Synthesis of 5-(carboranylalkylmercapto)-2'-deoxyuridines and 3- (carboranylalkyl)thymidines and their evaluation as substrates for human thymidine kinases 1 and 2

Article abstract of DOI:10.1021/jm990125i

Derivatives of thymidine containing o-carboranylalkyl groups at the N-3 position and derivatives of 2'-deoxyuridine containing o- carboranylalkylmercapto groups at the C-5 position were synthesized. The alkyl spacers consist of 4-8 methylene units. The sy

Full text of DOI:10.1021/jm990125i

3378
J . Med. Chem. 1999, 42, 3378-3389
Syn th esis of 5-(Ca r bor a n yla lk ylm er ca p to)-2′-d eoxyu r id in es a n d
3-(Ca r bor a n yla lk yl)th ym id in es a n d Th eir Eva lu a tion a s Su bstr a tes for Hu m a n
Th ym id in e Kin a ses 1 a n d 2
Anthony J . Lunato,† J ianghai Wang, J effrey E. Woollard,§ Abul K. M. Anisuzzaman,† Weihua J i,†
Feng-Guang Rong,† Seiichiro Ikeda,‡ Albert H. Soloway,† Staffan Eriksson, David H. Ives,‡
Thomas E. Blue,§ and Werner Tjarks*,†
College of Pharmacy and Departments of Biochemistry and Mechanical Engineering, The Ohio State University,
Columbus, Ohio 43210, and Department of Veterinary Medical Chemistry, Swedish University of Agricultural Sciences,
The Biomedical Center, Box 575, SE-75123 Uppsala, Sweden
Received March 18, 1999
Derivatives of thymidine containing o-carboranylalkyl groups at the N-3 position and derivatives
of 2′-deoxyuridine containing o-carboranylalkylmercapto groups at the C-5 position were
synthesized. The alkyl spacers consist of 4-8 methylene units. The synthesis of the former
compounds required 3-4 reaction steps in up to 75% overall yield and that of the latter 9-10
reaction steps with significantly lower overall yield. Derivatives of thymidine substituted with
carboranylalkyl substituents at the N-3 position and short spacers were phosphorylated by
both recombinant and purified cytosolic thymidine kinase (TK1) to a relatively high degree.
None of the tested 2′-deoxyuridine derivatives possessing carboranyl substituents at the C-5
position were phosphorylated by either recombinant or purified TK1. The amounts of
phosphorylation product detected for some of the C-5-substituted nucleosides with recombinant
mitochondrial thymidine kinase (TK2) were low but significant and decreased with increasing
lengths of the alkyl spacer. The data obtained in this study do not seem to support the tether
concept applied in the synthesis of the new C-5- and N-3-substituted carboranyl nucleosides
intended to reduce possible steric interference in the binding of carboranyl nucleosides with
deoxynucleoside kinases. Instead, it appeared that a closer proximity of the bulky carborane
moiety to the nucleoside scaffold resulted in better substrate characteristics.
In tr od u ction
In order for BNCT to be successful, 10B delivery
systems have to be developed that selectively target
tumor cells. The observation that a combination of
disodium mercaptoundecahydrododecaborate (BSH) and
4-dihydroxyborylphenylalanine (BPA), the two agents
used in clinical BNCT, proved to be more effective in
rats with intracerebral F98 glioma than either com-
pound alone lends strong support to the concept that a
“cocktail” of different compounds will eventually be used
in clinical BNCT, just as cancer chemotherapy is carried
out using combinations of drugs.2
Boron neutron capture therapy (BNCT) is a binary
system for the treatment of cancer. In order for this
therapy to be effective, the targeted cancer cells must
attain a sufficient concentration of 10B, a stable isotope
comprising approximately 20% of natural elemental
boron. At the time of treatment, this localized boron
content is activated by a suitable flux of low-energy
(thermal) neutrons. The nuclear reaction [10B(n,R)7Li]
that is initiated by neutron capture yields high-linear-
energy-transfer (LET) particles, He2+ and 7Li3+ ions.
4
These particles have a range of 9 and 5 µm, respectively,
in biological tissue and can cause cell death through
various cytocidal effects. However, the damage is largely
restricted to the tumor because of the limited range of
these particles. Provided that 10B is selectively taken
up by the tumor, the amount of this nuclide required to
sustain lethal tumor cell damage has been calculated
to be in the range of 15-30 µg/g of tumor, assuming a
homogeneous distribution throughout all intra- and
extracellular compartments.1
Nucleoside kinases play a pivotal role in the use of
nucleosides for cancer and antiviral therapy.3 For
BNCT, the cytosolic thymidine kinase (TK1) may be a
particularly important target enzyme. This enzyme of
the pyrimidine salvage pathway catalyzes the phospho-
rylation of thymidine (Thd) and 2′-deoxyuridine (dUrd)
to the corresponding monophosphates. TK1 activity is
present in proliferating cells but is absent from all
quiescent cells.4 In actively proliferating cells, TK1
activity is not constant, increasing dramatically during
the S-phase and then decreasing at cytokinesis.5 Boron-
containing Thd and dUrd derivatives that are good
substrates for TK1 may be entrapped in proliferating
neoplastic cells after conversion to the monophosphate
due to the acquired negative charge. In addition,
conversion of a boronated Thd/dUrd monophosphate to
the di- and triphosphates and subsequent incorporation
into tumor cell DNA could result in the relocation of
* Corresponding author: Werner Tjarks, The Ohio State University,
College of Pharmacy, 500 W. 12th Ave., Columbus, OH 43210. Phone:
+1 614 292 7624. Fax: +1 614 292 2435. E-mail: tjarks@dendrite.
pharmacy.ohio-state.edu.
† College of Pharmacy, The Ohio State University.
Department of Veterinary Medical Chemistry, Swedish University
of Agricultural Sciences.
§ Department of Mechanical Engineering, The Ohio State Univer-
sity.
‡ Department of Biochemistry, The Ohio State University.
10.1021/jm990125i CCC: $18.00 © 1999 American Chemical Society
Published on Web 08/10/1999

Substrates for Human Thymidine Kinases 1 and 2
J ournal of Medicinal Chemistry, 1999, Vol. 42, No. 17 3379
F igu r e 1. SDS-PAGE of recombinant TK1 and TK2 prepa-
rations. 50 ng of TK1 and 15 ng of TK2 were loaded on the
gel; M ) molecular weight markers.
boron in closest proximity to DNA which is the most
4
7
crucial target of the He2+ and Li3+ particles, thereby
increasing the radiobiological effectiveness (RBE) of the
boron neutron capture reaction significantly.6 Therefore,
Thd and dUrd analogues may be excellent vehicles for
the selective delivery of 10B to those parts of tumors
consisting of viable cells and would certainly be ideal
components of a “BNCT cocktail”.
A large number of natural and unnatural nucleosides
modified with various boron moieties at different posi-
tions of either the base or the sugar have been synthe-
sized and evaluated biologically for use in BNCT.1,7,8
Some dUrd derivatives were found to be phosphorylated
in CEM cells in vitro9 and in phosphoryl-transfer assays
with human thymidine kinase.10,11 However, the ob-
served rates of phosphorylation were low compared to
natural nucleosides, and the roles of cytosolic and
mitochondrial thymidine kinase (TK2) in the phospho-
rylation were not investigated. At present, it is not
known if certain types of tumors contain high levels of
TK2 activity. This enzyme seems to be localized pre-
dominantly in mitochondria and appears to be equally
active in proliferating and nonproliferating cells.12 The
substrate specificities of TK1 and TK2 differ signifi-
cantly,13 and therefore it is important to be able to
determine the activities of boronated nucleoside ana-
logues with defined preparations of TK1 and TK2.
This paper describes in detail the synthesis of new
tethered carboranyl Thd and dUrd analogues and their
evaluation in phosphoryl-transfer assays with recom-
binant human TK1 and TK2 (Figure 1), as well as with
human TK1 purified from leukemia cells, in comparison
with several known boronated nucleosides10,11,14,15 which
are listed in Figure 2.
F igu r e 2. C-5-Carboranyl-2′-deoxyuridine analogues.
component.7,8 The positioning of a bulky group such as
the carborane cage in immediate proximity to the
nucleoside may dramatically interfere with its binding
to thymidine kinases, whereas addition of a tether
propels the bulky boron moiety away from the nucleo-
side, thereby decreasing steric interference and allowing
better binding to the enzyme. The concept of using a
tether to overcome steric hindrance has proven useful
in the application of affinity chromatography that
exploits the binding of enzymes to substrates covalently
linked to a solid support matrix.17,18 The results of these
affinity chromatography studies indicated that a tether
length of approximately 7 methylene units provided
optimal binding.17,18 Shorter tethers bound enzyme less
efficiently because of possible steric interference by the
nearby column matrix, and longer tethers may fold back
on themselves thereby reducing the effective tether
length. The tether concept has been applied previously
by us10,11,14 and others19 in the synthesis of carboranyl
nucleosides.
Resu lts a n d Discu ssion
Ch em istr y. o-Carborane was chosen as the boron
moiety for Thd and dUrd analogues because it contains
10 boron atoms and is easily incorporated into organic
structures.1 In addition, there is a lack of appropriate
alternative boron entities possessing a sufficient number
of boron atoms that are suitable for attachment to
nucleosides. The inherent drawbacks of o-carborane are
its extreme lipophilicity, often rendering potentially
bioactive structures containing this cluster water-
insoluble,1 and its dimensions, which are approximately
50% larger than the space occupied by the three-
dimensional sweep of a phenyl group.16 The possibility
of steric hindrance prompted us to apply the concept of
a hydrocarbon tether between the carborane and the
nucleoside portion, unlike other boronated nucleosides
having the carborane directly attached to the nucleoside
The C-5 position of dUrd and the N-3 position of Thd
were chosen for the attachment of the o-carborane via
a tether. Reports indicate that 5-(methylmercapto)-2′-

3380 J ournal of Medicinal Chemistry, 1999, Vol. 42, No. 17
Lunato et al.
Sch em e 1a
SN2 mechanism led to the formation of nucleosides 16-
19 with the desired â-configuration. The R-anomers 20-
23 were also produced to a lesser extent, possibly from
an SN1 mechanism, but the use of ZnCl2 catalyst was
found to favor the desired â-anomer. The anomeric
1
configurations were determined by H NMR where the
H-1 signals are characteristically a doublet of doublets
(J ≈ 3 and 7 Hz) for R-nucleosides and a pseudotriplet
(J ≈ 7 Hz) for â-nucleosides.34 The anomeric ratios (â:
R) averaged 3:1 with the use of ZnCl2 in contrast to 1:1
without catalyst. The â-anomers were deprotected at 0
°C with sodium methoxide in methanol to yield the
target compounds 24-27 (Scheme 2). As a result of the
mild reaction conditions, base degradation of the car-
borane cage could be largely prevented.35
a
(a) B10H12(CH3CN)2/toluene/reflux/4-8 h.
deoxyuridine was phosphorylated20 and rapidly incor-
porated into DNA.21 Because of this tolerance for
5-mercapto substituents by enzymes involved in DNA
biosynthesis, the carboranylalkyl moieties in compounds
24-27 were also attached through a thioether linkage
at the 5-position of dUrd. A brief description of the
synthesis of 5-(carboranylalkylmercapto)-2′-deoxyuridines
has been published previously.22
The carboranylalkyl substituents were also bound to
N-3 of Thd (29-32) since in the affinity chromatography
studies mentioned above, Thd was most likely linked
through this position to the stationary phase.23 Since
thymidine kinases bound to the putative N-3-linked Thd
ligand of the affinity columns, it is reasonable to assume
that the same type of linkage might be tolerated for the
tethered attachment of the bulky carboranes without
significant loss of binding affinity. Nucleosides possess-
ing a cyanoborane substituent at the N-3 position have
been described previously by Sood et al.24
Tosylates 1-5 were prepared according to a procedure
described by Kabalka et al.25 from the corresponding
alcohols (Scheme 1).26-28 To the best of our knowledge,
compounds 3 and 5 have not been described previously
and were analyzed by 1H NMR. The tosyl functions
serve as electrophiles for the alkylation procedures
described subsequently and as protective groups for the
hydroxyl functions in the following boronation reaction,
since the presence of a free hydroxyl group would
prohibit carborane formation.1 For the boronation of
1-5, the bis(acetonitrile)decaborane complex, B10H12(CH3-
CN)2, was obtained by refluxing decaborane in aceto-
nitrile for 4 h.29 This complex was used to boronate
compounds 1-5 to form the respective carboranyl
derivatives 6-10 by refluxing in toluene for 4-8 h.29
S-Alkylation30 of 5-mercaptouracil31 (11) was ac-
complished under argon and in deoxygenated methanol
to prevent the oxidation of 11 during the reaction
(Scheme 2). 5-Mercaptouracil31 (11) was alkylated with
carboranyl tosylates 6-8 and 10 to yield the 5-S-
alkylated mercaptouracils 12-15 using only 1 equiv of
sodium methoxide to avoid the possible alkoxide deg-
radation of the carboranes.32
The 3-(carboranylalkyl)thymidines 29-32 (Scheme 3)
were synthesized in a one-step reaction from Thd (28)
by adapting procedures described previously.36,37 Tosyl-
ates 6-9 were added to a solution of potassium carbon-
ate and Thd in a DMF/acetone mixture at 50 °C to yield
the target compounds 29-32 (Scheme 3). The basic
conditions were mild enough not to degrade the carbo-
rane cage. While alkylation at other positions may
generally be possible under these reaction conditions,
it has not been reported in the literature,36,37 and
selective alkylation of the N-3 position was confirmed
by a correlation of the 13C NMR chemical shifts of 29-
32 with those of 3-methylthymidine38 and 4-O-meth-
ylthymidine.38
Compound 34, the disodium salt of the 5′-monophos-
phate of nucleoside 29, was prepared according to a
procedure described previously39 in order to function as
a reference in phosphoryl-transfer assays described in
the following section (Scheme 3). Bis(trichloroethyl)-
phosphorochloridate and compound 29 were reacted in
acetonitrile in the presence of pyridine to yield the
protected phosphate 33. Removal of the trichloroethyl
groups using zinc powder in 90% acetic acid, conversion
to the sodium salt by cation exchange, and subsequent
purification by reversed-phase flash chromatography
furnished compound 34.
Biologica l Resu lts. The results of the phosphoryl-
transfer assays with recombinant human TK1 and TK2,
as well as with purified human TK1, indicated that
compounds 30, 31, 36-38, and 40-43 are not phospho-
rylated by recombinant TK2 (data not shown). Low but
significant levels of phosphorylation products with re-
combinant TK2 could be detected for all 5-S-substituted
dUrd analogues (24-27), two N-3-substituted Thd ana-
logues (29, 32), compound 35 (previously designated as
CDU9), and compound 39 (data not shown). Among the
5-S-substituted dUrd analogues, there was clearly high-
er activity for the compounds with a shorter 5-S-alkyl
tether between nucleoside and carborane cage, in parti-
cular for 24 (Figure 3). Recombinant TK1 exhibited no
activity with all C-5-substituted carboranyl dUrd ana-
logues (24-27, 35-43). In addition, compound 25 was
not phosphorylated by purified TK1. However, all N-3-
substituted carboranyl Thd analogues were phosphoryl-
ated with both recombinant and purified TK1 at rela-
tively high rates ranging from 3-28% for recombinant
TK1 and ∼10-20% for purified TK1 (in relation to Thd
as the reference) (Table 1). The results in Table 1 are
compiled from two independent sets of experiments,
The 5-(carboranylalkylmercapto)pyrimidines 12-15
were silylated with hexamethyldisilazane (HMDS) and
a catalytic amount of trimethylsilyl chloride (TMSCl)
in THF to yield the intermediate 2,4-bis-silylated pyri-
midines which were reacted in situ with R-D-2-deoxy-
3,5-di-O-p-toluoylribofuranosyl chloride33 in carbon tet-
rachloride with ZnCl2 as a catalyst, to yield nucleosides
16-23 (Scheme 2).30 The labile TMS group at the
4-position was lost during the workup.
Nucleophilic displacement of the chloride in R-D-2-
deoxy-3,5-di-O-p-toluoylribofuranosyl chloride33 by an

