Efficient oxidation of promutagenic hydroxymethylpyrenes by cDNA-expressed human alcohol dehydrogenase ADH2 and its inhibition by various agents

Article abstract of DOI:10.1016/j.bcp.2007.08.030

Alkylated polycyclic aromatic hydrocarbons can be metabolically activated via benzylic hydroxylation and sulphation to electrophilically reactive esters. However, we previously found that the predominant biotransformation route for the hepatocarcinogen 1-hydroxymethylpyrene (1-HMP) in the rat in vivo is the oxidation of the side chain by alcohol dehydrogenases (ADHs) and aldehyde dehydrogenases to the carboxylic acid. Inhibition of this pathway by ethanol (competing ADH substrate) or 4-methylpyrazole (ADH inhibitor) led to a dramatic increase in the 1-HMP-induced DNA adduct formation in rat tissues in the preceding study. In order to elucidate the role of individual ADHs in the metabolism of alkylated polycyclic aromatic hydrocarbons, we expressed the various members of the human ADH family in bacteria. Cytosolic preparations from bacteria expressing ADH2 clearly oxidized hydroxymethylpyrene isomers (1-, 2- and 4-HMP) with the highest rate. This form was purified to near homogeneity to perform detailed kinetic analyses. High catalytic efficiencies (V_max/K_m) were observed with HMPs. Thus, this value was 10,000-fold higher for 2-HMP than for the reference substrate, ethanol. The corresponding aldehydes were also efficiently reduced by ADH2. 4-Methylpyrazole inhibited the oxidation of the HMP isomers as well as the reverse reaction. Daidzein, cimetidine and the competing substrate ethanol were further compounds that inhibited the ADH2-mediated oxidative detoxification of 1-HMP.

Full text of DOI:10.1016/j.bcp.2007.08.030

b i o c h e m i c a l p h a r m a c o l o g y 7 5 ( 2 0 0 8 ) 5 2 7 – 5 3 7
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/biochempharm
Efficient oxidation of promutagenic hydroxymethylpyrenes
by cDNA-expressed human alcohol dehydrogenase ADH2
and its inhibition by various agents
Ronny Kollock a, Walter Meinl a, Heiko Schneider a, Monika Batke a, Heinz Frank b,
Albrecht Seidel b, Hansruedi Glatt a,
*
a German Institute of Human Nutrition Potsdam-Rehbruecke, Department of Nutritional Toxicology, 14558 Nuthetal, Germany
b Biochemical Institute for Environmental Carcinogens, Prof. Dr. Gernot Grimmer Foundation, 22927 Grosshansdorf, Germany
a r t i c l e i n f o
a b s t r a c t
Article history:
Alkylated polycyclic aromatic hydrocarbons can be metabolically activated via benzylic
hydroxylation and sulphation to electrophilically reactive esters. However, we previously
found that the predominant biotransformation route for the hepatocarcinogen 1-hydro-
xymethylpyrene (1-HMP) in the rat in vivo is the oxidation of the side chain by alcohol
dehydrogenases (ADHs) and aldehyde dehydrogenases to the carboxylic acid. Inhibition of
this pathway by ethanol (competing ADH substrate) or 4-methylpyrazole (ADH inhibitor) led
to a dramatic increase in the 1-HMP-induced DNA adduct formation in rat tissues in the
preceding study. In order to elucidate the role of individual ADHs in the metabolism of
alkylated polycyclic aromatic hydrocarbons, we expressed the various members of the
human ADH family in bacteria. Cytosolic preparations from bacteria expressing ADH2
clearly oxidized hydroxymethylpyrene isomers (1-, 2- and 4-HMP) with the highest rate.
This form was purified to near homogeneity to perform detailed kinetic analyses. High
catalytic efficiencies (Vmax/Km) were observed with HMPs. Thus, this value was 10,000-fold
higher for 2-HMP than for the reference substrate, ethanol. The corresponding aldehydes
were also efficiently reduced by ADH2. 4-Methylpyrazole inhibited the oxidation of the HMP
isomers as well as the reverse reaction. Daidzein, cimetidine and the competing substrate
ethanol were further compounds that inhibited the ADH2-mediated oxidative detoxification
of 1-HMP.
Received 11 July 2007
Accepted 28 August 2007
Keywords:
ADH2
Alkylated polycyclic aromatic
hydrocarbons
Benzylic alcohols
Detoxification
Sulphotransferase
# 2007 Elsevier Inc. All rights reserved.
1.
Introduction
alkyl substituents or alkano bridges (alk-PAHs). PAHs require
metabolic activation to reactive intermediates in order to
Polycyclic aromatic hydrocarbons (PAHs) are important
environmental carcinogens, present e.g. in cigarette smoke,
diesel exhaust and foods [1]. Numerous congeners contain
become carcinogenic. Epoxidation, in particular the formation
of vicinal dihydrodiol-epoxides, is a major mechanism for the
activation of purely aromatic PAHs [1,2]. This mechanism may
* Corresponding author
. Tel.: +49 33200 88321; fax: +49 33200 88426.
E-mail address: glatt@dife.de (H. Glatt).
Abbreviations: ADH, alcohol dehydrogenase; ALDH, aldehyde dehydrogenase; alk-PAH, alkylated polycyclic aromatic hydrocarbon;
BSA, bovine serum albumin; CYP, cytochrome P450; DMSO, dimethylsulphoxide; FP, formylpyrene; FPLC, fast-performance liquid
chromatography; HMP, hydroxymethylpyrene; mp, melting point; PAGE, polyacrylamide gel electrophoresis; PAH, polycyclic aromatic
hydrocarbon; PCR, polymerase chain reaction; RT, reverse transcription; SDS, sodium dodecyl sulphate; SULT, sulphotransferase.
0006-2952/$ – see front matter # 2007 Elsevier Inc. All rights reserved.
doi:10.1016/j.bcp.2007.08.030

528
b i o c h e m i c a l p h a r m a c o l o g y 7 5 ( 2 0 0 8 ) 5 2 7 – 5 3 7
also occur with some alk-PAHs. However, the side chain
allows additional activation mechanisms, in particular the
hydroxylation in the benzylic position by cytochromes P450
(CYPs) and subsequent formation of reactive sulphuric acid
esters by sulphotransferases (SULTs) [3–5].
1-Methylpyrene is a substance that perfectly fits in this
model. Although it does not contain a terminal benzo ring and
thus cannot be activated to a vicinal dihydrodiol-epoxide, it is
hepatocarcinogenic in newborn mice [6]. The parent PAH,
pyrene, is considered to be non-carcinogenic. Thus the side
chain is important for the carcinogenic activity. We have
demonstrated that 1-hydroxymethylpyrene (1-HMP) is a major
metabolite of 1-methylpyrene in rat and human hepatic
microsomal systems as well as in V79-derived cell lines
expressing various individual rat and human CYPs [7]. 1-HMP
is strongly mutagenic to Salmonella typhimurium TA98 when
incubated in the presence of rat and human hepatic cytosolic
fraction supplemented with 30-phoshoadenosine-50-phospho-
sulphate, the cofactor for SULTs [8,9]. Likewise, a large number
of cDNA-expressed rat and human SULTs are able to catalyze
the activation of 1-HMP to a mutagen [10,11].
Fig. 1 – Scheme of the ADH-catalyzed oxidation of 1-HMP, a
reaction competing with its bioactivation to an
electrophilically reactive sulphuric acid ester. The
positions of the substituents in the two possible positional
isomers are indicated. All three isomers were investigated
in the present study.
