species was recovered
after centrifugation, by discarding the supernatant, washing with cold diethyl ether (3
drying. Lyophilization from H2O (containing 0.1% TFA) allowed obtaining the desired compound
almost quantitative yield (25 mg, 0.092 mmol): white powder. Rf = 0.1 (CH2Cl2/CH3OH, 8:2, v/v). Mass
×
5 mL) and
4
in
calculated for 4 (C10H14N4O5 = M): 270.10 u.m.a.; MALDI-TOF-MS (positive ions, Figure S1, up) m/z
found: 271.00 [M + H]+, 293.13 [M + Na]+, 309.10 [M + K]+; ESI-MS (positive ions, Figure S1, bottom)
1
m/z found: 271.14 [M + H]+, 292.98 [M + Na]+, 308.95 [M + K]+. H NMR (400 MHz, D2O; Figure S2,
up):
δ 7.44 (s, 1H, CH-6), 4.55 (bs, 2H, CH2-A), 3.93 (m, 1H, CHα-E), 3.87 (bd, J = 15.0 Hz, 1H, CH2-D1),
3.68 (bdd, 1H, J = 15.0, 5.9 CH2-D2), 1.90 (s, 3H, CH3-5). 13C NMR (100 MHz, D2O; Figure S2, bottom):
δ
172.56 (COOH-F); 171.29 (C-B); 167.70 (C-4); 153.13 (C-2); 143.83 (CH-6); 111.85 (C-5); 55.69 (CH2-A);
1
51.18 (CH-E); 40.66 (CH2-D); 11.98 (CH3-5). H NMR (500 MHz, DMSO-d6; Figure S3, up):
δ 8.35 (bt,
1H, NH-C); 7.41 (s, 1H, CH-6); 4.31 (AB system, 2H, CH2-A); 3.53 (bdt, J = 13.6, 4.5 Hz, 1H, CH2-D1);
3.33 (m, 1H, CH2-D1); 3.27 (m, 1H, CH
-E); 1.75 (s, 3H, CH3-5). 13C NMR (125 MHz, DMSO-d6; Figure
S3, bottom): 168.82 (COOH-F), 167.77 (C-B), 164.36 (C-4), 151.05 (C-2), 142.31 (C-6), 108.01 (C-5), 54.04
α
δ
(CH-E), 49.16 (CH2-A), 39.62 (CH2-D), 11.87 (CH3-5). UV-vis spectrum of
at 268 nm (ε260 = 8700 M−1cm−1).
4 (Figure 2): band maximum
3.3. Platination Reaction of DAP(T)–OH
The nucleoamino acid derivative DAP(T)–OH (
(1.35 mL). In parallel, K2PtCl4 (1 equiv., 10.58 mg, 0.092 mmol) was dissolved in the minimum amount
of H2O (150 L). In 1 h, the amino acid solution was slowly added to the aqueous solution of K2PtCl4
(final solvents ratio: CH3OH/H2O, 9:1, v/v). The reaction mixture was kept under stirring in the
4, 25 mg, 0.092 mmol) was suspended in CH3OH
µ

Pharmaceuticals 2020, 13, 284
14 of 20
dark and at room temperature for 6 h until the formation of an almost clear yellow solution from the
initial dark orange one, with the concomitant disappearance of the DAP(T)–OH white suspension.
Subsequently, the solvent was removed under vacuum at 30 ◦C, and the reaction crude was dried for
1 h at the oil pump to remove traces of H2O. Then, the crude mixture was sequentially resuspended
after sonication in various solvents (dichloromethane, chloroform, and acetone) and centrifuged,
affording, in all cases, a dark-yellow precipitate and a colorless supernatant. This solution, analyzed
by TLC, did not show UV-vis bands and was consequently discarded. In contrast, treatment of the
precipitate with CH3OH gave a pale-yellow solution and a dark-yellow precipitate. Thus, a series of
centrifugations and washings of the precipitate with CH3OH (until the supernatant was completely
colorless) was performed, and the combined yellow methanol solutions (ca. 6
dryness. Then, the dark-yellow solid was resuspended by sonication with H2O obtaining a yellow
supernatant and a white precipitate. After centrifugations and washings of the precipitate with H2O
×
5 mL) were taken to
(until the supernatant was completely colorless), the aqueous solutions (ca. 3
×
5 mL) were combined,
and immediately frozen and lyophilized to remove water from the complex. The white precipitate was
then discarded, and the two obtained yellow components (yellow powders) were separately analyzed.
LC-ESI-MS analysis of the two Pt complexes was performed as follows: the complexes were dissolved
in H2O/CH3CN (9:1, v/v), injected on a C18 column, and eluted in gradient mode (3 min isocratic
elution with 5% CH3CN in H2O, then gradient to 50% CH3CN in 10 min; tR = 0.94 and 0.89 min, for
methanol- and water-recovered Pt complexes, respectively; see Figure S4a).