Substrates for Human Thymidine Kinases 1 and 2
J ournal of Medicinal Chemistry, 1999, Vol. 42, No. 17 3381
Sch em e 2a
a
(a) 6-8, 10/NaOCH3/CH3OH/60 °C/4-6 h; (b) HMDS/TMSCl, THF/reflux/4-6 h; (c) 3,5-di-O-p-toluoyl-2-deoxy-R-D-ribofuranosyl chloride/
ZnCl2/CCl4/rt/2-4 days; (d) NaOCH3/CH3OH/0 °C/3-5 days.
Sch em e 3a
a
(a) 6-9/K2CO3/DMF-acetone (1:1)/50 °C/2 days; (b) 29/bis(2,2,2-trichloroethyl)phosphorochloridate/pyridine/0 °C/3 days; (c) Zn/AcOH/
rt/ 2 h/Dowex 50X8-100 (Na+-form).
and there is an apparent discrepancy between the
phosphorylation rates of compounds 31 and 32 with
recombinant and purified TK1. This is most likely due
to the different enzyme preparations and assay condi-
tions. In the case of the assays with purified TK1,
concentrations of protein, substrate, and solubilizing
DMSO (2.5%) were high and that of ATP was low. In
the assays with pure recombinant TK1, the concentra-
tions of protein, substrate, and DMSO (∼0.3%) were
much lower while that of ATP was higher. Therefore, it
is difficult to compare directly the activities since the
varying solubilities of the nucleoside analogues may also
have a significant effect on their phosphorylation rates.
Nevertheless, no increase in activity for the N-3-
substituted carboranyl Thd analogues with increasing
spacer length could be observed with any of the TK1
preparations.
For compounds 29 and 30, which appear to possess
the most favorable phosphorylation rates in both TK1
assay systems, we have also determined rather high Km
values (105 ( 12 and 71 ( 3 µM, respectively, with
recombinant TK1). For comparison, the Km for Thd is
∼1 µM.12 These data translate into a relative efficiency
(Vmax/Km) of ∼0.3% for both 29 and 30.
The obtained data for N-3-substituted carboranyl Thd
analogues with purified TK1 do not support the tether
concept, and the phosphorylation rates found for these
nucleosides with recombinant TK1 decrease with in-
creasing tether lengths. These results seem to contradict
the tether concept. However, we do not know whether

3382 J ournal of Medicinal Chemistry, 1999, Vol. 42, No. 17
Lunato et al.
F igu r e 3. Phosphorylation of dUrd and 5-S-carboranyl-2′-
deoxyuridine analogues 24-27 by recombinant TK2. The
reaction products were separated by PEI-cellulose TLC. The
concentrations of [γ-32P]ATP and substrates were 100 µM. The
assay conditions are described in detail in the Experimental
Section. The spot for the 5′-monophosphate of 26 is very faint,
and that of 27 can only be observed when higher substrate
and ATP concentrations are exposed to TK2 for an extended
period of time.
F igu r e 4. Comparative â/R-radiogram of enzymatically (TK1)
produced phosphorylation products of compound 29 and
synthetic 5′-monophosphate 34 as well as the results of
alkaline phosphatase treatment of these products: (A) â-ra-
diogram; (B) R-radiogram. Lanes: a ) TK1 + Thd + [γ-32P]-
ATP; b ) a + alkaline phosphatase; c ) TK1 + 29 +
[γ-32P]ATP; d ) c + alkaline phosphatase; e ) c + i; f ) g + i;
g ) TK1 + 29 + [31P]ATP; h ) g + alkaline phosphatase; i )
34; j ) i + alkaline phosphatase; k ) 29; MP ) 5′-monophos-
phate.
Ta ble 1. Relative Phosphorylation of Thd, dUrd, and 29-32
by Recombinant and Purified TK1
compd
recombinant TK1
purified TK1
Thd
dUrd
29
30
31
1a
nmc
0.55 ( 0.18
0.28 ( 0.03
0.19 ( 0.10
0.04 ( 0.02
0.03 ( 0.03
1b
0.20 ( 0.05
0.35 ( 0.01
0.32 ( 0.01
0.34 ( 0.06
phatase catalyzes the release of phosphate from several
phosphorylated compounds,40 and this procedure has
also been applied previously to prove indirectly the in
vitro phosphorylation of compound 35.9 Both experi-
ments were visualized by a combination of â- and
R-radiography41 which allows the detection of 32P (â-
particles) and 10B (R-particles from the [10B(n,R)7Li]
reaction) on TLC plates (Figure 4, see Experimental
Section for details). The pattern of the â/R-radiogram
displayed in Figure 4 shows that the phosphorylation
products of 29 obtained with TK1 and both [γ-32P]ATP
(lane c) and [31P]ATP (lane g) as well as compound 34
(lane i) have the same migrating ratio. Mixing of
enzymatic phosphorylation products with synthetic 34
does not change this ratio (lanes e and f). When products
from lanes a (Thd-5′-monophosphate), c, g, and i (com-
pound 34) were exposed to alkaline phosphatase, the
phosphorylated products disappear (lanes b, d, h, and
j), and in the case of lane j, a new product becomes
clearly visible at the position of compound 29 (lane k).
Very faint spots are also visible at the position of 29 on
lanes g and h because of incomplete conversion of 29 to
34 by TK1 (g) and/or reconversion of 34 to 29 by alkaline
phosphatase (h). All products at the positions of 29 and
34 are also UV-active. There are some additional
product spots that cannot be explained (lanes c, e, f, g,
and h). Particularly interesting are those at the Thd-
5′-monophosphate position on lanes c, e, f, and g. The
product causing these spots contains obviously both 32P
and 10B and is exclusively produced when compound 29
is exposed to TK1 and ATP. Therefore, it cannot be Thd-
5′-monophosphate. Since this product seems to be
significantly more polar than 34, it could be the diphos-
phate of 29 or the nido-carboranyl analogue of 34.
However, neither is TK1 known to catalyze the forma-
tion of diphosphates, nor are the experimental condi-
tions of the phosphoryl-transfer assay sufficiently basic
to cause degradation of the o-carborane cage in 34.
We have recently found evidence that TK1 purified
from human leukemic cells previously used in our
laboratories for the evaluation of compounds 35-43 as
32
a
For recombinant TK1, the obtained value for Thd was set to
b
1. For purified TK1, the obtained value for dUrd was set to 1.
c nm, not measured. Mean ( SD values are based on 4 experiments
for recombinant TK1 and 3 experiments for purified TK1. The
assay conditions are described in detail in the Experimental
Section.
this contradiction is due to a flaw in the concept or to
the water solubility of N-3-substituted carboranyl nu-
cleosides, which decreases with increasing tether length
thus probably limiting the number of substrates that
find access to the enzyme. Extended studies are cur-
rently underway in our laboratories, which address in
greater detail the influence of tether length and water
solubility on the phosphorylation rates of N-3-substi-
tuted carboranyl nucleosides with recombinant TK1.
TK2 generally possesses much broader substrate
specificity for pyrimidine nucleosides than TK1 and is
even known to tolerate relatively large substituents at
the 5-position of the base.12,13 However, the attachment
of any type of bulky carboranyl substituent at either
N-3 of Thd or C-5 of dUrd seems to prevent an efficient
interaction of recombinant TK2 with the substrates. As
in the case of compounds 29-32 with recombinant TK1,
the phosphorylation rates observed for the 5-S-substi-
tuted carboranyl dUrd analogues (24-27) with recom-
binant TK2 do not seem to support the tether concept.
However, the relationship between water solubilities
and TK2 phosphorylation velocities of compounds 24-
27 also remains to be determined.
Two different methods were employed to prove un-
equivocally that the product spots observed on PEI
cellulose TLC plates with the phosphoryl-transfer reac-
tion mixtures were indeed caused by phosphorylation
of the carboranyl nucleosides: (1) a Rf value comparison
of the phosphorylation product of 29 with synthetic 5′-
monophosphate 34 and (2) enzymatic removal of the
phosphate moiety from 34 as well as from the phospho-
rylation product of 29. It is known that alkaline phos-

