Identification and characterization of small molecule inhibitors of the ubiquitin ligases Siah1/2 in melanoma and prostate cancer cells

Article abstract of DOI:10.1016/j.canlet.2019.02.012

Inhibition of ubiquitin ligases with small molecule remains a very challenging task, given the lack of catalytic activity of the target and the requirement of disruption of its interactions with other proteins. Siah1/2, which are E3 ubiquitin ligases, are implicated in melanoma and prostate cancer and represent high-value drug targets. We utilized three independent screening approaches in our efforts to identify small-molecule Siah1/2 inhibitors: Affinity Selection-Mass Spectrometry, a protein thermal shift-based assay and an in silico based screen. Inhibitors were assessed for their effect on viability of melanoma and prostate cancer cultures, colony formation, prolyl-hydroxylase-HIF1α signaling, expression of selected Siah2-related transcripts, and Siah2 ubiquitin ligase activity. Several analogs were further characterized, demonstrating improved efficacy. Combination of the top hits identified in the different assays demonstrated an additive effect, pointing to complementing mechanisms that underlie each of these Siah1/2 inhibitors.

Full text of DOI:10.1016/j.canlet.2019.02.012

Accepted Manuscript
Identification and characterization of small molecule inhibitors of the ubiquitin ligases
Siah1/2 in melanoma and prostate cancer cells
Yongmei Feng, E. Hampton Sessions, Fan Zhang, Fuqiang Ban, Veronica Placencio-
Hickok, Chen-Ting Ma, Fu-Yue Zeng, Ian Pass, David B. Terry, Gregory Cadwell,
Laurie A. Bankston, Robert C. Liddington, Thomas D.Y. Chung, Anthony B. Pinkerton,
Eduard Sergienko, Martin Gleave, Neil Bhowmick, Michael R. Jackson, Artem
Cherkasov, Ze’ev A. Ronai
PII:
S0304-3835(19)30084-9
https://doi.org/10.1016/j.canlet.2019.02.012
CAN 14242
DOI:
Reference:
To appear in: Cancer Letters
Received Date: 19 October 2018
Revised Date: 10 December 2018
Accepted Date: 10 February 2019
Please cite this article as: Y. Feng, E.H. Sessions, F. Zhang, F. Ban, V. Placencio-Hickok, C.-T. Ma, F.-
Y. Zeng, I. Pass, D.B. Terry, G. Cadwell, L.A. Bankston, R.C. Liddington, T.D.Y. Chung, A.B. Pinkerton,
E. Sergienko, M. Gleave, N. Bhowmick, M.R. Jackson, A. Cherkasov, Z.’e.A. Ronai, Identification and
characterization of small molecule inhibitors of the ubiquitin ligases Siah1/2 in melanoma and prostate
cancer cells, Cancer Letters, https://doi.org/10.1016/j.canlet.2019.02.012.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT
Abstract
Inhibition of ubiquitin ligases with small molecule remains a very challenging task, given the
lack of catalytic activity of the target and the requirement of disruption of its interactions with
other proteins. Siah1/2, which are E3 ubiquitin ligases, are implicated in melanoma and prostate
cancer and represent high-value drug targets. We utilized three independent screening
approaches in our efforts to identify small-molecule Siah1/2 inhibitors: Affinity Selection-Mass
Spectrometry, a protein thermal shift-based assay and an in silico based screen. Inhibitors were
assessed for their effect on viability of melanoma and prostate cancer cultures, colony formation,
prolyl-hydroxylase-HIF1α signaling, expression of selected Siah2-related transcripts, and Siah2
ubiquitin ligase activity. Several analogues were further characterized, demonstrating improved
efficacy. Combination of the top hits identified in the different assays demonstrated an additive
effect, pointing to complementing mechanisms that underlie each of these Siah1/2 inhibitors.

ACCEPTED MANUSCRIPT
Identification and characterization of small molecule inhibitors of the ubiquitin ligases
Siah1/2 in melanoma and prostate cancer cells
1
1
2
2
Yongmei Feng , E. Hampton Sessions , Fan Zhang , Fuqiang Ban , Veronica Placencio-
3
1
1
1
1
1
Hickok , Chen-Ting Ma , Fu-Yue Zeng , Ian Pass , David B. Terry , Gregory Cadwell ,
1
1
1
1
Laurie A. Bankston , Robert C. Liddington , Thomas D.Y. Chung , Anthony B. Pinkerton ,
1
2
3
1
Eduard Sergienko , Martin Gleave , Neil Bhowmick , Michael R. Jackson , Artem
2
1
Cherkasov , Ze’ev A. Ronai
1
Cancer Center, Sanford Burnham Prebys Medical Discovery Institute, La Jolla, CA 92037,
2
USA, Vancouver Prostate Centre and Department of Urologic Sciences, University of
3
British Columbia, Vancouver, British Columbia, Canada, Department of Medicine, Cedars-
Sinai Medical Center, Los Angeles, CA 90048, USA.
Correspondence – Ze’ev Ronai (zeev@ronailab.net)

ACCEPTED MANUSCRIPT
Abstract
Inhibition of ubiquitin ligases with small molecule remains a very challenging task, given the
lack of catalytic activity of the target and the requirement of disruption of its interactions with
other proteins. Siah1/2, which are E3 ubiquitin ligases, are implicated in melanoma and
prostate cancer and represent high-value drug targets. We utilized three independent
screening approaches in our efforts to identify small-molecule Siah1/2 inhibitors: Affinity
Selection-Mass Spectrometry, a protein thermal shift-based assay and an in silico based
screen. Inhibitors were assessed for their effect on viability of melanoma and prostate cancer
cultures, colony formation, prolyl-hydroxylase-HIF1α signaling, expression of selected
Siah2-related transcripts, and Siah2 ubiquitin ligase activity. Several analogues were further
characterized, demonstrating improved efficacy. Combination of the top hits identified in the
different assays demonstrated an additive effect, pointing to complementing mechanisms that
underlie each of these Siah1/2 inhibitors.
Keywords
Siah1, Siah2, ubiquitin ligase, melanoma, prostate cancer
Abbreviations
HIF1α – hypoxia inducible factor 1 alpha
NCOR1 – Nuclear co-repressor 1
ATF4 – activating transcription factor 4
PHYL – phyllopod
RLS – Ronai Lab Siah inhibitor
CFE – colony forming efficiency

