Characterization of a thermostable arginase from Rummeliibacillus pycnus SK31.001

Article abstract of DOI:10.1016/j.molcatb.2016.11.020

L-arginase from Rummeliibacillus pycnus SK31.001 is newly discovered. A 906 bp complete open reading frame, which encodes a 301 amino acid protein, was identified using degenerate PCR and inverse PCR techniques. The arginase was found to have a conserved active site with 6 amino acid residues binding to 2 manganese ions: D123, H125, D228, D230, H100 and D127. Bioinformatics analysis revealed that R. pycnus arginase is a hexamer with a subunit molecular mass of 33 kDa and whole molecular mass of 195 kDa. R. pycnus arginase is thermostable with an optimal temperature of 80 °C and maintains 85% of its initial activity after 24 h of incubation at 40 or 50 °C. An arginase activity assay showed that R. pycnus arginase has an optimum pH of 9.5 and a preference for Mn²⁺. Using arginine as the substrate, the Michaelis-Menten constant (K_m) and catalytic efficiency (k_cat/K_m) were measured to be 0.212 mM and 2970 mM^?1s^?1, respectively. The biosynthesis yield of L-ornithine by the purified enzyme was 144.4 g/L, and the molar yield was 95.2%.

Full text of DOI:10.1016/j.molcatb.2016.11.020

G Model
MOLCAB-3485; No. of Pages8
ARTICLE IN PRESS
Journal of Molecular Catalysis B: Enzymatic xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Journal of Molecular Catalysis B: Enzymatic
journal homepage: www.elsevier.com/locate/molcatb
Characterization of a thermostable arginase from Rummeliibacillus
pycnus SK31.001
Kai Huang, Tao Zhang, Bo Jiang∗, Wanmeng Mu, Ming Miao
State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi 214122, China
a r t i c l e i n f o
a b s t r a c t
Article history:
L-arginase from Rummeliibacillus pycnus SK31.001 is newly discovered. A 906 bp complete open reading
frame, which encodes a 301 amino acid protein, was identified using degenerate PCR and inverse PCR
techniques. The arginase was found to have a conserved active site with 6 amino acid residues binding
to 2 manganese ions: D123, H125, D228, D230, H100 and D127. Bioinformatics analysis revealed that
R. pycnus arginase is a hexamer with a subunit molecular mass of 33 kDa and whole molecular mass of
195 kDa. R. pycnus arginase is thermostable with an optimal temperature of 80 ◦C and maintains 85%
of its initial activity after 24 h of incubation at 40 or 50 ◦C. An arginase activity assay showed that R.
pycnus arginase has an optimum pH of 9.5 and a preference for Mn2+. Using arginine as the substrate, the
Michaelis-Menten constant (Km) and catalytic efficiency (kcat/Km) were measured to be 0.212 mM and
2970 mM−1s−1, respectively. The biosynthesis yield of L-ornithine by the purified enzyme was 144.4 g/L,
and the molar yield was 95.2%.
Received 12 August 2016
Received in revised form 24 October 2016
Accepted 20 November 2016
Available online xxx
Keywords:
Rummeliibacillus pycnus
L-arginase
Degenerate PCR
Inverse PCR
Thermostable
Bioconversion
© 2016 Elsevier B.V. All rights reserved.
1. Introduction
for the monitoring of arginine levels in blood [5] and pharmaceu-
ticals [6]. In plants, the major functions of arginase is nitrogen
L-ornithine is a natural but non-essential amino acid in mam-
mals. This amino acid is an effective reagent in healing wounds,
protecting the liver, relieving stress and improving sleep and
fatigue symptoms [1]. Hence L-ornithine could be used as a
nutritional supplement for bodybuilders and applied to the phar-
maceutical industry. Owing to its multiple useful applications, a
convenient strategy for L-ornithine production is needed.
fixation, which is a crucial step during fruit development [7]. In
bacteria, arginases in Bacillus caldovelox, Helicobacter pylori, Bacil-
lus thuringiensis and Bacillus subtilis have been well characterized
[8]. Studies revealed that most of arginases are homo-oligomers
including trimer, tetramer and hexamer. Furthermore, arginases
have been proved to be metal ion activated enzymes, particular
activated by divalent cations.
Arginase (L-arginine amidinohydrolase, EC 3.5.3.1) is a binuclear
metalloenzyme that hydrolyzes L-arginine to L-ornithine and urea.
This reaction is accomplished by cleaving the guanidine group from
L-arginine. Arginase is considered to be a key enzyme responsible
for the urea cycle for the organisms which contain arginase are
able to carry out the complete urea cycle. Arginase is widely dis-
tributed throughout the biosphere and has been found in a diverse
set of organisms, including animals, plants, fungus and bacteria [2].
In animals, arginase depletes arginine levels by hydrolyzing argi-
nine to inhibit the growth of cancer cells which are auxotrophic for
arginine. It has been reported that site-directed pegylated human
arginase I could be used as anti-cancer and anti-viral agents [3,4].
Moreover, arginase could be a useful bioanalytical tool, allowing
There are three methods for the industrial production of L-
ornithine [9]. Compared to chemical synthesis and fermentative
production, the method using arginase is advantageous owning
to its specificity for the selected reactions, its use of simple appa-
ratuses and procedures, and its tolerance to the co-solvents used
to solubilize substrates with low water solubility [10]. Currently,
arginase applied in L-ornithine biosynthesis is mainly extracted
from animal livers, however this approach would be high cost and
viral contamination [8]. It seems that genetic technology might
be an efficient method to overcome these problems. With the
overexpression of human arginase I and B. caldovelox arginase
gene in Pichia pastoris and Escherichia coli, the production of 149
and 112.3 g/L L-ornithine were obtained [11,12]. Nevertheless, low
enzyme activity and poor stability of these arginases could restrict
the further application of these enzymes. Therefore, a high enzyme
activity and thermostable arginase is needed to be found.