Substrates for Human Thymidine Kinases 1 and 2
J ournal of Medicinal Chemistry, 1999, Vol. 42, No. 17 3383
substrates for TK110,11 may have been contaminated
with TK2.42 The results of the present study indicate
that the phosphorylation found for compounds 35-43
in these earlier studies10,11 may have been caused by
this TK2 contamination rather than by TK1.
VG 70-250S, Nicolet FTMS-2000, or Finnigan MAT-900 mass
spectrometer. Ionization was achieved by electron impact for
high-resolution mass spectra (HR-EI) and fast atom bombard-
ment (FAB) with Xe using m-nitrobenzyl alcohol (3-NBA) as
a matrix. For all carborane-containing compounds, the mass
of the most intensive peak of the isotopic pattern was reported;
measured patterns agreed with calculated patterns, and the
mass was calculated for a 80% boron-11 and 20% boron-10
distribution in the case of HR-EI. Elemental analyses were
performed by Galbraith Laboratories, Inc., Knoxville, TN,
Atlantic Microlab, Inc., Norcross, GA, or Robertson Microlit
Laboratories, Inc., Madison, NJ . IR spectra were recorded on
a Laser Precision Corp. RFX-40 FT-IR spectrometer. Melting
points were determined on a Fisher-J ohns or Thomas-Hoover
melting point apparatus and are reported uncorrected. Pre-
coated glass-backed TLC plates with silica gel 60 F254 (0.25-
mm layer thickness) and silica gel 60 (70-230 mesh) from
Merck were used for TLC and column chromatography,
respectively. General compound visualization for TLC was
achieved by UV light and I2 vapor. Carbohydrate-containing
compounds were selectively visualized by spraying the plate
with 1% H2SO4 and heating at 120 °C. Carborane-containing
compounds were selectively visualized by spraying the plate
with a 0.06% PdCl2/1% HCl solution and heating at 120 °C
which caused the slow (15-45 s) formation of a gray spot due
to reduction of Pd2+ to Pd0. Dynamax C18 and C8 columns (10.0
× 250 mm, 8-µm particle size, 60 Å pore size) were used for
analytical reversed-phase chromatography on an analytical/
semipreparative Rainin HPLC system with Macintosh-based
data acquisition and Rainin Dynamax model UV-1 detector.
Merck C8 silica gel (particle size ) 40 µm, pore size ) 60 Å)
was used for preparative reversed-phase flash chromatogra-
phy. Reagent-grade solvents were used for column chroma-
tography. Pyridine, acetonitrile, and dimethylformamide (DMF)
were dried over 4 Å molecular sieves. Tetrahydrofuran (THF)
was dried by distillation from sodium and benzophenone
indicator under argon. Toluene was dried over sodium. Other
chemicals were purchased from commercial suppliers.
Su m m a r y a n d Con clu sion
The reaction sequences for the syntheses of 3-(carbo-
ranylalkyl)thymidines 29-32 involve 3-4 steps from
readily available starting materials in up to ∼75%
overall yield (29). Complicated reaction and purification
procedures are not required. Thus, the synthesis of N-3-
substituted carboranyl Thd analogues applying the
methodology described herein should generally be suit-
able for large-scale production. The syntheses of 5-(car-
boranylalkylmercapto)-2′-deoxyuridines 24-27 require
9-10 steps and involve the separations of anomeric
mixtures. The overall yields are very low. In particular,
the necessary synthesis of 5-mercaptouracil starting
from 5-aminouracil proved to be a very tedious proce-
dure in our hands with yields not exceeding 6%.42
Both recombinant and purified TK1, the therapeuti-
cally relevant thymidine kinase isoform, tolerate bulky
carboranylalkyl substituents at the N-3 position of Thd
but do not tolerate bulky carboranyl groups at the C-5
position of dUrd. In the case of recombinant TK1, the
phosphorylation rates for the tested N-3-substituted
nucleosides decrease with increasing tether lengths
between nucleoside and carborane cage. To the best of
our knowledge, substantial phosphorylation velocities
for Thd derivatives with bulky groups at the N-3
position with TK1 have not been reported as yet. Our
findings are supported by previous studies demonstrat-
ing that Thd analogues substituted at the N-3 position
with various groups are potent inhibitors of Thd phos-
phorylation by TK1.43,44 Low amounts of phosphoryla-
tion product were detected for 8 out of 17 nucleosides
tested with recombinant TK2. Nine nucleosides were not
phosphorylated by recombinant TK2. The compounds
with a shorter 5-S-alkyl tether between nucleoside and
carborane cage seem to be better substrates for recom-
binant TK2.
Gen er a l P r oced u r e for th e Tosyla tion of Acetylen ic
Alcoh ols. Following a procedure developed by Kalbalka,25
alkyn-1-ols were dissolved in 35 mL of dichloromethane and
cooled to -10 °C. Pyridine (3 equiv) and p-toluenesulfonyl
chloride (2 equiv) were added, and the solution was stirred
for 2 h during which time the reaction reached room temper-
ature. Equal volumes of water and diethyl ether were added.
The aqueous layers were extracted three times with diethyl
ether and the combined ether layers were washed with 2 N
HCl, 5% NaHCO3, and saturated NaCl solutions. The solutions
were dried over MgSO4, filtered, and evaporated to crude oils
which were purified by silica gel column chromatography.
These discoveries lend support to the assumption that
previous design strategies for the synthesis of boronated
nucleosides for BNCT, which have mainly focused on
the attachment of various types of carboranyl moieties
to the C-5 position of uridines, were based on biochemi-
cal considerations that may not be applicable. The
results of our experiments may open new avenues in
the future design of boronated Thd and dUrd analogues
for BNCT and may also have impact in compound
development for traditional diagnosis and therapy of
cancer and viral diseases.
7-Octyn yl Tosyla te (3). A quantity of 2.1 g (16.7 mmol) of
7-octyn-1-ol27 yielded 3.6 g (77%) of product isolated as a clear,
1
colorless oil: Rf 0.92 (CH2Cl2); H NMR (CDCl3) δ 1.19-1.39
(m, 4H, alkane), 1.45 (m, 2H, CH2-CH2CtCH), 1.62 (q, J )
6, 2H, CH2-CH2O), 1.88 (t, J ) 3, 1H, HCtC), 2.13 (m, 2H,
CH2CtC), 2.43 (s, 3H, CH3), 3.97 (t, J ) 6, 2H, CH2-O), 7.55
(dd, J ) 8, 4H, ArH).
9-Decyn yl Tosyla te (5). A quantity of 1.8 g (12 mmol) of
9-decyn-1-ol28 yielded 3.0 g (84%) of product isolated as a white,
waxlike solid: mp 29 °C; Rf 0.75 (2:1 dichloromethane:hexane);
1H NMR (CDCl3) δ 1.10-1.37 (m, 8H, alkane), 1.48 (q, J ) 7,
2H, CH2-CH2CtCH), 1.62 (q, J ) 7, 2H, CH2-CH2O), 1.91
(t, J ) 3, 1H, HCtC), 2.14 (m, 2H, CH2CtC), 2.41 (s, 3H, CH3),
4.00 (t, J ) 7, 2H, CH2-O), 7.55 (dd, J ) 8 Hz, 4H, ArH).
Gen er a l P r oced u r e for th e Bor on a tion of Acetylen ic
Tosyla tes. Following a standard procedure described previ-
ously,29 a bis(acetonitrile)decaborane complex was prepared
by refluxing decaborane in 45 mL of anhydrous acetonitrile
for 4 h. Deca bor a n e is a h igh ly toxic, im pa ct-sen sitive
com pou n d wh ich for m s explosive m ixtu r es especia lly
with h a logen a ted m a ter ia ls. A ca r efu l stu d y of th e MSDS
is a d visa ble befor e u sa ge. On cooling to room temperature,
the complex precipitated out of solution, was filtered, and was
washed with diisopropyl ether. The complex was obtained as
Exp er im en ta l Section
Ch em ist r y. Proton, carbon-13, and phosphorus-31 NMR
spectra were obtained on Bruker 250 and 270 MHz FT-NMRs
at The Ohio State University College of Pharmacy as well as
Bruker 300 and 500 MHz FT-NMRs at The Ohio State
University Campus Chemical Instrumentation Center. NMR
spectra on the latter two instruments were produced by Dr.
Charles E. Cottrell. Chemical shifts (δ) are reported in ppm
from an internal tetramethylsilane or an external phosphoric
acid standard. Coupling constants are reported in Hz. All mass
spectra were obtained at The Ohio State University Campus
Chemical Instrumentation Center by Dr. David Chang on a

3384 J ournal of Medicinal Chemistry, 1999, Vol. 42, No. 17
Lunato et al.
a white powder (85%). The acetylenic tosylates (1 equiv) and
the complex (1.5 equiv) were dissolved in 75 mL of toluene
and refluxed for 2-6 h. The solvent was evaporated leaving
thick red syrups which were extracted several times with
diethyl ether. Upon near complete extraction of the products,
the syrups yielded yellow solids which were removed by
filtration. The ether extracts were combined and evaporated
to crude oils which were purified by silica gel column chro-
matography.
5-(o-Ca r bor a n -1-yl)p en tyl Tosyla te (7). Utilizing the
above general procedure, 3.3 g (12.4 mmol) of 6-heptynyl
tosylate26 yielded the corresponding carboranyl analogue. After
purification by silica gel column chromatography and recrys-
tallization from hexane containing a minimal amount of ethyl
acetate, 3.0 g (62%) of product was isolated as a white
crystalline solid: mp 109-110 °C; Rf 0.59 (2:1 hexane:ethyl
acetate); 1H NMR (CDCl3) δ 1.00-3.61 (br m, 10H, BH), 1.19-
1.51 (m, 4H, alkane), 1.62 (q, J ) 7, 2H, CH2-CH2O), 2.14
(m, 2H, CH2-CCarborane), 2.45 (s, 3H, CH3), 3.52 (br s, 1H,
CCarborane-H), 3.99 (t, J ) 6, 2H, CH2-O), 7.55 (dd, J ) 8, 4H,
ArH), 13C NMR (CDCl3) δ 21.59 (CH3), 24.87 (CH2), 28.35
(CH2), 28.44 (CH2), 37.87 (CH2), 61.12 (CCarborane-H), 69.77
(CH2-O), 74.98 (CCarborane-C), 127.84 (Ar), 129.88 (Ar), 133.28
(Ar), 144.86 (Ar); MS (HR-EI) C14H28O3SB10 calcd 384.2762,
found 384.2735.
Dinan,45,46 5-mercaptouracil31 (1 equiv) and NaOMe (1 equiv)
were added to 50 mL of anhydrous MeOH previously degassed
with argon. The corresponding carboranylalkyl tosylates (1
equiv) were added immediately, and the mixtures were stirred
under argon for 4-6 h at 60 °C. The reactions were cooled
and then neutralized with HCl/MeOH. Solvents were evapo-
rated and the solid residues taken up in a minimum amount
of THF and adsorbed to a minimal amount of silica gel by
careful evaporation of the THF under reduced pressure. The
mixtures were chromatographed on silica gel columns to obtain
both the products and the unreacted tosylates.
5-[4-(o-Ca r bor a n -1-yl)bu tylm er ca p to]u r a cil (12). Fol-
lowing the procedure outlined above, 1.1 g (7.6 mmol) of
5-mercaptouracil (11) and 2.8 g (7.6 mmol) of 4-(o-carboran-
1-yl)butyl tosylate14 yielded 0.89 g (35%) of product as a white
amorphous solid: mp 255-256 °C; Rf 0.71 (9:1 ethyl acetate:
1
hexane); H NMR (DMSO-d6) δ 1.10-3.15 (br m, 10H, BH),
1.30-1.55 (m, 4H, alkane), 2.25 (m, 2H, CH2-CCarborane), 2.62
(t, J ) 7, 2H, CH2-S), 5.14 (br s, 1H, CCarborane-H), 7.58 (d, J
) 6, 1H, H-6), 11.10 (br d, 1H, H-1), 11.28 (br s, 1H, H-3); 13
C
NMR (DMSO-d6) δ 27.54 (CH2), 27.64 (CH2), 31.75 (CH2), 35.95
(CH2), 62.95 (CCarborane-H), 76.38 (CCarborane-C), 104.46 (C-5),
144.40 (C-6), 151.00 (C-2), 162.57 (C-4); MS (HR-EI) C10H22O2N2-
SB10 calcd 342.2405, found 342.2391.
5-[5-(o-Ca r bor a n -1-yl)p en tylm er ca p to]u r a cil (13). Fol-
lowing the procedure outlined above, 0.40 g (2.8 mmol) of
5-mercaptouracil (11) and 1.1 g (2.8 mmol) of 5-(o-carboran-
1-yl)pentyl tosylate (7) yielded 0.40 g (40%) of product as a
white amorphous solid: mp 261-262 °C; Rf 0.75 (9:1 ethyl
acetate:hexane); 1H NMR (DMSO-d6) δ 1.10-3.20 (br m, 10H,
BH), 1.10-1.50 (m, 6H, alkane), 2.22 (m, 2H, CH2-CCarborane),
2.61 (t, J ) 7, 2H, CH2-S), 5.14 (br s, 1H, CCarborane-H), 7.56
(s, 1H, H-6), 11.08 (br s, 1H, H-1), 11.27 (br s, 1H, H-3); 13C
NMR (DMSO-d6) δ 26.89 (CH2), 27.82 (CH2), 28.14 (CH2), 32.14
(CH2), 36.38 (CH2), 62.82 (CCarborane-H), 76.40 (CCarborane-C),
104.72 (C-5), 144.11 (C-6), 150.95 (C-2), 162.49 (C-4); MS (HR-
EI) C11H24O2N2SB10 calcd 356.2562, found 356.2560.
5-[6-(o-Ca r bor a n -1-yl)h exylm er ca p to]u r a cil (14). Fol-
lowing the procedure outlined above, 0.29 g (2.0 mmol) of
5-mercaptouracil (11) and 0.80 g (2.0 mmol) of 6-(o-carboran-
1-yl)hexyl tosylate (8) yielded 0.29 g (39%) of product as a
white amorphous solid: mp 232-233 °C; Rf 0.77 (9:1 ethyl
acetate:hexane); 1H NMR (DMSO-d6) δ 1.09-3.25 (br m, 10H,
BH), 1.10-1.50 (m, 8H, alkane), 2.21 (m, 2H, CH2-CCarborane),
2.62 (t, J ) 7, 2H, CH2-S), 5.14 (br s, 1H, CCarborane-H), 7.55
(s, 1H, H-6), 11.08 (br s, 1H, H-1), 11.25 (br s, 1H, H-3); 13C
NMR (DMSO-d6) δ 27.16 (CH2), 27.53 (CH2), 28.11 (CH2), 28.51
(CH2), 32.25 (CH2), 36.42 (CH2), 62.85 (CCarborane-H), 76.43
(CCarborane-C), 104.90 (C-5), 143.91 (C-6), 150.92 (C-2), 162.49
(C-4); MS (HR-EI) C12H26O2N2SB10 calcd 370.2718, found
370.2713.
5-[8-(o-Ca r bor a n -1-yl)octylm er ca p to]u r a cil (15). Fol-
lowing the procedure outlined above, 0.21 g (1.5 mmol) of
5-mercaptouracil (11) and 0.62 g (1.5 mmol) of 8-(o-carboran-
1-yl)octyl tosylate (10) yielded 0.16 g (28%) of product as a
white amorphous solid: mp 222-223 °C; Rf 0.69 (9:1 ethyl
acetate:hexane); 1H NMR (DMSO-d6) δ 1.00-3.25 (br m, 10H,
BH), 1.10-1.50 (m, 12H, alkane), 2.22 (m, 2H, CH2-CCarborane),
2.62 (t, J ) 7, 2H, CH2-S), 5.14 (br s, 1H, CCarborane-H), 7.55
(d, J ) 5, 1H, H-6), 11.08 (br d, J ) 5, 1H, H-1), 11.26 (br s,
1H, H-3); 13C NMR (DMSO-d6) δ 27.60 (CH2), 27.96 (CH2),
28.09 (CH2), 28.18 (CH2), 28.28 (CH2), 28.60 (CH2), 32.28 (CH2),
36.47 (CH2), 62.88 (CCarborane-H), 76.50 (CCarborane-C), 104.94 (C-
5), 143.87 (C-6), 150.94 (C-2), 162.49 (C-4); MS (HR-EI)
6-(o-Car bor an -1-yl)h exyl Tosylate (8). Utilizing the above
general procedure, 2.6 g (9.2 mmol) of 7-octynyl tosylate (3)
yielded the corresponding carboranyl analogue. After purifica-
tion by silica gel column chromatography and recrystallization
from hexane containing a minimal amount of ethyl acetate,
1.7 g (45%) of product was isolated as a white crystalline
solid: mp 52-53 °C; Rf 0.56 (2:1 hexane:ethyl acetate); 1H
NMR (CDCl3) δ 1.10-3.75 (br m, 10H, BH), 1.10-1.50 (m, 6H,
alkane), 1.61 (q, J ) 6, 2H, CH2-CH2O), 2.12 (m, 2H, CH2-
C
Carborane), 2.42 (s, 3H, CH3), 3.55 (br s, 1H, CCarborane-H), 4.00
(t, J ) 6, 2H, CH2-O), 7.55 (dd, J ) 8, 4H, ArH); 13C NMR
(CDCl3) δ 21.58 (CH3), 24.96 (CH2), 28.21 (CH2), 28.61 (CH2),
28.90 (CH2), 37.94 (CH2), 61.09 (CCarborane-H), 70.16 (CH2-O),
75.23 (CCarborane-C), 127.84 (Ar), 129.83 (Ar), 133.41 (Ar), 144.74
(Ar); MS (HR-EI) C15H30O3SB10 calcd 398.2919, found 398.2915.
7-(o-Ca r bor a n -1-yl)h ep tyl Tosyla te (9). Utilizing the
above general procedure, 3.1 g (10.5 mmol) of 8-nonynyl
tosylate26 yielded the corresponding carboranyl analogue. After
purification by silica gel column chromatography and recrys-
tallization from hexane containing a minimal amount of ethyl
acetate, 2.5 g (59%) of product was isolated as a white
crystalline solid: mp 62-65 °C; Rf 0.52 (2:1 hexane:ethyl
acetate); 1H NMR (CDCl3) δ 1.10-3.55 (br m, 10H, BH), 1.10-
1.47 (m, 8H, alkane), 1.62 (q, J ) 6, 2H, CH2-CH2O), 2.14
(m, 2H, CH2-CCarborane), 2.44 (s, 3H, CH3), 3.55 (br s, 1H,
C
Carborane-H), 4.00 (t, J ) 6, 2H, CH2-O), 7.55 (dd, J ) 8, 4H,
ArH); 13C NMR (CDCl3) δ 21.55 (CH3), 25.11 (CH2), 28.33
(CH2), 28.60 (CH2), 28.69 (CH2), 28.95 (CH2), 37.98 (CH2), 61.08
(CCarborane-H), 70.35 (CH2-O), 75.38 (CCarborane-C), 127.80 (Ar),
129.80 (Ar), 133.36 (Ar), 144.69 (Ar); MS (HR-EI) C16H30O3-
SB10 calcd 412.3075, found 412.3067.
8-(o-Ca r bor a n -1-yl)octyl Tosyla te (10). Utilizing the
above general procedure, 3.0 g (9.7 mmol) of 9-decynyl tosylate
(5) yielded the corresponding carboranyl analogue. After
purification by silica gel column chromatography and recrys-
tallization from hexane containing a minimal amount of ethyl
acetate, 2.1 g (50%) of product was isolated as a white
crystalline solid: mp 37-40 °C; Rf 0.58 (2:1 hexane:ethyl
acetate); 1H NMR (CDCl3) δ 1.10-3.55 (br m, 10H, BH), 1.10-
1.50 (m, 10H, alkane), 1.60 (q, J ) 6, 2H, CH2-CH2O), 2.15
(m, 2H, CH2-CCarborane), 2.41 (s, 3H, CH3), 3.55 (br s, 1H,
C
14H30O2N2SB10 calcd 398.3031, found 398.3040.
Gen er a l P r oced u r e for th e P r ep a r a tion of Ca r bor a n yl
Nu cleosid es. The silyl-Hilbert-J ohnson reaction47-50 was
employed to synthesize the following blocked carboranyl
nucleosides. 5-S-(Carboranylalkyl)uracils (1 equiv) were dis-
solved in 30 mL of anhydrous THF. Hexamethyldisilazane
(HMDS) (2 equiv) and catalytic amounts of TMSCl (0.01 equiv)
were added and the solutions refluxed under argon atmo-
sphere. The byproduct, NH4Cl, sublimed and was periodically
removed from the condenser tips. The cessation of NH4Cl
C
Carborane-H), 3.95 (t, J ) 6, 2H, CH2-O), 7.55 (dd, J ) 8, 4H,
ArH); 13C NMR (CDCl3) δ 21.52 (CH3), 25.12 (CH2), 28.52
(CH2), 28.59 (CH2), 28.64 (CH2), 28.71 (CH2), 29.00 (CH2), 37.90
(CH2), 61.02 (CCarborane-H), 70.51 (CH2-O), 75.43 (CCarborane-C),
127.72 (Ar), 129.76 (Ar), 133.10 (Ar), 144.66 (Ar); MS (HR-EI)
C
17H34O3SB10 calcd 426.3232, found 426.3224.
Gen er a l P r oced u r e for th e Alk yla tion of 5-Mer ca p -
tou r a cil. Following a procedure similar to the one used by