2.2.1. Synthesis of 2-hydroxymethylpyrene (2-HMP)
A solution of 1.3 g (5 mmol) 2-pyrenecarboxylic acid methyl
ester [16] in 35 ml anhydrous tetrahydrofuran was added
dropwise to a suspension of 0.58 g (15 mmol) of LiAlH4 in 15 ml
anhydrous tetrahydrofuran. After stirring at room tempera-
ture for 18 h, a concentrated solution of NaCl in water (15 ml)
was cautiously added. Then, 10 ml of glacial acetic acid was
added to dissolve the aluminium salts. The product was
extracted with ethyl acetate, washed with a saturated solution
of NaHCO3 in water, dried, and concentrated. Chromatogra-
phy on silica gel (CH2Cl2/MeOH 95/5) provided 0.43 g (37%
yield) of 2-HMP as white crystals; mp 167–168 8C (lit. [17] 168–
169 8C); UV (CH3OH) lmax (nm): e [cm2 mmolꢀ1] 235 (133,100),
244 (231,200), 253 (66,200), 263 (105,800), 274 (151,600), 306
(37,600), 320 (76,100), 335 (122,000); 1H NMR (400 MHz, CDCl3) d
[ppm] 7.99 (d, 2, H6,8, J6,7 = J7,8 = 7.6 Hz), 7.97 (s, 2, H1,3), 7.87 (d, 4,
H4,5,9,10, J4,5 = J9,10 = 3.5 Hz), 7.83 (p–t, 1, H7, J7,6 = J7,8 = 7.6 Hz),
4.95 (s, 2, benzylic CH2).
However, the predominant metabolic pathway of 1-HMP in
the rat in vivo is its oxidation by alcohol dehydrogenases (ADHs)
and subsequently aldehyde dehydrogenases (ALDHs) to its
carboxylic acid [12]. Moreover, concurrent administration of
ethanol (a competing substrate of ADH) or 4-methylpyrazole (a
competitiveinhibitor ofADH[13,14])inhibitedthis pathwayand
led to a dramatic (up to 200-fold) increase in the level of DNA
adducts formed in rats treated with 1-HMP [12]. A scheme of
these pathways is presented in Fig. 1.
In order to elucidate the role of individual ADHs in the
metabolism of alk-PAHs and to specify interactions with other
compounds, such as ethanol, we expressed the various
members of the human ADH family [15] in bacteria. Using
cytosolic preparations we demonstrate that ADH2 is the form
that most efficiently oxidizes the HMP isomers (1-, 2- and 4-
HMP). This enzyme was then purified to near homogeneity to
conduct kinetic analyses and interaction studies.
2.2.2. Synthesis of 2-formylpyrene (2-FP)
A total of 2.9 g (7.6 mmol) of pyridinium dichromate was added
in small portions at room temperature to a solution of 1.16 g
(5 mmol) of 2-HMP in 70 ml of dichloromethane. After stirring
for 18 h, the mixture was filtrated, and the filtrate was
concentrated. Chromatography on silica gel (CH2Cl2) provided
0.70 g (61% yield) of 2-FP as white crystals; mp 1538 (lit. [17] 153–
154 8C); UV (CH3OH) lmax (nm): e [cm2 mmolꢀ1] 244 (68,800), 274
(106,000), 307 (18,900), 321 (34,800), 336 (60,500); 1H NMR
(400 MHz, CDCl3) d [ppm] 10.44 (s, 1, –CHO), 8.63 (s, 2, H1,3), 8.24
(d, 2, H 6,8, J6,7 = J7,8 = 7.6 Hz), 8.08–8.17 (m, 5, H4,5,7,9,10).
2.
Materials and methods
2.1.
Commercial chemicals, oligonucleotides and enzymes
4-Methylpyrazole, daidzein, cimetidine, 1-formylpyrene (1-
FP), NAD+ and NADH were purchased from Sigma–Aldrich
(Taufkirchen, Germany). Oligonucleotides were purchased
from BioTez (Berlin, Germany). Restriction endonucleases
were obtained from Fermentas (St. Leon-Rot, Germany) and
NEB (Frankfurt/M., Germany).
2.2.3. Synthesis of 4-pyrenecarboxylic acid
2.2.
Syntheses
A sample of 2.9 g (18 mmol) Br2 was added dropwise at 0 8C to a
stirred solution of 2.6 g (65 mmol) NaOH in 12 ml of water. The
solution was heated to 35 8C, and a solution of 1.0 g (4.1 mmol)
of 4-acetylpyrene [18,19] in 10 ml of dioxane was added
dropwise. Excess Br2 was destroyed by addition of NaHSO3
(40% solution in H2O). The mixture was then diluted with
100 ml of water and the dioxane was distilled off. The yellow
precipitate was dissolved in 1000 ml of 5% NaOH in water, the
solution was filtrated and acidified with concentrated
UV spectra were recorded on a Shimadzu UV-1601 spectro-
photometer. NMR spectra were obtained on Bruker AMX400
and DRX500 spectrometers in either CDCl3 or DMSO-d6.
Melting points (mp) were determined on
a Buchi 510
¨
apparatus. Silica gel 60 (0.063–0.200 mm, Merck) was used for
column chromatography. The synthesis of 1-HMP was
performed as previously described [9].

b i o c h e m i c a l p h a r m a c o l o g y 7 5 ( 2 0 0 8 ) 5 2 7 – 5 3 7
529
hydrochloric acid. The precipitated product was filtrated,
washed with water, and dried. Crystallization from chlor-
obenzene gave 0.886 g (88% yield) of 4-pyrenecarboxylic acid
as yellow crystals; mp 274–275 8C (lit. [18] 275.5–276 8C); UV
(CH3OH) lmax (nm): e [cm2 mmolꢀ1] 205 (32,000), 242 (57,300),
266 (18,700), 276 (31,400), 310 (9,500), 323 (18,200), 339 (26,700);
1H NMR (400 MHZ, DMSO-d6) d [ppm] 13.22 (s, 1, –COOH), 9.09
(dd, 1, H3, J2,3 = 7.8 Hz, J1,3 = 0.7 Hz), 8.79 (s, 1, H5) 8.35 (d, 1, H1,
J1,2 = 7.4 Hz), 8.29 (dd, 1, H6, J6,7 = 7.6 Hz, J6,8 = 0.8 Hz), 8.24 (dd,
1, H8, J7,8 = 7.6 Hz), 8.09 (AB-system, 2, H9,10, J9,10 = 9.0 Hz),
7.99–8.09 (m, 2, H2,7), 8.03 (p–t, 1, H7).
codon of ADH2. The reverse primer, 50-ACCAGGAAGCTTCA-
CATTCAATCAGATAGTTATTC, introduced a HindIII restriction
site in the 30-flanking region. The reaction conditions for PCR
were: 2 min at 95 8C for initial denaturing; 30 s at 94 8C for the
later denaturing steps, 45 s at 57 8C for annealing, and 3 min at
72 8C for the elongation (40 cycles); and a final elongation step
at 72 8C for 10 min.
The amplified ADH2 cDNA was cloned into the prokaryotic
expression vector pKK233-2 (Clontech, Mountain View, USA)
utilizing the 50 NcoI and the 30 HindIII restriction sites.
