Crystal structures and functional studies clarify substrate selectivity and catalytic residues for the unique orphan enzyme N-acetyl-D-mannosamine dehydrogenase

Article abstract of DOI:10.1042/BJ20140266

NAMDH (N-acetyl-D-mannosamine dehydrogenase), from the soil bacteroidete Flavobacterium sp. 141-8, catalyses a rare NAD⁺ -dependent oxidation of ManNAc (N-acetyl-Dmannosamine) into N-acetylmannosamino-lactone, which spontaneously hydrolyses into N-acetylmannosaminic acid. NAMDH belongs to the SDR (short-chain dehydrogenase/reductase) superfamily and is the only NAMDH characterized to date. Thorough functional, stability, site-directed mutagenesis and crystallographic studies have been carried out to understand better the structural and biochemical aspects of this unique enzyme. NAMDH exhibited a remarkable alkaline pH optimum (pH 9.4) with a high thermal stability in glycine buffer (T_m =64°C) and a strict selectivity towards ManNAc and NAD⁺ . Crystal structures of ligand-free and ManNAc- and NAD ⁺ -bound enzyme forms revealed a compact homotetramer having point 222 symmetry, formed by subunits presenting the characteristic SDR α₃β₇α₃ sandwich fold. A highly developed C-terminal tail used as a latch connecting nearby subunits stabilizes the tetramer. A dense network of polar interactions with the substrate including the encasement of its acetamido group in a specific binding pocket and the hydrogen binding of the sugar 4OH atom ensure specificity for ManNAc. The NAMDH-substrate complexes and site-directed mutagenesis studies identify the catalytic tetrad and provide useful traits for identifying new NAMDH sequences.

Full text of DOI:10.1042/BJ20140266

Biochem. J. (2014) 462, 499–511 (Printed in Great Britain) doi:10.1042/BJ20140266
499
Crystal structures and functional studies clarify substrate selectivity and
catalytic residues for the unique orphan enzyme N-acetyl-D-mannosamine
dehydrogenase
1
1
2
´
Agust´ın SOLA-CARVAJAL* , Fernando GIL-ORTIZ†‡ , Francisco GARCIA-CARMONA*, Vicente RUBIO† and
2
´
´
Alvaro SANCHEZ-FERRER*§
*Department of Biochemistry and Molecular Biology-A, Faculty of Biology, Regional Campus of International Excellence “Campus Mare Nostrum”, University of Murcia, Campus
Espinardo, E-30100 Murcia, Spain
†Instituto de Biomedicina de Valencia-Consejo Superior de Investigaciones Cient´ıficas (IBV-CSIC) and Centro de Investigacio´n Biome´dica en Red de Enfermedades Raras
(CIBERER-ISCIII), Valencia, Spain
‡CELLS-ALBA Synchrotron Light Source, 08290 Barcelona, Spain
§Murcia Biomedical Research Institute (IMIB-Arrixaca), 30120 Murcia, Spain
NAMDH (N-acetyl-D-mannosamine dehydrogenase), from the
soil bacteroidete Flavobacterium sp. 141-8, catalyses
revealed a compact homotetramer having point 222 symmetry,
formed by subunits presenting the characteristic SDR α3β7α3
sandwich fold. A highly developed C-terminal tail used as a
latch connecting nearby subunits stabilizes the tetramer. A dense
network of polar interactions with the substrate including the
encasement of its acetamido group in a specific binding pocket and
the hydrogen binding of the sugar 4OH atom ensure specificity for
ManNAc. The NAMDH–substrate complexes and site-directed
mutagenesis studies identify the catalytic tetrad and provide useful
traits for identifying new NAMDH sequences.
a
rare NAD+ -dependent oxidation of ManNAc (N-acetyl-D-
mannosamine) into N-acetylmannosamino-lactone, which spon-
taneously hydrolyses into N-acetylmannosaminic acid. NAMDH
belongs to the SDR (short-chain dehydrogenase/reductase)
superfamily and is the only NAMDH characterized to date.
Thorough functional, stability, site-directed mutagenesis and
crystallographic studies have been carried out to understand better
the structural and biochemical aspects of this unique enzyme.
NAMDH exhibited a remarkable alkaline pH optimum (pH 9.4)
with a high thermal stability in glycine buffer (Tm = 64◦C) and a
strict selectivity towards ManNAc and NAD+ . Crystal structures
of ligand-free and ManNAc- and NAD+ -bound enzyme forms
Key words: Flavobacterium sp. 141-8, N-acetyl-D-mannosamine,
N-acetyl-D-mannosamine dehydrogenase, short-chain dehydro-
genase/reductase, sialic acid, substrate selectivity.
fermentation, whereas ManNAc is first converted into N-acetyl-
D-glucosamine-6-phosphate by a combination of phosphorylation
and epimerization, and then this last phosphorylated acetyl
amino sugar is deacylated and deaminated, yielding fructose 1,6-
bisphosphate, which is used by the glycolytic route of the bacteria
(Figure 1A).
Although the conversion into fructose 1,6-bisphosphate is
the usual process of sialic acid catabolism in bacteria, which
have variants depending on whether the epimerization or
the phosphorylation step occurs first [11], a soil bacterium,
Flavobacterium sp. 141-8, isolated because of its ability to grow
on ManNAc as the sole carbon source [12], was found to oxidize
sialic acid (Figures 1A and 1B) by a unique dehydrogenase (EC
1.1.1.233), NAMDH (N-acyl-D-mannosamine dehydrogenase),
to N-acetylmannosamino-lactone, with subsequent spontaneous
hydrolysis of the lactone to yield N-acetylmannosaminic acid [12]
(Figure 1B). In line with the very limited biological information
existing on Flavobacterium sp. 141-8 (contained in U.S. Pat.
4,960,701) [13], the physiological role of this enzyme remains
unclarified, not having been found in any other micro-organism.
However, a commercial application for NAMDH has been found.
INTRODUCTION
ManNAc (N-acetyl-D-mannosamine) is a common amino sugar
that is part of the biosynthetic pathway of sialic acids, which
are the usual components of glycoproteins and gangliosides in
animals [1]. The most common form of sialic acid, Neu5Ac (N-
acetylneuraminic acid) is found as such in body fluids [2], and is
considered a biomarker for some tumoral [3] and inflammatory
[4] states, rendering its determination in serum important [2,5].
In addition, Neu5Ac is present in some bacteria that live in close
association with animals (deuterostomes), as a part of capsular
polysialic acid polymers that, by mimicking animal components,
can be important elements in the pathogenicity of these bacteria
[6–8].
Being a widespread biochemical component, sialic acid is
scavenged (Figure 1) by many bacteria from the surrounding
environment [8–10]. Thus bacteria use sialidases (Figure 1A)
to cleave sialic acid from sialo-glycoconjugates and then
they utilize Neu5Ac aldolase to split Neu5Ac to pyruvate
and ManNAc. Pyruvate can be used in
fermentative processes such as lactic, homolactic and alcoholic
a number of
Abbreviations: AldT, aldohexose dehydrogenase; CCD, charge-coupled device; C-tail, C-terminal tail; FspNAMDH, NAMDH from Flavobacterium
sp. 141-8; 3β/17β-HSD, 3β/17β-hydroxysteroid dehydrogenase; ManNAc, N-acetyl-D-mannosamine; NAMDH, N-acetyl-D-mannosamine dehydrogenase;
Neu5Ac, N-acetylneuraminic acid; RsGDH, Rhodobacter sphaeroides galactitol dehydrogenase; SDR, short-chain dehydrogenase/reductase; TLS,
translation–libration–screw–rotation.
1
These authors contributed equally to this work.
Correspondence may be addressed to either of these authors (rubio@ibv.csic.es or alvaro@um.es).
2
The co-ordinates and structure factors for the FspNAMDH-apo, FspNAMDH–ManNAc and FspNAMDH–NAD crystal structures have been deposited in
the PDB under codes 4CR6, 4CR7 and 4CR8 respectively.
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