Substrates for Human Thymidine Kinases 1 and 2
J ournal of Medicinal Chemistry, 1999, Vol. 42, No. 17 3385
sublimation indicated that the reactions were complete (4-6
h). Removal of THF and excess HMDS by evaporation left clear
oil residues which were immediately used for the condensation
step. The oils were dissolved in 25 mL of anhydrous CCl4, and
freshly prepared R-D-2-deoxy-3,5-di-O-p-toluoylribofuranosyl
chloride33 (1.25 equiv) and ZnCl2 (0.01 equiv) were added all
at once. The reactions were stirred at room temperature for
2-4 days, and then CCl4 was removed, leaving crude oils
which were purified by silica column chromatography. In all
cases the â-anomers eluted before the R-anomers. Fractions
containing both anomers were analyzed by 1H NMR to
determine their anomeric ratios. The overall anomeric ratios
were determined by weight.
cedure above, 0.36 g (1.0 mmol) of 5-[6-(o-carboran-1-yl)-
hexylmercapto]uracil (14) yielded 0.43 g (59%) of the â-anomer
as a white foam: mp 94-97 °C; Rf 0.38 (3:2 hexane:ethyl
acetate); 1H NMR (CDCl3) δ 1.10-3.14 (br m, 10H, BH), 1.10-
1.34 (m, 4H, alkane), 1.34-1.52 (m, 4H, alkane), 2.17 (m, 2H,
CH2-CCarborane), 2.42 (s, 3H, CH3), 2.43 (s, 3H, CH3), 2.49 (m,
2H, H-2′), 2.72 (m, 2H, CH2-S), 3.59 (br s, 1H, CCarborane-H),
4.56 (m, 1H, H-4′), 4.71 (m, 2H, H-5′), 5.60 (br d, 1H, H-3′),
6.40 (dd, J ) 8, J ) 5, 1H, H-1′), 7.60 (dd, J ) 8, 8H, ArH),
7.80 (s, 1H, H-6), 9.18 (br s, 1H, H-3); 13C NMR (CDCl3) δ 21.74
(CH3), 27.85 (CH2), 28.40 (CH2), 28.76 (CH2), 29.04 (CH2), 33.46
(CH2), 37.94 (CH2), 38.42 (C-2′), 61.11 (CCarborane-H), 64.17 (C-
5′), 74.76 (C-3′), 75.38 (CCarborane-C), 83.17 (C-1′), 85.63 (C-4′),
109.39 (C-5), 126.24 (Ar), 126.48 (Ar), 129.33 (Ar), 129.46 (Ar),
129.71 (Ar), 129.87 (Ar), 144.47 (Ar), 144.66 (Ar), 141.17 (C-
6), 150.00 (C-2), 161.61 (C-4), 166.04 (CdO), 166.14 (CdO);
MS (FAB+, 3-NBA) 723 (M + 1). The total nucleoside yield
was 85% with a â:R ratio of 2.3:1.
5-[6-(o-Ca r bor a n -1-yl)h exylm er ca p to]-3′,5′-d i-O-p-tolu -
oyl-r-D-2′-d eoxyu r id in e (22). The R-anomer, 0.19 g (26%),
was isolated as a white foam: Rf 0.29 (3:2 hexane:ethyl
acetate); 1H NMR (CDCl3) δ 1.03-3.10 (br m, 10H, BH), 1.03-
1.33 (m, 4H, alkane), 1.33-1.53 (m, 4H, alkane), 2.16 (m, 2H,
CH2-CCarborane), 2.40 (s, 3H, CH3), 2.42 (s, 3H, CH3), 2.72 (m,
2H, CH2-S), 2.80 (m, 2H, H-2′), 3.65 (br s, 1H, CCarborane-H),
4.53 (m, 2H, H-5′), 4.93 (t, 1H, H-4′), 5.64 (br d, 1H, H-3′),
6.33 (br d, J ) 6, 1H, H-1′), 7.52 (dd, J ) 9, 4H, ArH), 7.62
(dd, J ) 9, 4H, ArH), 7.92 (s, 1H, H-6), 10.00 (br s, 1H, H-3).
5-[8-(o-Ca r bor a n -1-yl)octylm er ca p to]-3′,5′-d i-O-p-tolu -
oyl-â-D-2′-d eoxyu r id in e (19). Performing the general pro-
cedure above, 1.1 g (2.75 mmol) of 5-[8-(o-carboran-1-yl)-
octylmercapto]uracil (15) yielded 0.46 g (60%) of the â-anomer
as a white foam: mp 87-92 °C; Rf 0.39 (3:2 hexane:ethyl
acetate); 1H NMR (CDCl3) δ 0.80-3.30 (br m, 10H, BH), 1.10-
1.35 (m, 8H, alkane), 1.35-1.53 (m, 4H, alkane), 2.16 (m, 2H,
CH2-CCarborane), 2.42 (s, 3H, CH3), 2.43 (s, 3H, CH3), 2.49 (m,
2H, H-2′), 2.72 (m, 2H, CH2-S), 3.59 (br s, 1H, CCarborane-H),
4.56 (m, 1H, H-4′), 4.71 (m, 2H, H-5′), 5.60 (br d, 1H, H-3′),
6.40 (dd, J ) 8, J ) 5, 1H, H-1′), 7.60 (dd, J ) 8, 8H, ArH),
7.80 (s, 1H, H-6), 8.81 (br s, 1H, H-3); 13C NMR (CDCl3) δ 21.75
(CH3), 28.35 (CH2), 28.86 (CH2), 28.96 (CH2), 29.01 (CH2), 29.15
5-[4-(o-Ca r bor a n -1-yl)bu tylm er ca p to]-3′,5′-d i-O-p-tolu -
oyl-â-D-2′-d eoxyu r id in e (16). Performing the above general
procedure, 0.86 g (2.5 mmol) of 5-[4-(o-carboran-1-yl)butyl-
mercapto]uracil (12) yielded 0.90 g (51%) of the â-anomer as
a white foam: mp 92-97 °C; Rf 0.35 (3:2 hexane:ethyl acetate);
1H NMR (CDCl3) δ 1.10-3.40 (br m, 10H, BH), 1.34-1.63 (m,
4H, alkane), 2.17 (m, 2H, CH2-CCarborane), 2.42 (s, 3H, CH3),
2.43 (s, 3H, CH3), 2.49 (m, 2H, H-2′), 2.74 (m, 2H, CH2-S),
3.72 (br s, 1H, CCarborane-H), 4.57 (m, 1H, H-4′), 4.72 (m, 2H,
H-5′), 5.60 (br d, 1H, H-3′), 6.37 (dd, J ) 8.5, J ) 5.5, 1H,
H-1′), 7.61 (dd, J ) 8 Hz, ArH), 7.83 (s, 1H, H-6), 9.51 (br s,
1H, H-3); 13C NMR (CDCl3) δ 21.86 (CH3), 27.83 (CH2), 28.36
(CH2), 33.00 (CH2), 37.31 (CH2), 38.44 (C-2′), 61.23 (CCarborane
-
H), 64.04 (C-5′), 74.70 (C-3′), 75.03 (CCarborane-C), 83.23 (C-1′),
85.72 (C-4′), 108.78 (C-5), 126.15 (Ar), 126.41 (Ar), 129.28 (Ar),
129.40 (Ar), 129.64 (Ar), 129.80 (Ar), 144.47 (Ar), 144.61 (Ar),
141.61 (C-6), 149.88 (C-2), 161.83 (C-4), 166.00 (CdO), 166.07
(CdO); MS (FAB+, 3-NBA) 695 (M + 1). The total nucleoside
yield was 78% with a â:R ratio of 2:1.
5-[4-(o-Ca r bor a n -1-yl)bu tylm er ca p to]-3′,5′-d i-O-p-tolu -
oyl-r-D-2′-d eoxyu r id in e (20). The R-anomer, 0.46 g (26%),
was isolated as a white foam: Rf 0.30 (3:2 hexane:ethyl
acetate); 1H NMR (CDCl3) δ 1.15-3.35 (br m, 10H, BH), 1.32-
1.64 (m, 4H, alkane), 2.16 (m, 2H, CH2-CCarborane), 2.42 (s, 3H,
CH3), 2.43 (s, 3H, CH3), 2.74 (m, 2H, CH2-S), 2.79 (m, 2H,
H-2′), 3.65 (br s, 1H, CCarborane-H), 4.54 (m, 2H, H-5′), 4.94 (t,
1H, H-4′), 5.63 (br d, 1H, H-3′), 6.31 (br d, J ) 6, 1H, H-1′),
7.52 (dd, J ) 8, 4H, ArH), 7.61 (dd, J ) 8, 4H, ArH), 7.93 (s,
1H, H-6), 9.42 (br s, 1H, H-3).
(CH2), 33.53 (CH2), 38.09 (CH2), 38.44 (C-2′), 61.02 (CCarborane
-
H), 64.18 (C-5′), 74.81 (C-3′), 75.49 (CCarborane-C), 83.19 (C-1′),
85.61 (C-4′), 109.67 (C-5), 126.31 (Ar), 126.56 (Ar), 129.40 (Ar),
129.52 (Ar), 129.78 (Ar), 129.93 (Ar), 144.51 (Ar), 144.73 (Ar),
140.99 (C-6) 149.96 (C-2), 161.39 (C-4), 166.12 (CdO), 166.20
(CdO); MS (FAB+, 3-NBA) 751 (M + 1). The total nucleoside
yield was 82% with a â:R ratio of 2.7:1.
5-[8-(o-Ca r bor a n -1-yl)octylm er ca p to]-3′,5′-d i-O-p-tolu -
oyl-r-D-2′-d eoxyu r id in e (23). The R-anomer, 0.17 g (22%),
was isolated as a white foam: Rf 0.30 (3:2 hexane:ethyl
acetate); 1H NMR (CDCl3) δ 0.90-3.30 (br m, 10H, BH), 1.10-
1.35 (m, 8H, alkane), 1.35-1.58 (m, 4H, alkane), 2.17 (m, 2H,
CH2-CCarborane), 2.40 (s, 3H, CH3), 2.43 (s, 3H, CH3), 2.73 (m,
2H, CH2-S), 2.79 (m, 2H, H-2′), 3.57 (br s, 1H, CCarborane-H),
4.54 (AB m, 2H, H-5′), 4.92 (t, 1H, H-4′), 5.64 (br d, 1H, H-3′),
6.33 (br d, J ) 6, 1H, H-1′), 7.53 (dd, J ) 8, 4H, ArH), 7.61
(dd, J ) 8, 4H, ArH), 7.91 (s, 1H, H-6), 8.97 (br s, 1H, H-3).
Gen er a l P r oced u r e for th e Dep r otection of th e p-
Tolu oyl-P r ot ect ed Nu cleosid es. The blocked nucleosides
were dissolved in 10 mL of anhydrous MeOH, and a solution
of 40% NaOMe/MeOH was added dropwise to raise the pH to
9. The reaction mixtures were kept in a desiccator at 0 °C for
3-5 days. Periodically, it was necessary to add several drops
of the 40% NaOMe/MeOH solution to the reaction mixtures
to maintain a pH of 9. The reactions were neutralized with
Dowex 50WX2-200 ion-exchange resin (H+-form), filtered, and
evaporated to oils which were purified by silica gel column
chromatography. If clear glasses were obtained after evapora-
tion of the solvent, the glasses were dissolved in diethyl ether
and the ether was evaporated to obtain white foams.
5-[5-(o-Car bor an -1-yl)pen tylm er capto]-3′,5′-di-O-p-tolu -
oyl-â-D-2′-d eoxyu r id in e (17). Performing the general pro-
cedure above, 0.42 g (1.2 mmol) of 5-[5-(o-carboran-1-yl)-
pentylmercapto]uracil (13) yielded 0.50 g (58%) of the â-anomer
as a white foam: mp 99-102 °C; Rf 0.35 (3:2 hexane:ethyl
acetate); 1H NMR (CDCl3) δ 1.18-3.15 (br m, 10H, BH), 1.18-
1.34 (m, 2H, alkane), 1.34-1.53 (m, 4H, alkane), 2.16 (m, 2H,
CH2-CCarborane), 2.42 (s, 3H, CH3), 2.43 (s, 3H, CH3), 2.49 (m,
2H, H-2′), 2.73 (m, 2H, CH2-S), 3.67 (br s, 1H, CCarborane-H),
4.57 (m, 1H, H-4′), 4.71 (m, 2H, H-5′), 5.61 (br d, 1H, H-3′),
6.39 (dd, J ) 8.5, J ) 5.5, 1H, H-1′), 7.61 (dd, J ) 8, 8H, ArH),
7.81 (s, 1H, H-6), 9.42 (br s, 1H, H-3); 13C NMR (CDCl3) δ 21.76
(CH3), 27.65 (CH2), 28.57 (CH2), 28.70 (CH2), 33.43 (CH2), 37.86
(CH2), 38.48 (C-2′), 61.21 (CCarborane-H), 64.19 (C-5′), 74.79 (C-
3′), 75.31 (CCarborane-C), 83.25 (C-1′), 85.69 (C-4′), 109.23 (C-5),
126.29 (Ar), 126.53 (Ar), 129.41 (Ar), 129.54 (Ar), 129.77 (Ar),
129.93 (Ar), 144.59 (Ar), 144.75 (Ar), 141.50 (C-6), 150.03 (C-
2), 161.95 (C-4), 166.15 (CdO), 166.23 (CdO); MS (FAB+,
3-NBA) 709 (M + 1). The total nucleoside yield was 90% with
a â:R ratio of 1.8:1.
5-[5-(o-Car bor an -1-yl)pen tylm er capto]-3′,5′-di-O-p-tolu -
oyl-r-D-2′-d eoxyu r id in e (21). The R-anomer, 0.27 g (32%),
was isolated as a white foam: Rf 0.26 (3:2 hexane:ethyl
acetate); 1H NMR (CDCl3) δ 1.15-3.10 (br m, 10H, BH), 1.15-
1.35 (m, 2H, alkane), 1.35-1.53 (m, 4H, alkane), 2.16 (m, 2H,
CH2-CCarborane), 2.40 (s, 3H, CH3), 2.43 (s, 3H, CH3), 2.72 (m,
2H, CH2-S), 2.79 (m, 2H, H-2′), 3.65 (br s, 1H, CCarborane-H),
4.54 (m, 2H, H-5′), 4.93 (t, 1H, H-4′), 5.63 (br d, 1H, H-3′),
6.33 (br d, J ) 6, 1H, H-1′), 7.50 (dd, J ) 8, 4H, ArH), 7.62
(dd, J ) 8, 4H, ArH), 7.92 (s, 1H, H-6), 9.66 (br s, 1H, H-3).
5-[4-(o-Ca r bor a n -1-yl)bu tylm er ca p to]-â-D-2′-d eoxyu r i-
d in e (24). Following the above general procedure, 40 mg (0.06
mmol) 5-[4-(o-carboran-1-yl)butylmercapto]-3′,5′-di-O-p-tolu-
5-[6-(o-Ca r bor a n -1-yl)h exylm er ca p to]-3′,5′-d i-O-p-tolu -
oyl-â-D-2′-d eoxyu r id in e (18). Performing the general pro-