Since the most common NMR organic solvents (CDCl3, CD3OD, CD3COCD3) did not solubilize
the recovered Pt complexes at a proper concentration for a complete NMR characterization, we used
DMSO for their solubilization. The newly obtained DAP(T)-based complexes were named T1 and
T2 (originated from the DMSO-exchange reaction of the Pt complex recovered in CH3OH and H2O,
respectively). The purity of the obtained complexes was checked by LC-ESI-MS, which evidenced
the presence of a single peak for each compound (Figure S5a). For the LC-ESI-MS characterization,
T1 and T2 were dissolved in H2O/CH3CN (9:1, v/v), injected on a C18 column, and eluted as follows:
3 min isocratic elution with 10% CH3CN in H2O, then gradient to 95% CH3CN in 10 min (tR = 0.94 and
0.84 min, for T1 and T2, respectively).
3.3.1. T1 Characterization
Mass calculated for T1 (C12H20ClN4O6Pt = M): 578.23 u.m.a.; LC-ESI-MS (positive ions; Figure S5a,
left) m/z found: 579.10 [M + H]+, 601.08 [M + Na]+, 617.06 [M + K]+ (chromatographic peak at 0.94 min).
1H NMR (400 MHz, DMSO-d6; Figure S6):
δ
11.29/11.28 (s, two rotamers, NH-3/30), 8.58/8.48 (bt, two
rotamers, J = 5.7/5.6, NH-C/C’), 7.44/7.43 (s, two rotamers, H-6/60), 6.29 (bs, NH2-G1), 5.68 (bs, NH2-G2),
4.35 (AB system, CH2-A), 3.90 (bm, CH2-E), 3.64 (bdt, J = 14.53, 5.06 Hz, CH2-D1), 3.59-3.26 (overlapped
signals; in decreasing ppm order: CH2-D1 , CH2-E0, CH2-D2/D2 ), 3.16 (bs, CH3-DMSO-Pt), 1.75 (s,
0
0
CH3-5). 13C NMR (125 MHz, DMSO-d6; Figure S6):
δ 181.33 (C-F), 168.86/168.31 (C-B/B’), 164.44/164.42
(C-4/40), 151.05 (C-2), 142.24 (C-6), 108.10/107.98 (C-5/50), 56.78 (CH-E), 52.40 (CH-E0), 49.22 (CH2-A),
49.02 (CH3-DMSO-Pt), 41.66 (CH2-D’), 38.58 (CH2-D), 11.93/11.91 (CH3-5/50).
3.3.2. T2 Characterization
Mass calculated for T2 (C12H20ClN4O6Pt = M): 578.23 u.m.a.; LC-ESI-MS (positive ions; Figure S5a,
right) m/z found: 578.91 [M + H]+, 601.15 [M + Na]+, 617.24 [M + K]+ (chromatographic peak at
1
0.84 min). H NMR (400 MHz, DMSO-d6; Figure S7):
δ 11.30 (s, 1H, NH-3), 8.43 (bs, 1H, NH-C), 7.43
(s, 1H, H-6); 6.25 (bs, 1H, NH2-G1), 5.63 (bs, 1H, NH2-G2), 4.34 (s, 2H, CH2-A), 3.65-3.27 (overlapped
signals; in decreasing ppm order: CH2-D1, CH2-E, CH2-D2), 3.16 (bs, CH3-DMSO-Pt), 1.75 (s, 3H,
CH3-5). 13C NMR (100 MHz, DMSO-d6; Figure S8):
δ 181.38 (C-F), 168.44 (C-B), 164.47 (C-4), 151.07
(C-2), 142.23 (C-6), 108.16 (C-5), 56.90 (CH-E), 49.27 (CH2-A), 48.61 (CH3-DMSO-Pt), 41.69 (CH2-D),
11.94 (CH3-5).

Pharmaceuticals 2020, 13, 284
15 of 20
Several attempts to obtain also MALDI-TOF spectra of the two complexes were performed using
CHCA and DHB as matrixes and various laser powers, obtaining, in all cases, many adducts with the
matrix and degradation products.
Based on their chemical structures (as deduced by NMR and mass data), the synthesis yields of
T1 and T2 from the complexation reaction of DAP(T)–OH with K2PtCl4 followed by DMSO-exchange,
were 35 and 23%, respectively.
Attempts to obtain crystals of the initial complexes, as well as of T1 and T2, suitable for X-ray
crystallography, failed, giving only degradation products (white crystals).
3.4. MTT Assay
3.4.1. Cell Cultures
Human adenocarcinoma (HeLa), human metastatic melanoma (WM266), breast adenocarcinoma
(MCF-7) cell lines were purchased from ATCC (U.S.). Normal human dermal fibroblasts (HDF) were
kindly provided by Dr. A. Tito Arterra, Biosciences (Napoli, Italy). HeLa, MCF-7, and HDF were
grown in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum
(FBS), 1% glutamine, 100 U/mL penicillin, and 100
µg/mL streptomycin (Euroclone, Milano, Italy).