500
A. Sola-Carvajal and others
Figure 1 Sialic acid catabolism and the FspNAMDH reaction
(A) Catabolism of sialic acid (Neu5Ac) in bacteria. The reaction catalysed by NAMDH is boxed. AGE, N-acyl-D-mannosamine 2-epimerase; ManNAc-6P, N-acetyl-D-mannosamine 6-phosphate;
NagA, N-acetylglucosamine 6-phosphate deacetylase; NagB, glucosamine 6-phosphate deaminase; NAL, N-acetylneuraminic acid aldolase; NanE, N-acetyl-D-glucosamine 2-epimerase; NanK,
N-acetylmannosamine kinase; RokA, hexokinase. (B) FspNAMDH uses NAD+ to oxidize ManNAc to N-acetylmannosamino lactone, which is then spontaneously hydrolysed to N-acetylmannosaminic
acid.
value, D-sorbitol dehydrogenase (used for sorbitol assay in
food, pharmaceutical and cosmetic preparations). We were
surprised to find that the putative sequence for this enzyme
from Rhodobacter capsulatus SB1003 appeared in the UniProtKB
database (http://www.uniprot.org) under two different accession
numbers (D5AUY1 and O68112) and annotated as both a
sorbitol dehydrogenase and NAMDH. When we cloned and
expressed the R. capsulatus gene (NCBI 9004849) for this putative
protein [15], the purified protein product was clearly a sorbitol
dehydrogenase with no NAMDH activity. If the UniProtKB
database is queried with the NAMDH EC number 1.1.1.233,
By coupling the Neu5Ac aldolase and NAMDH reactions, sialic
acid can be assayed in fluids by simply following NAD reduction
[5]. This led to the early production with this purpose of
FspNAMDH (NAMDH from Flavobacterium sp. 141-8) [12],
and, later on, to the cloning of the gene from this micro-organism
that encodes NAMDH and the recombinant production of this
enzyme [14], which was sold commercially as a part of a sialic
acid assay kit.
Although NAMDH had been used widely, little was known
about this enzyme [12,14]. Our interest in NAMDH was spurred
by our recent studies [15] on another enzyme of biotechnological
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

Structure of N-acetyl-D-mannosamine dehydrogenase
501
14 entries appear, which include the genuine NAMDH from
Flavobacterium sp. 141-8 (FspNAMDH), but also R. capsulatus
sorbitol dehydrogenase and other putative proteins of different
lengths, some of them with much longer sequences than that of the
experimentally demonstrated FspNAMDH, rendering it difficult
to ascertain which are the key characteristics that could allow the
annotation with a high degree of certainty of a sequence as truly
corresponding to NAMDH. Since structural determination can
be a way to define these key characteristics, helping to identify
sequence motifs associated with a given function, we decided
to determine the crystal structure of the only known genuine
FspNAMDH.
Escherichia coli DH5α electrocompetent cells (Novagen), was
used for transformation of E. coli Rosetta 2(DE3) cells (Novagen).
Protein expression and purification were carried out as described
previously for BoAGE2 [22], except for the utilization of a 50 kDa
cut-off membrane in the ultrafiltration step, and the use in the
next step of column chromatography on a Ni2 + -loaded HiPrep
IMAC 16/10 FF column (GE Life Sciences) connected to an
¨
Akta Prime FPLC system (GE Life Sciences). The fractions
containing the pure protein (purity monitored by SDS/PAGE
[23]) were concentrated by centrifugal ultrafiltration to ∼6 mg/ml
(Bradford assay [24], using a commercial reagent from Bio-Rad
Laboratories and BSA as a standard).
We report the results of these studies, which are not just
crystallographic, since they also include functional and site-
directed mutagenesis studies. The structure of FspNAMDH
confirms this enzyme as a member of the SDR (short-chain
dehydrogenase/reductase) family [16]. This large functionally
convergent protein family is nucleated by the common structural
trait of sharing a dinucleotide-binding motif. However, the modest
to low sequence identity (15–30%) among the members of this
family [17] and the presence in these enzymes of a highly variable
C-terminal segment hosting the site for the non-dinucleotide
substrate [18,19] has resulted in great diversity of specificities
and even different activities and reactional mechanisms within
the family, which not only includes dehydrogenases/reductases,
but also lyases and some isomerases [20].
Site-directed mutagenesis
Six single mutants (N119A, N119S, S153T, Y166N, Y166Q
and K170R) were prepared by the overlapping extension
method [25] using pFspNAMDH as the template and
appropriate mutagenic oligonucleotides (Supplementary Table
S1 at http://www.biochemj.org/bj/462/bj4620499add.htm). PCR
products were digested with DpnI, and transformed in E. coli
DH5α electrocompetent cells. The presence of the mutations
and the absence of unwanted changes were confirmed by DNA
sequencing. Production of the mutant proteins in Rosetta cells and
their purification were as for the wild-type enzyme.
Our crystal structures of FspNAMDH in a free form or bound
to ManNAc or NAD+ , at respective resolutions of 1.9 Å, 2.15
Å and 2.2 Å (1 Å = 0.1 nm), reveal a homotetrameric 222
point group architecture with subunits conforming to the SDR
family fold. The structures clarify how the enzyme can select
for ManNAc. Structural analysis and site-directed mutagenesis
studies corroborate that Asn119, Ser153, Tyr166 and Lys170 constitute
the catalytic tetrad which is typical of the SDR family [16,21].
A water-rich pocket is identified as a proton reservoir/acceptor,
allowing proton transfer to the solvent during catalysis. By being
clamped between two elements of another subunit, the highly
developed C-tail (C-terminal tail) plays a key role in interlinking
different subunits and stabilizing the tetramer. The comparison
of the structures of the ligand-free and substrate-containing
structures fails to reveal significant conformational changes upon
ManNAc or NAD+ binding.
Enzyme activity assays
NAMDH activity was assayed [12] as NAD+ reduction by
monitoring the increase in the absorbance at 340 nm in 1 ml
of assay mixtures at 37◦C containing 50 mM glycine, pH 9.5,
3 mM NAD+ and 5 mM ManNAc. For determination of Km
values for the two substrates, one of the substrates was kept at the
concentration used in the standard assay and the second substrate
was varied in an appropriate range to approach saturation. Results
were fitted to hyperbolic kinetics using GraphPad Prism.
Crystallization and data collection
The sparse matrix vapour diffusion sampling procedure [26]
was used for screening crystallization conditions at 21◦C in
sitting drops of 0.4 μl of reservoir fluid and 0.4 μl of 5.5 mg/ml
FspNAMDH in 0.02 M Tris/HCl, pH 8.0, alone or supplemented
with 10 mM ManNAc or 5 mM NAD+ . The best FspNAMDH
crystals prepared without ligands (FspNAMDH-apo) or with
ManNAc (FspNAMDH–ManNAc) had a cubic shape (0.2 mm
maximal dimension) and grew using 0.1 M Hepes, pH 7.5,
and 30% (w/v) PEG 300 as a crystallization solution. Both
crystals were frozen directly from the drop. The crystal prepared
in the presence of NAD+ (FspNAMDH–NAD) had a plate
shape, grew in 8% (w/v) PEG 4000 and was frozen in
liquid nitrogen after passage through crystallization solution
enriched with 30% (w/v) PEG 400. FspNAMDH-apo and
FspNAMDH–ManNAc crystals were diffracted at 100 K (Oxford
Cryosystems) at the ESRF (European Synchrotron Radiation
Facility) synchrotron (Grenoble) (Table 1), using a 225 mm
MarMOSAIC CCD (charge-coupled-device camera) detector and
an ADSC Quantum 210r CCD detector respectively. Crystals of
the NAD+ complex were diffracted at the Diamond Light Source
Synchrotron (Harwell, Oxfordshire), using an ADSC Quantum
Q315r CCD detector. Data was processed with MOSFLM or
XDS, SCALA and TRUNCATE [27,28] (Table 1). Ligand-free
and ManNAc-containing crystals had triclinic cells (space group
P1) (Table 1) with one and four homotetramers in the asymmetric
unit respectively at 44% solvent content. The FspNAMDH–NAD
EXPERIMENTAL
Cloning, expression and protein purification
Molecular biology techniques were carried out as described
[22]. The FspNAMDH gene (GenBank accession number
BAA14346.1) was cloned from genomic DNA (obtained from
an overnight culture in Bouillon medium) of Flavobacterium
sp. 148-1 cells (provided by the International Patent Organism
Depositary, Japan) by PCR. For this PCR cloning we used a high
fidelity thermostable DNA polymerase (PfuUltra II, Stratagene);
the respective forward and reverse oligonucleotides were 5ꢁ-CG-
GCGAATTCATGACAACAGCAGGCGTTTC-3ꢁ and 5ꢁ-CTAC-
CTCGAGTCAGCGTCGGCCTTCC-3ꢁ, which contained restric-
tion sites (highlighted in italics) for EcoRI (forward primer) and
XhoI (reverse primer) for directional insertion of the product in the
corresponding sites of pET28a (Novagen). The PCR mixture was
supplemented with 0.125 M betaine and 5% dimethylsulfoxide
(because of the 77% GC content of the gene). The PCR
product was inserted into pET28a (Novagen), yielding the plasmid
pFspNAMDH, encoding the protein with an N-terminal 36-
residue His6 tag. This plasmid, isolated from electrotransformed
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