3386 J ournal of Medicinal Chemistry, 1999, Vol. 42, No. 17
Lunato et al.
oyl-â-D-2′-deoxyuridine (16) yielded 23 mg (86%) of product as
a white foam. The product was recrystallized from diethyl
ether to give a crystalline white solid: mp 145-146 °C; Rf 0.25
(4:1 CHCl3:acetone); 1H NMR (CD3OD) δ 1.30-3.17 (br m, 10H,
BH), 1.35-1.62 (m, 4H, alkane), 2.29 (m, 4H, H-2′ and CH2-
and 129 mg (0.35 mmol) of 4-(o-carboran-1-yl)butyl tosylate14
yielded 68 mg (93%) of product as a white foam: mp 91-97
1
°C; Rf 0.50 (1:1 CHCl3:acetone); H NMR (DMSO-d6) δ 1.20-
2.63 (br m, 10H, BH), 1.30-1.58 (m, 4H, alkane), 1.82 (s, 3H,
CH3), 2.12 (t, J ) 6, 2H, H-2′), 2.27 (m, 2H, CH2-CCarborane),
3.57 (m, 2H, H-5′), 3.77 (m, 3H, CH2-N and H-3′), 4.23 (br d,
1H, H-4′), 5.15 (br s, 1H, CCarborane-H), 6.20 (t, J ) 6, 1H, H-1′),
7.78 (s, 1H, H-6); 13C NMR (DMSO-d6) δ 12.78 (CH3), 26.09
(CH2), 26.18 (CH2), 35.97 (CH2), 39.47 (CH2), 40.28 (C-2′), 61.12
(CCarborane-H), 62.89 (C-5′), 70.17 (C-3′), 76.39 (CCarborane-C), 84.77
(C-1′), 87.32 (C-4′), 108.34 (C-5), 134.70 (C-6), 150.28 (C-2),
162.54 (C-4); MS (HR-EI) C16H32O5N2B10 calcd 440.3314, found
440.3313. Anal. (C16H32O5N2B10) C, H, N.
C
Carborane), 2.65 (br t, J ) 6.5, 2H, CH2-S), 3.71 (m, 2H, H-5′),
3.89 (dd, J ) 6, J ) 3, 1H, H-3′), 4.35 (m, 1H, H-4′), 4.44 (br
s, 1H, CCarborane-H), 6.19 (t, J ) 6.5, 1H, H-1′), 8.23 (s, 1H, H-6);
13C NMR (CD3OD) δ 29.13 (CH2), 29.46 (CH2), 33.87 (CH2),
38.33 (CH2), 41.72 (C-2′), 62.74 (CCarborane-H), 63.59 (C-5′), 72.22
(C-3′), 77.19 (CCarborane-C), 87.07 (C-1′), 89.22 (C-4′), 108.84 (C-
5), 144.64 (C-6), 151.94 (C-2), 164.42 (C-4); MS (FAB+, 3-NBA)
459 (M + 1). Anal. (C15H30O5N2SB10) C, H, N.
5-[5-(o-Ca r bor a n -1-yl)p en tylm er ca p to]-â-D-2′-d eoxyu r i-
d in e (25). Following the above general procedure, 100 mg
(0.15 mmol) of 5-[5-(o-carboran-1-yl)pentylmercapto]-3′,5′-di-
O-p-toluoyl-â-D-2′-deoxyuridine (17) yielded 57 mg (86%) of
product as a white foam: mp 88-93 °C; Rf 0.25 (4:1 CHCl3:
acetone); 1H NMR (CD3OD) δ 1.18-3.25 (br m, 10H, BH),
1.31-1.62 (m, 6H, alkane), 2.26 (m, 4H, H-2′ and CH2-
3-[5-(o-Ca r bor a n -1-yl)p en tyl]th ym id in e (30). Following
the above-described procedure, 40 mg (0.32 mmol) of Thd (28)
and 134 mg (0.35 mmol) of 5-(o-carboran-1-yl)pentyl tosylate
(7) yielded 37 mg (49%) of product as a white foam: mp 84-
87 °C; Rf 0.55 (1:1 CHCl3:acetone); 1H NMR (DMSO-d6) δ 1.20-
3.10 (br m, 10H, BH), 1.21 (q, 2H, alkane), 1.33-1.62 (m, 4H,
alkane), 1.82 (s, 3H, CH3), 2.09 (dd, J ) 6.5, 3J ) 5, 2H, H-2′),
2.27 (m, 2H, CH2-CCarborane), 3.57 (m, 2H, H-5′), 3.77 (m, 3H,
C
Carborane), 2.68 (br t, J ) 7, 2H, CH2-S), 3.76 (m, 2H, H-5′),
3.94 (dd, J ) 6, J ) 3, 1H, H-3′), 4.40 (m, 1H, H-4′), 4.50 (br
s, 1H, CCarborane-H), 6.26 (t, J ) 6.5, 1H, H-1′), 8.30 (s, 1H, H-6);
13C NMR (CD3OD) δ 28.66 (CH2), 29.52 (CH2), 29.89 (CH2),
34.19 (CH2), 38.70 (CH2), 41.71 (C-2′), 62.76 (CCarborane-H), 63.57
(C-5′), 72.26 (C-3′), 77.30 (CCarborane-C), 87.01 (C-1′), 89.18 (C-
4′), 109.00 (C-5), 144.59 (C-6), 151.94 (C-2), 164.42 (C-4); MS
(FAB+, 3-NBA) 473 (M + 1). Anal. (C16H32O5N2SB10) C, H, N.
CH2-N and H-3′), 4.23 (br d, 1H, H-4′), 5.15 (br s, 1H, CCarborane
-
H), 6.20 (t, J ) 6, 1H, H-1′), 7.76 (s, 1H, H-6); 13C NMR
(DMSO-d6) δ 12.76 (CH3), 25.43 (CH2), 26.47 (CH2), 28.36
(CH2), 36.29 (CH2), 39.47 (CH2), 40.28 (C-2′), 61.14 (CCarborane
-
H), 62.95 (C-5′), 70.19 (C-3′), 76.47 (CCarborane-C), 84.66 (C-1′),
87.27 (C-4′), 108.35 (C-5), 134.61 (C-6), 150.26 (C-2), 162.50
(C4); MS (HR-EI) C17H34O5N2B10 calcd 454.3471, found
454.3455). Anal. (C17H34O5N2B10) C, H, N.
5-[6-(o-Ca r bor a n -1-yl)h exylm er ca p to]-â-D-2′-d eoxyu r i-
d in e (26). Following the above general procedure, 100 mg
(0.14 mmol) of 5-[6-(o-carboran-1-yl)hexylmercapto]-3′,5′-di-O-
p-toluoyl-â-D-2′-deoxyuridine (18) yielded 55 mg (81%) of
product as a white foam: mp 84-86 °C; Rf 0.29 (4:1 CHCl3:
acetone); 1H NMR (CD3OD) δ 1.19-3.19 (br m, 10H, BH),
1.19-1.62 (m, 8H, alkane), 2.25 (m, 4H, H-2′ and CH2-
3-[6-(o-Ca r bor a n -1-yl)h exyl]th ym id in e (31). Following
the above-described procedure, 40 mg (0.32 mmol) of Thd (28)
and 139 mg (0.35 mmol) of 6-(o-carboran-1-yl)hexyl tosylate
(8) yielded 59 mg (77%) of product as a white foam: mp 73-
79 °C; Rf 0.60 (1:1 CHCl3:acetone); 1H NMR (DMSO-d6) δ 1.15-
2.60 (br m, 10H, BH), 1.17-1.31 (m, 4H, alkane), 1.31-1.57
(m, 4H, alkane), 1.82 (s, 3H, CH3), 2.09 (t, J ) 6, 2H, H-2′),
2.24 (m, 2H, CH2-CCarborane), 3.58 (m, 2H, H-5′), 3.77 (m, 3H,
CH2-N and H-3′), 4.24 (m, 1H, H-4′), 5.05 (t, J ) 5, 1H, 5′
OH), 5.17 (br s, 1H, CCarborane-H), 5.25 (d, J ) 4, 1H, 3′ OH),
6.21 (t, J ) 7, 1H, H-1′), 7.76 (s, 1H, H-6); 13C NMR (DMSO-
d6) δ 12.78 (CH3), 25.73 (CH2), 26.75 (CH2), 27.77 (CH2), 28.55
C
Carborane), 2.70 (br t, J ) 7, 2H, CH2-S), 3.77 (m, 2H, H-5′),
3.95 (dd, J ) 6, J ) 3, 1H, H-3′), 4.41 (m, 1H, H-4′), 4.50 (br
s, 1H, CCarborane-H), 6.26 (t, J ) 6.5, 1H, H-1′), 8.29 (s, 1H, H-6);
13C NMR (CD3OD) δ 28.84 (CH2), 29.43 (CH2), 29.80 (CH2),
30.17 (CH2), 34.25 (CH2), 38.74 (CH2), 41.64 (C-2′), 62.74
(CCarborane-H), 63.52 (C-5′), 72.21 (C-3′), 77.34 (CCarborane-C), 86.97
(C-1′), 89.105 (C-4′), 109.22 (C-5), 144.18 (C-6), 151.87 (C-2),
164.32 (C-4);MS (FAB+, 3-NBA)487 (M +1). Anal. (C17H34O5N2-
SB10) C, H, N.
(CH2), 36.46 (CH2), 39.47 (CH2), 40.28 (C-2′), 61.17 (CCarborane
-
H), 62.93 (C-5′), 70.21 (C-3′), 76.53 (CCarborane-C), 84.68 (C-1′),
87.29 (C-4′), 108.35 (C-5), 134.60 (C-6), 150.26 (C-2), 162.50
(C-4); MS (HR-EI) C18H36O5N2B10 calcd 468.3627, found
468.3648. Anal. (C18H36O5N2B10) C, H, N.
5-[8-(o-Ca r bor a n -1-yl)octylm er ca p to]-â-D-2′-d eoxyu r i-
d in e (27). Following the above general procedure, 100 mg
(0.14 mmol) 5-[8-(o-carboran-1-yl)octylmercapto]-3′,5′-di-O-p-
toluoyl-â-D-2′-deoxyuridine (19) yielded 63 mg (92%) of product
as a white foam: mp 77-81 °C; Rf 0.35 (4:1 CHCl3:acetone);
1H NMR (CD3OD) δ 1.10-3.26 (br m, 10H, BH), 1.10-1.62
(m, 12H, alkane), 2.21 (m, 4H, H-2′ and CH2-CCarborane), 2.70
(br t, J ) 7, 2H, CH2-S), 3.76 (m, 2H, H-5′), 3.95 (dd, J ) 6,
3-[7-(o-Ca r bor a n -1-yl)h ep tyl]th ym id in e (32). Following
the above-described procedure, 40 mg (0.32 mmol) of Thd (28)
and 144 mg (0.35 mmol) of 7-(o-carboran-1-yl)heptyl tosylate
(8) yielded 58 mg (73%) of product as a white foam: mp 64-
69 °C; Rf 0.57 (1:1 CHCl3:acetone); 1H NMR (DMSO-d6) δ 1.09-
2.70 (br m, 10H, BH), 1.09-1.31 (m, 6H, alkane), 1.31-1.57
(m, 4H, alkane), 1.82 (s, 3H, CH3), 2.09 (t, J ) 6, 2H, H-2′),
2.24 (m, 2H, CH2-CCarborane), 3.57 (m, 2H, H-5′), 3.77 (m, 3H,
CH2-N and H-3′), 4.24 (m, 1H, H-4′), 5.04 (t, J ) 5, 1H, 5′
OH), 5.17 (br s, 1H, CCarborane-H), 5.25 (d, J ) 4, 1H, 3′ OH),
6.21 (t, J ) 7, 1H, H-1′), 7.77 (s, 1H, H-6); 13C NMR (DMSO-
d6) δ 12.82 (CH3), 26.00 (CH2), 26.85 (CH2), 27.95 (CH2), 28.00
(CH2), 28.66 (CH2), 36.45 (CH2), 39.47 (CH2), 40.28 (C-2′), 61.15
(CCarborane-H), 62.97 (C-5′), 70.21 (C-3′), 76.55 (CCarborane-C), 84.64
(C-1′), 87.28 (C-4′), 108.37 (C-5), 134.61 (C-6), 150.26 (C-2),
162.50 (C-4); MS (HR-EI) C19H38O5N2B10 calcd 482.3784, found
482.3826. Anal. (C19H38O5N2B10) C, H, N.
3-[4-(o-Ca r bor a n -1-yl)bu tyl]-5′-[bis(2,2,2-tr ich lor oeth -
yl)p h osp h or o]th ym id in e (33). A 330-mg (0.87 mmol) quan-
tity of bis(2,2,2-trichloroethyl)phosphorochloridate was added
to an ice-cooled solution of 330 mg (0.75 mmol) 3-[4-(o-
carboran-1-yl)butyl]thymidine and 50 µL (0.95 mmol) of py-
ridine in 10 mL of acetonitrile. The solution was left in the
refrigerator for 3-5 days. The reaction was terminated by
adding 5 mL of methanol and stirring this solution for 30 min
at room temperature. Subsequently, the solvents were evapo-
rated, and the resulting residue was dissolved in 20 mL of
diethyl ether and extracted two times with 10 mL of 0.1 M
J ) 3, 1H, H-3′), 4.41 (m, 1H, H-4′), 4.50 (br s, 1H, CCarborane
-
H), 6.27 (t, J ) 6.5, 1H, H-1′), 8.27 (s, 1H, H-6); 13C NMR (CD3-
OD) δ 29.34 (CH2), 29.92 (CH2), 29.94 (CH2), 29.99 (CH2), 30.03
(CH2), 30.35 (CH2), 34.35 (CH2), 38.87 (CH2), 41.66 (C-2′), 62.78
(CCarborane-H), 63.60 (C-5′), 72.27 (C-3′), 77.42 (CCarborane-C), 86.98
(C-1′), 89.17 (C-4′), 109.38 (C-5), 144.13 (C-6), 151.94 (C-2),
164.38 (C-4);MS (FAB+, 3-NBA)515 (M +1). Anal. (C19H38O5N2-
SB10) C, H, N.
Gen er a l P r oced u r e for th e N-3 Alk yla tion of Th d .
Adapting a procedure described by Sasaki et al. and Yamamoto
et al.,36,37 Thd (1 equiv), K2CO3 (2 equiv), and the corresponding
alkylcarboranyl tosylates (1.1 equiv) were combined in 10 mL
of anhydrous DMF/acetone (1/1). The mixtures were heated
to 50 °C and stirred for 1-2 days. The solvents were evapo-
rated, and the products were isolated by silica gel column
chromatography. To remove trace amounts of DMF after
isolation, the products were taken up in diethyl ether and
washed with small amounts of water. This was repeated until
evaporation of ether gave a white foam. The products were
hygroscopic and were stored in a desiccator.
3-[4-(o-Ca r bor a n -1-yl)bu tyl]th ym id in e (29). Following
the above-described procedure, 40 mg (0.32 mmol) of Thd (28)