WM266 were grown in RPMI, as previously described [38
air containing 5% CO2 at 37 ◦C.
,
39 49]. Cells were maintained in humidified
,
3.4.2. Cell Proliferation Experiments
Cells were plated at a density of 1200 cells/well for HeLa, 2000 for WM266, MCF-7, and HDF in
96-well microplates (Corning) and incubated at 37 ◦C. After 24 h, cells were treated for 48 h with the
compounds previously solubilized. In detail, the Pt complexes and DAP(T)–OH were dissolved in
DMSO at a 10 mM concentration, while cisplatin was solubilized in an aqueous solution of DMSO
(10%)/NaCl (0.9%), at a 2 mM concentration [50], then diluted with growth medium until the final
solution contained no more than 0.5% DMSO, well-tolerated by in vitro cell cultures. Cell proliferation
was determined by using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay
(MTT, Sigma Aldrich, Milano, Italy) after 48 h incubation [51]. Plates were then analyzed using a
microplate reader (Enspire, Perkin Elmer, Waltham, MA, USA) at 570 nm. The results are reported as
the percentage of living cells with respect to the control (vehicle-treated cells) and are expressed as
means ± SE of at least three independent experiments performed in triplicate.
3.5. UV-Vis Experiments
The UV spectra were recorded using a scanning speed of 100 nm/min and a 2.0 nm bandwidth
with the appropriate baseline subtraction. A quartz cuvette with a path length of 1 cm was used
(3.5 mL internal volume). The UV-vis spectra of the compounds were recorded in PBS (137 mM NaCl,
2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4) over time in the range of 220 to 450 nm to study their
stability. The solutions analyzed were 80
stock solution (7 mM in DMSO).
µM in PBS and were obtained after dilution from the original
3.6. CD Experiments
◦
The CD spectra were recorded at 20 C in a quartz cuvette with a path-length of 1 cm using
the following parameters: spectral window 240–320 nm, response 1 s, scanning speed 100 nm/min,
bandwidth 2.0 nm. All the spectra were averaged over 3 scans and corrected by subtraction of the
background scan with buffer. For all the experiments, oligonucleotides were dissolved at 2
µM
concentration, stock solutions of ligands [T1 T2, and DAP(T)–OH] were prepared at 7 mM conc.
,
in DMSO, whereas stock CDDP solution was obtained at a 7 mM concentration in an aqueous
solution of DMSO (10%)/NaCl (0.9%) [50]. A buffer solution of 7 mM Na2HPO4/NaH2PO4, 100 mM

Pharmaceuticals 2020, 13, 284
16 of 20
KCl (pH 7.2) was used for the studies on the interaction between the DNA model systems and the
platinum-based complexes.
The tested DNA sequences were the following (GG boxes are underlined and in italic):
ODN1 = CCTCTGGTCTCC (single strand model);
ds27 = CGCGAATTCGCG TTT CGCGAATTCGCG (duplex model not-containing a GG box);
dsGG = CATGTGGTTCTG TTT CAGAACCACATG (duplex model containing one GG box);
tel26 = TTAGGGTTAGGGTTAGGGTTAGGGTT (G-quadruplex model).
3.7. PAGE Experiments
Annealed oligonucleotides samples, dissolved at 2 µM concentration in 7 mM Na2HPO4/NaH2PO4,
100 mM KCl (pH 7.2) were incubated with 10 equiv. of each platinum complex. After 48 h incubation at
room temperature (r.t.), the samples, including the reference DNA, were loaded on 25% polyacrylamide
gels in TBE 1 as running buffer. All the mixtures were supplemented with 5% glycerol just before
×
loading and then run, under native conditions, at 80 V at r.t. for 3.3 h. Gels were stained with a
GelGreen solution (supplemented with 0.1 M NaCl) for 30 min and finally visualized with a UV
transilluminator (BioRad ChemiDoc XRS, Milano, Italy). Each experiment was performed in duplicate.
4. Conclusions
In this work, the nucleoamino acid DAP(T)–OH, derived by the coupling of l-2,3-diaminopropanoic
acid with a thymine acetic acid, was synthesized and characterized via mass spectrometry and NMR
spectroscopy and used for the reaction with a platinum(II) salt to obtain novel Pt(II) complexes.
Two new platinum-based complexes, named T1 and T2, were obtained and characterized by various
techniques. These compounds include in their structures one nucleoamino acid unit [DAP(T)–OH],
a platinum(II) ion, a chloride ion, and a DMSO molecule. The identity of the new metal complexes was
ascertained by NMR spectroscopy (1H and 13C, COSY, HSQC, HMBC, and NOESY experiments) and
mass spectrometry (LC-ESI-MS) techniques.