502
A. Sola-Carvajal and others
Table 1 Data collection and refinement statistics
Values in parenthesis are data for the highest resolution shell. Rsym = ꢀ|I − <I>|/ꢀI, where I is the observed intensity and <I> is the average intensity of multiple observations of symmetry-related
reflections. R-factor = ꢀhklꢂFobs| − |Fcalcꢂ/ꢀhkl|Fobs|, where Fobs and Fcalc are the observed and calculated structure factors respectively. The Ramachandran plots were calculated using PROCHECK.
Parameter
Native
ManNAc complex
NAD+ complex
Data collection
Beamline
ID23-2 (ESRF)
0.9393
P1
ID23-1 (ESRF)
0.9724
P1
I24 (DLS)
0.9796
C2
˚
Wavelength (A)
Space group
Unit cell
˚
a, b, c (A)
59.3, 59.1, 74.2
81.1, 73.3, 79.3
50.00–1.90 (2.00–1.90)
128784/67168
6.2 (3.9)
99.4, 100.1, 111.6
67.4, 89.8, 72.5
57.49–2.15 (2.27–2.15)
507562/199836
5.2 (1.7)
158.9, 146.8, 90.4
90.0, 115.3, 90.0
50.00–2.20 (2.32–2.20)
357924/94228
5.1 (1.9)
◦
α, β, γ ( )
˚
Resolution range (A)
Reflections (total/ unique)
I/σI
Rsym(%)
Completeness (%)
6.4 (16.9)
90.5 (92.7)
9.3 (35.8)
96.9 (97.8)
14.0 (39.3)
99.4 (99.2)
Refinement
Resolution range (A)
˚
12–1.90
15–2.15
20–2.20
Reflections (work/test)
63579/3360
20.9/22.8
189715/10032
20.1/23.1
89504/4723
22.19/25.3
R-factor (work/test) (%)
2
˚
Average B-factors (A )
Protein atoms
NAM
26.71
–
39.9
–
26.84
44.64
28.70
–
10.64
–
–
15.71
10.77
Mannose
NAD+
Water
16.59
27.49
Number of:
Polypeptide chains
Protein atoms
ManNAc molecules
Mannose molecules
NAD+ molecules
Water molecules
4
16
29146
16
4
–
811
0.012
1.33
8
7180
–
2
14733
–
–
–
8
213
0.015
1.35
645
0.012
1.41
˚
◦
RMSD bond (A)
RMSD angle ( )
Ramachandran plot
Most favoured (%)
Additional allowed (%)
Generously allowed (%)
Disallowed (%)
91.4
8.6
0.0
90.3
9.7
0.0
91.8
8.2
0.0
0.0
0.0
0.0
crystal had a monoclinic cell (space group C2) with two tetramers
in the asymmetric unit and 43% solvent content.
last steps of refinement with the TLSMD server for definition
of the TLS groups [30]. The final models at 1.90 Å, 2.15
Å and 2.2 Å (FspNAMDH-apo, FspNAMDH–ManNAc and
FspNAMDH–NAD respectively) exhibited excellent Rfactor/Rfree
values (Table 1), including in the asymmetric unit one, four
and two homotetramers respectively. Non-protein electron density
was found in the active centre of each subunit, which fitted best a
bound ManNAc or the ADP moiety of NAD+ in the FspNAMDH–
ManNAc and FspNAMDH–NAD crystals respectively. Also,
electron density compatible with a mannose molecule was found
at the intersubunit interface of the tetramer, coincident with the
4-fold axis in the FspNAMDH-apo and FspNAMDH–ManNAc
complexes (Table 1). Structure analysis with PROCHECK yielded
excellent stereochemistry for both models [31] (Table 1).
Structure solution and refinement
Table 1 summarizes refinement and model data. Phases were
determined by molecular replacement with MOLREP [27] using
a polyalanine model of a subunit of TT0321 from Thermus
thermophilus HB8 (PDB code 2D1Y; 34% sequence identity
with FspNAMDH), a hypothetical oxidoreductase having a
Rossmann NAD(P) fold, as a search model for the FspNAMDH-
apo crystal. The structure obtained (see below) allowed molecular
replacement in the crystals with ligands. Initial model building and
map improvement were performed using the program ARP/wARP
[27]. Rigid body refinement was performed stepwise with
increased resolution, and it was followed by automated refinement
using REFMAC5 [27], alternating with graphic manual model
adjustment sessions using COOT [29]. Electron density from the
resulting difference maps was interpreted, building the protein
model except for residues 1–9, which lack electron density. B-
factors and positional non-crystallographic symmetry restraints
were used and gradually released as refinement progressed. All of
the diffraction data were used throughout the refinement process
A superimposition of structures and RMSD calculation were
carried out with the SSM option of COOT using default
parameters [29,32]. The Figures were drawn using PyMOL
(http://www.pymol.org) and ESPript [33].
Other techniques
Thermal unfolding of 1 μg of enzyme was followed with
a real-time PCR instrument by monitoring Sypro Orange
(Molecular Probes) fluorescence with increasing temperature
(ramp, 1◦C/min) according to the methods discussed previously
[34,35], in a mixture containing 50 mM of the indicated buffer.
except the 5% of randomly selected data for calculating Rfree
.
TLS (translation–libration–screw-rotation) was applied in the
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

Structure of N-acetyl-D-mannosamine dehydrogenase
503
Figure 2 Properties of FspNAMDH
(A) Size-exclusion chromatography of pure (shown in the inset, by SDS/PAGE) FspNAMDH. The bottom panel illustrates the optical absorption (280 nm) of the effluent. The top panel illustrates a
semi-logarithmic plot of molecular mass against elution volume. Open circles correspond to the following protein standards (mass is given in kDa in parentheses): cytochrome c (12.4), carbonic
anhydrase (29), BSA (66.4), alcohol dehydrogenase (150), β-amylase (200) and apoferritin (440). The closed square plots the elution volume of the main peak against the sequence-deduced mass
for a tetramer (124.8 kDa). (B) Dependence of the enzyme activity on pH (main panel) and temperature (inset, assayed at pH 9.5). The buffers used (50 mM) were sodium phosphate (pH 6.5–7.5),
Tris/HCl (pH 8.0–9.0) and glycine (pH 9.5–11). (C) FspNAMDH thermal unfolding monitored by the increase in Sypro Orange fluorescence using the thermofluor approach. The buffer (50 mM) used
was: (ᮀ) sodium acetate, pH 5.0; (᭹) none; (᭛ and ᭿) sodium phosphate pH 6.0 and 7.0 respectively; (ꢁ, ᭜ and ᭺) Tris/HCl pH 8.0, 8.5 or 9.0 respectively; (✩ and ᭡), glycine pH 9.0 or 9.5
respectively. Inset: Tm (temperature at which the increase in fluorescence is 50% of the maximum increase) as a function of pH.
Gel filtration (Superdex 200 10/300 GL, GE Life Sciences)
was used to confirm the homogeneity and to determine the
molecular mass of the purified enzyme, in 0.05 M Tris/HCl,
pH 7.5, containing 0.15 M NaCl [35].
Precise subunit molecular mass determination was carried out
using LC-ESI–MS, using an HP/1100 LC/MSD Ion Trap System
(Agilent Technologies) and Ion Trap software (version 3.2) [35].
was produced in abundance (∼900 mg/l of culture), in
homogeneous form (Figure 2A, inset) and ∼80% yield, after
a two-step purification procedure. The enzyme was a tetramer
as judged from its gel-filtration elution as a peak (Figure 2A)
(124.8 kDa, for a subunit mass of 31.2 kDa, corroborated by
MS). The enzyme was highly active (specific activity at pH 9.5
◦
+
and 37 C, 83.2 0.4 U/mg), with optimum pH and temperature
−
of 9.5 (Figure 2B) and 55–60◦C respectively. Nevertheless, the
enzyme was active over a broad pH range (pH 6.5–11), in line
with the growth of the bacteria in the pH range of 4.5–8.5 [13].
The pH range of the enzyme was broader on the alkaline side
than previously reported for the natural enzyme [12]. The notable
alkaline tolerance of FspNAMDH agrees with the high ratio of
arginine/(arginine + lysine) residues in its sequence (value for this
RESULTS AND DISCUSSION
Enzyme expression, purification and characterization
The N-terminally His6-tagged protein product of the cloned
FspNAMDH gene (GenBank accession number BAA14346.1)
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