∗
Corresponding author.
E-mail address: bjiang@jiangnan.edu.cn (B. Jiang).
http://dx.doi.org/10.1016/j.molcatb.2016.11.020
1381-1177/© 2016 Elsevier B.V. All rights reserved.
Please cite this article in press as: K. Huang, et al., Characterization of a thermostable arginase from Rummeliibacillus pycnus SK31.001,
J. Mol. Catal. B: Enzym. (2016), http://dx.doi.org/10.1016/j.molcatb.2016.11.020

G Model
MOLCAB-3485; No. of Pages8
ARTICLE IN PRESS
K. Huang et al. / Journal of Molecular Catalysis B: Enzymatic xxx (2016) xxx–xxx
2
Table 1
Bacterial strains, plasmids and primers designed in this study.
Strain, plasmid or primers
Description
Source or reference
strains
R.pycnus SK31.001
E. coli JM 109
wild type
This study
Novagen
recA1, endA1, gyrA96, thi-1, hsdR17(rk-mk−), e14−(mcrA−), supE44,
relA1, ꢀ(lac-proAB)/F’ [traD36, proAB+, lacIq, lacZꢀM15]
hsdS, gal(ꢀcIts857) ind1, Sam7, nin5, lacUV5-T7, gene1
E. coli BL21(DE3)
Novagen
Plasmids
pMD19-T
pET28a
Primers
dF1
dR1
dF2
dR2
iF
TA cloning vector Ampr
T7 promoter, Kanr
Takara
Takara
GGNGTNGAYATGGGNCC
ACNGGNGTNCCNACNCC
GGNAAYATHCAYGGNATGCC
CATYTCCATNGCYAARTG
for degenerate-PCR
for degenerate-PCR
for inverse-PCR
TGCGCCTAAAGTAAAACCTG
iR
TCGCAATACTATGATCACCAC
fF
fR
CGCGGATCCATGGAATCATTAAAAATATCAATGA (BamHI)
CCGCTCGAGTTAAACTAAAGTCTCACCAAATAA (XhoI)
for full-length PCR
Previously, Rummeliibacillus pycnus SK31.001 was isolated from
watermelon planting soil samples by our laboratory. Before this
study, the only genomic information for R. pycnus was its 16S rRNA
sequence. It is the first report regarding the nucleotide and amino
acid sequence of R. pycnus arginase. In this study, arginase encod-
ing gene from R. pycnus SK31.001 was overexpressed in E.coli. This
enzyme displayed considerable activity and significant thermosta-
bility. Kinetic parameters of the enzyme were also determined and
compared to the other arginases. Additionally, high productivity
revealed that this arginase could be a good candidate for L-ornithine
biosynthesis.
fragments were sequenced by Sangon Biotech Company (Shanghai,
China).
2.3. Cloning of the full-length R. pycnus arginase gene by inverse
PCR
The inverse PCR was subsequently used to obtain the flanking
regions [13]. According to the partial sequence encoding R. pycnus
arginase as described above, two primers were designed (Table. 1).
Genomic DNA was digested by HindIII and self-ligated by T4 DNA
ligase at 16 ◦C for 12 h. The circulated DNA fragments were purified
by PCR product purification kit (TaKaRa, Dalian, China). Reaction
system of inverse PCR was composed of 0.5 ␮L of 0.5 U/␮L La Taq
DNA polymerase, 5 ␮L 10 × La Taq buffer, 1 ␮L of 10 mM forward
primer, 1 ␮L of 10 mM reverse primer, 50 ng circulated DNA tem-
plate, and added distill water up to 50 ␮L. A cool start method was
used in the PCR program: initial denaturation at 94 ◦C for 1 min,
denaturation at 98 ◦C for 10 s, annealing at 68 ◦C for 2 min, and final
extension at 72 ◦C for 10 min. The inverse PCR was run for 35 cycles.
The PCR products were checked by gel electrophoresis. Separation
and sequence analysis of the product were as described above.
2. Materials and methods
2.1. Strains, plasmids and media
R. pycnus SK31.001 strain was deposited at China Center for Type
Culture Collection (CCTCC), with an accession number of CCTCC
M2011466. Strains, plasmids and primers used in this study are
listed in Table 1. All chemicals used in this study were purchased
from Sinopharm Chemical Reagent (Shanghai, China). Culturing
conditions for R. pycnus were as described by Zhang et al. [9].
E. coli strains were grown in LB (0.5% yeast extract, 1% trypton,
1% NaCl) supplemented with 100 ␮g/mL kanamycin or 100 ␮g/mL
ampicillin.
2.4. Expression of R. pycnus arginase gene
To express R. pycnus arginase gene, the primers for full-length
amplification were designed according to the result detected above.
Forward and reverse primers carried BamHI and XhoI restriction
sites, respectively. Reaction system of full-length PCR was com-
posed of 0.5 ␮L of 0.5 U/␮L PrimeSTAR DNA polymerase, 25 ␮L
2 × La Taq buffer, 1 ␮L of 10 mM forward primer, 1 ␮L of 10 mM
reverse primer, 50 ng genomic DNA template, and added distill
water up to 50 ␮L. The conditions for PCR amplification were:
denaturation at 95 ◦C for 10 s, annealing at 55 ◦C for 5 s, extension
at 72 ◦C for 10 s. The PCR was run for 35 cycles. Full-length PCR
products were purified and ligated into plasmid pMD19-T. Then,
the constructed plasmid was transformed into E. coli JM109 for
cloning. Vectors carrying the PCR product were extracted and puri-
fied from the E. coli by plasmid mini preparation kit (TaKaRa, Dalian,
China). To confirm that the gene encoding R. pycnus arginase had
been successfully ligated into pMD19-T, the purified plasmids were
used as templates for PCR amplification. Confirmed purified plas-
mids were digested by BamHI and XhoI, and the digests were ligated
into pET28a(+). Recombinant plasmids were transformed into E. coli
BL21 for expression.