The cytotoxicity of T1 and T2, as well as of DAP(T)–OH used as a reference, was tested,
in preliminary assays, on a panel of human cancer (HeLa, WM266, MCF-7) and normal (HDF) cells
using the MTT assay. CDDP was also tested as a positive control. Both the Pt complexes showed good
antiproliferative activity on HeLa cells. Indeed, T1 and T2 at 50 µM concentration reduced HeLa cell
viability more than 50% after 48 h incubation, whereas, at the same tested concentration, they were less
active on WM266 and MCF-7, suggesting a selectivity of action towards the specific tumor cells that is
an important feature in cancer therapy. It is worth noting that, although T1 and T2 complexes resulted
less effective in blocking cell proliferation than cisplatin, they were more selective towards cancer cells
than healthy ones, as demonstrated by comparing the activity on HeLa cells with that observed on
HDF ones, on which the complexes were essentially inactive even at the highest concentration tested.
Interestingly, the free ligand DAP(T)–OH did not affect all the tested cells indicating that the observed
bioactivity is essentially driven by the presence of the platinum center.
We also hypothesized that the nucleobase could contribute to the bioactivity of the Pt complexes
by both protecting the Pt center from premature deactivation and increasing the cellular uptake of the
complexes, plausibly thanks to specific nucleobase transporters, thus giving a synergistic effect together
with the presence of the metal. Furthermore, generally, single nucleobases do not show relevant
biological activity (nor significantly interact with DNA). In addition, as previously reported [21],
the Pt complex with DAP-OH as ligand did not evidence significant antiproliferative activity in the
same experimental conditions, showing a 50% inhibition of HeLa cells proliferation only at 220 µM
concentration, whereas T1 and T2 seemed to be about 4-times more active on the same cancer cells.
Once the antiproliferative effects of the platinum-based complexes were assessed, to explore if
their activity could be correlated with their DNA-binding ability, T1 and T2, as well as DAP(T)–OH
and cisplatin, used as reference compounds, were studied using CD spectroscopy. Their interaction
in solution was investigated with four DNA model systems, i.e., a random coil single strand, two B

Pharmaceuticals 2020, 13, 284
17 of 20
form-duplexes, one with and the other without a GG box, and a G-quadruplex structure. From CD
binding experiments, it emerged that DNA can be a possible target of these brand new compounds,
similar to other reported bioactive Pt complexes (as well as transition metal complexes, such as
ruthenium complexes) [6,7,12,15,21,23,47,48,52,53]. In particular, we observed significant changes only
in the CD spectrum of the single strand and G4 when T1 and T2 were added to each DNA system,
evidencing that both the complexes interacted with these oligonucleotides. A more marked interaction
seemed to occur in the case of T2 with respect to T1. On the contrary, the interaction of the starting
nucleoamino acid with all the tested DNA systems was almost null, in line with the absence of specific
antiproliferative effects observed in cell assays. Thus, CD data were in agreement with the observed
biological activity for all the compounds. Furthermore, comparing the DNA-binding behavior of the
new Pt complexes with that of cisplatin, it emerged that, while CDDP efficiently interacted with duplex
structures containing a GG box not being able to perturb or disrupt the compact structure of the G4, T1
and T2 resulted good G4-binders as revealed by both CD- and PAGE-monitored binding experiments.
The moderate cytotoxicity combined with the selectivity of the Pt(II) complexes obtained
and described in the present work, can be of pharmaceutical interest in multiple drug therapy.
In addition, the synthesis and characterization of DAP-based nucleoamino acids also containing the
other nucleobases, i.e., DAP(C)-OH, DAP(A)-OH, and DAP(G)-OH, are ongoing in our laboratories
to use these nucleamino acid scaffolds as building blocks for the preparation of novel Pt complexes
endowed with increased activity and selectivity, identifying the most promising analogs of the series.
Supplementary Materials: The following are available online at http://www.mdpi.com/1424-8247/13/10/284/s1.
Author Contributions: Conceptualization, D.M. (Domenica Musumeci), D.M. (Daniela Montesarchio), G.N.R.;
Methodology, D.M. (Domenica Musumeci), D.M. (Daniela Montesarchio); Software, G.N.R.; Formal analysis, D.M.
(Domenica Musumeci), D.M. (Daniela Montesarchio); Investigation, C.R., D.C., A.C., C.P., S.D.G., D.M. (Domenica
Musumeci); Resources, D.M. (Daniela Montesarchio), D.M. (Domenica Musumeci), G.N.R., D.C., S.D.G.; Data
curation, D.M. (Domenica Musumeci), C.R., D.C.; Writing—original draft preparation, D.M. (Domenica Musumeci);
Writing—review and editing, C.R., C.P., D.M. (Daniela Montesarchio), D.M. (Domenica Musumeci); All authors
have read and agreed to the published version of the manuscript.
Funding: We are grateful to the financial support received from the H2020-MSCA-RISE-2019 under grant
agreement No 872331 (acronym: NoBiasFluors).