Sequencing confirmed that the cloned cDNA was identical
(with the exception of a silent nucleotide exchange, A653G) to
that reported in the database for human ADH2 (GenBank
accession no. BC022319). This sequence contains G in the
polymorphic position 925 (A or G, encoding 308Ile or 308Val,
respectively), the variant that is predominating in the Swedish
population [20]. The plasmid was initially transfected into
Escherichia coli XL-1 blue (Stratagene) and then adapted to the
restriction enzymes of S. typhimurium LT2 by passaging
through the restriction-deficient, but methylation-proficient
S. typhimurium strain LB5000 [21], before transforming the
Ames tester strain TA1538 [22]. The resulting recombinant
strain was termed TA1538-hADH2. Transformation of the
strain TA100, which already contains an ampicillin resistance
marker [22], was performed in an analogous manner after
subcloning the ADH2 cDNA into the expression vector pKN, a
2.2.4. Synthesis of 4-hydroxymethylpyrene (4-HMP)
A solution of 0.88 g (3.5 mmol) of 4-pyrenecarboxylic acid in
35 ml anhydrous tetrahydrofuran was added dropwise to a
suspension of 0.40 g (11 mmol) of LiAlH4 in 15 ml anhydrous
tetrahydrofuran. After stirring at room temperature for 18 h, a
concentrated solution of NaCl in water (10 ml) was cautiously
added to the mixture. Glacial acetic acid (15 ml) was then
added to dissolve the aluminium salts. The product was
extracted with ethyl acetate, washed with a saturated solution
of NaHCO3 in water, dried, and concentrated. Chromatogra-
phy on silica gel (CH2Cl2) provided 0.80 g (84% yield) of 4-HMP
as pale yellow crystals; mp 151–152 8C; UV (CH3OH) lmax (nm): e
[cm2 mmolꢀ1
] 242 (63,300), 264 (23,500), 275 (42,100), 307
(10,600), 320 (25,900), 336 (40,100); 1H NMR (500 MHZ, CDCl3)
d [ppm] 8.43 (d, 1, H3, J2,3 = 7.8 Hz), 8.24 (d, 1, H1, J1,2 = 7.8 Hz),
8.21 (d, 1, H6, J6,7 = 7.6 Hz), 8.20 (d, 1, H8, J7,8 = 7.6 Hz), 8.16 (s, 1,
H5), 8.11 (s, 2, H9,10), 8.07 (p–t, 1, H2), 8.03 (p–t, 1, H7), 5.39 (s, 2,
benzylic CH2).
derivative of pKK233-2 encoding
a neomycin resistance
marker instead of an ampicillin resistance marker [23],
utilizing the 50 SalI and 30 HindIII restriction sites. The resulting
recombinant strain was termed TA100-hADH2.
Bacterial expression of the other human ADH enzymes was
performed analogously (Table 1). The names of the resulting
strains are composed of the designation of the recipient strain
(TA1538 and TA100) and the expressed enzyme (hADH1A,
hADH1B, hADH1C hADH3 and hADH4).
2.2.5. Synthesis of 4-formylpyrene (4-FP)
A total 2.9 g (7.6 mmol) of pyridinium dichromate was added in
small portions to a solution of 1.16 g (5 mmol) of 4-HMP in
70 ml of dichloromethane at room temperature. After stirring
for 18 h, the mixture was filtrated, and the filtrate was
concentrated. Chromatography on silica gel (CH2Cl2) provided
0.89 g (77% yield) of 4-FP as yellow crystals; mp 177–178 8C
(177–179 8C [16]); UV (CH3OH) lmax (nm): e [cm2 mmolꢀ1] 210
(29,300), 223 (27,800), 242 (44,700), 275 (16,900), 311 (10,000), 321
(7,100), 337 (10,600), 355 (9,100), 389 (5,300); 1H NMR (400 MHz,
CDCl3) d [ppm] 10.43 (s, 1, –CHO), 9.52 (dd, 1, H3, J2,3 = 8.0 Hz,
J1,3 = 0.9 Hz) 8.49 (s, 1, H5), 8.23 (d, 2, H 9,10, J9,10 = 7.8 Hz), 8.16
(dd, 1, H1, J1,2 = 7.7 Hz), 7.94–8.05 (m, 4, H2,6,7,8).
2.4.
Purification of ADH2
Cytosolic fraction of the transformed S. typhimurium strain
TA100-ADH2 was used as the source for the purification of
ADH2. The cytosolic fraction was prepared as described
previously [24] using 10 mM Tris/HCl buffer (pH 8.0) containing
1 mM dithiothreitol as the homogenisation medium. The
protein was purified on a FPLC unit (Biorad, Munich, Germany)
with the following specifications: MV-6 6-port injection valve,
EP-1 Econo Pump, Econo-Pac Cartridge HighQ (5 ml), EM-1
Econo UV Monitor, and EG-1 Econo Gradient Monitor. Column
and eluents were maintained at 4 8C. After conditioning of the
column with 10 mM Tris/HCl (pH 8.0), 5 ml cytosolic fraction
(10 mg protein) was loaded. Proteins were eluted, at a flow rate
of 1 ml/min, with 10 mM Tris/HCl (pH 8.0) for 60 min and then
for another 60 min with the same buffer containing 0.5 M
NaCl. Fractionation was guided by protein peaks monitored
spectrometrically at 280 nm. The fractions were concentrated
to a final volume of 200–400 ml using AmiconUltra Centrifugal
Filter Devises 30,000 MWCO (Millipore, Carrigtwohill, Ireland)
and were analyzed by sodium dodecyl sulphate polyacryla-
mide gel electrophoresis (SDS-PAGE) [25] and subsequent
Coomassie blue staining. Fractions were also assayed for ADH
activity (Section 2.5). To distinguish endogenous ADH activity
2.3.
Bacterial expression of human ADH2
ADH2 cDNA was isolated using reverse transcription (RT)
polymerase chain reaction (PCR) from a human liver sample.
Total RNA was isolated with RNeasy mini Kit from Qiagen
(Hilden, Germany). Two micrograms of total RNA were
subjected to RT with the DuraScript First Strand Synthesis
Kit (Sigma–Aldrich, Taufkirchen, Germany) according to the
manufacturer’s instructions. Two microliters of the RT
reaction product was used for amplification of ADH2 cDNA
using 2 units Pfu DNA polymerase (Promega, Mannheim,
Germany) in
a final volume of 50 ml according to the
manufacturer’s recommendations. The forward primer, 50-
ACAGTTTCCCAAAGAACCATGGGCACCAAG, introduced an
NcoI restriction site at the position of the translation start

530
b i o c h e m i c a l p h a r m a c o l o g y 7 5 ( 2 0 0 8 ) 5 2 7 – 5 3 7
Table 1 – Human ADH cDNA sequences cloned into the pKK233-2 expression vector
ADH GenBank accession
number
Amplified coding
sequence (nucleotides)
Primer sequences used for the amplification
1A
1B
1C
NM000667
BC033009
NM000669
4-1128
4-1128
4-1128
50-CTC CTG GTC TGC AGA GAA GAC AGA ATC AAC (forward, 1st PCR) 50-CAA
TTT CCA TTT CTT TGG AAA GCC CCC AAA (backward, 1st PCR) 50-AGC ACA
GCA GGA AAA GTA AT (forward, 2nd PCR) 50-CAT CTG TAA AGC TTC AAA
AC (backward, 2nd PCR)
50-AAT CCA CAA AGA CTC ACA GTC TGC TGG TGG (forward, 1st PCR) 50-TAT
TTT TCC TCA ATG GCA AAG GTG ACA CAG (backward, 1st PCR) 50-AGC ACA
GCA GGA AAA GTA ATC AAA TGC AAA G (forward, 2nd PCR) 50-GCA TCT
CTA AAG CTT CAA AAC GTC AGG ACG (backward 2nd PCR)
50-CAG AGA AGA AAT CCA CAA GTA CTC ACC AGC (forward, 1st PCR) 50-TCA
ATT TCC ATT TCT TTG GAA AGC TCC CAC (backward, 1st PCR) 50-AGC ACA
GCA GGA AAA GTA ATC AAA TGC AAA G (forward, 2nd PCR) 50-GCA TCT CTA
AAG CTT CAA AAC GTC AGG ACG (backward, 2nd PCR)
2
3
4
BC022319
BC014665
X76342
1-1179
1-1125
4-1125
50-ACA GTT TCC CAA AGA ACC ATG GGC ACC AAG (forward) 50-ACC AGG AAG
CTT CAC ATT CAA TCA GAT AGT ATT C (backward)
50-GCC GAC CAG AAT CCG TGA CCA TGG CGA ACG (forward) 50-ATT ATT TAA
GCT TTT GAA TTA AAT CTT TAC A (backward)
50-GGC ACT GCT GGA AAA GTT ATT AAA TGC AAA GCA GCT GTG CTT (forward)
50-GAC AAC ACA AGC TTC CTG CCA CTT TGG ATC (backward)
Due to the similarity (>90%) among the various ADH1 sequences, nested PCRs were required for obtaining the individual ADH1 forms. The final
amplification products were inserted into the vector using the NcoI (CCATGG) and HindIII (AAGCTT) restriction sites (italicized when introduced
with the primers). For inserting ADH1A, 1B, 1C and 4, the NcoI-digested pKK233-2 plasmid was treated with Klenow fragment in order to obtain
blunt ends concluding with the start codon ATG (which therefore was not included in the amplified cDNA sequence). In all cases, the resulting
vector encoded the correct amino acid sequence of the corresponding ADH with start and stop codons in the right positions. The cloning and
expression of ADH2 are presented in detail in Section 2.