2.2. Cloning partial R. pycnus arginase gene
Degenerate PCR was used for partial R. pycnus arginase DNA
amplification. Total genomic DNA was isolated using Genomic
DNA Extraction Kit (TaKaRa, Dalian, China). Highly conversed
areas could be used to design degenerate primers and to clone
the homologs. Amino acid sequences from different microorgan-
isms were downloaded from GeneBank (www.ncbi.nlm.nih.gov)
and blast by DNAMAN program (http://www.lynnon.com). From
the blast result, we found that GVDMPSA, GNIHGM, GVGTPVI
and HLAMEML were the highly conversed motifs. The nucleotide
sequences of degenerate primers were: dF1, dF2, dR1 and dR2,
respectively. Degenerate PCR was performed by using a program
as follows: initial denaturation at 93 ◦C for 3 min, denaturation at
94 ◦C for 30 s, annealing at gradient temperature from 50 to 60 ◦C
for 30 s, extension at 72 ◦C for 1 min, and final extension at 72 ◦C
for 10 min. The PCR was run for 35 cycles. PCR products were
recovered by agarose gel electrophoresis and DNA gel recovery kit
(TaKaRa, Dalian, China). The recovered PCR products were cloned
into pMD19-T and transformed into E. coli JM109. The cloned partial
Please cite this article in press as: K. Huang, et al., Characterization of a thermostable arginase from Rummeliibacillus pycnus SK31.001,
J. Mol. Catal. B: Enzym. (2016), http://dx.doi.org/10.1016/j.molcatb.2016.11.020

G Model
MOLCAB-3485; No. of Pages8
ARTICLE IN PRESS
K. Huang et al. / Journal of Molecular Catalysis B: Enzymatic xxx (2016) xxx–xxx
3
2.5. Protein purification
and stored at −20 ◦C. Protein molecular mass was analyzed by SDS-
PAGE and HPLC [14].
The positive transformants carrying R. pycnus arginase gene
were grown in LB liquid medium containing 50 ␮g/mL kanamycin.
When the absorbance of the bacterial culture reached to 0.6 at
600 nm, isopropyl ␤-d-1-thiogalactopyranoside (IPTG) was added
to the culture medium with a final concentration of 0.5 mM to
induce the expression. Then, further cultured at 28 ◦C for 6 h. Cells
were harvested by centrifugation (8000g, 30 min) and disrupted
by sonication. Cell debris was removed by centrifugation (10,000g,
30 min) and supernatant was incubated in 80 ◦C water for 10 min
to remove partial protein contaminants. Then crude extract was
applied to DEAE Sepharose Fast Flow column pre-equilibrated with
Tris-HCl buffer (50 mM, pH 8.0), and eluted with a linear gradient of
NaCl (0 to 1 M) in the same buffer at a flow rate of 1 mL/min. Frac-
tions showing enzyme activity were pooled and dialyzed against
Tris-HCl buffer (50 mM, pH 8.0). Active fractions were collected
2.6. Enzyme activity assay
Prior to determine the characters of the enzyme, L-arginase was
activated by incubation with 2 mM divalent metal ion for 30 min
at 55 ◦C. Enzyme activity was assayed by determining L-ornithine
produced from L-arginine using HPLC [9]. The reaction mixture con-
tained 100 mM L-arginine in 50 mM NaOH-glycine buffer (pH 9.5),
and the total volume was 1 mL. Reaction was started by adding
20 ␮L enzyme dilution and performed at 80 ◦C for 10 min. Reac-
tion was stopped by adding 200 ␮L of 1.5 M trichloroacetic acid
(TCA). The reaction without adding enzyme dilution was taken as
control. One unit of L-arginase activity was defined as the amount
of enzyme required to generate 1 ␮mol of L-ornithine per minute
under the conditions above. Protein concentration was determined
Fig. 1. Nucleotide sequence of the ORF of R. pycnus arginase gene. Conserved motifs are indicated by gray. Active site and metal binding residues are signified by rectangles
and dots.
Please cite this article in press as: K. Huang, et al., Characterization of a thermostable arginase from Rummeliibacillus pycnus SK31.001,
J. Mol. Catal. B: Enzym. (2016), http://dx.doi.org/10.1016/j.molcatb.2016.11.020

G Model
MOLCAB-3485; No. of Pages8
ARTICLE IN PRESS
K. Huang et al. / Journal of Molecular Catalysis B: Enzymatic xxx (2016) xxx–xxx
4
by the Lowry method [15], and bovine serum albumin was used as
the standard protein.
(671 bp and 369 bp) by NCBI BLASTn indicated that the fragments
belonged to the arginase family. Then, inverse PCR primers were
designed based on the sequenced fragments to amplify upstream
and downstream of the known R. pycnus partial sequence. Before
inverse PCR, genomic DNA must be singly digested by a restriction
enzyme and then self-ligated with T4 DNA ligase. The ideal length
of the digested fragments was 1 to 5 kb. Generally, short circular-
ized double-standed DNA fragments were ideal for amplification by
inverse PCR [16]. We tested 5 restriction enzymes and found that
HindIII was the best restriction enzyme. Circularized HindIII-cut R.