ACCEPTED MANUSCRIPT
1
. Introduction
Ubiquitin ligases limit the stability and activity of substrates by targeting them for
proteasomal-dependent degradation. Siah is a two-member family of ubiquitin ligases
implicated in control of key cellular processes. Among those, Siah ligases control prolyl
hydroxylases, which regulate HIF1α and ATF4 stability [1-3]. Inhibition of Siah1/2
attenuates expression of HIF1α, resulting in attenuated tumor development and metastasis in
melanoma [4] and inhibits neuroendocrine (NE) prostate tumor development [4, 5]. Through
its regulation of the co-repressor NCOR1, Siah2 controls transcription of select androgen
receptor-regulated genes that contribute to development of hormone refractory prostate
cancers (PCa) [6]. Siah2 also determines ATF4 levels with a concomitant effect on cell death
programs following stress, as occurs in ischemic conditions [3]. Moreover, Siah2 is
implicated in control of mitochondrial fission, which impacts cell death under stress
conditions, such as those associated with heart infarction [7]. In all cases, blocking Siah
activity appears to alleviate pathological conditions – from ischemia to tumor development
and metastasis – making it a high value drug target.
There have been numerous attempts to inhibit Siah2 ubiquitin ligase activity, including
application of a meso-scale-based screening that led to identification of menadione [8]. A
structure-based approach enabled identification of short peptides that covalently bind Siah2
and inhibit its ubiquitin ligase activity [9]. The crystal structure of Siah2-bound peptides has
been solved, revealing a newly defined structural pocket. Siah2 inhibitory peptides were
found to significantly suppress Siah2 ubiquitin ligase activity in cell culture and in vitro [9].
Yet, the utilization of such peptides has been largely limited to cultures, limiting further
characterization in vivo.
We undertook three independent screening approaches to identify prospective Siah1/2
inhibitors, on the assumption that each strategy might reveal different classes of compounds.
Using these approaches, we succeeded in identifying small molecule Siah1/2 inhibitors that
could provide the foundation for further development of small molecules that disrupt the
ubiquitin ligase activities of Siah1/2.
2
. Materials and Methods

ACCEPTED MANUSCRIPT
Purification of GST-Siah2 and full length Siah2
GST-Siah2 proteins were produced in bacteria and purified from using Glutathione-
Sepharose (Amersham Bioscience) as described before [8].
Screen of Siah2 inhibitors by Affinity Selection-Mass Spectrometry (AS-MS)
The affinity selection-mass spectrometry (AS-MS) ligand binding screen was optimized
following Cloutier, et. al. [10]. Briefly, an ultrafiltration (UF) plate (Pall Acroprep Advance
9
6 filter plate, 3k MW cutoff) was incubated with 150 µL of protein buffer, placed on top of
a receiver plate (Greiner-Bio 96 well microplate) and centrifuged (Eppendorf centrifuge
5
1
810R) at 2,000g. The eluent was discarded and replaced with a fresh receiver plate. Next,
00 µL of a 20 µM protein solution, 3.2 µL of 400 compounds mixture in DMSO with each
at 125 µM, and 100 µL of protein buffer was added to one well of the UF plate. This step was
repeated for each of the 80 wells for a total of 32,000 compounds. The final concentration is
1
6
0 µM of protein, 2 µM of each compound and 1.6 % DMSO. The plate was incubated for
0 minutes at room temperature in the dark and subsequently centrifuged for 45 mins. The
eluent was discarded, 150 µL of buffer was added to each well and centrifuged for 45 mins.
This washing step was repeated three times while discarding the eluent after each wash.
After the final wash step, 150 µL of buffer was added, mixed, and 50 µL aliquot was
transferred to a fresh UF plate. 150 µL of methanol was added to each well, thoroughly
mixed and centrifuged to collect the compounds in the eluent. The compounds were dried
with nitrogen stream (Argonaut SPE DRY 96) and reconstituted in a mixture of
methanol:H O (25:75). A 2 µL injection of the eluent was analyzed on an Agilent
2
Technologies (Wilmington, DE) 1200 HPLC system with 1290 Affinity HTS autosampler
and 6224A TOF-MS using a gradient profile on an Agilent Zorbax SB-C18 R.R. HT, 2.1 x
5
0mm, 1.8 µm HPLC column. Agilent MassHunter Data acquisition and MassHunter
Qualitative Analysis softwares were used to collect the data and identify compounds with
protein affinity, respectively.
Purification of Siah1 for PTS screening
Full length Siah1 was produced in the baculovirus/insect cell system. The full-length gene
was cloned into the pVL intracellular insect cell expression vector. 8 x 1 L of Sf9 cells at 3 x
6
1
0 cells/ml were infected with ~10 ml of freshly-produced virus P2 stock. Cells were
infected for 72 h at 27°C, shaken at 120 rpm, then harvested by centrifugation at 3000g for
0 min. Pellets were resuspended in 500 mM NaCl, 20 mM Tris pH 8.0, 10 mM imidazole,
1

ACCEPTED MANUSCRIPT
EDTA-free protease inhibitor cocktail, and 10 mM DTT (final volume was 2-3x cell pellet).
Cells were lysed gently on ice using a glass dounce homogenizer (6 times). Cell debris was
pelleted by centrifugation at 19,000 RPM at 4°C for 1 h. Supernatants were bound to cobalt
Talon resin for four hours at 4°C. Protein was eluted on an FPLC column using a gradient of
1
0 mM to 1 M imidazole, 500 mM NaCl, 20 mM HEPES pH 7.4, 10 mM DTT. Peak
fractions containing Siah1 were collected and run over a Superdex S200 gel filtration column
equilibrated in 150 mM NaCl, 20 mM HEPES at pH 7.4, and 1 mM TCEP (tris(2-
carboxyethyl) phosphine)). Peak fractions were concentrated to 1-2 mg/ml, stored at 4°C and
used within 2 weeks. Truncated Siah1 (residues 90-282), comprising the ligand binding
domain and 2 N-terminal Zinc finger domains, but lacking the RING domain, was produced
as a HIS-tag protein in E. coli as previously described [11].
Screen of Siah2 inhibitors by Protein Thermal Shift assay (PTS)
Compounds dissolved in DMSO were dispensed into 384-well PCR plates by Echo 555
acoustic dispenser. Pre-chilled 1.7 µM full-length Siah2 protein, prepared in assay buffer
containing 20 mM Tris pH 8, 150 mM NaCl, and 1 mM TCEP, was dispensed by Multi-Drop
Combi. After 15-minute pre-incubation, equal volume of 10X Sypro Orange dye in room
temperature assay buffer was added. The plate was sealed and spun for 2 minutes at 1000
RPM. The plate was read on ViiA7 RT-PCR instrument with a ramping speed of 0.15
°
C/min using X1-M3 setting. Transition temperature (T ) values were determined using
m
Protein Thermal Shift™ software from ThermoFisher. Hit compounds were selected using hit
criteria Z-score ≥ 3 or ∆Tm ≥ 1 °C and reconfirmed in triplicate-well single-concentration
and duplicate-well concentration-dependent assays.
In silico screening for small molecule Siah2 inhibitors
The virtual screening pipeline involving numerous methods of computer-aided drug
discovery and successfully used in many previous studies [12, 13] has been employed to
Siah2 hit discovery. The crystal structure of Siah2 SBD domain (pdb code 5H9M) was used
for docking. We identified a possible small molecule binding pocket using the SiteFinder
module of MOE suite of software [14]. When superimpose the crystal structure 5H9M of
Siah2 and the co-crystal structure of Siah1 and a bound peptide (see Fig 4a), we found that
the identified small molecule binding pocket is located at exactly where Siah1 peptide
inhibitor (pink) binds.