from that produced by the cDNA-expressed human enzyme,
the same separation and analyses procedures were performed
using cytosol from the untransformed strain TA100 as the
starting material.
2.5.1. Continuous spectrometric assay
Continuous reaction monitoring has obvious advantages.
For example,
a deviation from linearity with time is
immediately recognized. Likewise levels of enzyme, sub-
strate or modulator can quickly be optimised, since the
result is immediately available. Biochemical reactions
involving the co-substrate NAD(P)(H) are commonly mon-
itored using the fact that only the reduced form absorbs
light in the 340–360 nm range. However, pyrene derivatives
exhibit high absorbance in the same wavelength range. The
spectra of the HMPs and the corresponding FPs differ and
are also affected by the presence or absence of BSA.
Thus, for calculating reaction rates, one has to take into
account the sum of the absorption changes due to the
formation or utilization of NADH, the formation or
disappearance of FP, and the disappearance or formation
of the HMP. We have monitored most reactions at 360 nm.
At this wavelength, the extinction coefficients (e in cm2
mmolꢀ1 units were: 3700 for of NADH and 1100 for 1-HMP
under all conditions; 13,500 and 28,500 for 1-FP in the
absence and presence of BSA (0.33%), respectively; the
corresponding values were 1000 and 100 for 4-HMP; 9800
and 12,600 for 4-FP; 400 and 130 for 2-HMP; 5900 and 230
for 2-FP (with the last compound, this value was dependent
on the buffer used; the values given refer to the media used
for the reduction reaction). Oxidation of 2-HMP was
monitored at 340 nm, using the following e values: 6200
for NADH; 12,000 and 29,420 for 2-HMP in the absence and
presence of BSA, and 11,300 and 34,870 for 2-FP in the
absence and presence of BSA. The correctness of results of
the continuous assay was examined in exemplary cases
using the endpoint assays (all conducted at ambient
temperature).
Protein concentrations were determined using the BCA
Protein Assay Kit (Pierce, Rockford, USA).
2.5.
Measurement of enzyme activities
Three different assays were used for determining ADH2
activity towards various substrates: (a) by continuous
spectrometric monitoring of the reaction at 340 nm or
360 nm (production/consumption of NADH, corrected in
the case of the pyrene derivatives for differences in
absorption between the alcohol and the aldehyde); (b)
measurement of the NADH present a given time point using
an HPLC/UV detection method; and (c) as assay b but
measuring the other product formed, the aldehyde (only
used for pyrene derivatives).
Cofactor concentrations and buffers used in the incuba-
tions were the same for all three assay systems. The oxidation
reaction was performed in 0.1 M glycine/NaOH buffer (pH
10.0) with 1.25 mM NAD+ as cofactor and the reduction
reaction in 0.1 sodium phosphate buffer (pH 7.5) with 0.25 mM
NADH as cofactor. The pyrene derivatives had to be delivered
in an organic solvent, such as DMSO. Depending on the
individual pyrene derivative and its concentration, up to 10%
DMSO was required in the assay to obtain an optically clear
solution. When BSA (0.33%) was added, the DMSO concen-
tration could be reduced to 0.33%. Incubations were con-
ducted at ambient temperature (21–23 8C) in the continuous
spectrometric assay or at 37 8C in the endpoint assays, unless
specified otherwise.

b i o c h e m i c a l p h a r m a c o l o g y 7 5 ( 2 0 0 8 ) 5 2 7 – 5 3 7
531
2.5.2. Endpoint assay with determination of NADH by HPLC
After the incubation (5 min unless specified otherwise), the
reaction was stopped by heating to 95 8C for 5 min. It was
verified that no NADH was destroyed by this short heat
treatment. Insoluble components were then sedimented by
centrifugation at 23,000 ꢁ g for 10 min. The supernatant was
subjected to HPLC analysis (automatic sample injector ASI-
100, HPLC pump P580 and column oven STH585 from Dionex,
Idstein, Germany). An aliquot of 10 ml was injected into a
hydrosphere C18 column (5 mm, 4 mm ꢁ 150 mm, YMC,
Schermbeck, Germany). The elution was conducted isocrati-
cally with a mixture of 80% eluent E1 (20 mM KH2PO4, 2 mM
tetrabutylammonium hydrogensulphate, pH 3.9) and 20%
eluent E2 (methanol) at a flow rate of 0.7 ml/min with a
column temperature of 40 8C. The NADH formed was detected
at 340 nm in a UV detector (UV-970, Jasco, Gross-Umstadt,
Germany) and quantified using external standards. In this
assay, an individual reaction product is detected with high
specificity and sensitivity.
[26] was used to determine apparent Ki values: a vertical
straight line is dropped from the intersect of the lines
representing results obtained at a individual concentration
of the inhibitor; the value indicated on the x-axis by this
vertical line is equal to ꢀKi.
Molecular turnover rates were calculated from Vmax (at
ambient temperature for the most favourable solubilizing
regimen) using a molecular mass of 40,220 Da for the ADH
subunit and a purity of 90% of the purified enzyme.
3.
Results
3.1.
Oxidation of HMPs in cytosolic preparations from
bacteria expressing individual human ADH forms
Control cytosol prepared from untransformed strain TA100
showed endogenous ADH activity using HMPs as the sub-
strates. Activity with all three isomers was enhanced (1.9–7.3-
fold) when ADH2 was expressed (Table 2). Activity towards 2-
HMP, but not the other isomers, was also enhanced when
ADH3 or ADH4 was expressed (5.1- and 5.6-fold, respectively).
Activities were hardly changed in TA100-hADH1C compared
to TA100 cytosol. In all remaining cases, the expression of a
human ADH tended to decrease ADH activity towards HMPs
compared to control cytosol. We have not explored the
underlying mechanism, which might – for example – involve
down-regulation of endogenous ADH in the presence of
certain heterologous ADHs.
2.5.3. Endpoint assay with determination of 1-FP by HPLC
The assays presented in the preceding sections are only useful
when a single substrate is used, but not when the competition
between different substrates is the object of the investigation.