pycnus genomic DNA was used as the template for inverse PCR. The
PCR product was sequenced. Combining the nucleotide sequences
obtained from the degenerate and inverse PCR products generated
the open reading frame (ORF) of R. pycnus arginase (Fig. 1). By align-
ing sequences known to encode arginases in different species using
NCBI BLASTn and BLASTp, the full-length franking regions encoding
R. pycnus arginase were identified. These regions were deposited in
NCBI (GenBank ID: KP702726). The theoretical isoelectric point (pI)
and molecular mass (Mw) of the enzyme were calculated by ExPASy
(www.expasy.org) to be 4.92 and 32439.06 Da, respectively. To
characterize the arginase, the full-length R. pycnus arginase was
PCR-amplified (shown in Fig. 1) and cloned into pET28a(+). So as to
avoid the effect of 6 × His tag on the enzyme characterization, the
tag was not added. The reconstructed plasmid was transformed into
E. coli BL21 (DE3) for expression.
2.7. Optimal pH and effect of metal cofactor
The effect of pH was determined in the range of pH 6.0 to 11.0
using the 50 mM buffer system: NaH2PO4 Na2HPO4 buffer (pH 6.0
to 7.5), Tris-HCl buffer (pH 7.5 to 9.0) and NaOH-glycine buffer (pH
9.0 to 10.5). Activity assay was performed as described above.
The effects of metal ions on L-arginase activity was evaluated
in the presence of different divalent metal ions, each at 2 mM
concentration: Mg2+, Cu2+, Ba2+, Mn2+, Ni2+, Co2+, Ca2+ and Zn2+
.
The reactions were performed at 2 kinds of pH buffer, NaH2PO4-
Na2HPO4 buffer (pH 6.5) and NaOH-glycine buffer (pH 9.5), for each
metal ions. The other conditions were as the same above.
2.8. Optimum temperature and thermal stability
The optimal temperature of L-arginase was obtained by mea-
suring the activity with the standard assay at temperature ranging
from 40 to 90 ◦C. Thermal stability of L-arginase was determined by
incubating the enzyme at 40, 50, 60, 70 and 80 ◦C for different time
intervals. Residual activity was measured under standard enzyme
assay conditions as described above.
2.9. Determination of kinetic parameters
Kinetic parameters of the recombinant enzyme was determined
at 80 ◦C in glycine-NaOH buffer (50 mM, pH 9.5) for different con-
centration substrates (5–100 mM). Reaction was performed for
10 min and terminated by adding 200 ␮L of 1.5 M trichloroacetic
acid (TCA). The Lineweaver-Burk equation was applied to calcu-
late the kinetic constants. Turnover numbers (kcat) were calculated
using a theoretical molecular mass of 33 kDa.
3.2. Sequence analysis
As shown in Fig. 1, the ORF of R. pycnus arginase consists
of 906 bp, which encode 301 amino acid residues. Conserved
sequences were identified from the motifs used to design degener-
ate PCR primers. Based on the published structure of arginase from
B. caldovelox, a three dimensional (3D) homology model was built
using SWISS-MODEL (http://www.swissmodel.expasy.org). Mod-
eling indicated that one manganese ion was in the active site bound
to 4 amino acid residues: D123, H125, D228 and D230. However,
published structure of arginase from a different species shows a
2.10. Optimization of bioconversion conditions
The optimization of bioconversion conditions was based on the
properties of the arginase. To determine the effect of substrate
concentration on the bioconversion, an L-arginine concentration
range from 50 to 300 g/L was used. The amount of L-ornithine
and L-arginine in the mixture was quantified by HPLC after 1 h. To
determine the effect of product concentration on bioconversion, an
L-arginine concentration of 200 g/L and an L-ornithine concentra-
tion range from 0 to 300 g/L was used. Relative productivity was
quantified.
2+
binuclear Mn2 in the active site [17]. We found that the amino
acid residues H100 and D127 were also located in the active site
(shown in Fig. 1). These two residues was suspected to bind with
another manganese ion.
3.3. Protein expression and purification
The vector used in this study was pET28a(+), which contains
a strong recombinant T7 promoter. The full-length arginase gene
sequence was cloned into pET28a(+) and then transformed into
E. coli BL21 (DE3). Recombinant cells were cultivated in LB medium,
and IPTG was added to induce R. pycnus arginase gene expres-
sion. After cultivation in a shake flask at 37 ◦C for 16 h, volumetric
arginase activity was 40.2 U/mL. Cells were harvested by centrifu-
gation and disrupted by sonication. The specific activity of the
purified enzyme was 914 U/mg. The space-time yield was calcu-
lated to be 2.75 mg/L/h. SDS-PAGE analysis showed that the purity
of the eluate was approximately 90%. Additionally, as shown in
Fig. 2a, this protein was highly thermostable, and considerable pro-
tein contaminants were removed during heat treatment at 80 ◦C
for 10 min. Heat treatment might be the most convenient way to
partially purify recombinant arginase. SDS-PAGE analysis yielded a
protein band at 33 kDa, which coincided with the protein’s pre-
dicted molecular mass of 32439.06 Da. As shown in Fig. 2b, the
whole molecular mass of the recombinant arginase was estimated
to be 195 kDa by gel-filtration chromatography using HPLC.
2.11. Bioconversion of L-ornithine by the recombinant enzyme
Bioconversion of L-ornithine was determined under optimal
conditions. The conversion mixture (2 L) contained 200 g/L L-
arginine and 10 U/mL of purified enzyme. The final concentrations
of Mn2+ were 2 mM. The conversion was performed in a shaking
water bath at pH 9.5 and 40 ◦C for 8 h. The product and substrate
were analyzed by HPLC.