Substrates for Human Thymidine Kinases 1 and 2
J ournal of Medicinal Chemistry, 1999, Vol. 42, No. 17 3387
aqueous HCl. The organic layer was dried with anhydrous
magnesium sulfate, filtered, and evaporated to dryness. The
residue was purified by column chromatography: clear glass;
yield 317 mg (54%); Rf 0.77 (1:9 hexane:ethyl acetate); 1H NMR
(CDCl3) δ 1.30-3.00 (br m, 10H, B-H); 1.37-1.65 (m, 4H,
CH2CH2CH2CH2), 1.95 (s, 3H, CH3), 2.13-2.48 (m, 4H, CH2-
CCarborane, 2 H-1′), 3.61 (br s, 1H, Ccarborane-H); 3.90 (t, 2H,
N-CH2), 4.11 (m, 1H, H-3′), 4.59-4.78 (m, 6H, 2 O-CH2, 2
H-5′, H-4′, C-OH), 6.34 (t, 1H, H-1′, J ) 7.1), 7.30 (d, 1H,
H-6); 13C NMR (CDCl3) δ 13. 43 (CH3), 26.35 (CH2), 26.72
showed that the presence of the tag sequence appeared not to
significantly affect the properties of the enzymes.
P u r ifica tion of Th ym id in e Kin a se fr om Hu m a n Leu -
k em ic Cells. TK1 was purified to near-homogeneity from
chronic myelocytic leukemic cells concentrated by leukophore-
sis and provided by the Tissue Procurement Service of The
Ohio State University Comprehensive Cancer Center. After
extraction by freeze-thaw, preliminary purification of the
supernatant enzyme entailed precipitation of nucleic acids
with streptomycin sulfate (equal in weight to the total protein
and added as a 10% solution, pH 7) and collection of the protein
which precipitated between 20% and 50% saturation by
ammonium sulfate. This precipitate was resuspended in buffer
A (pH 7.5, 0.01 M Tris-HCl, 10% glycerol, 2 mM dithiothreitol
(DTT), 0.5 mM EDTA) and mixed with an equal volume of
glycerol for storage at -20 °C.
(CH2), 37.40 (CH2), 40.33 (CH2), 40.33 (C-2′), 61.37 (CCarborane
-
H), 65.95 (C-5′), 71.20 (C-3′), 75.25 (CCarborane-C), 77.40 (CH2-
CCl3), 84.22 (C-1′), 85.85 (C-4′), 94.52 (CH2CCl3), 110.81 (C-
5), 133.63 (C-6), 150.86 (C-2), 163.34 (C-4); MS (FAB+, 3-NBA)
784 (M + 1).
3-[4-(o-Ca r b or a n -1-yl)b u t yl]t h ym id in e-5′-m on op h os-
p h a te (34). A 250-mg (0.32 mmol) quantity of 3-[4-(o-carboran-
1-yl)butyl]-5′-[bis(2,2,2-trichloroethyl)phosphoro]thymidine and
300 mg (0.46 mmol) of zinc powder (100 mesh) were stirred at
room temperature in 20 mL of 90% acidic acid for 2 h.
Subsequently, the zinc powder was filtered off and the filtrate
evaporated at room temperature (0.5 mm). The remaining
residue was suspended in 10 mL of water, and 10% of formic
acid was added in small aliquots to this suspension under
vigorous stirring until all material was dissolved (pH 2-3).
The solution was passed through a 2.5-cm × 50-cm column
containing Dowex 50X8-100 (Na+-form). Fractions of 10 mL
were collected, and those showing UV absorption (254 nm)
were combined and evaporated at room temperature (0.5 mm).
The residue was purified by reversed-phase flash chromatog-
raphy (water/methanol, 11:9). Fractions (5 mL) showing UV
absorption (254 nm) were checked for purity by analytical
HPLC, combined, and evaporated at room temperature (0.5
mm). The residue was dissolved in 5 mL of double-distilled
water and freeze-dried: fluffy white powder; mp 269-273 °C;
yield 82 mg (49%); HPLC retention time 6.1 min (broad peak);
column Dynamax-60 Å 8 µm C18; flow rate 0.75 mL/min;
A 50-mL (2.5 cm diameter × 6.5 cm) affinity chromatogra-
phy column was prepared with Thd-Sepharose matrix made
by coupling Thd directly to epoxy-activated Sepharose-6B
(Sigma) as described by Gro¨bner and Loidl23 and equilibrated
with buffer B (15 mM K2PO4, 20% glycerol, 2 mM DTT, pH
8). About 220 units of partially purified TK1 was applied and
allowed to equilibrate overnight. The column was then washed
successively with buffer B, buffer C (buffer B containing 0.1
M KCl), buffer B, buffer D (buffer C plus 0.01% Triton X-100).
Elution of TK1 was achieved with 100 mL of buffer E (buffer
D + 0.1 mM ThdTP) at 1.5 mL/min. Active fractions (ca. 160
units) were combined and concentrated by centrifugal ultra-
filtration in a Centriplus-30 filter unit (Millipore Co.). The
concentration of ThdTP was reduced to less than 0.001 mM
by repeated dilution with buffer D followed by reconcentration.
The final preparation, which was stabilized with 3% bovine
serum albumin (final concentration), contained 58 units of TK1
in 0.75 mL. The TK1 activities throughout the purification
procedure were assayed as described previously,53,54 1 unit of
activity being defined as the activity converting 1 nmol of Thd
to ThdMP per minute at 37 °C. Possible TK2 contamination
of this TK1 preparation was evaluated by measuring the rate
of dCyd phosphorylation55 and found to be below the limits of
detection.
P h osp h or yl-Tr a n sfer Assa y w ith Recom bin a n t TK1
a n d TK2. Nucleosides 24-27, 29-32, and 35-43 were
dissolved in DMSO to make stock solutions of various concen-
trations (4-120 mM). Thd and dUrd were dissolved in water
prior to addition to the assay mixtures. The assays were
carried out in reaction mixtures of 100 µM nucleoside, ∼0.3%
DMSO (except 36, 37, dUrd, and Thd where final DMSO
concentrations were 2.5, 1.4, 0.0, and 0.0%, respectively), 100
µM [γ-32P]ATP (Amersham), 50 mM Tris-HCl (pH 7.6), 5 mM
MgCl2, 15 mM NaF, 125 mM KCl, 10 mM DTT, and 0.5%
bovine serum albumin (BSA). The reaction was initiated by
the addition of 50 ng of enzyme, and the reaction mixture was
incubated for 15-30 min at 37 °C. After being heated to 95
°C for 2 min to stop the reaction, the mixture was centrifuged,
and 2-µL portions of the samples were applied to PEI-cellulose
TLC plates (Merck). The TLC plates were developed for 10-
15 h with isobutyric acid:ammonium hydroxide:water (66:1:
33) followed by exposure at room temperature to X-ray films
(Kodak). The â-radiograms were scanned with an LKB ultras-
can XL laser densitometer and quantified with the software
GelScan XL 2.1 (Pharmacia).
1
solvent system 80% water/20% methanol; H NMR (CD3OD)
δ 1.30-3.00 (br m, 10H, B-H); 1.41-1.68 (m, 4H, CH2CH2CH2-
CH2), 1.96 (s, 3H, CH3), 2.17-2.38 (m, 4H, CH2-CCarborane, 2
H-1′), 3.91 (t, 2H, N-CH2), 4.04 (m, 3H, H-3′, 2 H-5′), 4.59
(m, 2H, Ccarborane-H, H-4′), 6.37 (t, 1H, H-1′, J ) 7.3); 7.93 (s,
1H, H-6); 31P NMR (CD3OD, H3PO4) δ 2.11; 13C NMR (CD3-
OD) δ 11.42 (CH3), 25.70 (CH2), 25.96 (CH2), 36.36 (CH2), 39.16
(CH2), 39.46 (C-2′), 61.76 (CCarborane-H), 63.85 (C-5′), 70.95 (C-
3′), 75.34 (CCarborane-C), 85.21 (C-1′), 86.20 (C-4′), 109.29 (C-5),
134.90 (C-6), 150.59 (C-2), 163.70 (C-4); MS (FAB-, 3-NBA)
519 (M + 1)-.
Exp r ession a n d P u r ifica tion of Recom bin a n t Hu m a n
TK1 a n d TK2. The cDNA for human TK1 was PCR-amplified
with plasmid pTK11 as template51 and a pair of primers (5′-
sense primer, 5′CCATATGAGCTGCATTAACCTG, and 3′-
reverse complement primer, 5′CGGGATCCCTCAGTTGGCAG)
to create a NdeI site (underlined) at the 5′-end and a BamHI
site (italic) at the 3′-end of the fragment. After being treated
with NdeI and BamHI, the TK1 fragment was ligated to
plasmid pET-14b (Novagen), which has been digested previ-
ously with the same restriction enzymes, to yield the expres-
sion plasmid pETKW3. After being sequenced to confirm the
correct insertion, pETKW3 was transfected into E. coli BL21
(DE3) pLys host cells. The expression of recombinant TK1 was
induced with 1 mM isopropyl â-D-thiogalactopyranoside, and
the protein was purified by one-step affinity chromatography
on chelated His‚Bind resin (Novagen). The recombinant hu-
man TK2 was expressed and purified according to a procedure
described previously.52 The calculated molecular weights are
28 kDa for both recombinant human TK1 and TK2, and SDS-
PAGE showed that both preparations were more than 95%
pure (Figure 1). The double band visible in the case of TK1 is
most likely due to the effects of heterogeneous properties of
the protein from the bacterial expression and the strong charge
of the tag, as well as the overloading of the gel. In the present
study, the histidine tags at the N-terminal of the recombinant
proteins were not removed, since kinetic characterization
P h osp h or yl-Tr a n sfer Assa ys w ith P u r ified TK1. Nu-
cleosides 25 and 29-32 and dUrd were dissolved in DMSO to
make 100 mM stock solutions. The assays were carried out in
reaction mixtures of 2.5 mM nucleoside, 2.5% DMSO, 0.375
µM [γ-33P]ATP (10-15 Ci/mmol; DuPont Co.), 100 mM Tris-
HCl (pH 8), 0.2 mM MgCl2, 10 mM DTT, and 0.5% BSA. Units
of TK were adjusted (0.09-0.12 unit) to maintain conversion
factors of 20%, or less, overall. Assay mixtures were incubated
at 25 °C for 15-60 min, 4-µL aliquots were withdrawn and
mixed with 10 µL of 0.1 N formic acid, and 2 µL of this mixture
was spotted on PEI-cellulose TLC plates (Merck). These plates
were developed with isobutyric acid:ammonium hydroxide:
water (66:1:33) followed by exposure at room temperature to