ACCEPTED MANUSCRIPT
Approximately 5M ZINC15 commercially available lead-like compounds was first docked to
the identified Siah2 pocket using Glide [15] with default settings. Subsequently, 235103
compounds that have the Glide docking score better than -6.0 were selected for a second
round of docking using eHiTS program [16] with default parameter settings. Only
compounds of RMSD between the predicted binding poses from the Glide and eHITS less
than 2.0 Å, which are 16402 structures, were subsequently subjected to consensus ranking
using glide-docking score, eHITS-score, and Dock-pKi (calculated using MOE’s scoring.svl).
After the final visual check, 133 compounds were selected as hits, of which 94 compounds
were purchased for Siah2 assays.
Experimental procedures for the synthesis of RLS-7 and derivatives
Betulin was purchased commercially and purified on silica gel (hexane/EtOAc gradient) to
1
give pure material. H-NMR (500 MHz-CDCl ) δ 4.68 (s, 1H), 4.58 (s, 1H), 3.79 (d, J = 10.6
3
Hz, 1H), 3.33 (d, J = 10.8 Hz, 1H), 3.18 (dd, J = 11.4, 4.8 Hz, 1H), 2.38 (m, 1H), 2.08 – 0.53
(m, >10H), 1.68 (s, 3H), 1.02 (s, 3H), 0.98 (s, 3H), 0.96 (s, 3H), 0.82 (s, 3H), 0.76 (s, 3H).
1
3
C-NMR (125 MHz-CDCl ) δ 150.68, 109.89, 79.19, 60.75, 55.50, 50.61, 48.97, 48.00,
3
4
2
2.93, 41.13, 39.07, 38.92, 37.52, 37.37, 34.45, 34.18, 29.97, 29.39, 28.20, 27.60, 27.26,
5.42, 21.05, 19.30, 18.52, 16.32, 16.20, 15.58, 14.98. HRMS: calculated [M+H]: 443.3884,
found [M+H]: 443.3868.

ACCEPTED MANUSCRIPT
A round bottom flask was charged with betulin (750 mg, 1.69 mmol) and acetone (50 mL)
and cooled to 0 °C in an ice water bath. Separately, a solution of Jones reagent was prepared
by combining CrO (1 g), concentrated H SO (1 mL) and water (3 mL) at 0 °C. This Jones
3
2
4
reagent was then slowly added to the betulin solution which caused the initially white
suspension to become green. As the addition is continued, the orange color of the Jones
reagent is maintained in the reaction mixture. The combined mixture was then stirred at 0 °C
for 2 h, after which methanol was slowly added until the solution became a dark green color
and the solution was warmed to room temperature. The mixture was then partially
concentrated in vacuo and then partitioned between EtOAc and water. The aqueous portion
was thrice extracted with EtOAc and the combined organic portions were washed with brine
and dried over sodium sulfate. Purification on silica gel (25 g, preabsorbed onto silica gel, 5-
1
2
5% hexane/EtOAc gradient) gave betulonic acid (426 mg, 55% yield) as a white solid. H-
NMR (500 MHz-CDCl ) δ 4.75 (s, 1H), 4.62 (s, 1H), 3.00 (m, 1H), 2.57 – 2.34 (m, 2H), 2.33
3
–
2.18 (m, 2H), 2.05 – 1.85 (m, 2H), 1.83 – 0.75 (m, >12H), 1.69 (s, 3H), 1.07 (s, 3H), 1.02
1
3
(
s, 3H), 0.99 (s, 3H), 0.98 (s, 3H), 0.93 (s, 3H). C-NMR (125 MHz-CDCl ) δ 218.41,
3
182.46, 150.51, 109.97, 56.60, 55.13, 50.05, 49.40, 47.54, 47.11, 42.70, 40.84, 39.81, 38.72,
37.25, 37.12, 34.33, 33.81, 32.31, 30.77, 29.89, 26.85, 25.70, 21.58, 21.20, 19.83, 19.58,
16.16, 16.03, 14.83. HRMS: calculated [M+H]: 455.3520, found [M+H]: 455.3519.
A vial was charged with betulonic acid (50 mg, 0.11 mmol), cesium carbonate (54 mg, 0.16
mmol) and DMF (1 mL) at room temperature. Iodomethane (22 ꢀL, 0.33 mmol) was added
and the resulting solution was stirred for 17 h at room temperature. Water (~ 5 mL) was then
added to the solution which initiated the precipitation of a white solid. This solid was
collected via filtration and washed with water. Purification of the solid on silica gel (10 g
biotage column, material pre-adsorbed onto silica gel) with a hexane/EtOAc gradient (2-
1
2
5%) resulted in methyl betulonate (37 mg, 70% yield) as a white solid. H-NMR (500
MHz-CDCl ) δ 4.74 (bs, 1H), 4.60 (bs, 1H), 3.67 (s, 3H), 3.00 (m, 1H), 2.54 – 2.33 (m, 2H),
3
2
.31 – 2.19 (m, 2H), 1.89 (m, 3H), 1.69 (s, 3H), 1.81 – 1.12 (m, 16H), 1.07 (s, 3H), 1.02 (s,
1
3
3
H), 0.97 (s, 3H), 0.95 (s, 3H), 0.92 (s, 3H), 0.88 (m, 1H). C-NMR (125 MHz-CDCl ) δ
3