3. Results
3.1. Cloning of the full-length R. pycnus arginase gene
Conserved motifs were used to design degenerate primers,
which were used to clone a partial gene encoding arginase in R.
pycnus. Amino acid sequences from different microorganisms were
downloaded from GenBank (www.ncbi.nlm.nih.gov) and BLASTed
using DNAMAN to identify conserved motifs. Degenerated PCR
products were sequenced. Analysis of the two sequenced fragments
Please cite this article in press as: K. Huang, et al., Characterization of a thermostable arginase from Rummeliibacillus pycnus SK31.001,
J. Mol. Catal. B: Enzym. (2016), http://dx.doi.org/10.1016/j.molcatb.2016.11.020

G Model
MOLCAB-3485; No. of Pages8
ARTICLE IN PRESS
K. Huang et al. / Journal of Molecular Catalysis B: Enzymatic xxx (2016) xxx–xxx
5
activity sharply dropped. At least 60% of the optimal activity was
detected for temperature between 40 and 85 ◦C. Interestingly, the
enzyme retained activity even at 90 ◦C. The enzyme showed great
thermal stability between 40 and 50 ◦C, retaining at least 85% of its
activity for 24 h (Fig. 3d). However, no more than 60% activity was
remained after 30 min, 1 h and 15 h at 80, 70 and 60 ◦C, respectively.
3.6. Determination of kinetic parameters
Steady-state kinetic constants were determined for the arginase
with L-arginine as the substrate using Lineweaver–Burk plots.
Kinetic parameters for the recombinant enzyme were determined
at 80 ◦C in glycine-NaOH buffer (50 mM, pH 9.5) for differ-
ent substrate concentrations (5–100 mM). As shown in Table. 2,
the Km and the Vmax values were determined to be 0.212 mM
and 1111 U/mg, respectively. Using a theoretical molecular mass
of 33 kDa, the turnover number (kcat) was calculated to be
629.6 s−1. The catalytic efficiency (kcat/ Km) was calculated to be
2970 mM−1s−1
.
3.7. Optimization of bioconversion conditions
In this study, concentration of L-arginine ranging from 50
to 300 g/L in the bioconversion was investigated. Productivity
improved with increasing L-arginine. As shown in Fig. 4a, after 1 h,
62.1 g/L L-ornithine was obtained when the initial substrate con-
centration was 250 g/L, whereas 35.2 g/L L-ornithine was obtained
when the initial substrate concentration was 50 g/L.
According to the previous study, the activity of arginase was
inhibited by a high L-ornithine concentration. As shown in Fig. 4b,
the Ki(L-ornithine) (50% inhibition on bioconversion with proper L-
ornithine concentration) was determined to be 182 g/L. Combined
with the results of effect of L-arginine and L-ornithine concentra-
tion, a concentration of L-arginine maintained at 150–250 g/L was
more suitable for high productivity of L-ornithine.
3.8. Bioconversion under optimum conditions
The bioconversion was conducted in a 2 L reactor. The mix-
ture contained 200 g/L L-arginine, 10 U/mL purified enzyme and
2 mM Mn2+. Reaction mixture was incubated at pH 9.5 and 40 ◦C.
As shown in Fig. 5, after 6 h, almost all the substrate had been con-
verted into the product and 144.4 g/L product was obtained. The
molar yield was calculated to be 95.2%, which was higher than the
reported record from calf liver and B. thuringiensis [25], with nearly
9.6 g/L L-arginine residue.
Fig. 2. Molecular mass determination. a Protein profiles. lane 1 purified enzyme,
lane 2 heat treated at 80 ◦C for 10 min, lane 3 heat treated at 80 ◦C for 20 min, lane
4 crude enzyme, lane M middle range maker. b whole molecular mass determina-
tion by HPLC. Marker proteins (670 kDa thyroglobulin; 158 kDa ␥-globulin; 44 kDa
ovalbumin; 17 kDa myohemoglobin; 1.35 kDa vitamin B12).
3.4. Optimal pH and metal cofactor
R. pycnus arginase exhibited optimal activity at a pH of 9.5. As
shown in Fig. 3a, the enzyme showed no more than 30% resid-
ual activities under acidic conditions whereas showed more than
70% residual activities with a relatively broad pH spectrum from
7.0 to 10.5. To investigate the effect of metal ions, the activity of
purified arginase was assayed at pH 6.5 and 9.5 in the presence of
different divalent metal ions. Arginase is a typical metalloenzyme
that requires metal ions to maintain its stable native state [2]. As
shown in Fig. 3b, similar well characterized animal and bacterial
arginases, R. pycnus arginase exhibited the highest enzyme activ-
ity when incubated with Mn2+ at pH 9.5. It was also found that
Mg2+ could enhance arginase activity, increasing catalytic activity
approximately 3-fold. Unexpectedly, enzyme activity was 4-fold
higher when Ni2+ was added at pH 6.5. Co2+ significantly increased
activity at both pH 6.5 and 9.5.
4. Discussion
Before this study, the only genomic information for R. pyc-
nus was its 16S rRNA sequence. This is the first report regarding
the nucleotide and amino acid sequence of R. pycnus arginase.
Several primers for the R. pycnus arginase were designed based
on sequences from homologous species, but these primers all
failed to amplify the correct gene. Nevertheless, BLAST analysis of
nucleotide sequences from Bacillus genera revealed that arginases
possess highly conserved motifs [23]. Primers for degenerate PCR
were therefore designed from these conserved motifs. Sequences
upstream and downstream of the R. pycnus arginase gene were
obtained by inverse PCR as described by Kataoka et al. [28]. Com-
pared with conventional methods [16], this method is simple and
reliable. The strategy for amplifying R. pycnus arginase DNA uses
degenerate PCR and inverse PCR, generalizing the technology used
for screening of unknown genes.