In that case, the product of interest (1-FP) has to be analysed
directly. The enzymatic reaction was carried out and stopped
as described in the preceding paragraph. The 1-FP formed was
detected by HPLC with a Waters 2695 Separations Module
(Waters, Eschborn, Germany) equipped with a 5-mm Supelcosil
LC-18 column (25 mm ꢁ 4.6 mm) (Sigma–Aldrich, Tauf-
kirchen, Germany) using a Waters 474 Fluorescence Detector
(excitation: 396 nm, emission: 450 nm). HPLC conditions were
as followed: HPLC was started with 10% acetonitrile and 10%
methanol in water, pH 2.3 (adjusted with phosphoric acid) as
the eluent. A linear gradient up to 35% acetonitrile and 35%
methanol was used in the initial 5 min. Chromatography was
continued using these concentrations until 20 min, followed
by a linear gradient back to 10% acetonitrile and 10% methanol
for the next 5 min, and continued with these concentrations
until 30 min. 1-FP eluted from the column with a retention
time of 19.5 min and was quantified using external standards.
More than 80% of 1-FP (20 mM) added to a solution of 0.33%
BSA was recovered after an incubation period of 1 h at room
temperature. Since the incubation time for studying the
formation of 1-FP from 1-HMP was much shorter (5 min), no
corrections were made.
Levels of ADH1B, 1C, 3 and 4 in recombinant strains were
similar to those of ADH2 in TA100-hADH2 (differing by a factor
of ꢃ1.35). ADH1A was expressed at a markedly lower level
than ADH2 (by a factor of 8), but this protein decreased rather
than increased the activity towards HMP. Based on these
findings, we expect that ADH2 may play a prominent role in
the sequestration of benzylic alcohols and the prevention of
their SULT-mediated toxification in human tissues.
3.2.
Partial purification of ADH2
Before appropriate kinetic analysis with cDNA-expressed
human ADH2 could be conducted, it was necessary to remove
the endogenous ADH enzyme(s) present in Salmonella cytosol.
Various mammalian ADHs show unusually weak interactions
with anion exchange materials [20]. Indeed, in our FPLC
procedure, ADH activity was eluted in the flow-through front
with the low-salt eluent (starting with 5 ml of the eluate up to
about 15 ml); later fractions of the low-salt mobile phase
contained no ADH activity. However, ADH activity was again
eluted – together with the bulk of the proteins – by the high-
salt mobile phase. This later activity peak was also seen when
cytosol from untransformed bacteria was chromatographed,
indicating that it represented endogenous ADH. By contrast,
the front peak was only seen with cytosol from recombinant
bacteria, indicating that it constituted human ADH2 free from
endogenous bacterial ADH. Fractions I and II representing 5–9
and 10–15 ml, respectively, were then analysed by SDS-PAGE
and Coomassie blue staining. Both fractions contained a major
protein band of approximately 40 kDa, as estimated from its
electrophoretic mobility. This value agrees with the molecular
2.6.
Kinetic and inhibition studies
For determining the apparent Vmax and Km values, the reaction
rate (v) was measured using various concentrations of the
substrate S. The data points were fitted to the Michaelis–
Menten equation v = (Vmax [S])/(Km + [S]) using non-linear
regression analysis (SigmaPlot 8.02, SPSS Science Software),
to give estimates of the kinetic constants (ꢂS.E.).
For investigating inhibition kinetics, the concentrations of
the inhibitor and the substrate were varied. 4-Methylpyrazole
and cimetidine were delivered in reaction buffer. Daidzein
was delivered in DMSO (final incremental concentration 1%,
also added in corresponding controls). The method of Dixon

532
b i o c h e m i c a l p h a r m a c o l o g y 7 5 ( 2 0 0 8 ) 5 2 7 – 5 3 7
Table 2 – Oxidation of HMPs by cytosolic preparations from Salmonella typhimurium strains engineered for expression of
human ADHs
Human ADH expressed
ADH expression level
Activity (nmol/[min mg])
2-HMP
(mg ADH protein/mg cytosolic protein)a
1-HMP
4-HMP
None
–
2.5
16
14
20
27
16
3.3 ꢂ 0.1
1.4 ꢂ 0.1
2.0 ꢂ 0.1
4.4 ꢂ 0.0
6.1 ꢂ 0.3
2.0 ꢂ 0.0
2.4 ꢂ 0.2
1.8 ꢂ 0.0
0.7 ꢂ 0.0
1.3 ꢂ 0.1
1.9 ꢂ 0.0
13.1 ꢂ 0.0
9.2 ꢂ 0.4
10.1 ꢂ 0.6
0.6 ꢂ 0.0
0.2 ꢂ 0.0
0.3 ꢂ 0.0
0.6 ꢂ 0.1
4.5 ꢂ 0.1
0.3 ꢂ 0.0
0.3 ꢂ 0.1
ADH1A
ADH1B
ADH1C
ADH2
ADH3
ADH4
Human ADHs were expressed in S. typhimurium TA100. Cytosolic fraction (200 mg protein), substrate (100 mM) and NAD+ (1.25 mM) were
incubated in a total volume of 1 ml at 37 8C for 20 min. The final concentration of the delivering solvent DMSO was 10%. No BSA was used. The
NADH formed was determined by the HPLC/UV method. Values are means ꢂ S.D. of two incubations. Formation of NADH was not detected
(<0.1 nmol/min/mg) when no substrate was added.
a
Levels of human ADH proteins in the cytosolic fraction were estimated from immunoblots using nearly homogeneous inclusion bodies as
standards and antisera raised against the inclusion bodies as probes (Kollock and Glatt, manuscript in preparation). The procedure is
analogous to that used for quantifying cDNA-expressed human SULTs [39].
mass of the ADH2 peptide unit deduced from its cDNA
sequence (40,220 Da). This 40-kDa band contributed >90% and
ꢄ75% of the protein detected by the Coomassie-staining in
fractions I and II, respectively. The specific activities, using
33 mM ethanol as the substrate, amounted to 410 and
370 nmol/(min mg) protein. These values were about 20-
and 22-fold higher than the net ADH2 activity in TA100-
hADH2 cytosol (i.e. after subtracting the activity detected in
cytosol from the untransformed control strain, TA100). Due to
its higher purity, fraction I was used for all subsequent
investigations.
miscible organic solvent such as DMSO. When the concentra-
tion of the test compound in the delivering solvent was too
high, it precipitated at the addition site in the incubation. This
effect could be prevented by adding BSA to the medium.
However, solubilizers may affect the catalytic activities of
enzymes. Indeed, it has been reported DMSO is a moderately
potent inhibitor of various ADH forms [27,28]. Human ADH2
had not yet been investigated in this regard. Therefore, we
studied the influence of DMSO and BSA on ADH2 activity using
substrates that pose no solubility problems, ethanol and
acetaldehyde. DMSO inhibited the oxidation as well as the
reduction reaction. As seen from Lineweaver–Burk plots,
inhibition was uncompetitive for the oxidation of ethanol
(Fig. 2A), and of the mixed type, with a preponderance of the
competitive component, for the reduction of acetaldehyde
(Fig. 2B). The presence of BSA did not affect the oxidation
reaction (data not shown), but decreased the aldehyde
3.3.
Effect of solubilizers for pyrene derivatives on ADH
activities with reference substrates
Since alcohols and aldehydes of alk-PAHs are very poorly
soluble in aqueous media, they have to be delivered in a water-
Fig. 2 – Lineweaver–Burk plots for the oxidation of ethanol (A) and the reduction of acetaldehyde (B) by ADH2 in the presence
of varying concentrations of DMSO. Reactions were conducted at ambient temperature. They were continuously monitored
in a spectrometer (measuring the production or utilization of NADH at 340 nm). Values are means and range of two
determinations.