ACCEPTED MANUSCRIPT
2
3
1
4
18.33, 176.85, 150.73, 109.86, 56.77, 55.23, 51.52, 50.15, 49.63, 47.57, 47.17, 42.68, 40.85,
9.86, 38.58, 37.18, 37.15, 34.38, 33.86, 32.34, 30.82, 29.89, 26.84, 25.76, 21.64, 21.27,
9.88, 19.61, 16.17, 15.99, 14.86. HRMS: calculated [M+H]: 469.3676, found [M+H]:
69.3664.
A vial was charged with betulonic acid (50 mg, 0.11 mmol), triethylamine (31 ꢀL, 0.22
mmol), HATU (63 mg, 0.16 mmol) and DMF (1 mL) at room temperature. 2-aminoethanol
(13 ꢀL, 0.22 mmol) was added and the resulting yellow solution was stirred for 18 h at room
temperature. Water (~ 5 mL) was then added to the solution which initiated the precipitation
of a white solid. This solid was collected via filtration and washed with water. Purification
of the solid on silica gel (10 g biotage column, material preabsorbed onto silica gel) with a
hexane/EtOAc gradient (2-100%) resulted in (1R,3aS,5aR,5bR,11aR)-N-(2-hydroxyethyl)-
5
3
a,5b,8,8,11a-pentamethyl-9-oxo-1-(prop-1-en-2-yl)icosahydro-1H-cyclopenta[a]chrysene-
1
a-carboxamide (36 mg, 65% yield) as a white solid. H-NMR (500 MHz-CDCl ) δ 6.03 (t, J
3
=
5.7 Hz, 1H), 4.74 (bs, 1H), 4.60 (bs, 1H), 3.73 (t, J = 4.9 Hz, 2H), 3.55 – 3.31 (m, 2H), 3.11
td, J = 11.1, 4.5 Hz, 1H), 2.49 (m, 2H), 2.40 (m, 1H), 2.05 – 1.85 (m, 2H), 1.81 – 1.65 (m,
(
2
3
5
3
H), 1.69 (3H, s), 1.65 – 1.14 (m, >10H), 1.06 (s, 3H), 1.02 (s, 3H), 0.98 (s, 6H), 0.92 (s,
1
3
H). C-NMR (125 MHz-CDCl ) δ 218.32, 178.17, 150.96, 109.71, 63.56, 55.92, 55.29,
3
0.30, 50.23, 47.59, 46.95, 42.78, 42.63, 40.94, 39.88, 38.64, 38.07, 37.17, 34.40, 34.05,
3.92, 31.09, 29.66, 26.80, 25.85, 21.67, 21.27, 19.86, 19.75, 16.16, 16.10, 14.81. HRMS:
calculated [M+H]: 498.3942, found [M+H]: 498.3949.
A microwave vial was charged with betulonic acid (50 mg, 0.11 mmol), hydroxylamine
hydrochloride (53 mg, 0.77 mmol) and pyridine (1 mL) at room temperature. The solution
was then heated in a microwave at 120 °C for 4h. Water (~ 8 mL) was then added to the

ACCEPTED MANUSCRIPT
solution which initiated the precipitation of a white solid. This solid was collected via
filtration and washed with water to give (1R,3aS,5aR,5bR,11aR,E)-9-(hydroxyimino)-
5
a,5b,8,8,11a-pentamethyl-1-(prop-1-en-2-yl)icosahydro-1H-cyclopenta[a]chrysene-3a-
1
carboxylic acid as a white solid (49 mg, 94%). H-NMR (500 MHz-CDCl ) δ 12.07 (s, 1H),
3
1
2
0
5
3
0.25 (s, 1H), 4.70 (s, 1H), 4.57 (s, 1H), 3.04 – 2.90 (m, 1H), 2.81 (dt, J = 15.4, 4.9 Hz, 1H),
.13 (m, 2H), 1.94 – 0.75 (m, >12H), 1.66 (s, 3H), 1.08 (s, 3H), 0.96 (s, 3H), 0.94 (s, 3H),
13
.91 (s, 3H), 0.87 (s, 3H). C-NMR (125 MHz-CDCl ) δ 177.22, 163.41, 150.28, 109.64,
3
5.42, 54.99, 49.44, 48.49, 46.59, 42.03, 40.26, 38.04, 37.65, 36.72, 36.30, 33.42, 31.65,
0.08, 29.17, 27.56, 25.10, 23.01, 20.74, 18.94, 18.62, 16.54, 15.63, 15.42, 14.26. HRMS:
calculated [M+H]: 470.3629, found [M+H]: 470.3623.
A round bottom flask was charged with 10% Pd/C (293 mg, 0.275 mmol) and flushed with
nitrogen. Anhydrous THF (20 mL) and methanol (20 mL) were sequentially added, followed
by betulonic acid (5.00 g). A hydrogen-filled balloon was then added and the flask was
evacuated and back-filled with hydrogen. This evacuation and fill procedure was repeated
two additional times. The mixture was then vigorously stirred at room temperature until the
reduction was complete (~ 22 h). The mixture was then filtered through celite, washing with
methanol, and concentrated under vacuum to give (1S,3aS,5aR,5bR,11aR)-1-isopropyl-
5
a,5b,8,8,11a-pentamethyl-9-oxoicosahydro-1H-cyclopenta[a]chrysene-3a-carboxylic acid
1
(
4.92 g, 98% yield) as a white solid. H-NMR (500 MHz-CDCl ) δ 2.58 – 2.34 (m, 2H), 2.25
3
(m, 2H), 2.02 – 1.12 (m, 22H), 1.08 (s, 3H), 1.02 (s, 3H), 0.98 (s, 3H), 0.97 (s, 3H), 0.94 (s,
1
3
3
2
3
1
H), 0.86 (d, J = 6.9 Hz, 3H), 0.76 (d, J = 6.7 Hz, 3H). C-NMR (125 MHz-CDCl ) δ
3
18.30, 179.80, 56.91, 55.18, 49.87, 48.91, 47.57, 44.31, 42.88, 40.89, 39.83, 38.53, 37.57,
7.12, 34.37, 33.93, 32.22, 29.95, 29.91, 27.13, 26.86, 23.19, 22.93, 21.64, 21.27, 19.87,
6.15, 16.10, 14.90, 14.76. HRMS: calculated [M-H]: 455.3531, found [M-H]: 455.3525.