3.5. Optimum temperature and thermal stability
As shown in Fig. 3c, the optimal temperature of the recombinant
enzyme was determined to be 80 ◦C. At temperatures above 80 ◦C,
The R. pycnus arginase was 65% identical to the published B. cal-
dovelox arginase sequence (AAB06939). Furthermore, the R. pycnus
Please cite this article in press as: K. Huang, et al., Characterization of a thermostable arginase from Rummeliibacillus pycnus SK31.001,
J. Mol. Catal. B: Enzym. (2016), http://dx.doi.org/10.1016/j.molcatb.2016.11.020

G Model
MOLCAB-3485; No. of Pages8
ARTICLE IN PRESS
K. Huang et al. / Journal of Molecular Catalysis B: Enzymatic xxx (2016) xxx–xxx
6
Fig. 3. Effect of pH, metal ions and temperature. a Effect of pH on the activity of R. pycnus arginase. The buffers were NaH2PO4-Na2HPO4 buffer (pH 6.0 to 7.5), Tris-HCl buffer
(pH 7.5 to 9.0) and NaOH −glycine buffer (pH 9.0 to 10.5). b Metal effect on the activity of R. pycnus arginase. The effect of each divalent metal ion was performed under 2
kind of buffers: NaH2PO4-Na2HPO4 buffer (pH 6.5) and NaOH −glycine buffer (pH 9.5). c Effect of temperature. Enzyme activity was assay at temperatures ranging from 40
to 90 ◦C. d Thermal stability of R. pycnus arginase. The enzyme was incubated at different temperature (40 ᭿,50 ᭹, 60 ꢀ,70 ꢁ,80 ꢂ)for different time intervals.
Table 2
Comparison of kinetic paramrters of arginase from various species.
Organisms
pH
Metal ion
Km (mM)
Vmax (U/mg)
kcat (s−1
)
kcat /Km (mM−1s−1
)
References
R. pycnus
human liver
Rat liver
9.5
8.5
9.8
9.5
8.5
9.5
6.4
9.5
9.5
10.0
9.0
10.0
Mn2+
Mn2+
Mn2+
Mn2+
Mn2+
Mn2+
Co2+
0.212
2.3
1.58
0.95
13
15.7
23
3.4
1111
NR
69.4
NR
629.6
300
30
116.7
96
NR
NR
3000
656.6
NR
2970
129
10.9
122.8
7.4
NR
NR
882
3.8
NR
This study
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
Beef liver
Plasmodium falciparum
S. cerevisiae
H. pylori
B. caldovelox
G. thermodenitrificans
B. subtilis
NR
885
155
4400
1194
NR
Mn2+
Mn2+
Mn2+
Ni2+
171.9
13.5
10
[26]
[27]
[9]
B. anthracis
B. thuringiensis
3
526
NR
NR
NR
NR
Mn2+
14.6
NR: not reported.
arginase gene was 62%, 45%, 36% and 22% identical to the published
arginase sequences from Bacillus thuringiensis (AJI37018), Thermus
thermophiles (WP 038039155), Human arginase I (2AEB) and Heli-
cobacterpylori(ABO15436), respectively[25]. Themajordifferences
between eukaryotic and bacterial arginases occur in extensions at
the C and N termini; the active sites of eukaryotic and bacterial
arginases are largely similar. A 3D homology model of the R. pyc-
nus arginase was built based on the published B. caldovelox arginase
[17]. The active site is created by two long loops of residues 125–142
and 230–248, with the catalytic manganese ions (Mn22+) are at the
bottom of the active site cavity. Compared with the Mn2+ bound to
H100, the Mn2+ bound to H125 is closer to the surface and more
exposed to the external solvent. It has been reported that second-
shell residues could affect the geometry of the active site with
respect to positioning of the manganese ligands [24]. Changes in
geometry may affect water coordination and metal release [17].
Please cite this article in press as: K. Huang, et al., Characterization of a thermostable arginase from Rummeliibacillus pycnus SK31.001,
J. Mol. Catal. B: Enzym. (2016), http://dx.doi.org/10.1016/j.molcatb.2016.11.020

G Model
MOLCAB-3485; No. of Pages8
ARTICLE IN PRESS
K. Huang et al. / Journal of Molecular Catalysis B: Enzymatic xxx (2016) xxx–xxx
7
Arginases are homo-oligomers consisting of typical 32–34 kDa
subunits. In general, eukaryotic arginases are trimeric, while bac-
terial arginases are hexameric [2]. The molecular mass of the full
R. pycnus arginase complex indicated that the protein is a hex-
amer. The size of the R. pycnus arginase was similar to the sizes
of arginases from Bacillus thuringiensis and B. caldovelox [9,24].
The optimal pH of the R. pycnus arginase is similar to most
arginases, exception of the arginase from H. pylori and arginase I
with Co2+, which both exhibited optimal activities at alkaline con-
ditions with a wide range pH spectrum from 7.0 to 10.5 [23,29]. In
this study, an arginase from Bacillus genera was found that could
maintain a high enzyme activity with Ni2+ at low pH other than at
the optimal pH 9.5 with Mn2+. Though Bacillus anthracis arginase
could remain active at pH 6.3 with Ni2+, the activity of is quite low
[27]. Previously, Abhishek et al. reported that the low optimal pH
for H. pylori might due to its possession of a unique 13-residue
sequence motif [23]. The pH shift in R. pycnus arginase is similar to
Human arginase I with Co2+ but different from H. pylori arginase.
The metal ligand bonds are asymmetrical, furthermore, the metal
ligand lengths would change accordingly when the pH changed.
This will lead to modification in metal selectivity while remain
enzyme active at different pH [29].