504
A. Sola-Carvajal and others
Four FspNAMDH subunits associate into
a compact
ratio, 0.55), since ratios above 0.5 characterize alkaline-tolerant
enzymes [36].
homotetramer, which presents 222 point group symmetry
(Figures 4C–4E), with the three perpendicular 2-fold axes (P,
Q and R) defining three different dimers, of which dimer AB
(and A’B’) (Figures 4C–4E), formed around the Q-axis, exhibits
the largest interactions (Q interface, ∼885 Å2 buried surface
per subunit corresponding to 14% of the subunit surface),
mediated by the α4 and α5 helices of both subunits forming a
four-helix bundle (Figure 4D and Supplementary Figure S1 at
http://www.biochemj.org/bj/462/bj4620499add.htm). In turn, the
AB’ (or BA’) dimer is formed around the P-loop (Figures 4C
and 4D) with an interface (P-interface) that buries ∼753 Å2 per
subunit (12% of the subunit surface). The β-sheets of the two
subunits merge at this interface, forming a 14-stranded molecular
open concave β-sheet (Figure 4C and Supplementary Figure S1)
thanks to non-canonical antiparallel contacts of the β7 strands of
both subunits. Helix α6, the C-tail, helix α7 and the C-terminal
two turns of helix α5 are also involved in the contacts at this
interface. Finally, the AA’ (or BB’) dimer, formed around the R
axis (Figures 4C and 4E), presents a smaller (∼647 A2 per subunit,
∼10% of the surface area of the subunit) interface (known as
the R-interface) involving helix α6, the C-tail and the β4–α4
and β5–α5 loops. At this interface the C-tail of each subunit is
clamped between helix α6 and loops β4–α5 and β5–α6 of the
other subunit, stabilizing the tetramer. Interestingly, this diagonal
interface, which is also very close to the ManNAc site of the
subunit that receives the C-tail of the other subunit, is much
more developed in FspNAMDH than in its protein homologues,
such as sorbitol dehydrogenase and Gluconobacter frateurii L-
sorbose reductase (PDB code 3AI3) (Figure 3), which exhibit
smaller buried surfaces areas at this interface (only 135 and
297 Å2 respectively) [37,38]. Otherwise the FspNAMDH fold
and architecture are very similar to those of its homologues
(all belonging to the SDR family), with low RMSD values for
superimposition of Cα carbons of the subunits (one by one) or the
entire tetramer. For example, modest RMSD values not exceeding
1.5 Å were obtained for superimposition of the Cα atoms (227–
233 atoms) of the FspNAMDH tetramer with the tetramers of
TT0321, R. sphaeroides sorbitol dehydrogenase [37] or RsGDH
(R. sphaeroides galactitol dehydrogenase; PDB code 3LQF [39]
(Figure 3).
We were surprised to find a 10–15◦C higher optimum
temperature for the activity assay (55–60◦C) than previously
reported for the natural enzyme [12], although this may be
due to the use of Tris/HCl buffer in the prior assays and of
glycine buffer in the present ones. Nevertheless, the enzyme
exhibited substantial activity within the temperature range at
which Flavobacterium sp. 141-8 grows (up to 41◦C) [13]. The
use of different buffers is known to influence thermal stability of
enzymes even at the same pH [36]. Furthermore, thermofluor
assays [34] (Figure 2C and inset thereof) revealed a lower
unfolding temperature of FspNAMDH with Tris/HCl (the buffer
used in previous studies) than with glycine. With this last buffer,
at pH 9.4, unfolding only occurred above 60◦C, in agreement
with the full preservation of the activity up to this temperature,
particularly since the substrates present in the assay may be
expected to induce thermal protection. Actually, the stability of
our enzyme in glycine buffer (Tm = 64◦C) was similar to that
achieved with known protein stabilizers, such as hydroxyectoine
1 M (Tm = 63◦C) or ammonium sulfate 1 M (Tm = 68◦C) (results
not shown), suggesting that glycine itself might have a stabilizing
effect.
The enzyme exhibited no activity with mannosamine or with
NADP+ , thus attesting high specificity for both substrates. The
dependence of the activity on the concentrations of both substrates
+
was hyperbolic, with apparent Km values (0.46 0.02 mM for
−
+
+
NAD ; 0.55 0.01 mM for ManNAc) of the same order or even
−
somewhat lower than those reported earlier [12,14]. Interestingly,
the Neu5Ac aldolases, which use ManNAc in the rare aldehyde
form (the open form), exhibit much higher Km values for ManNAc
(160–220 mM [35]), suggesting that FspNAMDH utilizes the
predominant pyranose form of the sugar.
Crystal structure of NAMDH
Crystals of FspNAMDH in its apo form or bound to ManNAc
or NAD+ diffracted X-rays to 1.9 Å, 2.15 Å and 2.2 Å
resolution respectively (Table 1). The sequence identity of
37% with the hypothetical oxidoreductase of known structure
TT0321 (PDB code 2D1Y) (Figure 3), from T. thermophilus,
led us to successfully use this protein structure for phasing,
yielding solutions consisting of one, four and two enzyme
homotetramers in the asymmetric unit of the respective crystals
of the apo (Table 1, Native) and the ManNAc and NAD+
complexes.
The binding of ManNAc explains the specificity of the enzyme for
the N-acetyl amino sugar substrate
The FspNAMDH subunit was compact and globular
(approximate dimensions, 35 Å×40 Å×50 Å). It presented
a typical Rossmann fold architecture with a seven-stranded
parallel central open β-sheet (topology, β3-β2-β1-β4-β5-β6-β7)
sandwiched between helices α1, α2 and α7 on one side and α3–
α5 on the other side (Figures 4A and 4B). Helix α6 is far away
and runs obliquely relative to the direction of the β-strands, being
a part of a long β6–α7 loop that projects over the C-edge of the
central β-sheet (Figure 4A). Whereas in FspNAMDH the β6–α6
connection is folded as a rigid loop, in homologous proteins of
known structures, such as TT0321 or Rhodobacter sphaeroides
sorbitol dehydrogenase (39% identity; PDB code 1K2W) [37],
this connection is folded as an α-helix (Figure 3). An additional
interesting feature of the subunit fold was the extended and highly
ordered C-tail (residues 260–271) which surrounds the C-terminal
part of helix α6, making important contacts with neighbouring
subunits, being involved in oligomerization and provision of
structural stability to the ManNAc-binding site (Figure 4B).
A large mass of non-protein electron density fitting a ManNAc
molecule in partial occupancy (0.7–1, depending on the subunit)
was found in the FspNAMDH crystal grown in the presence
of ManNAc (Figure 5A), in the same orientation and at an
approximately equivalent place than the mannose molecule
observed in the structure of Thermoplasma acidophilum [AldT
(aldohexose dehydrogenase); PDB code 2DTX; another enzyme
of the SDR family that exhibits 29% sequence identity with
FspNAMDH] [17] (Figure 5B). The amino sugar is at the
bottom of the cleft formed over the C-edge of the β-sheet
(Figures 4A, 5C and 5D, and Supplementary Figure S2 at
http://www.biochemj.org/bj/462/bj4620499add.htm) by the N-
terminal halves of helices α4 and α5 and their connecting loops,
on one side, and by helix α6 and its flanking loops β6–α6 and α6–
α7 on the other side. Thus the substrate is in a gorge (Figures 4A,
4B, 5C and 5D, and Supplementary Figure S2) which is closed
towards β7 by the C-tail of the other subunit of the AA’ dimer.
This tail contributes to stick both walls of the cleft and thus it
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