ACCEPTED MANUSCRIPT
A round bottom flask containing 4 angstrom molecular sieves was flame dried under an
atmosphere of nitrogen. To this flask was then added betulonic acid (43 mg, 0.095 mmol),
.
anhydrous THF (2 mL) and LaCl LiCl (1.57 mL, 0.6 M in THF, 0.95 mmol) at room
3
temperature. After 10 min, MeMgBr (316 ꢀL, 3 M in Et O, 0.95 mmol) was added and the
2
solution was stirred at room temperature for 3 h. The solution was then quenched with
NH Cl and twice extracted with CH Cl . The product was adsorbed onto SiO and purified
4
2
2
2
via flash chromatography (10 g SiO , 2-40% hexane/EtOAc gradient) to give
2
(1R,3aS,5aR,5bR,11aR)-9-hydroxy-5a,5b,8,8,9,11a-hexamethyl-1-(prop-1-en-2-
1
yl)icosahydro-1H-cyclopenta[a]chrysene-3a-carboxylic acid (14 mg) as a white solid. H-
NMR (500 MHz-CDCl ) δ 4.74 (s, 1H), 4.61 (s, 1H), 3.49 (s, 1H), 3.00 (td, J = 10.7, 4.7 Hz,
3
1
3
H), 2.27 (dd, J = 13.0, 3.6 Hz, 1H), 2.24 – 2.13 (m, 1H), 2.08 – 0.65 (m, >18H), 1.69 (s,
1
3
H), 1.20 (s, 3H), 0.99 (s, 3H), 0.93 (s, 3H), 0.85 (s, 3H), 0.84 (s, 6H). C-NMR (125 MHz-
CDCl ) δ 181.55, 150.62, 109.89, 75.56, 56.58, 53.65, 51.18, 51.10, 49.51, 47.13, 42.64,
3
4
2
1.12, 40.95, 38.64, 38.12, 37.73, 37.27, 34.71, 34.36, 32.41, 30.81, 29.95, 25.72, 24.71,
3.44, 21.05, 19.61, 19.10, 16.59, 16.30, 15.03. HRMS: calculated [M+H]: 469.3687, found
[
M+H]: 469.3681.
Cell culture
All human and mouse melanoma cell lines, liver cancer cell lines and pancreatic cell lines
were cultured in high-glucose Dulbecco’s modified Eagle’s medium supplemented with 10%
fetal bovine serum and 1% penicillin-streptomycin. All prostate cancer cell lines are
maintained in RPMI medium supplemented with 10% fetal bovine serum and 1% penicillin-
streptomycin. Cell cultures were maintained in cell culture incubator at 37°C in 5% CO . For
2
hypoxia treatment, cell cultures were maintained in hypoxia cell incubator at 37°C, 5% CO2
and 1% oxygen.
Reagents and drug treatment protocol

ACCEPTED MANUSCRIPT
RLS-7 and derivatives were synthesized and purified at the CPCCG of SBP Medical
Discovery Institute as described above. Other compounds were purchased from MolPort
(
Latvia) and Enamine Chemicals (New Jersey, USA). All compounds were maintained as 10
mM DMSO stocks. To determine the effect of selected compounds and derivatives, cells
were plated at 50% confluency and grown overnight in 6-well plates. Test compounds at
different concentrations were added to the plates, cells were exposed to hypoxia (1%) for 6
hours and lysed immediately for Western blot analysis.
Western blot analysis and antibodies
Cells were rinsed with PBS and lysed in lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM
NaCl, 1% NP-40, 1 mM EDTA, 10 ꢀg/ml aprotinin, 1 ꢀg/ml pepstatin A, 10 ꢀg/ml leupeptin,
2
mM phenylmethylsulfonyl fluoride, 2.5 mM sodium orthovanadate). Protein concentration
was determined using Coomassie Plus Protein Assay Reagent (Thermo Scientific). Equal
amounts of cell lysate proteins (50 µg) were separated on SDS-PAGE and transferred to
PVDF membrane. Membranes were blocked with 3% BSA/TBST, incubated with primary
antibodies and secondary antibodies. Detection and quantifications were made using Odyssey
Infrared Imaging System (LiCor Biosciences). Antibodies against HIF1α were kindly
provided by Dr. Gary Chiang (1:1000). Antibodies α-tubulin, GAPDH, HA and Myc were
obtained from Santa Cruz Biotechnology. Anti-Flag antibody was obtained from Sigma-
Aldrich. Secondary antibodies were goat anti-rabbit Alexa-680 F(ab') (Molecular Probes)
2
and goat anti-mouse IRDye 800 F(ab') (Rockland Immunochemicals). All antibodies were
2
used according to the suppliers' recommendations.
Proliferation assay
All cell lines were seeded (4,000 cells in 100 ꢀL per well) in 96-well plates. Cells were
allowed to attach overnight. Tested compounds and derivatives were serially diluted using
media from stock solutions and were added to cells. Tests were performed in triplicate, and
each microplate included media and DMSO control wells. Cell viability was assessed using
ATPlite after 72 h according to manufacturer’s protocol. Cell growth inhibition was
calculated as a percentage of DMSO-treated controls and plotted against the compound
concentration.

ACCEPTED MANUSCRIPT
Colony formation assay
For colony formation assays, cells were plated in triplicate (500 cells/well) in 6-well plates or
1
2
00 cells/well in 24-well plates and grown overnight before compounds were added. After 1–
weeks, depending on cell line, colonies were stained with Accustain Crystal Violet solution
(Sigma-Aldrich) for 30 min. Plates were rinsed with water and images were acquired by
scanning. Colony number and size were analyzed using Image J software. Colony formation
efficiency was calculated relative to the number of colonies in control (DMSO)-treated wells.
Soft agar assay
Soft agar culture was performed as described before. Briefly, 50,000 melanoma cells mixed
in top agar (0.35% in 1× DMEM) were plated over a second layer of agar (0.7% in 1×
DMEM). After 24 h, medium containing indicated compounds was added over the top agar
and replaced every 5 days. Colonies were visualized by crystal violet staining (0.005%
crystal violet in 4% paraformaldehyde/PBS). Images were acquired with a microscope (×40)
or scanned (HP ScanJet G4010). Colony number and size were analyzed using Image J
software (NIH).
Silencing Siah2 expression by shRNA
The shRNA vectors for silencing of Siah2 were previously described [3]. The sequences used
for scramble and Siah2 shRNA were respectively: caacaagatgaagagcaccaa (scramble),
ccttggaatcaatgtcacgat (Siah2). Melanoma cells were transfected with scramble or shSiah2
using the jetPRIME DNA transfection reagent kit (Polyplus, France) according to the
manufacture’s protocol.
Reverse Transcription and real-time qPCR.
Total RNA was extracted using a total RNA miniprep kit (Sigma) with the On-column
DNase I digestion step included. cDNA was synthesized using cDNA kit from Applied
Biosystems. Real-time PCR was performed on a Bio-Rad CFX Connect Real-Time System
using FastStart Universal SYBR Green Master (Rox) from Roche. H3.3A was used as an
internal control. Quantitative PCR reactions were performed in triplicates. PCR primers were
designed using PrimerBank (http://pga.mgh.harvard.edu/primerbank).
In vitro ubiquitination assay