3388 J ournal of Medicinal Chemistry, 1999, Vol. 42, No. 17
Lunato et al.
(7) Lesnikowski, Z. J .; Schinazi, R. F. Boron Neutron Capture
Therapy of Cancer: Nucleic Bases, Nucleosides, and Oligonucle-
otides as Potential Boron Carriers. Pol. J . Chem. 1995, 69, 827-
840.
(8) Goudgaon, N. M.; Fulcrand-El Kattan, G.; Schinazi, R. F. Boron
Containing Pyrimidines, Nucleosides, and Oligonucleotides for
Neutron Capture Therapy. Nucleosides Nucleotides 1994, 13,
849-880.
a X-ray films (Kodak). These were quantitatively imaged on
an AMBIS 1000 radioimaging instrument.
Dou ble-La belin g Exp er im en ts Utilizin g â- a n d r-Ra -
d iogr a p h y. TK1 phosphoryl-transfer assays with 100 µM Thd/
100 µM [γ-32P]ATP, 5 mM 29/5 mM [γ-32P]ATP, and 5 mM 29/5
mM [31P]ATP were carried out as described above, and small
aliquots of these mixtures were applied to a PEI-cellulose TLC
plate on lanes a, c, and g, respectively (Figure 4). Aliquots of
3 mM solutions of compounds 29 and 34 in phosphoryl-transfer
assay buffer without ATP and TK1 were applied on lanes k
and i, respectively. Solutions (12.5 µL) applied to lanes a, c, g,
and i were also subjected to alkaline phosphatase treatment
by mixing with 1.5 µL of 10× alkaline phosphatase reaction
buffer (100 mM Tris-HCl, pH 8.4, 10 mM MgCl2) and 1 µL (20
U) of alkaline phosphatase from calf intestine (Sigma). These
mixtures were incubated at 37 °C for 1 h, and the reaction
was stopped by heating to 95 °C for 2 min.40 Aliquots of these
mixtures were applied to lanes b, d, h, and j. Finally, a mixture
of solutions applied to lanes c and i was put on lane e, and a
mixture of solutions applied to lanes g and i was put on lane
f. This TLC plate was developed as described above and
subsequently cut in two pieces between lanes e and f. Portion
A (Figure 4), containing lanes a-e, was exposed at room
temperature to a X-ray film (Kodak). A slightly modified
version of a R-radiographic technique reported previously was
used to produce the R-radiogram of the portion B (Figure 4)
containing lanes f-k.41 This modified technique, like the
original technique, uses the solid-state nuclear track detector
(SSNTD) CR-39.56 The TLC plate was placed on similarly
shaped pieces of CR-39 so that the TLC material was in contact
with the CR-39. The TLC plate/CR-39 sandwich was irradiated
in the thermal column of The Ohio State University Research
Reactor (OSURR) to a thermal neutron fluence of approxi-
mately 3 × 1012 neutrons/cm2. After irradiation, the TLC plate/
CR-39 sandwich was separated and the CR-39 was etched in
a 6.25 M NaOH solution at 60 °C for 130 min. After etching,
the tracks from the passage of R-particles (from [10B(n,R)7Li]
reactions) through the CR-39 are visible as small pits in the
surface of the CR-39. Portion B in Figure 4 displays a black/
white-inverse photographic image of this CR-39.
(9) Schinazi, R. F.; Goudgaon, N. M.; Fulcrand, G.; El Kattan, Y.;
Lesnikowski, Z.; Ullas, G.; Moravek, J .; Liotta, D. C. Cellular
Pharmacology and Biological Activity of 5-Carboranyl-2′-deoxy-
uridine. Int. J . Radiat. Oncol. Biol. Phys. 1994, 28, 1113-1120.
(10) Rong, F.-G.; Soloway, A. H.; Ikeda, S.; Ives, D. H. Synthesis and
Biochemical Activity of Hydrophilic Carborane-Containing Py-
rimidine Nucleosides as Potential Agents for DNA Incorporation
and BNCT. Nucleosides Nucleotides 1997, 16, 379-401.
(11) Rong, F.-G.; Soloway, A. H.; Ikeda, S.; Ives, D. H. Synthesis and
Biochemical Activity of 5-Tethered Carborane-Containing Py-
rimidine Nucleosides as Potential Agents for DNA Incorporation.
Nucleosides Nucleotides 1995, 14, 1873-1887.
(12) Arne´r, E. S. J .; Eriksson, S. Mammalian Deoxyribonucleoside
Kinases. Pharmacol. Ther. 1995, 67, 155-186.
(13) J ohansson, N. G.; Eriksson, S. Structure-Activity Relationships
for Phosphorylation of Nucleoside Analogues to Monophosphates
by Nucleoside Kinases. Acta Biochim. Pol. 1996, 43, 143-160.
(14) Rong, F.-G.; Soloway, A. H. Synthesis of 5-Tethered Carborane-
Containing Pyrimidine Nucleosides as Potential Agents for DNA
Incorporation. Nucleosides Nucleotides 1994, 13, 2021-2034.
(15) Yamamoto, Y.; Seko, T.; Nakamura, H.; Nemoto, H.; Hojo, H.;
Mukai, N.; Hashimoto, Y. Synthesis of Carboranes Containing
Nucleoside Bases. Unexpected High Cytostatic and Cytocidal
Toxicity Towards Cancer Cells. J . Chem. Soc., Chem. Commun.
1992, 157-158.
(16) M. Hofmann, University of Georgia, Athens, GA, unpublished
results. According to ab initio computations at the MP2(fc)/6-
31G* level, the diameter of benzene is 4.968 Å [H(C1)-H(C4)],
and those of the o-carborane cluster are 5.48 Å [H(C1)-H(B12)],
5.75 Å [H(B3)-H(B10)], and 5.729 Å [H(B4)-H(B11)].
(17) Lowe, C. R.; Dean, P. D. G. Affinity Chromatography; Wiley &
Sons Ltd.: London, 1974.
(18) Lowe, C. R.; Harvey, M. J .; Craven, D. B.; Dean, P. D. G. Some
Parameters Relevant to Affinity Chromatography on Immobi-
lized Nucleotides. Biochem. J . 1973, 133, 499-506.
(19) Kabalka, G. W.; Kesavulu Reddy, N.; Narayana, C. Synthesis
of Boronated Uridine Derivatives for Neutron Capture Therapy.
In Cancer Neutron Capture Therapy; Mishima, Y., Ed.; Plenum
Press: New York, 1996; pp 157-161.
(20) Kalman, T. I.; Bardos, T. J . Enzymatic Studies Relating to the
Mode of Action of 5-Mercapto-2′-deoxyuridine. Mol. Pharmacol.
1970, 6, 621-630.
Ack n ow led gm en t. The authors would like to thank
Dr. Raymond F. Schinazi for providing compound 35
(CDU), Dr. Liya Wang for constructing and purifying
the recombinant TK2, and Callery Chemical Co. for
providing decaborane. The authors would also like to
acknowledge Drs. David Chang and Charles E. Cottrell
for producing MS and NMR data, respectively. This
work was supported by the U.S. Department of Energy
Grants DE-FG02-90ER60972 and DE-FG02-95ER62059,
by the U.S. Public Health Service Grants R01CA-53896
and P30CA16058, and in part by a grant from the
European commission (BMH4-CT96-0479) to S.E.
(21) Hardi, R.; Hughes, R. G., J r.; Ho, Y. K.; Chada, K. C.; Bardos,
T. J . Differential Effects of 5-Methylmercapto-2′-deoxyuridine
on the Replication of Herpes Simplex Virus Type 1 in Two Cell
Systems. Antimicrob. Agents Chemother. 1976, 10, 682-686.
(22) Lunato, A. J .; Anisuzzaman, A. K. M.; Rong, F.-G.; Ives, D. H.;
Ikeda, S.; Soloway, A. H. Synthesis of 5-S-Alkylcarboranyl-2′-
deoxyuridines. In Cancer Neutron Capture Therapy; Mishima,
Y., Ed.; Plenum Press: New York, 1996; pp 151-155.
(23) Gro¨bner, P.; Loidl, P. Thymidine Kinase. A Novel Affinity
Chromatography of the Enzyme and Its Regulation by Phos-
phorylation in Physarium polycephalum. J . Biol. Chem. 1984,
259, 8012-8014.
(24) Sood, A.; Spielvogel, B. F.; Shaw, B. R. Boron-Containing Nucleic
Acids: Synthesis of Cyanoborane Adducts of 2′-Deoxynucleo-
sides. J . Am. Chem. Soc. 1989, 111, 9234-9235.
(25) Kabalka, G. W.; Varma, M.; Varma, R. S. Tosylation of Alcohols.
J . Org. Chem. 1986, 51, 2386-2388.
Refer en ces
(26) Knapp, F. F.; Srivastava, P. C.; Callahan, A. P.; Cunningham,
E. B.; Kabalka, G. W.; Sastry, K. A. R. Effect of the Tellurium
Position on the Myocardial Uptake of Radioiodinated 18-Iodo-
tellura-17-octadecenoic Acid Analogues. J . Med. Chem. 1984, 27,
57-63.
(27) Brown, C. A.; Negishi, E. Novel Synthesis of an ω-Alkynylor-
ganonmetallic Reagent via Triple Bond Isomerization with
Potassium 3-Aminopropylamide: ω-(9-Borabicyclo[3.3.1]nonan-
9-yl)alkynes. J . Chem. Soc., Chem. Commun. 1977, 318-319.
(28) Korblova, E.; Romanuk, M. Preparation of (Z) and (E)-9-
Dodecanyl Acetates. Collect. Czech. Chem. Commun. 1985, 50,
2284-2288.
(1) Soloway, A. H.; Tjarks, W.; Barnum, B. A.; Rong, F.-G.; Barth,
R. F.; Codogni, I. M.; Wilson, J . G. The Chemistry of Neutron
Capture Therapy. Chem. Rev. 1998, 98, 1515-1562.
(2) Barth, R. F.; Soloway, A. H.; Goodman, J . H.; Gahbauer, R. E.;
Gupta, N.; Blue, T. E.; Yang, W.; Tjarks, W. Boron Neutron
Capture Therapy of Brain Tumors: An Emerging Therapy
Modality. Neurosurgery 1999, 44, 433-457.
(3) Chu, C. K.; Baker, D. C. Nucleosides and Nucleotides as
Antitumor Agents and Antiviral Agents; Plenum Press: New
York, 1993.
(4) Bello, L. J . Regulation of Thymidine Kinases in Human Cells.
Expl. Cell Res. 1974, 89, 263-274.
(29) Heying, T. L.; Ager, J . W., J r.; Clark, S. L.; Mangold, D. J .;
Goldstein, H. L.; Hillman, M.; Polack, R. J .; Szymanski, J . W. A
New Series of Organocarboranes. I. Carboranes from the Reac-
tion of Decaborane with Acetylenic Compounds. Inorg. Chem.
1963, 2, 1089-1092.
(5) Piper, A. A.; Tattersall, H. N.; Fox, R. M. The Activities of
Thymidine Metabolising Enzymes During the Cell Cycle of a
Human Lymphocyte Cell Line LAZ-007 Synchronized by Cen-
trifugal Eluation. Biochim. Biophys. Acta 1980, 633, 400-409.
(6) Hartman, T.; Carlsson, J . Radiation Dose Heterogeneity in
Receptor and Antigen Mediated Boron Neutron Capture Therapy.
Radiother. Oncol. 1994, 31, 61-75.
(30) Kotick, M. P.; Szantay, C.; Bardos, T. J . Synthesis of 5-S-
Substituted 2′-Deoxyuridines. Study of the Factors Influencing