Structure of N-acetyl-D-mannosamine dehydrogenase
505
Figure 3 Sequence alignment of FspNAMDH with structurally characterized SDR family homologues
Invariant residues are on a black background. Largely conserved or conservatively replaced residues are boxed. Secondary structure elements (springs, α-helices; arrows, β-strands) are represented
above the sequences and are numbered. The four residues of the catalytic tetrad are indicated by arrowheads at the bottom of the sequences. The protein sequences are identified by their PDB codes.
1hxh represents Comamonas testosterone 3β/17β-HSD, the other identifiers are described in the text. The Figure was constructed using ESPript [33].
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

506
A. Sola-Carvajal and others
Figure 4 FspNAMDH crystal structure
(A and B) Orthogonal views of the FspNAMDH subunit with a ManNAc molecule and the ADP moiety of NAD+ bound (in ball and sticks). The binding of the ADP moiety has been carried out by
superimposing the nucleotide from the NAD+ complex on to the model for the ManNAc complex. Helices, β-strands and loops are coloured red, blue and grey respectively. (C and D) Orthogonal
views of the FspNAMDH tetramer showing the three perpendicular 2-fold axes. The two subunits of each dimer defined by the Q-axis are represented in different shades of either red or blue. (E)
Surface representation of the tetramer in the same projection as in (C) to highlight the C-tail interacting with the neighbour subunit. One bound ManNAc molecule per subunit is represented as
spheres. The colour code is as (C). (F) Superimposition of the Cα trace for the tetramers of FspNAMDH-apo (green) and FspNAMDH–ManNAc (black).
close-binding pocket formed between the side chain of Ala163
,
might stabilize the binding site, but it does not provide polar
contacts with the bound substrate, although Phe263 and Ile262 are at
average distances of 3.3 and 4 Å respectively from the ManNAc
molecule.
In contrast with the lack of polar interactions with the C-tail,
the bound ManNAc molecule makes a dense meshwork of polar
contacts between all of its polar atoms (except the hydroxy group
at C3 of the sugar ring, which is exposed) and protein atoms
(Figure 5B). The specificity for the N-acetylated form of the amino
sugar is achieved by encasing the N-acetamido group in a specific
which contacts the methyl group of the acetamido substitutent;
the carboxylate of Glu160, which hydrogen-bonds the N atom of
the acetamido group (as well as the hydroxy group attached to
C6 of the hexose); and the Gly99 N atom, which is hydrogen
bonded to the O atom of the acetamido group. In addition, this
group lies flat on the phenolic ring of Tyr166, whereas the phenolic
O of this tyrosine is hydrogen-bonded to the hydroxy group of
the anomeric C atom. Not surprisingly, the mutation of Tyr166 to
glutamine or asparagine, which were tested in the present study
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

Structure of N-acetyl-D-mannosamine dehydrogenase
507
Figure 5 ManNAc-binding site
(A) Stereoview of the electron density map around the bound ManNAc molecule (subunit P). The 2Fo − Fc electron density map contoured at 1.0 σ is shown as a blue grid and the Fo − Fc omit
electron density map for ManNAc, contoured at 2.5 σ, is illustrated as a red grid. The sticks model is coloured in light green and yellow for C atoms of the protein and the ligand respectively. P, N
and O atoms are coloured green, blue and red respectively. (B) Stereoview of the superimposition of the ManNAc site of FspNAMDH (subunit C; in colour) and the mannose site of AldT (shown
in light grey; PDB code 2DTX). (C and D) View of the substrate gorge in semi-transparent surface representation with one bound ManNAc molecule in α-configuration (C) or β-configuration (D).
Important protein residues are represented in sticks and their secondary structure is shown. The C-tail surface of the adjacent subunit is represented in orange to highlight its nearness to the bound
ManNAc substrate.
Thr176 of T. acidophilum AldT) (Figure 5B). By being bulky
and firmly fixed by sandwiching between large hydrophobic side
chains of neighbouring residues, Tyr208 pushes the sugar towards
its binding site, helping the acetamido group to fit into its specific
binding pocket.
Another finding in our FspNAMDH–ManNAc structure that
differs from that in other SDR family members [18] is the
inadequate conformation of the ManNAc molecule in some of
the subunits for enabling its interaction with the catalytic residues
(see below) Ser153 and Tyr166. This is due to the showing of bound
ManNAc predominantly in the α-configuration of its anomeric
(Table 2), caused large increases in the apparent Km value for
ManNAc.
As already indicated, a characteristic trait of the FspNAMDH
ManNAc site is the replacement of the α-helix found in
other members of the SDR immediately after β6, by a
loop that is highly structured (Supplementary Figure S3 at
http://www.biochemj.org/bj/462/bj4620499add.htm) thanks to
interactions mediated by Asp200. This rigid loop of FspNAMDH
provides Tyr208, a residue that is hydrogen-bonded to the C4
hydroxy group of the sugar ring, replacing in this function the
smaller residues found in other SDR family enzymes (such as
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