Currently, the main strategy for L-ornithine production via
enzyme hydrolysis uses beef liver L-arginase. The optimal temper-
ature of beef liver L-arginase is 37 ◦C, and its t1/2 is less than 100 min
at its optimal temperature [20]. A thermostable arginase, such as
the arginase produced by the extreme thermophile B. caldovelox,
has a t1/2 = 107 min at 60 ◦C without any additives (bovine serum
albumin) [24]. Compared with the B. caldovelox arginase and the
beef liver L-arginase, the R. pycnus arginase had a higher optimal
temperature and significantly higher thermal stability. Gener-
ally, industrial applications for enzymatic L-ornithine production
require a thermophilic arginase with relatively high optimum tem-
perature. L-arginine hydrolysis performed at higher temperature
may improve the reaction rate and prevent the reaction mixture
from being biologically contaminated. The optimal temperature
of R. pycnus arginase was determined to be 80 ◦C. This significant
high optimal temperature could obviously certify its application
in L-ornithine biosynthesis at the range of 40–70 ◦C. Moreover,
such high optimal temperature suggested that this arginase had
a high structural stability. More than 85% and 60% enzyme activ-
ity was remained after incubating at 40–50 and 60 ◦C for 24 and
15 h, respectively. This enzyme revealed promising thermal stabil-
ity which could maintain high enzyme efficiencies for production.
Based on its kinetic parameters and quaternary structure,
R. pycnus arginase is a typical ureotelic L-arginase [2]. The Km
value of the enzyme was lower than other arginases from other
organisms (Table 2), including S. cerevisiae (15.7 mM), B. anthracis
(10 mM), B. caldovelox (3.4 mM), human liver (2.3 mM) and beef
liver (0.95 mM). The lower Km value of R. pycnus arginase indicates
that the enzyme has a greater affinity for the substrate (L-arginine).
In addition, the catalytic efficiency of R. pycnus arginase was rela-
tively high, approximately 3- and 60-fold higher than B. caldovelox
and human liver arginase I, respectively.
Fig. 4. Optimization of bioconversion. Bioconversion was carried out under a stan-
dard mixture at 40 ◦C. a Optimization of the concentration of substrate. b Effect of
L-ornithine concentration on bioconversion. The group with zero initial concentra-
tion of L-ornithine is defined as the control.
In this study, it was found that L-ornithine had a lower inhi-
bition effect on this recombinant arginase compared with the
precious reports [8]. Moreover, the optimal concentration of sub-
strate ranging 150 to 250 g/L made this enzyme suitable for high
L-ornithine production. The highest production rate of L-ornithine
was reported by Song et al. [11]. However, the high concentration
of residual L-arginine (more than 30 g/L) made the product separa-
tion complex. Here, 144.4 g/L L-ornithine was obtained within 6 h,
with only 9.2 g/L substrate residue, which demonstrated it to be an
efficient L-ornithine production method.
Fig. 5. Bioconversion for L-ornithine production (L-ornithine ᭹, L-arginine ᭿). The
conversion was performed in a shaking water bath at pH 9.5 and 40 ◦C for 8 h.
In conclusion, the R. pycnus arginase was successfully cloned
using degenerate PCR and inverse PCR techniques, and the nuclear
Please cite this article in press as: K. Huang, et al., Characterization of a thermostable arginase from Rummeliibacillus pycnus SK31.001,
J. Mol. Catal. B: Enzym. (2016), http://dx.doi.org/10.1016/j.molcatb.2016.11.020

G Model
MOLCAB-3485; No. of Pages8
ARTICLE IN PRESS
K. Huang et al. / Journal of Molecular Catalysis B: Enzymatic xxx (2016) xxx–xxx
8
and amino acid sequences was firstly reported. R. pycnus arginase
showed significant thermostability and high enzyme activity at its
optimal pH with Mn2+. Kinetic study showed that this enzyme had
higher catalytic efficiency than other arginases reported. Low inhi-
bition of product and high productivity made R. pycnus arginase
could be applied in high L-ornithine biosynthesis.
[12] X. Zhang, J. Liu, X. Yu, F. Wang, L. Yi, Z. Li, Y. Liu, L. Ma, High-level expression
of human arginase I in Pichia pastoris and its immobilization on chitosan to
produce L-ornithine, BMC Biotechnol. 15 (1) (2015) 1–10.
[13] J. Houghton-Larsen, P.A. Pedersen, Cloning and characterisation of a
glucoamylase gene (GlaM) from the dimorphic zygomycete Mucor
circinelloides, Appl. Microbiol. Biotechem. 62 (2–3) (2003) 210–217.
[14] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head
of bacteriophage T4, Nature 227 (5259) (1970) 680–685.
[15] O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall, Protein measurement with
the Folin phenol reagent, J. Biol. Chem. 193 (1) (1951) 265–275.
[16] Y. Han, L. Chen, L. Guan, S. He, Inverse PCR-based method for isolating novel
SINEs from genome, Mol. Biotechnol. 56 (4) (2014) 296–304.
[17] M.C. Bewley, P.D. Jeffrey, M.L. Patchett, Z.F. Kanyo, E.N. Baker, Crystal
structures of Bacillus caldovelox arginase in complex with substrate and
inhibitors reveal new insights into activation, inhibition and catalysis in the
arginase superfamily, Structure 7 (4) (1999) 435–448.
Competing interests
The author(s) declare that they have no competing interests.
Acknowledgements
[18] E.M. Stone, E.S. Glazer, L. Chantranupong, P. Cherukuri, R.M. Breece, D.L.
Tierney, S.A. Curley, B.L. Iverson, G. Georgiou, Replacing Mn2+ with Co2+ in
human arginase I enhances cytotoxicity toward L-arginine auxotrophic
cancer cell lines, ACS Chem. Biol. 5 (3) (2010) 333–342.
[19] S. Maggini, F.B. Stoecklin-Tschan, S. Morikofer-Zwez, P. Walter, New kinetic
parameters for rat liver arginase measured at near-physiological steady-state
concentrations of arginine and Mn2+, Biochem. J. 283 (1992) 653–660.