Conflicts of Interest: The authors declare no conflict of interest.
Abbreviations
A (adenine), APS (ammonium persulfate), B (nucleobase), Boc (tert-butoxycarbonyl), C (cytosine),
CD (circular dichroism), CDDP (cis-diaminedichloro-platinum), CHCA (α-cyano-4-hydroxycinnamic acid),
COSY (correlation spectroscopy), DAP (2,3-diaminopropanoic acid), DHB (2,5-dihydroxybenzoic acid), DIEA
(N,N-diisopropylethylamine), DMEM (Dulbecco’s Modified Eagle’s Medium), DMF (N,N-dimethylformamide),
DMSO (dimethyl sulfoxide), EDTA (Ethylenediaminetetraacetic Acid), ESI (electrospray ionization), FBS
(fetal serum bovine), Fmoc (9-fluorenylmethoxycarbonyl), G (Guanine), G4 (G-quadruplex), HATU
(1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate), HDF (human
dermal fibroblast), HeLa (cervical cancer cells), HMBC (heteronuclear multiple-bond correlation), HPLC
(high-performance liquid-chromatography), HSQC (heteronuclear single quantum correlation), LC (liquid
chromatography), MALDI (matrix-assisted laser desorption ionization), MCF-7 (human breast adenocarcinoma
cell line), MS (mass spectrometry), MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide), NMR
(nuclear magnetic resonance), NOESY (nuclear overhauser effect spectroscopy), ODN (oligodeoxyribonucleotide),
PAGE (polyacrylamide gel electrophoresis), PBS (phosphate-buffered saline), PNA (peptide nucleic acid),
ppm (parts per million), Rf (retention factor), r.t. (room temperature), TBE (Tris-Borate-EDTA), TEMED
(tetramethylethylenediamine), TFA (trifluoroacetic acid), TOC (Thin layer chromatography), TOF (time of
flight), tR (retention time), WM (Wistar melanoma cell lines).

Pharmaceuticals 2020, 13, 284
18 of 20
References
1.
2.
3.
4.
5.
Dasari, S.; Bernard Tchounwou, P. Cisplatin in cancer therapy: Molecular mechanisms of action. Eur. J.
Pharmacol. 2014, 740, 364–378. [CrossRef] [PubMed]
Makovec, T. Cisplatin and beyond: Molecular mechanisms of action and drug resistance development in
cancer chemotherapy. Radiol. Oncol. 2019, 53, 148–158. [CrossRef] [PubMed]
Wexselblatt, E.; Yavin, E.; Gibson, D. Cellular interactions of platinum drugs. Inorg. Chim. Acta 2012, 393,
75–83. [CrossRef]
Ga˛sior-Głogowska, M.; Malek, K.; Zajac, G.; Baranska, M. A new insight into the interaction of cisplatin with
DNA: ROA spectroscopic studies on the therapeutic effect of the drug. Analyst 2016, 141, 291–296. [CrossRef]
Mügge, C.; Liu, R.; Görls, H.; Gabbiani, C.; Michelucci, E.; Rüdiger, N.; Clement, J.H.; Messori, L.; Weigand, W.
Novel platinum(II) compounds with O,S bidentate ligands: Synthesis, characterization, antiproliferative
properties and biomolecular interactions. Dalton Trans. 2014, 43, 3072–3086. [CrossRef]
Hardie, M.; Kava, H.; Murray, V. Cisplatin analogues with an increased interaction with DNA: Prospects for
therapy. Curr. Pharm. Des. 2016, 22, 6645–6664. [CrossRef]
Cucciolito, M.E.; D’Amora, A.; De Feo, G.; Ferraro, G.; Giorgio, A.; Petruk, G.; Monti, D.M.; Merlino, A.;
Ruffo, F. Five-coordinate Platinum(II) compounds containing sugar ligands: Synthesis, characterization,
cytotoxic activity, and interaction with biological macromolecules. Inorg. Chem. 2018, 57, 3133–3143.
[CrossRef]
6.
7.
8.
9.
Iakovidis, A.; Hadjiliadis, N. Complex compounds of platinum (II) and (IV) with amino acids, peptides and
their derivatives. Coord. Chem. Rev. 1994, 135–136, 17–63. [CrossRef]
Liu, R.; Li, H.; Gao, X.; Mi, Q.; Zhao, H.; Gao, Q. Mannose-conjugated platinum complexes reveals effective
tumor targeting mediated by glucose transporter 1. Biochem. Biophys. Res. Commun. 2017, 487, 34–40.