508
A. Sola-Carvajal and others
Table 2 Effects of mutations affecting the putative catalytic tetrad
in two subunits (G and H) of the FspNAMDH–NAD complex
(Figure 6B).
KmManNAc (mM)
kcat (s− 1
)
kcat/Km (mM− 1·s− 1
)
Similarly to ManNAc binding, NAD+ binding did not trigger
important conformational changes, given the very small RMSD
values (not exceeding 0.4 Å) for the superimposition of the
subunits or even of the entire tetramers from the different crystals,
irrespective of whether one or the other substrate was or was
not bound. Again, the ligand-free form revealed essentially
the same conformation for the cofactor site with minor side
chain rearrangements in comparison with the NAD+ -bound form
(results not shown).
Variant
+
+
Wild-type
Y166N
Y166Q
S153T
N119A
N119S
K170R
0.55 0.01
11.4 0.1
218.9 0.1
9.9 0.2
397.9
0.9
0.2
14.9
2.8
12.1
7.6
−
−
+
+
−
−
+
+
108.0 0.1
26.5 0.1
−
−
+
+
2.5 0.2
37.3 0.3
−
−
+
+
5.5 0.1
15.6 0.1
−
−
+
+
4.0 0.2
48.4 0.1
−
−
+
+
1.12 0.02
8.5 0.3
−
−
carbon (Figure 5C). In fact, both anomers coexist with different
occupations, with predominance of occupancy of the β-anomer in
subunits D and L. Correspondingly, in these subunits the hydroxy
group on the C1 of the sugar was able to interact with residues
Ser153 and Tyr166 and with Asn155 (Figure 5D), strongly suggesting
that the β-anomer is the active form of the substrate for proton
transfer to Tyr166. The fact that both anomers coexist with different
occupations indicates that the enzyme does not exhibit a high
selectivity for one or the other anomer.
ManNAc binding does not appear to induce important
conformational changes, as reflected in the low RMSD values
(results not shown) obtained when the structure of the ManNAc
form is superimposed with that of the ligand-free form
(Figure 4F). In fact, the residues at the substrate site are well
aligned for substrate binding even in the substrate-free from of
the enzyme, with only small movements (<0.5 Å) occurring with
some side chains. The most flexible region of the enzyme is the
β4–α4 loop, where movements of up to 2 Å could be observed by
comparing different subunits in the various crystals (results not
shown).
The proton relay tetrad of FspNAMDH
The oxido-reduction reaction catalysed by the enzymes of the
SDR family is believed to rely on the existence of a proton
relay mechanism involving a catalytic Asn-Ser-Tyr-Lys tetrad,
in which the serine and tyrosine resides play critical roles for
activating the O/OH group of the substrate that is the subject
of the reaction, and the lysine and the asparagine play proton
relay roles, supplying or removing protons depending on the
direction of the reaction and ultimately transferring these to
solvent molecules [21]. On the basis of sequence comparisons
and because of their positions in the enzyme active centre, we
identify in FspNAMDH the invariant Tyr166, Ser153 and Lys170, and
the nearly invariant Asn119 (Figure 3), as the four members of
this catalytic tetrad, where the tyrosine and serine residues are
shown by the structure to interact with the hydroxy group of the
anomeric carbon in the subunits in which this carbon is in the β
configuration. The involvement of Lys170 and Asn119 in the proton
relay system is well supported by their position relative to the
purported site of the ribose of the nicotinamide ribosyl moiety
of the NAD+ , and also because they are well placed around an
intraenzymatic solvent reservoir hosting five water molecules that
should act as a proton source/proton sink (Figure 7). Four of the
five water molecules in that reservoir are conserved in equivalent
positions in the corresponding reservoir identified in 3β/17β-
HSD (3β/17β-hydroxysteroid dehydrogenase) [21]. This water-
filled hydrophilic cavity is surrounded by polar groups provided
by conserved amino acids, which include the already mentioned
Lys170 and Asn119, and also Thr21 and Thr123, all of which line
the reservoir with their polar side chains, and Ala93, Gly95 and
Ile151, lining it with their carbonyl main-chain groups, in this
way stabilizing this water-filled cavity and also facilitating proton
transfer among them, as reported for 3β/17β-HSD [21].
NAD+ binding
Non-protein electron density interpreted to correspond to the ADP
moiety of NAD+ was patent in the crystals grown in the pre-
sence of NAD+ (Figure 6A), at the same position observed in
AldT (Figure 6B), in a deep cleft over the β-sheet C-edge at
the N-terminal half of the subunit (Supplementary Figure S2).
The characteristic Rossmann-fold dinucleotide cofactor binding
motif consensus sequence TGXXXGXG [18], starting at Thr21
(Figure 3), is found at the ADP subsite of the NAD+ site, with the
ADP phosphate groups hydrogen bonded to the N atoms of Gly26
and Ile27, within this motif. Other NAD+ -recognizing residues
are also highly conserved, as in other SDR family enzymes, as
can be seen when the NAD+ sites of FspNAMDH and AldT are
compared (Figure 6B). The purine interacts with Asp67 (Asp53 in
AldT) and with the main chain N atom of Leu68 (Val54 in AldT),
and the ring of the base lies flat over the hydrophobic side chains
of Val118 (Val103 in AldT) and Leu68 (Val54 in AldT) (Figure 6C).
Both ribose hydroxy groups are anchored on the protein by bonds
with the side chains of Asp46 and Arg50. The hemiacetalic O atom
interacts with the N atom of Ala96 (Gly82 in AldT).
In further support of the identification of Tyr166, Ser153, Lys170
and Asn119 as the catalytic tetrad of FspNAMDH, site-directed
mutagenesis of these residues resulted in drastic losses in apparent
kcat (that is, the rate extrapolated at infinite concentration of
ManNAc while the NAD concentration was kept at 3 mM) and
even in larger losses in catalytic efficiency of the enzyme (the
ManNAc
kcat/Km
ratio) (Table 2). Even the mild S153T substitution
had a large impact, much more serious than observed for a
similar substitution in 3β/17β-HSD [21], suggesting that in this
case steric clash to accommodate the extra methyl group of
the threonine misplaced the hydroxy group of this residue for
activation of the sugar hydroxy group. This clash is warranted,
given the crowded environment of the Ser153 side chain in
FspNAMDH (results not shown).
Although the nicotinamide moiety of NAD+ was not visible,
possibly because it requires the binding of the second substrate
for good fixation, comparison with AldT suggests that the site
has the same conformation and space to accommodate this part
of the dinucleotide as in AldT (Figure 6B). Thus AldT residues
Lys149 and Tyr145, which bind to the nicotinamide ribose moiety,
align with Lys170 and Tyr166 of FspNAMDH (Figure 6B). In fact,
a water molecule located at the position expected for the hydroxy
group of the ribose mimics the interaction with Lys170 and Tyr166
Final considerations
The present structural studies fully confirm FspNAMDH as
a genuine member of the SDR family, with all the traits
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

Structure of N-acetyl-D-mannosamine dehydrogenase
509
Figure 6 NAD+ -binding site
(A) Electron density map around the bound NAD+ molecule (subunit H). Relevant residues are shown. The 2Fo − Fc electron density map contoured at 1.0 σ is shown as a blue grid and the Fo − Fc
omit electron density map around NAD+ , contoured at 2.5 σ, is illustrated as a red grid. The sticks model is coloured light green and yellow for C atoms of the protein and ligand respectively. P, N
and O atoms are coloured green, blue and red respectively. (B) Stereoview in stick representation superimposing the NAD+ molecule and surrounding residues of AldT (light grey) and FspNAMDH
subunit H (coloured). (C) Stereoview of the cofactor-binding site of FspNAMDH showing the interactions between NAD+ and surrounding residues.
Figure 7 Proton-relay system of FspNAMDH
Surface representation in stereoview showing the hydrophilic pocket with its five enclosed fixed water molecules (cyan spheres). Residues surrounding the pocket are represented in sticks and
labelled.
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

510
A. Sola-Carvajal and others
Figure 8 Variability of the substrate site in the SDR family
Comparison of the FspNAMDH site for ManNAc (A) with several homologues of the SDR family: the mannose site of AldT (PDB code 2DTX) (B); the site of RcSDH (sorbitol dehydrogenase
from R. capsulatus SB1003) (PDB code 1K2W) with sorbitol modelled (theoretical model PDB 1UZO) (C); and the site of RsGDH with erythritol bound (PDB code 3LQF) (D). The enzymes are in
semi-transparent surface representations, and the substrates (labelled) are shown in spheres representation, to highlight the complementarity with the site and to provide insight on the acetamido
group specificity in FspNAMDH. Note that the Glu84 of the AldT is replaced in FspNAMDH by Gly99, which has no side chain, leaving space for fitting in the acetamido group. One face of the ManNAc
molecule is exposed (A), whereas the mannose is completely enclosed (B).
for pertaining to it, including fold, architecture, sequence
conservation and the existence of a catalytic tetrad that reflects
the conservation of the family mechanism for carrying out the
NAD+ /NADH-based oxido/reduction reaction. As is customary
among members of this family [18], the site for the non-
NAD+ substrate is the one exhibiting the highest specialization,
having a structure and residue composition that fully accounts
for the specificity of the enzyme for the N-acetylated form
of mannosamine, mainly on the basis of the encasing of the
acetamido group in a specific binding pocket, and also by using a
bulky firmly fixed tyrosine residue (Tyr208) to make contacts with
the OH group at C4 of the sugar ring and to push the substrate
to having its acetamido group into its highly complementary
encasement. Since residue Tyr208 is not conserved across the SDR
family (Figure 3), it may be an identifying sequence trait for
annotating genuine NAMDH sequences in genomic databases. In
addition, although loop β4–α4 is involved in substrate binding in
many enzymes of the SDR family, it plays an important role in
limiting the size of the substrate-binding pocket. In FspNAMDH,
it hosts a residue without a side chain, Gly99, instead of a bulky
side chain that would have prevented the binding of the acetamido
group of the ManNAc, as in many other enzymes of this family
(Figure 8A). In this respect, Gly99 also appears to be a very
important residue for determining the specificity of the enzyme
for ManNAc, and since it is not conserved in other members
of the family, it might also be used for helping identification of
NAMDH in sequence databases. The importance of this residue
in selecting for a substrate is exemplified by the comparison with
the structure of AldT, where the glycine is replaced by a bulky
glutamate (Glu84) residue, that prevents the access of acetylated
mannosamine, endowing the cavity with the optimal size for
binding the mannose O2 atom (Figure 8B). Further evidence for
the importance of the β4–α4 loop to limit the size of the substrate
that can be bound by the enzyme is provided by the structure of
R. sphaeroides sorbitol dehydrogenase, in which the side chain of
Phe90 also reduces the space available for the substrate to the size
of an open sugar (sorbitol) [3] (Figures 8C). In addition to the role
of the β4–α4 loop, the substrate site can be limited using other
strategies as reported in RsGDH [39]. In this enzyme the substrate
site is divided into two regions: a smaller and a larger one, allowing
the binding of asymmetric substrates composed by a small and a
large substituent, and favouring the binding of linear forms instead
of cyclic ones (Figures 8D). The presence of large substituents
is allowed thanks to the presence of an alanine residue (Ala96) at
the β4–α4 loop, whereas the opposite side of the site is limited
by a hydrophobic cushion composed by bulky side chains (Tyr191
and Trp210). The absence of this cushion in FspNAMDH and the
substitution of the alanine residue in the β4–α4 loop for glycine
enlarges the site allowing the fitting of a substrate with larger
substituents. Thus it appears clear that the β4–α4 loop represents
a key adaptive sequence for expanding/restricting the substrate-
binding site in the SDR family and contributes importantly to the
specificity of each enzyme.
AUTHOR CONTRIBUTION
Agust´ın Sola-Carvajal generated the constructs, produced the protein and together, with
FranciscoGarc´ıa-Carmona, carriedoutthebiochemicalstudies. FernandoGil-Ortizcarried
out the crystallization studies as well as the analysis and interpretation of the structural
´
data. Vicente Rubio and Alvaro Sa´nchez-Ferrer directed the work, analysed the results
and, together with Fernando Gil-Ortiz and Agustın Sola-Carvajal, wrote the paper.
´
ACKNOWLEDGEMENTS
We thank the ESRF and Diamond Light Source synchrotron’s staff for data collection
assistanceandtheEUandEuropeanMolecularBiologyLaboratoryforfundingsynchrotron
visits.
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