b i o c h e m i c a l p h a r m a c o l o g y 7 5 ( 2 0 0 8 ) 5 2 7 – 5 3 7
533
high amount of DMSO (final concentration up to 10% for the
least soluble compounds, the FPs); in the second regimen, a
lower level of DMSO (0.33%) was used in combination with the
presence of BSA (0.33%) in the incubation mixture. The kinetic
constants differed between these conditions. The apparent Km
values as well as the Vmax values were increased with the
second protocol (Table 3). The effect on the apparent Km values
was not surprising, as BSA reduces the free concentration of the
pyrene derivatives by reversible binding. However, the bound
substrate may act as a deposit to rapidly replenish the free form
eliminated by ADH. This mechanism and the reduced level of
the inhibitory solvent DMSO explain the increases in Vmax
values in the second protocol. Humans are normally exposed to
very low levels of methylpyrenes and their benzylic oxidation
products. Under these conditions, the catalytic efficiency (Vmax
/
Km)isthemostrelevantkineticparameter. Forall methylpyrene
derivatives studied, this value was somewhat lower in the
second regimen (presence of BSA) than in the first regimen
(increased level ofDMSO). Itislikelythat itwouldbeevenhigher
in the absence of both solubilizers, the conditions used for
studying the biotransformation of the reference substrates
ethanol and acetaldehyde. Nevertheless, the catalytic efficiency
of ADH2 was greater for the pyrene derivatives than for the
reference substrates by a factor of up to 10,000 (oxidation of 2-
HMP using regimen 1, compared to the oxidation of ethanol).
The high catalytic efficiency with the methylpyrene derivatives
was primarily produced by low Km values. Nevertheless, the
Vmax values for 2-HMP (both regimens) and 2-FP (low-DMSO
regimen) also exceeded the Vmax values for ethanol and
acetaldehyde, respectively. The calculated molecular turnover
rates [nmol substrate metabolized per nmol enzyme subunit
per second] at Vmax amounted to 1.0, 0.5, 3.5 and 1.3 for ethanol,
1-HMP, 2-HMP and 4-HMP, respectively, and 3.3, 0.3, 4.8 and 0.2
for the corresponding reverse reaction (in the presence of BSA
for the methylpyrene derivatives).
Fig. 3 – Lineweaver–Burk plot for the reduction of
acetaldehyde by ADH2 in the presence of varying
concentrations of BSA. The reaction in the other direction,
the oxidation of ethanol, was unaffected in the presence of
BSA. Reactions were conducted at ambient temperature.
They were continuously monitored in a spectrometer
(measuring the production or utilization of NADH at
340 nm). Values are means and range of two
determinations.
reduction in a competitive mode with a slight activating
component at high substrate concentrations (Fig. 3). Competi-
tion inhibition may not require direct interaction of BSA with
ADH2, but alternatively could also result from reversible
binding of the substrate to BSA.
3.4.
Oxidation of HMP isomers and reduction of FP isomers
by ADH2
For all substrate pairs and conditions, the catalytic
efficiencies of the reverse reaction (reduction of the aldehyde)
were somewhat higher than for the forward reaction (oxida-
tion of the alcohol).
Two different regimens were used for delivering the substrates.
In the first regimen, the substrateswere added using a relatively
Table 3 – Kinetics of the oxidation of HMPs compared to the reference substrate ethanol and of the corresponding reverse
reactions by of ADH2
Substrate
Solubilizera
Oxidation of the alcohol
Reduction of the aldehyde
Vmax (nmol/
Km (mM)
Vmax/Km (ml/ Vmax (nmol/
Km (mM)
Vmax/Km (ml/
[min mg])
[min mg])
[min mg])
[min mg])
Ethanol/
None
1350 ꢂ 80
33000 ꢂ 4000
0.04
4400 ꢂ 300
26000 ꢂ 4000
0.2
acetaldehyde
1-HMP/1-FP
2-HMP/2-FP
4-HMP/4-FP
DMSO-high
600 ꢂ 40
76 ꢂ 7
8
2
140 ꢂ 7
12 ꢂ 2
95 ꢂ 8
12
5
DMSO-low, BSA
680 ꢂ 140
350 ꢂ 90
460 ꢂ 30
DMSO-high
1800 ꢂ 100
4700 ꢂ 700
4.4 ꢂ 0.7
80 ꢂ 20
409
59
1210 ꢂ 110
6400 ꢂ 200
2.9 ꢂ 0.2
29 ꢂ 2
417
221
DMSO-low, BSA
DMSO-high
860 ꢂ 110
40 ꢂ 10
22
7
189 ꢂ 4
268 ꢂ 5
3.8 ꢂ 0.3
50
26
DMSO-low, BSA
1770 ꢂ 220
240 ꢂ 40
10.2 ꢂ 0.5
Reactions were conducted at ambient temperatures. They were continuously monitored by UV spectrometry (at l = 340 or 360 nm).
a
The final concentrations of the solubilizers were 0.33% DMSO and 0.33% BSA (DMSO-low, BSA) or the minimal level of DMSO required to keep
the incubation mixture over the entire concentration range used for the corresponding compound, 2% for 2-HMP, 6% for 1-HMP and 4-HMP,
and 10% for all FP isomers.

534
b i o c h e m i c a l p h a r m a c o l o g y 7 5 ( 2 0 0 8 ) 5 2 7 – 5 3 7
Fig. 4 – Dixon plots of the ADH2-catalyzed oxidation of ethanol and HMP isomers in the presence of varying concentrations
of 4-methylpyrazole. The substrates were used at the following concentrations—ethanol: 100 mM (*), 60 mM ( ) and
30 mM ( ); 1-HMP: 60 mM, (*), 40 mM ( ) and 20 mM ( ); 2-HMP: 20 mM (*), 10 mM ( ) and 5 mM ( ); 4-HMP: 40 mM (*), 20 mM
(
) and 10 mM ( ). Solubilizing regimen 1 (6% DMSO) was used with the HMPs. The reactions were carried out at ambient
temperature. They were continuously monitored by UV spectrometry (at l = 340 or 360 nm). Values are means and range of
two determinations.
3.5.
isomers
Inhibition of ADH2 catalyzed oxidation of HMP
preceding study [12]. Levels of 1-methylpyrenyl DNA adducts
were increased up to 200-fold in liver, lungs and kidneys.
Likewise, serum levels of 1-sulphooxymethylpyrene and
excretion of 1-methylpyrenyl mercapturic acid were ele-
vated. This interaction study had been conducted after
observing that free and conjugated carboxylic acids were
the predominating metabolites of 1-HMP excreted in urine
and faeces. Evidently, oxidation of the hydroxyl group would
prevent its sulpho conjugation, i.e. the bioactivation. Since we
considered ADHs as the primary candidate enzymes to
mediate the first oxidation step of 1-HMP, we had used
ethanol (a competing ADH substrate) and 4-methylpyrazole
(an ADH inhibitor) in the animal studies. The strongly
enhanced bioactivation of 1-HMP in co-treated animals
corroborated our hypothesis on an involvement of ADHs.