Substrates for Human Thymidine Kinases 1 and 2
J ournal of Medicinal Chemistry, 1999, Vol. 42, No. 17 3389
the Stereoselectivity of the Silyl Modification of the Hilbert-
J ohnson Reaction. J . Org. Chem. 1969, 34, 3806-3813.
(31) Bardos, T. J .; Herr, R. R.; Enkoji, T. Synthesis of Compounds
Related to Thymine. I. 5-Mercaptouracil and Some S-Substituted
Derivatives. J . Am. Chem. Soc. 1955, 77, 960-963.
(32) Ketz, H.; Tjarks, W.; Gabel, D. Synthesis of Nido-Carborate
Containing Thioureas. Tetrahedron Lett. 1990, 31, 4003-4006.
(33) Hoffer, M. R-Thymidin. Chem. Ber. 1960, 93, 2777-2781.
(34) Robins, M. J .; Robins, R. K. Purine Nucleosides. XI. The
Synthesis of 2′-Deoxy-9-R- and -â-ribofuranosylpurines and the
Correlation of their Anomeric Structure with Proton Magnetic
Resonance Spectra. J . Am. Chem. Soc. 1965, 87, 4934-4940.
(35) Tjarks, W.; Anisuzzaman, A. K. M.; Liu, L.; Soloway, A. H.;
Barth, R. F.; Perkins, D. J .; Adams, D. M. Synthesis and in vitro
Evaluation of Boronated Uridine and Glucose Derivatives for
Boron Neutron Capture Therapy. J . Med. Chem. 1992, 35, 1628-
1633.
(43) Beck, R. A.; Munch-Petersen, B.; Do¨lker, M.; Cloos, L.; Tyrsted,
G.; Eger, K. Ligands for the Affinity Chromatography of Mam-
malian Thymidine Kinase 1: Strategy, Synthesis and Evalua-
tion. Pharm. Acta Helv. 1996, 71, 279-291.
(44) Hampton, A.; Chawla, R. R.; Kappler, F. Species- or Isozyme-
Specific Enzyme Inhibitors. 5. Differential Effects of Thymidine
Substitutents on Affinity for Rat Thymidine Kinase Isozymes.
J . Med. Chem. 1982, 25, 644-649.
(45) Dinan, F. J .; Chodkowski, J .; Barren, J . P.; Robinson, D. M.;
Reinhard, D. W. Simplified Synthesis of 5-Mercaptouracil Ri-
boside Derivatives. J . Org. Chem. 1982, 47, 1769-1772.
(46) Dinan, F. J .; Bardos, T. J . Synthesis of Some New S-Alkylated
Derivatives of 5-Mercapto-2′-deoxyuridine as Potential Antiviral
Agents. J . Med. Chem. 1980, 23, 569-572.
(47) Hubbard, A. J .; J ones, A. S.; Walker, R. T. An Investigation by
1H NMR Spectroscopy into the Factors Determining the â:R
Ratio of the Products in 2′-Deoxynucleoside Synthesis. Nucleic
Acids Res. 1984, 12, 6827-6837.
(48) Bardos, T. J .; Ryu, E. K. Synthesis of 5-Methylmercaptopyri-
midine Nucleosides. J . Heterocycl. Chem. 1979, 16, 1049-1055.
(49) Nishimura, T.; Shimizu, B.; Iwai, I. Studies on Synthetic
Nucleosides. IV. A New Synthetic Method of Pyrimidine and
Purine Ribosides. Chem. Pharm. Bull. 1964, 12, 1471-1478.
(50) Nishimura, T.; Shimizu, B.; Iwai, I. A New Synthetic Method of
Nucleosides. Chem. Pharm. Bull. 1963, 11, 1470-1472.
(51) Bradshaw, H. D., J r.; Deininger, P. L. Human Thymidine Kinase
Gene: Molecular Cloning and Nucleotide Sequence of a cDNA
Expressible in Mammalian Cells. Mol. Cell Biol. 1984, 11, 4,
2316-2320.
(36) Sasaki, T.; Minamoto, K.; Suzuki, H. Elimination Reactions on
the Di- and Trimesylated Derivatives of N3-Benzyluridine. J .
Org. Chem. 1973, 38, 598-607.
(37) Yamamoto, I.; Kimura, T.; Tateoka, Y.; Watanabe, K.; Ho, I. K.
N-Substituted Oxopyrimidines and Nucleosides: Structure-
Activity Relationship for Hypnotic Activity as Central Nervous
System Depressants. J . Med. Chem. 1987, 30, 2227-2231.
(38) Chang, C.-J .; Ashworth, D. J .; Chern, L.-J .; Gomes, J . D.; Lee,
C.-G.; Mou, P.-W.; Narayan, R. C-13 NMR Studies of Methyl-
nucleosides. Org. Magn. Reson. 1984, 22, 671-675.
(39) Eckstein, F.; Scheit, K. H. Synthesis of Nucleoside Diphosphates
by Means of Di-(2,2,2-trichloroethyl) Phosphorochloridate. An-
gew. Chem., Int. Ed. Engl. 1967, 6, 362.
(52) Wang, L.; Munch-Petersen, B.; Herrstro¨m Sjo¨berg, A.; Hellman,
U.; Bergman, T.; J o¨rnvall, H.; Eriksson, S. Human Thymidine
Kinase 2: Molecular Cloning and Characterization of the
Enzyme Activity with Antiviral and Cytostatic Nucleoside
Substrates. FEBS Lett. 1999, 443, 170-174.
(53) Ives, D. H. A New System for Washing Ion-Exchange Paper
Disks Used in Radiochemical Enzyme Assays. Anal. Biochem.
1984, 136, 416-420.
(54) Ives, D. H.; Duham, J . P.; Tucker, V. S. Rapid Determination of
Nucleoside Kinase and Nucleotidase Activities with Tritium
Labeled Substrates. Anal. Biochem. 1969, 28, 192-205.
(55) Cheng, Y.-C. Thymidine Kinase From Blast Cells of Myelocytic
Leukemia. Methods Enzymol. 1991, 51, 346-354.
(56) Cartwright, B. G.; Shirk, E. K.; Price, P. B. The Use of CR-39
as Track Detectors. Nucl. Instrum. Methods 1978, 153, 457-460.
(40) Brenna, O.; Perrella, M.; Pace, M.; Pietta, P. G. Affinity-
Chromatographic Purification of Alkaline Phosphatase from Calf
Intestine. Biochem. J . 1975, 151, 291-296.
(41) J iang, Y.; Ng, S.; Blue, T. E.; Barth, R. F. The Application of an
Alpha Autoradiographic Technique for Determination of Boron-
10 Concentrations in a Study of Intratumoral Injection of BSH
and CBU-2. In Advances in Neutron Capture Therapy; Soloway,
A. H., Barth, R. F., Carpenter, D. E., Eds.; Plenum Press: New
York, 1993; pp 449-451.
(42) Lunato, A. J . Part 1. Synthesis and in vitro Phosphorylation of
a Homologous Series of 5-S-Alkylcarboranyl-2′-deoxyuridines
and 3-N-Alkylcarboranylthymidines for Use in Boron Neutron
Capture Therapy of Brain Cancer. Part 2. An Investigation into
the Stereoselective Formation of 3,5-Di-O-(p-toluoyl)-2-deoxy-
alpha-D-ribofuranosyl Chloride (Chlorination). The Ohio State
University, Columbus, OH, Ph.D. Thesis; University Microfilms
Int. DA9639297; Diss. Abstr. Int., B 1997, 57(7), 4411.
J M990125I