ACCEPTED MANUSCRIPT
GST-Siah2 was purified from the bacteria using glutathione-Sepharose (Amersham
Biosciences). Siah substrates were obtained from 293T cells transfected with FLAG-
OGDCE2, myc-Sprouty 2 or V5-ASPP2. After 24 h, indicated Siah substrate was
immunoprecipitated with agarose A/G beads. Purified GST-Siah2 was incubated with test
compounds for 30 min at room temperature before adding to Siah substrate beads and
ubiquitination buffer (50 mM Tris-HCl, pH 8.0, 5 mM MgCl , 0.5 mM dithiothreitol, 2
2
mM NaF) supplemented with purified ubiquitin (2 ꢀg), 2 mM ATP, E1 (50 ng) (Boston
Biochem, Cambridge, MA), purified E2 (UbcH5b) (250 ng) for 45 min at 37 °C. These
reactions were washed four times with buffer containing (50 mM Tris-HCl, pH 8.0, 150
mM NaCl, 1% Triton X-100, 1 mM EDTA). Samples were loaded on SDS-PAGE and
followed by Western blot analysis using anti-ubiquitin antibody.
Luciferase assay
A375 cells (50% confluency) were transiently transfected with the firefly luciferase reporter
plasmid HRE-Luc and renilla luciferase plasmid pRL-TK (20:1) using jetPRIME according
5
to the manufacturer's protocol. After 24 h, cells were plated (1×10 cells/well in 24-well
plate) and allowed to attach overnight. Cells were then treated with different concentration of
selected compounds with or without 10 µM of FG4592. Luciferase assay was performed
using the dual luciferase kit (Promega, Madison, WI) according to the manufacturer’s
protocol after 24 h. Firefly luciferase activity was normalized to renilla luciferase activity as a
control for transfection efficiency.
Neuroendocrine differentiation
RV1 cells were plate into 6-well plate at low density (2000 cells per well) and treated with
different concentrations of tested compounds. Cells were maintained under hypoxia (1%
oxygen) at 37°C, 5% CO for one week before images were taken using bright field
2
microscopy.
Animal studies
Male beige/SCID mice (Envigo, 8-10 weeks old) were orthotopically grafted as previously
described [17]. In accordance with institutional animal care and use committee approval,
5
5
2
×10 RV1 cells and 6×10 human primary prostatic CAF were suspended in 30 µL type I
collagen for grafting into mice supplemented with testosterone (30 mg pellet implanted

ACCEPTED MANUSCRIPT
subcutaneously). After allowing the tumors to expand for four weeks, the testosterone pellets
were removed, the mice were castrated, and the mice were treated 3 times weekly with
enzalutamide (1 mg/mouse by oral gavage) and/or RLS-12 (20 mg/kg i.v.). The mice were
sacrificed 14 days after castration. The tumor tissues were fixed in 4% para-formaldehyde
and embedded in paraffin for sectioning and immunohistochemical staining.
3
. Results
AS-MS screen for Siah inhibitors
To identify potential inhibitors of Siah1/2 ubiquitin ligases we performed an Affinity
Selection-Mass Spectrometry (AS-MS)-based screen, which is based on a compound's
propensity to exhibit tight association with the target protein (Fig S1a). A screen of over
3
0,000 compounds revealed 150 compounds that bound with high affinity to Siah2 but not to
RNF5, a different RING finger ubiquitin ligase used in a counter-assay (Table S1).
Assessment of hits identified a subset of compounds with similar structures. Of those, seven
were selected for further analysis in a secondary assay to evaluate their effect on expression
levels of HIF1α. Since Siah2 regulates stability of prolyl hydroxylases 1 and 3 which are
negative regulators of HIF1α, it was expected that inhibition of Siah2 should upregulate
PHD1/3 levels with concomitant reduction in HIF1α levels [1, 5].
In further referencing, compounds identified by different screening campaigns were
designated Ronai Lab Siah (RLS) inhibitors and numbered sequentially. Of the seven
compounds selected by primary screening, four (RLS-2, RLS-5, RLS-6, RLS-7) reduced
HIF1α protein expression, with RLS-7 the most active (Fig 1a). Notably, RLS-7, also known
as betulonic acid (Fig 1b), was found to effectively inhibit HIF1α expression. We then
further assessed the effect of the two top hits (RLS-6, RLS-7) on HIF1α expression, using
purchased betulinic acid (BA, RLS-7 is the oxidized form of betulinic acid) and two its close
analogs - lupeol and oleanolic acid (Fig S1b). Notably, RLS-7 and BA were most efficient in
inhibiting HIF1α levels in a dose-dependent manner. Lupeol was active in inhibiting HIF1α
level, albeit to lesser degree. Although oleanolic acid caused inhibition of HIF1α, such
inhibition was not dose-dependent (Fig 1c). As an independent assessment, we measured
HIF1α transcriptional activity using HRE-luc reporter assay. Notably, RLS-7 treatment of
HEK293T cells harboring the HRE-Luc reporter resulted in a dose-dependent inhibition of
transcriptional activity (Fig 1d).