At this stage it became important to identify the ADH forms
involved in order to specify the mechanism underlying the
interaction and to facilitate the detection of other interacting
factors. For the purpose of elucidating the results of the
animal experiment it would have been optimal to study rat
ADHs. However, since effects and interactions occurring in
humans are of much higher interest, we cloned and studied
the ADHs from this species. We found that human ADH2
shows particular high catalytic activity towards all three
possible isomers of HMP. Previously, it was found that ADH2
prefers aromatic and large aliphatic alcohols [31]. The
aromatic alcohols studied at that time were benzyl alcohol
The ADH2-mediated oxidation of the HMP isomers was clearly
inhibited in the presence of 4-methylpyrazole (Fig. 4). The Ki
values were 480 ꢂ 40 mM with the substrate 1-HMP, 770 ꢂ 50 mM
with 2-HMP and 460 ꢂ 30 mM with 4-HMP. These values were
2.5–4.5-fold higher than the apparent Ki value determined using
ethanol as the substrate 170 ꢂ 20 mM (Fig. 4, upper left panel).
Inhibition of the ADH2-catalyzed oxidation of 1-HMP was
also studied using the known ADH inhibitors daidzein [29] and
cimetidine [30] and compared with the inhibition of ethanol
oxidation by these compounds (Fig. 5). The apparent Ki value
for daidzein was similar with both substrates used: 58 ꢂ 2 mM
with 1-HMP and 51 ꢂ 2 mM with ethanol (Fig. 5, left panels). By
contrast, the inhibition by cimetidine was stronger for the
oxidation of ethanol (Ki = 900 ꢂ 200 mM) than for the oxidation
of 1-HMP (Ki = 4400 ꢂ 400 mM) (Fig. 5, right panels).
Ethanol inhibited the ADH2-mediated oxidation of 1-HMP
with an apparent Ki value of 38 ꢂ 2 mM (Fig. 6). This Ki value is
similar to the Km value for the ADH2-mediated oxidation of
ethanol (33 mM, Table 3).
4.
Discussion
Concurrent exposure to ethanol or 4-methylpyrazole led to a
dramatic increase in the bioactivation of 1-HMP in rats in a
and 3-phenyl-1-propanol, molecules containing
a single

b i o c h e m i c a l p h a r m a c o l o g y 7 5 ( 2 0 0 8 ) 5 2 7 – 5 3 7
535
Fig. 5 – Dixon plots of the ADH2-catalyzed oxidation of ethanol (upper panels) and 1-HMP (lower panels) in the presence of
varying concentrations of daidzein (left panels) and cimetidine (right panels). The substrates were used at the following
concentrations—ethanol: 100 mM (*), 60 mM ( ) and 30 mM ( ); 1-HMP: 60 mM (*), 40 mM ( ) and 20 mM ( ). Solubilizing
regimen 1 (6% DMSO) was used with 1-HMP. And additional 1% DMSO was used as delivering agent for daidzein and in the
corresponding negative controls. The reactions were carried out at ambient temperature. They were continuously
monitored by UV spectrometry (at l = 340 nm). Values are means and range of two determinations.
aromatic ring, whereas the methylpyrene derivatives involve
four condensed benzene rings.
of organic delivering solvents and solubilizing regimens
(which in general negatively affect kinetic parameters apart
from the better solubility). Nevertheless, we could clearly
show that HMPs and FPs are much better substrates for ADH2
than the standard substrates ethanol and acetaldehyde. 2-
HMP and 2-FP were even better substrates than their
positional isomers, possibly because their functional group
is located in the most peripheral position of the pyrene
nucleus and thus may best be accessible for the enzyme.
We identified and characterized four inhibitors of the
Kinetic analyses with the methylpyrene derivatives were
complicated by their poor solubility in water, requiring the use
ADH2-mediated oxidation of HMPs: ethanol, which is
a
competing substrate, and three compounds for which an
inhibition of ADH2 with other substrates such as ethanol was
known from earlier studies. The apparent Ki value of ethanol
was 38 mM (0.175%, w/v), a concentration that can be attained
in humans by alcohol consumption. 4-Methylpyrazole, a
competitive ADH inhibitor clinically used for the treatment
of ethylene glycol [32,33] and methanol poisoning [34], showed
a somewhat higher apparent Ki value when HMPs rather than
ethanol were used as substrates. The reasons for this
difference have not been elucidated. They may be technical
as solubilizing agents had to be used for HMPs, but not for
ethanol. From previous studies it was known that the H2
receptor antagonist cimetidine [30] and the isoflavone
daidzein [29] competitively inhibit ADH2 activity towards
ethanol. We confirmed these findings and extended them to a
further substrate, 1-HMP. This congruence is not fully trivial,
as cimetidine and daidzein differentially affected another
ADH form, ADH1C, depending on the substrate used—they
Fig. 6 – Dixon plot of the ADH2-catalyzed oxidation of 1-
HMP in the presence of varying concentrations of ethanol.
The substrate, 1 HMP, was used at the following
concentrations: 60 mM (*), 40 mM ( ) and 20 mM ( ).
Solubilizing regimen 1 (6% DMSO) was used. The reactions
were carried out at 37 8C for 5 min. Afterwards the amount
of 1-FP formed was determined by HPLC with fluorescence
detection. Values are means and range of two
determinations.

536
b i o c h e m i c a l p h a r m a c o l o g y 7 5 ( 2 0 0 8 ) 5 2 7 – 5 3 7
[7] Engst W, Landsiedel R, Hermersdorfer H, Doehmer J, Glatt
¨
inhibited the oxidation of ethanol, but stimulated the
oxidation of 4-HMP (Kollock and Glatt, manuscript in
preparation).
HR. Benzylic hydroxylation of 1-methylpyrene and 1-
ethylpyrene by human and rat cytochromes P450
individually expressed in V79 Chinese hamster cells.
Carcinogenesis 1999;20:1777–85.
The practical significance of such interactions remains to
be clarified. There is good epidemiological evidence that
consumption of alcoholic beverages increases the incidence of
various cancers in humans; by contrast, ethanol did not
induce tumours in animals in general when tested alone
[35,36]. However, it enhanced the tumorigenicity of certain
carcinogens [35]. Likewise, a strong synergism has been
observed between alcohol and tobacco smoking for certain
malignant tumours in humans, e.g. those of the oesophagus
[37]. Alk-PAHs are present at high levels in cigarette smoke. For
example, 1-methylpyrene has been found in cigarette smoke
at a 3.3-fold higher level than that of benzo[a]pyrene [38]. And
the total of three methylpyrenes exceeds the level of
benzo[a]pyrene by a factor of 10; in addition dimethylated
congeners are present (Seidel, Frank and Glatt, manuscript in
preparation). It is therefore possible that ethanol is an indirect
carcinogen in humans acting via a reduced ADH-mediated
detoxification (which does not exclude additional modes of
action). In this context, it would be interesting to see whether
other long-term modulations of ADH2 activity—e.g. resulting
from genetic polymorphism [20] or from dietary and pharma-
ceutical factors (such as daidzein and cimetidine, respectively)
would increase cancer risks in certain situations (e.g. involving
high exposure to alk-PAHs).
[8] Glatt HR, Seidel A, Harvey RG, Coughtrie MWH. Activation
of benzylic alcohols to mutagens by human hepatic
sulphotransferases. Mutagenesis 1994;9:553–7.
[9] Glatt HR, Pauly K, Frank H, Seidel A, Oesch F, Harvey RG, et al.
Substance-dependent sex differences in the activation of
benzylic alcohols to mutagens by hepatic sulfotransferases
of the rat. Carcinogenesis 1994;15:2605–11.
[10] Glatt HR. Sulfotransferases in the bioactivation of
xenobiotics. Chem-Biol Interact 2000;129:141–70.
[11] Glatt HR, Pabel U, Muckel E, Meinl W. Activation of
polycyclic aromatic compounds by cDNA-expressed phase
I and phase II enzymes. Polycyclic Aromat Compd
2002;22:955–67.