[20] E.e. Dala, B. Szaj’ani, Immobilization, characterization, and laboratory-scale
application of bovine liver arginase, Appl. Biochem. Biotechnol. 49 (3) (1994)
203–215.
[21] D.P. Dowling, M. Ilies, K.L. Olszewski, S. Portugal, M.M. Mota, M. Llinás, D.W.
Christianson, Crystal structure of arginase from Plasmodium falciparum and
implications for L-arginine depletion in malarial infection, Biochemistry 49
(26) (2010) 5600–5608.
[22] S.M. Green, E. Eisenstein, P. McPhie, P. Hensley, The purification and
characterization of arginase from Saccharomyces cerevisiae, J. Biol. Chem. 265
(3) (1990) 1601–1607.
[23] A. Srivastava, S.K. Meena, M. Alam, S.M. Nayeem, S. Deep, A.K. Sau, Structural
and functional insights into the regulation of Helicobacter pylori arginase
activity by an evolutionary nonconserved motif, Biochemistry 2 (3) (2013)
508–519.
[24] M.L. Patchett, R.M. Daniel, H.W. Morgan, Characterisation of arginase from the
extreme thermophile ‘Bacillus caldovelox’, BBA-Proteins Proteom. 077 (3)
(1991) 291–298.
[25] H. Kai, M. Wanmeng, Z. Tao, J. Bo, M. Ming, Cloning, expression, and
characterization of a thermostable L-arginase from Geobacillus
thermodenitrificans NG80-2 for L-ornithine production, Biotechnol. Appl.
Biochem. 63 (9) (2015) 737–740.
[26] J.J. Yu, K.B. Park, S.G. Kim, S.H. Oh, Expression, purification, and biochemical
properties of arginase from Bacillus subtilis 168, J. Microbiol. 51 (2) (2013)
222–228.
This work was financially supported by the 863 project of China
(No. 2013AA102102) and the Fundamental Research Funds for the
Central Universities (SKLF-ZZA-201509).
References
[1] K. Nakazawa, T. Nemoto, T. Hata, Y. Seyama, S. Nagahara, A. Sano, H. Itoh, Y.
Nagai, S. Kubota, Single-injection ornithine decarboxylase-directed antisense
therapy using atelocollagen to suppress human cancer growth, Cancer 109 (5)
(2007) 993–1002.
[2] C.P. Jenkinson, W.W. Grody, S.D. Cederbaum, Comparative properties of
arginases, COMP Biochem. Phys. B 114 (1) (1996) 107–132.
[3] T.Y.C. Leung, T.W.H. Lo, Site-directed pegylation of arginases and the use
thereof as anti-cancer and anti-viral agents, Google Patents, 2012.
[4] I. Minten, N. Abello, M.F. Schooneveld-Bergmans, M. van den Berg,
Post-production modification of industrial enzymes, Appl. Microbiol. Biot. 98
(14) (2014) 6215–6231.
[5] N.E. Stasyuk, G.Z. Gaida, M.V. Gonchar, L-arginine assay with the use of
arginase I, Appl. Microbiol. Biotechem. 9 (5) (2013) 529–534.
[6] R.H. Böger, S.M. Bode-Böger, The clinical pharmacology of L-arginine, Annu.
Rev. Pharmacol. 41 (1) (2001) 79–99.
[7] C.D. Todd, J.E.K. Cooke, D.J. Gifford, Purification and properties of Pinus taeda
arginase from germinated seedlings, Plant Physiol. Biochem. 39 (12) (2001)
1037–1045.
[8] M. Wang, M. Xu, Z. Rao, T. Yang, X. Zhang, Construction of a highly efficient
Bacillus subtilis 168 whole-cell biocatalyst and its application in the
production of L-ornithine, J. Ind. Microbiol. Biotechnol. 2 (11) (2015)
1427–1437.
[9] T. Zhang, Y. Guo, H. Zhang, W. Mu, M. Miao, B. Jiang, Arginase from Bacillus
thuringiensis SK 20.001: Purification, characteristics, and implications for
L-ornithine biosynthesis, Process Biochem. 48 (4) (2013) 663–668.
[10] Y.P. Zhan, J.Z. Liu, P.T. Mao, H.J. Zhang, Q. Liu, Q.C. Jiao, Biotransformation of
L-ornithine from L-arginine using whole-cell recombinant arginase, World J.
Microb. Biotechem. 9 (11) (2013) 2167–2172.
[11] W. Song, P. Niu, X. Chen, L. Liu, Enzymatic production of L-ornithine from
L-arginine with recombinant thermophilic arginase, J. Mol. Catal. B-Enzym.
110 (2014) 1–7.
[27] R. Viator, R. Rest, E. Hildebrandt, D. McGee, Characterization of Bacillus
anthracis arginase: effects of pH, temperature, and cell viability on metal
preference, BMC Biochem. 9 (1) (2008) 1–14.
[28] M. Kataoka, A.R.G. Delacruz-Hidalgo, M.A. Akond, E. Sakuradani, K. Kita, S.
Shimizu, Gene cloning and overexpression of two conjugated polyketone
reductases, novel aldo-keto reductase family enzymes, of Candida
parapsilosis, Appl. Microbiol. Biotechem. 64 (3) (2004) 359–366.
[29] T. Marino, N. Russo, M. Toscano, What occurs by replacing Mn2+ with Co2+ in
human arginase I: first-principles computational analysis, Inorg. Chem. 52 (2)
(2013) 655–659.
Please cite this article in press as: K. Huang, et al., Characterization of a thermostable arginase from Rummeliibacillus pycnus SK31.001,
J. Mol. Catal. B: Enzym. (2016), http://dx.doi.org/10.1016/j.molcatb.2016.11.020