ACCEPTED MANUSCRIPT
We further confirmed the effect of RLS-7 on Siah2 by assessing viability of melanoma cells
transfected with control shRNA or shRNA targeting Siah2 for 24h followed by RLS-7
treatment. Melanoma cell viability following RLS-7 treatment was less pronounced in cells
that were subjected to knockdown of Siah2, supporting Siah2 as RLS-7 target. Along these
lines, inhibition of Siah2 expression by shSiah2 abolished cell death seen upon RLS-7
treatment (10 µM), compared with 80% cell viability in cells subjected to control shRNA. At
a higher dose of RLS-7 (20 µM) the degree of cell viability was 71% (shSiah2) compared
with 42% (control shRNA; Fig S1c). These findings provide independent confirmation of
Siah2 being the target of RLS-7.
Next, we determined the effect of RLS-7 on viability of various melanoma cell lines in
comparison with HEK293 cells. Notably, RLS-7 exhibited a pronounced inhibition of growth
in Mel501 melanoma line, to degree seen in HEK293 cells (Fig 1e, Fig S1d). Then we asked
whether RLS-7 treatment could alter the efficiency of colony formation (CFE) by melanoma
cells that were plated at low density and allowed to grow and form colonies over 10-day
period. Notably, inhibition of CFE by RLS-7 was not limited to cells where it was found to
affect the viability (HEK293 and Mel501 cells, Fig 1f), as evident from its effect on CFE of
WM793, MeWo and WM35 lines (Fig S1e). These observations suggest that RLS-7
effectiveness is mediated by a number of pathways, not limited to its ability to induce cell
death programs.
Given these effects on established melanoma cell lines, we next determined whether RLS-7
treatment had any effect on primary melanoma cells, which had been cultured for a short time
after collection from patient tumors. RLS-7 inhibited melanoma cell growth in 3 of 6
primary cell lines, albeit to different degrees, again raising the possibility that effective Siah2
inhibition of melanoma viability is determined by select genetic and possibly epigenetic
characteristics, seen in specific tumor types or genetic backgrounds (Fig S1f).
Siah activity was also shown to play an important role in the development of aggressive
forms of prostate cancer [18]. Thus, we extended our analysis of RLS-7 to include prostate
cancer cell lines. We found that the effect of RLS-7 on viability of PCa cell lines CW22RV1
(RV1) and PC3 was more robust than on melanoma cells tested so far (Fig 1g). Also, RLS-7
treatment very effectively inhibited colony formation by PCa lines (Fig 1h). Siah2’s effect on

ACCEPTED MANUSCRIPT
transformation of PCa cells is reportedly mediated, in part, by its regulation of transcription
of AR-dependent genes [5, 6]. To this end we evaluated whether RLS-7 could block
transcription of Siah2-regulated, AR-dependent genes, such as PSA, PMEPA1 and NKX3.1.
Indeed, the expression of these three genes was inhibited in PCa cells treated with RLS-7,
while expression of the Siah-independent AR target gene FKBP5 was not affected (Fig S1g).
Identification of RLS-7 analogs
Our initial analysis of RLS-7 activity led us to synthesize 6 analogues modifying either the
carboxylic acid, the ketone or the isopropene group of RLS-7 (RLS-8 to RLS-13) (Fig 2a) to
assess potential structure/activity relationships within the series. These compounds were all
tested for inhibition of HIF1α expression under hypoxia. Modifications to the ketone (RLS-
1
1 and RLS-13) or isopropene (RLS-12) demonstrate similar inhibition compared to RLS-7
(10 µM; Fig 2b). These analogs were further tested for their efficacy in causing cell death of
cultured A375 melanoma cells using the ATPlite protocol. Comparing the IC50 for RLS-7,
and RLS-12, the latter exhibited somewhat greater efficacy in killing cells (Fig 2c). Viability
assay of a series of human melanoma cell lines treated with RLS-12 showed it is more potent
in inhibiting multiple cell lines growth compared with RLS-7 (Fig 2d and Fig S1d). We also
analyzed the efficacy of RLS-12 against the human prostate lines RV1 and PC3 and observed
killing efficacy in both (Fig 2e, and S2a). Dose-response analysis of RLS-7 and RLS-12
effects using Lu1205 melanoma cells revealed that RLS-12 was more potent in inhibiting
HIF1α protein expression (Fig S2b). We also monitored effects of RLS-7 and RLS-12 on
melanoma ability to form colonies (Fig 2f), where RLS-12 was shown to be more potent in
inhibiting colony formation. The inhibition of RLS-12 on melanoma and prostate cancer cell
growth on soft agar was shown in Fig S2c.
Siah inhibition has a marked effect on the ability of RV1 cells to exhibit neuroendocrine (NE)
phenotypes in vitro and in vivo [5]. Thus, we assessed a potential effect of RLS-12 treatment
of RV1 cells on NE phenotypes, such as neurite extension. RLS-12 treatment of RV1 cells,
maintained under hypoxic conditions required to induce NE phenotypes, markedly inhibited
neurite extension (Fig S2d), consistent with the role of Siah in their formation. We have also
tested RLS-12 in a tissue recombination orthotopic grafts having RV1 prostatic epithelia with
human carcinoma associated fibroblasts (CAF). In this study all mice were castrated after
allowing the tumor to expand to initiate a neuroendocrine response by the tumor.

ACCEPTED MANUSCRIPT
Subsequently, vehicle or RLS-12 was administered for two weeks prior to sacrifice. While no
appreciable differences in tumor volume were found among the treatment groups, there was a
marked change in the differentiation state of the tumors. We found that the neuroendocrine
differentiation marker, chromogranin A (CHGA), reproducibly expressed in the vehicle
treated castrated mice, was largely absent in the mice treated with RLS-12 (Fig 2g).
Analogously, the observed down regulation of androgen receptor (AR) potentiated by
castration, seemed to be restored in the tumors when RLS-12 was administered. However,
there were minimal differences in proliferation or cell death in the treatment and control mice
(data not shown).
RLS-12 also elicited effective growth inhibition of melanoma cells resistant to vemurafenib
A375R), suggesting that Siah2 inhibition could also address some melanoma drug sensitivity
(
problems (Fig S2e). Consistent with previously observed effects of the developed compounds
on HIF1α, we further established a dose-dependent decrease in transcript levels of HIF1α
target genes VEGF, GLUT1, and HK2 (Fig 2h), following the treatment of human melanoma
A375 cells with RLS-12.
Use of a Protein Thermal Shift assay to identify Siah inhibitors
An independent approach to identify small molecule inhibitors of Siah - is a Protein Thermal
Shift assay (PTS), which is based on the principle that protein melting temperature is
potentially altered by binding of a small molecule [19]. As this screen requires large
quantities of purified proteins, we produced full-length Siah1 in baculovirus as well as
truncated Siah1 (residues 90-282; i.e., lacking the N-terminal Ring domain) in E. coli, and
purified them to homogeneity. Siah1 protein that was produced and purified from insect
cultures was used for the final screen. Of 30,000 small molecules used in the previously
described high throughput screening, 80 elicited a change in Siah1 melting temperature (Fig
S3a), and of those, 15 (RLS-14 to RLS-28) were selected for the initial assessment, based on
structure and biophysical properties. Among them, RLS-24 (adapalene, Fig 3a) elicited a
more potent effect, as assayed by the degree of inhibition of HIF1α protein expression in
melanoma cells (Fig 3b). Correspondingly, we also observed parallel dose-dependent
inhibition of HRE-Luc reporter activity by RLS-24 (Fig 3c). Moreover, the effect on cell
viability in melanoma cells treated with RLS-24 was more potent than that seen with other
selected small molecule inhibitors in this group (Fig S3b).