[12] Ma L, Kuhlow A, Glatt HR. Ethanol enhances the activation
of 1-hydroxymethylpyrene to DNA adduct-forming species
in the rat. Polycyclic Aromat Compd 2002;22:933–46.
[13] Theorell H, Yonetani T, Sjoberg B. On the effects of some
¨
heterocyclic compounds on the enzymic activity of liver
alcohol dehydrogenase. Acta Chem Scand 1969;23:255–60.
[14] Li TK, Theorell H. Human liver alcohol dehydrogenase:
inhibition by pyrazole and pyrazole analogs. Acta Chem
Scand 1969;23:892–902.
[15] Duester G, Farre´s J, Felder MR, Holmes RS, Hoog J-O, Pare´s
¨ ¨
X, et al. Recommended nomenclature for the vertebrate
alcohol dehydrogenase gene family. Biochem Pharmacol
1999;58:389–95.
[16] Vollmann H, Becker H, Corell M, Streeck H. Beitrage zur
¨
Kenntnis des Pyrens und seiner Derivate. Justus Liebigs
Ann Chem 1937;531:1–159.
[17] Nakasuji K, Akiyama S, Nakagawa M. Linear conjugated
systems bearing aromatic terminal groups. VII. Syntheses
and electronic spectra of 1,10- and 2,20-dipyrenylpoly-ynes.
Bull Chem Soc Jpn 1972;45:875–82.
[18] Gerasimenko YE, Shevcbuk IN. Pyrene chemistry. VIII. 4-
Acylpyrenes and 3H-benz[c,d]pyrene-3-one. J Org Chem
(USSR) 1968;4:2120–3.
[19] Foroozesh M, Primrose G, Guo Z, Bell LC, Alworth WL,
Guengerich FP. Aryl acetylenes as mechanism-based
inhibitors of cytochrome P450-dependent monooxygenase
enzymes. Chem Res Toxicol 1997;10:91–102.
Acknowledgements
Research described in this article was supported by Philip
Morris USA Inc. and by Philip Morris International. We thank
Dr. Harschadrai Rawel for his assistance on the purification of
ADH2 and Martina Scholtyssek for her skilful technical
assistance.
r e f e r e n c e s
[20] Stromberg P, Svensson S, Hedberg JJ, Nordling E, Hoog J-O.
¨ ¨
¨
Identification and characterisation of two allelic forms of
human alcohol dehydrogenase 2. Cell Mol Life Sci
2002;59:552–9.
[1] Luch A. The Carcinogenic Effects of Polycyclic Aromatic
Hydrocarbons. London: Imperial College Press; 2005.
[2] Thakker DR, Yagi H, Levin W, Wood AW, Conney AH, Jerina
DM. Polycyclic aromatic hydrocarbons: metabolic
activation to ultimate carcinogens. In: Anders MW, editor.
Bioactivation of Foreign Compounds. Academic Press Inc.;
1985. p. 177–242.
[3] Watabe T, Ishizuka T, Isobe M, Ozawa N. A 7-
hydroxymethyl sulfate ester as an active metabolite of 7,12-
dimethylbenz[a]anthracene. Science 1982;215:403–5.
[4] Surh Y-J, Miller JA. Roles of electrophilic sulfuric acid ester
metabolites in mutagenesis and carcinogenesis by some
polynuclear aromatic hydrocarbons. Chem-Biol Interact
1994;92:351–62.
[21] Bullas LR, Ryu J-I. Salmonella typhimurium LT2 strains which
are rꢀ m+ for all three chromosomally located systems of
DNA restriction and modification. J Bacteriol 1983;156:471–4.
[22] Maron DM, Ames BN. Revised methods for the Salmonella
mutagenicity test. Mutat Res 1983;113:173–215.
[23] Glatt HR, Meinl W. Sulfotransferases and
acetyltransferases in mutagenicity testing: technical
aspects. Meth Enzymol 2005;400:230–49.
[24] Meinl W, Meerman JHN, Glatt HR. Differential activation of
promutagens by alloenzymes of human sulfotransferase
1A2 expressed in Salmonella typhimurium. Pharmacogenetics
2002;12:677–89.
[5] Glatt HR, Meinl W, Kuhlow A, Ma L. Metabolic formation,
distribution and toxicological effects of reactive sulphuric
acid esters. Nova Acta Leopoldina NF87 2003;329:151–61.
[6] Rice JE, Rivenson A, Braley J, LaVoie EJ. Methylated
derivatives of pyrene and fluorene: evaluation of
genotoxicity in the hepatocyte/DNA repair test and
tumorigenic activity in newborn mice. J Toxicol Environ
Health 1987;21:525–32.
[25] Laemmli UK. Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature
1970;227:680–5.
[26] Dixon M. The determination of enzyme inhibitor constants.
Biochem J 1953;55:170–1.
[27] Sharkawi M. Inhibition of alcohol dehydrogenase by
dimethyl formamide and dimethyl sulfoxide. Toxicol Lett
1979;4:493–7.

b i o c h e m i c a l p h a r m a c o l o g y 7 5 ( 2 0 0 8 ) 5 2 7 – 5 3 7
537
[28] Cho H, Plapp BV. Specificity of alcohol dehydrogenases for
[34] Brent J, McMartin K, Phillips S, Aaron C, Kulig K. Fomepizole
sulfoxides. Biochemistry 1998;37:4482–9.
for the treatment of methanol poisoning. N Engl J Med
2001;344:424–9.
[35] IARC. IARC Monographs on the Evaluation of Carcinogenic
Risks, vol. 44. Lyon (France): International Agency for
Research on Cancer; 1988.
[36] World Cancer Research Fund. Food, Nutrition and the
Prevention of Cancer: A Global Perspective. Washington:
World Cancer Research Fund; 1997.
[37] Tuyns AJ. Oesophageal cancer in non-smoking drinkers
and in non-drinking smokers. Int J Cancer 1983;32:443–4.
[38] Grimmer G. Prozesse, bei denen PAH entstehen. In:
[29] Keung WM. Biochemical studies of a new class of alcohol
dehydrogenase inhibitors from Radix puerariae. Alcohol Clin
Exp Res 1993;17:1254–60.
[30] Stone CL, Hurley TD, Peggs CF, Kedishvili NY, Davis GJ,
Thomasson HR, et al. Cimetidine inhibition of human
gastric and liver alcohol dehydrogenase isoenzymes:
identification of inhibitor complexes by kinetics and
molecular modeling. Biochemistry 1995;34:4008–14.
[31] Ditlow CC, Holmquist B, Morelock MM, Vallee BL. Physical
and enzymatic properties of a class II alcohol
dehydrogenase isozyme of human liver: p-ADH.
Biochemistry 1984;23:6363–8.
Umweltbundesamt, editor. Luftqualitatskriterien fur
¨
¨
ausgewahlte polyzyklische aromatische
¨
[32] Brent J, McMartin K, Phillips S, Burkhart KK, Donovan JW,
Wells M, et al. Fomepizole for the treatment of ethylene
glycol poisoning. N Engl J Med 1999;340:832–8.
[33] Borron SW, Me´garbane B, Baud FJ. Fomepizole in treatment
of uncomplicated ethylene glycol poisoning. Lancet
1999;354:831.
Kohlenwasserstoffe. Berlin: Erich Schmidt-Verlag; 1979. p.
54–76.
[39] Meinl W, Pabel U, Osterloh-Quiroz M, Hengstler JG, Glatt
HR. Human sulfotransferases are involved in the activation
of aristolochic acids and are expressed in renal target
tissue. Int J Cancer 2006;118:1090–7.