Structure of N-acetyl-D-mannosamine dehydrogenase
511
18 Kavanagh, K. L., Jornvall, H., Persson, B. and Oppermann, U. (2008) Medium- and
FUNDING
short-chain dehydrogenase/reductase gene and protein families: the SDR superfamily:
functional and structural diversity within a family of metabolic and regulatory enzymes.
Cell. Mol. Life Sci. 65, 3895–3906 CrossRef PubMed
This study was supported by the Spanish Ministry for Science [grant number MINECO-
FEDER BIO2010-22225-C02-01], the Fundacio´n Se´neca (‘Programa de Ayuda a Grupos
de Excelencia de la Regio´n de Murcia’, 04541/GERM/06, Plan Regional de Ciencia y
Tecnolog´ıa 2007–2010), the Spanish Ministry of Economy and Innovation [grant number
BFU2011-30407] and the Valencian Government [grant number Prometeo/2009/051].
A.S.-C. received a predoctoral research grant from the above project of Grupos de
Excelencia de la Regio´n de Murcia. Synchrotron visits were funded by the European
Community’s Seventh Framework Programme (FP7/2007–2013) under BioStruct-X [grant
agreement 283570].
19 Keller, B., Volkmann, A., Wilckens, T., Moeller, G. and Adamski, J. (2006) Bioinformatic
identification and characterization of new members of short-chain
dehydrogenase/reductase superfamily. Mol. Cell Endocrinol. 248, 56–60
CrossRef PubMed
20 Kallberg, Y., Oppermann, U., Jornvall, H. and Persson, B. (2002) Short-chain
dehydrogenases/reductases (SDRs). Eur. J. Biochem. 269, 4409–4417 CrossRef PubMed
21 Filling, C., Berndt, K. D., Benach, J., Knapp, S., Prozorovski, T., Nordling, E., Ladenstein,
R., Jornvall, H. and Oppermann, U. (2002) Critical residues for structure and catalysis in
short-chain dehydrogenases/reductases. J. Biol. Chem. 277, 25677–25684
CrossRef PubMed
REFERENCES
22 Sola-Carvajal, A., Sa´nchez-Carro´n, G., Garc´ıa-Garc´ıa, M. I., Garc´ıa-Carmona, F. and
´
Sa´nchez-Ferrer, A. (2012) Properties of BoAGE2, a second N-acetyl-D-glucosamine
1
Varki, A. and Schauer, R. (2009) Sialic acids. In Essentials of Glycobiology (Varki, A.,
Cummings, R. D., Esko, J. D., Freeze, H. H., Stanley, P., Bertozzi, C. R., Hart, G. W. and
Etzler, M. E., eds), Chaper 14, Cold Spring Harbor Press, Cold Spring
Harbor, NY
2-epimerase from Bacteroides ovatus ATCC 8483. Biochimie 94, 222–230
CrossRef PubMed
23 Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227, 680–685 CrossRef PubMed
24 Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72,
248–254 CrossRef PubMed
2
Hayakawa, K., De Felice, C., Watanabe, T., Tanaka, T., Iinuma, K., Nihei, K., Higuchi, S.,
Ezoe, T., Hibi, I. and Kurosawa, K. (1993) Determination of free N-acetylneuraminic acid
in human body fluids by high-performance liquid chromatography with fluorimetric
detection. J. Chromatogr. 620, 25–31 CrossRef PubMed
25 Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K. and Pease, L. R. (1989) Site-directed
mutagenesis by overlap extension using the polymerase chain reaction. Gene 77, 51–59
CrossRef PubMed
26 Jancarik, J. and Kim, S.-H. (1991) Sparse matrix sampling: a screening method for
crystallization of proteins. J. Appl. Crystallog. 24, 409–411 CrossRef
27 Collaborative Computational Project, Number 4 (1994) The CCP4 suite: programs for
protein crystallography. Acta Crystallogr. D Biol. Crystallogr. 50, 760–763
CrossRef PubMed
3
4
Narayanan, S. (1994) Sialic acid as a tumor marker. Ann. Clin. Lab. Sci. 24, 376–384
PubMed
Regan˜o´n, E., Vila, V., Mart´ınez-Sales, V., Vaya´, A., Mira, Y., Ferrando, F. and Aznar, J.
(2007) Sialic acid is an inflammation marker associated with a history of deep vein
thrombosis. Thromb. Res. 119, 73–78 CrossRef PubMed
Crook, M. (1993) The determination of plasma or serum sialic acid. Clin. Biochem. 26,
31–38 CrossRef PubMed
Silver, R. P., Finn, C. W., Vann, W. F., Aaronson, W., Schneerson, R., Kretschmer, P. J. and
Garon, C. F. (1981) Molecular cloning of the K1 capsular polysaccharide genes of E. coli.
Nature 289, 696–698 CrossRef PubMed
5
6
28 Kabsch, W. (2010) XDS. Acta Crystallogr. D Biol. Crystallogr. 66, 125–132
CrossRef PubMed
29 Emsley, P. and Cowtan, K. (2004) Coot: model-building tools for molecular graphics. Acta
Crystallogr. D Biol. Crystallogr. 60, 2126–2132 CrossRef PubMed
30 Painter, J. and Merritt, E. A. (2006) Optimal description of a protein structure in terms of
multiple groups undergoing TLS motion. Acta Crystallogr. D Biol. Crystallogr. 62,
439–450 CrossRef PubMed
31 Laskowski, R. A., MacArthur, M. W., Moss, D. S. and Thornton, J. M. (1993) PROCHECK:
a program to check the stereochemical quality of protein structures. J. Appl. Crystallog.
26, 283–291 CrossRef
32 Krissinel, E. and Henrick, K. (2004) Secondary-structure matching (SSM), a new tool for
fast protein structure alignment in three dimensions. Acta Crystallogr. D Biol. Crystallogr.
60, 2256–2268 CrossRef PubMed
33 Gouet, P., Courcelle, E., Stuart, D. I. and Metoz, F. (1999) ESPript: analysis of multiple
sequence alignments in PostScript. Bioinformatics 15, 305–308 CrossRef PubMed
34 Niesen, F. H., Berglund, H. and Vedadi, M. (2007) The use of differential scanning
fluorimetry to detect ligand interactions that promote protein stability. Nat. Protoc. 2,
2212–2221 CrossRef PubMed
35 Sanchez-Carrio´n, G., Garc´ıa-Garc´ıa, M. I., Lo´pez-Rodr´ıguez, A. B., Jime´nez-Garc´ıa, S.,
Sola-Carvajal, A., Garc´ıa-Carmona, F. and Sa´nchez-Ferrer, A. (2011) Molecular
characterization of a novel N-acetylneuraminate lyase from Lactobacillus plantarum
WCFS1. Appl. Environ. Microbiol. 77, 2471–2478 CrossRef PubMed
36 Deng, A., Wu, J., Zhang, G. and Wen, T. (2011) Molecular and structural characterization
of a surfactant-stable high-alkaline protease AprB with a novel structural feature unique to
subtilisin family. Biochimie 93, 783–791 CrossRef PubMed
7
8
9
Schauer, R. (1985) Sialic acids and their roles as biological masks. Trends Biochem. Sci.
10, 357–360 CrossRef
Severi, E., Hood, D. W. and Thomas, G. H. (2007) Sialic acid utilization by bacterial
pathogens. Microbiology 153, 2817–2822 CrossRef PubMed
Vimr, E. R., Kalivoda, K. A., Deszo, E. L. and Steenbergen, S. M. (2004) Diversity of
microbial sialic acid metabolism. Microbiol. Mol. Biol. Rev. 68, 132–153
CrossRef PubMed
10 Almagro-Moreno, S. and Boyd, E. F. (2009) Insights into the evolution of
sialic acid catabolism among bacteria. BMC Evol. Biol. 9, 118
CrossRef PubMed
11 Brigham, C., Caughlan, R., Gallegos, R., Dallas, M. B., Godoy, V. G. and Malamy, M. H.
(2009) Sialic acid (N-acetyl neuraminic acid) utilization by Bacteroides fragilis requires a
novel N-acetyl mannosamine epimerase. J. Bacteriol. 191, 3629–3638
CrossRef PubMed
12 Horiuchi, T. and Kurokawa, T. (1988) Purification and properties of
N-acyl-D-mannosamine dehydrogenase from Flavobacterium sp. 141-8. J. Biochem.
104, 466–471 PubMed
13 Horiuchi, T. and Kurokawa, T. (1990) N-Acetylmannosamine dehydrogenase, process for
its production, method for quantitatively analyzing N-acetylmannosamine or sialic acid,
and kit for the quantitative analysis., U.S. Pat. 4,960,701
14 Yamamoto-Otake, H., Koyama, Y., Horiuchi, T. and Nakano, E. (1991) Cloning,
sequencing, and expression of the N-acyl-D-mannosamine dehydrogenase gene from
Flavobacterium sp. strain 141-8 in Escherichia coli. Appl. Environ. Microbiol. 57,
1418–1422 PubMed
37 Philippsen, A., Schirmer, T., Stein, M. A., Giffhorn, F. and Stetefeld, J. (2005) Structure of
˚
zinc-independent sorbitol dehydrogenase from Rhodobacter sphaeroides at 2.4 A
15 Sola-Carvajal, A., Garc´ıa-Garc´ıa, M. I., Sa´nchez-Carro´n, G., Garc´ıa-Carmona, F. and
´
resolution. Acta Crystallogr. D Biol. Crystallogr. 61, 374–379 CrossRef PubMed
38 Kubota, K., Nagata, K., Okai, M., Miyazono, K., Soemphol, W., Ohtsuka, J., Yamamura, A.,
Saichana, N., Toyama, H., Matsushita, K. and Tanokura, M. (2011) The crystal structure of
L-sorbose reductase from Gluconobacter frateurii complexed with NADPH and
L-sorbose. J. Mol. Biol. 407, 543–555 CrossRef PubMed
39 Carius, Y., Christian, H., Faust, A., Zander, U., Klink, B. U., Kornberger, P., Kohring, G.-W.,
Giffhorn, F. and Scheidig, A. J. (2010) Structural insight into substrate differentiation of
the sugar-metabolizing enzyme galactitol dehydrogenase from Rhodobacter sphaeroides
D. J. Biol. Chem. 285, 20006–20014 CrossRef PubMed
Sa´nchez-Ferrer, A. (2012) Functional assignment of gene AAC16202.1 from Rhodobacter
capsulatus SB1003: new insights into the bacterial SDR sorbitol dehydrogenases family.
Biochimie 94, 2407–2415 CrossRef PubMed
16 Jornvall, H., Persson, B., Krook, M., Atrian, S., Gonzalez-Duarte, R., Jeffery, J. and
Ghosh, D. (1995) Short-chain dehydrogenases/reductases (SDR). Biochemistry 34,
6003–6013 CrossRef PubMed
17 Yasutake, Y., Nishiya, Y., Tamura, N. and Tamura, T. (2007) Structural insights into unique
substrate selectivity of Thermoplasma acidophilum D-aldohexose dehydrogenase. J. Mol.
Biol. 367, 1034–1046 CrossRef PubMed
Received 27 February 2014/26 June 2014; accepted 27 June 2014
Published as BJ Immediate Publication 27 June 2014, doi:10.1042/BJ20140266
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