[CrossRef]
10. Sengupta, P.; Basu, S.; Soni, S.; Pandey, A.; Roy, B.; Oh, M.S.; Chin, K.T.; Paraskar, A.S.; Sarangi, S.; Connor, Y.;
et al. Cholesterol-tethered platinum II-based supramolecular nanoparticle increases antitumor efficacy and
reduces nephrotoxicity. PNAS 2012, 109, 11294–11299. [CrossRef]
11. Ratzon, E.; Najajreh, Y.; Salem, R.; Khamaisie, H.; Ruthardt, M.; Mahajna, J. Platinum (IV)-fatty acid conjugates
overcome inherently and acquired Cisplatin resistant cancer cell lines: An in-vitro study. BMC Cancer 2016
16, 1–11. [CrossRef] [PubMed]
,
12. Riccardi, C.; Capasso, D.; Rozza, G.M.; Platella, C.; Montesarchio, D.; Di Gaetano, S.; Marzo, T.; Pratesi, A.;
Messori, L.; Roviello, G.N.; et al. Synthesis, DNA binding studies, and antiproliferative activity of novel
Pt(II)-complexes with an L-alanyl-based ligand. J. Inorg. Biochem. 2020, 203, 110868. [CrossRef] [PubMed]
13. D’Errico, S.; Oliviero, G.; Piccialli, V.; Amato, J.; Borbone, N.; D’Atri, V.; D’Alessio, F.; Di Noto, R.; Ruffo, F.;
Salvatore, F.; et al. Solid-phase synthesis and pharmacological evaluation of novel nucleoside-tethered
dinuclear platinum(II) complexes. Bioorg. Med. Chem. 2011, 21, 5835–5838. [CrossRef] [PubMed]
14. D’Errico, S.; Oliviero, G.; Borbone, N.; Piccialli, V.; Pinto, B.; De Falco, F.; Maiuri, M.C.; Carnuccio, R.;
Costantino, V.; Nici, F.; et al. Synthesis and pharmacological evaluation of modified adenosines joined to
mono-functional platinum moieties. Molecules 2014, 19, 9339–9353. [CrossRef]
15. Chen, J.; Li, K.; Swavey, S.; Church, K.M. Synthesis, characterization and DNA binding activity of
PtCl2[DMSO][N4[N-3(4-pyridylmethyl)thymidine]]. Inorg. Chim. Acta 2016, 444, 76–80. [CrossRef]
16. Cincinelli, R.; Musso, L.; Dallavalle, S.; Artali, R.; Tinelli, S.; Colangelo, D.; Zunino, F.; De Cesare, M.;
Beretta, G.L.; Zaffaroni, N. Design, modeling, synthesis and biological activity evaluation of
camptothecin-linked platinum anticancer agents. Eur. J. Med. Chem. 2013, 63, 387–400. [CrossRef]
17. Pastor-Anglada, M.; Pérez-Torras, S. Nucleoside transporter proteins as biomarkers of drug responsiveness
and drug targets. Front. Pharmacol. 2015, 6, 1–14. [CrossRef]
18. Inoue, K. Molecular basis of nucleobase transport systems in mammals. Biol. Pharm. Bull. 2017, 40, 1130–1138.
[CrossRef]
19. Jin, V.X.; Ranford, J.D. Complexes of platinum(II) or palladium(II) with 1,10-phenanthroline and amino acids.
Inorg. Chim. Acta 2000, 304, 38–44. [CrossRef]
20. Krylova, L.F.; Kovtunova, L.M.; Romanenko, G.V. Pt(II) and Pd(II) complexes with β-alanine. Bioinorg. Chem.
Appl. 2008, 2008, 983725. [CrossRef]

Pharmaceuticals 2020, 13, 284
19 of 20
21. Moradell, S.; Lorenzo, J.; Rovira, A.; Robillard, M.S.; Avil
é
s, F.X.; Moreno, V.; De Llorens, R.; Martinez, M.A.;
Reedijk, J.; Llobet, A. Platinum complexes of diaminocarboxylic acids and their ethyl ester derivatives:
The effect of the chelate ring size on antitumor activity and interactions with GMP and DNA. J. Inorg. Biochem.