Biochem. J. (2014) 462, 499–511 (Printed in Great Britain) doi:10.1042/BJ20140266
SUPPLEMENTARY ONLINE DATA
Crystal structures and functional studies clarify substrate selectivity and
catalytic residues for the unique orphan enzyme N-acetyl-D-mannosamine
dehydrogenase
1
1
2
´
Agust´ın SOLA-CARVAJAL* , Fernando GIL-ORTIZ†‡ , Francisco GARCIA-CARMONA*, Vicente RUBIO† and
2
´
´
Alvaro SANCHEZ-FERRER*§
*Department of Biochemistry and Molecular Biology-A, Faculty of Biology, Regional Campus of International Excellence “Campus Mare Nostrum”, University of Murcia, Campus
Espinardo, E-30100 Murcia, Spain
†Instituto de Biomedicina de Valencia-Consejo Superior de Investigaciones Cient´ıficas (IBV-CSIC) and Centro de Investigacio´n Biome´dica en Red de Enfermedades Raras
(CIBERER-ISCIII), Valencia, Spain
‡CELLS-ALBA Synchrotron Light Source, 08290 Barcelona, Spain
§Murcia Biomedical Research Institute (IMIB-Arrixaca), 30120 Murcia, Spain
Figure S2 General view of the FspNAMDH binding sites
View of the substrate sites of FspNAMDH in semi-transparent surface representation. The
secondary structure is shown. The ManNAc and the modelled (by superimposition of the NAD+
complex) ADP portion of NAD+ are represented in spheres. The C-tail surface of the adjacent
subunit is represented in orange.
Figure S1 The FspNAMDH tetramer
The view is along the Q-axis. The four helices at each bundle at the junctions between the
two subunits of both dimers formed around the Q-axis are shown in green. The 14-stranded
molecular β-sheets of the two dimers formed around the P-axis are coloured red.
Figure S3 Helix α6 is substituted by a loop in FspNAMDH
Stereoview of the superimposition (in Cα trace) of FspNAMDH (black) and AldT (green; PDB
code 2DTX) substrate-binding sites. ManNAc is shown in ball and stick representation.
1
These authors contributed equally to this work.
Correspondence may be addressed to either of these authors (rubio@ibv.csic.es or alvaro@um.es).
2
The co-ordinates and structure factors for the FspNAMDH-apo, FspNAMDH–ManNAc and FspNAMDH–NAD crystal structures have been deposited in
the PDB under codes 4CR6, 4CR7 and 4CR8 respectively.
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society

A. Sola-Carvajal and others
Table S1 Oligonucleotides used for site-directed mutagenesis of
FspNAMDH
The mutated codons are underlined.
Oligonucleotide
Sequence 5ꢁ–3ꢁ
N119A-forward
N119A-reverse
N119S-forward
N119S-reverse
S153T-forward
S153Thr-Reverse
Y166N-forward
Y166N-reverse
Y166Q-forward
Y166Q-reverse
K170R-forward
K170R-reverse
CGCTATGTCGACGTCGCCATGACCGGCACCTTC
GAAGGTGCCGGTCATGGCGACGTCGACATAGCG
CCGCTATGTCGACGTCTCCATGACCGGCACCTTCC
GGAAGGTGCCGGTCATGGAGACGTCGACATAGCGG
CGCATCATCACCATCGGCACCGTCAATTCCTTCATGGCC
GGCCATGAAGGAATTGACGGTGCCGATGGTGATGATGCG
GGAGGCGGCCGCCAATGTCGCGGCCAAGG
CCTTGGCCGCGACATTGGCGGCCGCCTCC
GGAGGCGGCCGCCCAAGTCGCGGCCAAGG
CCTTGGCCGCGACTTGGGCGGCCGCCTCC
CTATGTCGCGGCCCGGGGCGGCGTCGCCA
TGGCGACGCCGCCCCGGGCCGCGACATAG
Received 27 February 2014/26 June 2014; accepted 27 June 2014
Published as BJ Immediate Publication 27 June 2014, doi:10.1042/BJ20140266
ꢀ
c
ꢀ
c
The Authors Journal compilation 2014 Biochemical Society