2003, 96, 493–502. [CrossRef]
22. Altman, J.; Wilchek, M.; Warshawsky, A. Platinum(II) complexes with 2,4-diaminobutyric acid, ornithine,
lysine and 4,5-diaminovaleric acid. Inorg. Chim. Acta 1985, 107, 165–168. [CrossRef]
23. Ziegler, C.J.; Sandman, K.E.; Liang, C.H.; Lippard, S.J. Toxicity of platinum(II) amino acid (N,O) complexes
parallels their binding to DNA as measured in a new solid phase assay involving a fluorescent HMG1 protein
construct readout. J. Biol. Inorg. Chem. 1999, 4, 402–411. [CrossRef] [PubMed]
24. Moradell, S.; Lorenzo, J.; Rovira, A.; Van Zutphen, S.; Avilés, F.X.; Moreno, V.; De Llorens, R.; Martinez, M.A.;
Reedijk, J.; Llobet, A. Water-soluble platinum(II) complexes of diamine chelating ligands bearing amino-acid
type substituents: The effect of the linked amino acid and the diamine chelate ring size on antitumor activity,
and interactions with 50-GMP and DNA. J. Inorg. Biochem. 2004, 98, 1933–1946. [CrossRef] [PubMed]
25. Roviello, G.N.; Musumeci, D.; Moccia, M.; Castiglione, M.; Sapio, R.; Valente, M.; Bucci, E.M.; Perretta, G.;
Pedone, C. dabPNA: Design, synthesis, and DNA binding studies. Nucleosides Nucleotides Nucleic Acids 2007
26, 1307–1310. [CrossRef]
,
26. Roviello, G.N.; Musumeci, D.; Pedone, C.; Bucci, E.M. Synthesis, characterization and hybridization studies
of an alternate nucleo-ε/γ-peptide: Complexes formation with natural nucleic acids. Amino Acids 2010, 38,
103–111. [CrossRef]
27. Roviello, G.N.; Musumeci, D.; Bucci, E.M.; Pedone, C. Synthesis of a diaminopropanoic acid-based
nucleoamino acid and assembly of cationic nucleopeptides for biomedical applications. Amino Acids 2012
,
43, 2537–2543. [CrossRef]
28. Roviello, G.N.; Musumeci, D.; D’Alessandro, C.; Pedone, C. Synthesis of a thymine-functionalized
nucleoamino acid for the solid phase assembly of cationic nucleopeptides. Amino Acids 2013, 45, 779–784.
[CrossRef]
29. Roviello, G.N.; Musumeci, D. Synthetic approaches to nucleopeptides containing all four nucleobases,
and nucleic acid-binding studies on a mixed-sequence nucleo-oligolysine. RSC Adv. 2016, 6, 63578–63585.
[CrossRef]
30. Musumeci, D.; Roviello, V.; Roviello, G.N. DNA- and RNA-binding ability of oligoDapt,
a nucleobase-decorated peptide, for biomedical applications. Int. J. Nanomed. 2018, 13, 2613–2629.
[CrossRef]
31. Musumeci, D.; Mokhir, A.; Roviello, G.N. Synthesis and nucleic acid binding evaluation of a thyminyl
L-diaminobutanoic acid-based nucleopeptide. Bioorg. Chem. 2020, 100, 103862. [CrossRef] [PubMed]
32. D’Errico, S.; Borbone, N.; Piccialli, V.; Di Gennaro, E.; Zotti, A.; Budillon, A.; Vitagliano, C.; Piccialli, I.;
Oliviero, G. Synthesis and evaluation of the antitumor properties of a small collection of PtII complexes with
7-deazaadenosine as scaffold. Eur. J. Org. Chem. 2017, 2017, 4935–4947. [CrossRef]
33. Musumeci, D.; Roviello, G.N.; Valente, M.; Sapio, R.; Pedone, C.; Bucci, E.M. New synthesis of PNA-30DNA
linker monomers, useful building blocks to obtain PNA/DNA chimeras. Biopolym. Pept. Sci. Sect. 2004, 76,
535–542. [CrossRef] [PubMed]
34. Avitabile, C.; Moggio, L.; Malgieri, G.; Capasso, D.; Di Gaetano, S.; Saviano, M.; Pedone, C.; Romanelli, A.
γ
sulphate PNA (PNA S): Highly selective DNA binding molecule showing promising antigene activity.
PLoS ONE 2012, 7, e35774. [CrossRef] [PubMed]
35. Smith, T.J. MOLView: A program for analyzing and displaying atomic structures on the Macintosh personal
computer. J. Mol. Graph. 1995, 13, 122–125. [CrossRef]
36. Halgren, T.A. Merck molecular force field. I. Basis, form, scope, parameterization, and performance of
MMFF94. J. Comput. Chem. 1996, 17, 490–519. [CrossRef]
37. Cavaluzzi, M.J.; Borer, P.N. Revised UV extinction coefficients for nucleoside-50-monophosphates and
unpaired DNA and RNA. Nucleic Acids Res. 2004, 32, e13. [CrossRef]
38. Musumeci, D.; Roviello, G.N.; Rigione, G.; Capasso, D.; Di Gaetano, S.; Riccardi, C.; Roviello, V.;
Montesarchio, D. Benzodifuran derivatives as potential antiproliferative agents: Possible correlation
between their bioactivity and aggregation properties. ChemPlusChem 2017, 82, 251–260. [CrossRef]

Pharmaceuticals 2020, 13, 284
20 of 20
39. Vicidomini, C.; Cioffi, F.; Broersen, K.; Roviello, V.; Riccardi, C.; Montesarchio, D.; Capasso, D.; Di Gaetano, S.;
Roviello, G.N. Benzodifurans for biomedical applications: BZ4, a selective anti-proliferative and anti-amyloid
lead compound. Future Med. Chem. 2019, 11, 285–302. [CrossRef]
40. Platella, C.; Musumeci, D.; Arciello, A.; Doria, F.; Freccero, M.; Randazzo, A.; Amato, J.; Pagano, B.;
Montesarchio, D. Controlled pore glass-based oligonucleotide affinity support: Towards high throughput
screening methods for the identification of conformation-selective G-quadruplex ligands. Anal. Chim. Acta
2018, 1030, 133–141. [CrossRef]
41. Platella, C.; Pirota, V.; Musumeci, D.; Rizzi, F.; Iachettini, S.; Zizza, P.; Biroccio, A.; Freccero, M.;
Montesarchio, D.; Doria, F. Trifunctionalized naphthalene diimides and dimeric analogues as
G-quadruplex-targeting anticancer agents selected by affinity chromatography. Int. J. Mol. Sci. 2020
21, 1964. [CrossRef]
,
42. Lipps, H.J.; Rhodes, D. G-quadruplex structures: In vivo evidence and function. Trends Cell Biol. 2009, 19,
414–422. [CrossRef] [PubMed]
43. Balasubramanian, S.; Hurley, L.H.; Neidle, S. Targeting G-quadruplexes in gene promoters: A novel anticancer
strategy? Nat. Rev. Drug Discov. 2011, 10, 261–275. [CrossRef] [PubMed]
44. Marzano, M.; Falanga, A.P.; Marasco, D.; Borbone, N.; D’Errico, S.; Piccialli, G.; Roviello, G.N.; Oliviero, G.
Evaluation of an analogue of the marine
ε-PLL peptide as a ligand of G-quadruplex DNA structures.
Mar. Drugs 2020, 18, 49. [CrossRef] [PubMed]
45. Petraccone, L.; Spink, C.; Trent, J.O.; Garbett, N.C.; Mekmaysy, C.S.; Giancola, C.; Chaires, J.B. Structure
and stability of higher-order human telomeric quadruplexes. J. Am. Chem. Soc. 2011, 133, 20951–20961.
[CrossRef]
46. Petraccone, L.; Pagano, B.; Giancola, C. Studying the effect of crowding and dehydration on DNA
G-quadruplexes. Methods 2012, 57, 76–83. [CrossRef]
47. Musumeci, D.; Platella, C.; Riccardi, C.; Merlino, A.; Marzo, T.; Massai, L.; Messori, L.; Montesarchio, D.
A first-in-class and a fished out anticancer platinum compound: Cis-[PtCl2(NH3)2] and cis-[PtI2(NH3)2]
compared for their reactivity towards DNA model systems. Dalton Trans. 2016, 45, 8587–8600. [CrossRef]
48. Mügge, C.; Musumeci, D.; Michelucci, E.; Porru, F.; Marzo, T.; Massai, L.; Messori, L.; Weigand, W.;
Montesarchio, D. Elucidating the reactivity of Pt(II) complexes with (O,S) bidentate ligands towards DNA
model systems. J. Inorg. Biochem. 2016, 160, 198–209. [CrossRef]
49. Farina, B.; De Paola, I.; Russo, L.; Capasso, D.; Liguoro, A.; Del Gatto, A.; Saviano, M.; Pedone, P.V.;
Di Gaetano, S.; Malgieri, G.; et al. A combined NMR and computational approach to determine the
RGDechi-hCit-αvβ3 integrin recognition mode in isolated cell membranes. Chemistry 2016, 22, 681–693.
[CrossRef]
50. D’Errico, S.; Falanga, A.P.; Capasso, D.; Di Gaetano, S.; Marzano, M.; Terracciano, M.; Roviello, G.N.;
Piccialli, G.; Oliviero, G.; Borbone, N. Probing the DNA reactivity and the anticancer properties of a novel
tubercidin-Pt (II) complex. Pharmaceutics 2020, 12, 627. [CrossRef]
51. Di Gaetano, S.; Bedini, E.; Landolfi, A.; Pedone, E.; Pirone, L.; Saviano, M.; Traboni, S.; Capasso, D.; Iadonisi, A.
Synthesis of diglycosylated (di)sulfides and comparative evaluation of their antiproliferative effect against
tumor cell lines: A focus on the nature of sugar-recognizing mediators involved. Carbohydr. Res. 2019
482, 107740. [CrossRef] [PubMed]
,
52. Musumeci, D.; Rozza, L.; Merlino, A.; Paduano, L.; Marzo, T.; Massai, L.; Messori, L.; Montesarchio, D.
Interaction of anticancer Ru(III) complexes with single stranded and duplex DNA model systems. Dalton Trans.
2015, 44, 13914–13925. [CrossRef] [PubMed]
53. Riccardi, C.; Musumeci, D.; Trifuoggi, M.; Irace, C.; Paduano, L.; Montesarchio, D. Anticancer ruthenium (III)
complexes and Ru(III) containing nanoformulations: An update on the mechanism of action and biological
activity. Pharmaceuticals 2019, 12, 146. [CrossRef] [PubMed]
©
2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).