ACCEPTED MANUSCRIPT
RLS-24 has been shown by others to possess anti-proliferative and pro-apoptotic effects in
cultured colon carcinoma (CC-531, HT-29 and LoVo) and hepatoma (HepG2, Hep1B) lines
[
20, 21], largely by altering Caspase 3, Bcl2 and Bax activities [22]. We used RLS-24 to treat
2 human and murine melanoma lines of different genetic backgrounds and observed
1
effective growth inhibition in all of them, with Mel501, SW1, and SK-MEL103 showing
greatest sensitivity (~40% inhibition at 0.625 µM; Fig 3d). Similar analysis indicated a loss
of viability in different PCa lines (Fig 3e). Likewise, colony formation culture by several
melanoma and PCa lines (Fig 3f, S3c), including the vemurafenib-resistant melanoma line
A375R (Fig 3f), was suppressed by RLS-24. The degree of the colony formation inhibition
varied, with the less profound effect seen for vemurafenib-resistant melanoma, and SW1, a
mouse melanoma line which was relatively sensitive to RLS-24-induced effective cell death
(Fig 3d, 3f). However, overall results indicate that RLS-24 is generally effective in
decreasing viability and growth of both melanoma and PCa lines.
We next investigated whether RLS-24 blocked Siah E3 ligase activity by performing
ubiquitination assays and monitoring the degree of in vitro ubiquitination of Siah2 substrates
in the presence and absence of the inhibitor. To achieve this, we examined in vitro
ubiquitination of the Siah2 substrates ASPP2, Sprouty2 and OGDCE2 using bacterially-
produced and then purified Siah2 plus substrates immuno-purified from HEK293 cells.
Addition of RLS-24 to these reactions effectively decreased the degree of ubiquitination (Fig
S3d). We also performed dose-response analysis of RLS-24’s effect on OGDCE2
ubiquitination, which confirmed inhibition of ubiquitination in vitro (Fig 3g).
We next assessed several RLS-24 analogs which one of them has been previously reported
[
23] and tested the effect of 8 compounds (RLS-29 to RLS-36) on HIF1α protein expression
levels in both A375 and Lu1205 cells. It has been established that two analogs, demethylated
Adapalene (RLS-30) and the hydroxylated analog RLS-34 were as potent as RLS-24 itself
(Fig 3h). Notably, treatment of melanoma cells with an analogue RLS-35, which has a
modified retinoic acid moiety, did not reduce HIF1α expression, pointing to the importance
of this moiety for inhibiting Siah. Structures of the two most active analogues, RLS-30 and
RLS-34, are shown in Fig 3i, and the comparison of both of them with RLS-24 in a viability
assay revealed their greater potency (Fig 3j, Fig S3e; data not shown). Their propensity to
induce apoptosis, was previously reported (15), and was confirmed for RLS-30 using

ACCEPTED MANUSCRIPT
Annexin V-PI FACS analyses (data not shown), which may be independent of their effect on
Siah ubiquitin ligases (15).
In silico screen identifies new Siah inhibitors
A third, independent approach to identify Siah2 inhibitors relied on in silico screening of a
published three dimensional structure of Siah [24]. We focused on the Siah substrate
binding domain characterized in earlier studies [9, 25]. This domain binds a peptide
designated as PHYL derived from the Drosophila protein phyllopod [26-28], which in flies
serves as an adaptor for Siah2 substrates. Although PHYL homologues were not identified
in mammalian systems, they are as potent in inhibiting Siah binding and ubiquitination of
its substrates [29]. The 19aa PHYL peptide used in our earlier studies potently inhibited
Siah ubiquitin ligase activities and has served as the basis to design other short Siah2
inhibitory peptides [9]. We evaluated 5 million drug-like compounds in a virtual screen
(Fig 4a, S4a) and identified ~100 putative inhibitors of Siah2 (RLS-37 to RLS-135), which
we then purchased and tested for Siah ubiquitin ligase inhibition by monitoring changes of
HIF1α expression in melanoma cultured cells (Fig S4b). Of those, we confirmed dose-
dependent HIF1α inhibition by RLS-96, RLS-104, and RLS-111 (Fig 4b). Cell viability
assays revealed RLS-96 to be the most effective, both in promoting cell death and in CFE
assays (Fig 4c; S4c). Moreover, degree of cell death seen in WT mouse embryo fibroblasts
that were treated with RLS-96 was attenuated in Siah1/2 DKO cells (1-7) (Fig 4d),
supporting the notion that cell death can partially be attributed to Siah inhibition. In vitro
ubiquitination studies also confirmed that RLS-96 antagonizes Siah-dependent OGDCE2
ubiquitination (Fig 4e), although to a lesser degree than RLS-24.
Parallel comparison of top Siah1/2 small molecule inhibitors.
To evaluate the efficacy of the top inhibitor identified in each of the three screening
campaigns (RLS-12, RLS-24, RLS-96) we performed parallel assessments for key Siah1/2
related indications. Effect on viability of 9 melanoma cell lines confirmed RLS-24 as the
most potent compound (2.5µM causing 50% inhibition in about half of the lines; Fig S5a),
which was also reflected in effective inhibition of CFE (Fig 5a). In both cases, RLS-12
scored second in its effects on melanoma cells (Fig S5a, 5a). To assess the toxicity of these
compounds on non-transformed cells, we compared the effect RLS-12, RLS-24 and RLS-96
on human melanocytes (Hermes H3A) with their effect on the melanoma cell line A375.

ACCEPTED MANUSCRIPT
Although at the higher concentrations, all three compounds elicited toxicity on normal
melanocytes, 80% of the melanocytes retained their viability at the dose of EC for
50
melanoma cells (Fig. S5a, lower panel).
Assessment of these compounds in 4 prostate cancer cell lines confirmed RLS-24 to be
superior over RLS-12 and RLS-96, respectively for both viability and inhibition of CFE (Fig
S5b, 5b). Likewise, the ability to attenuate formation of neurites in culture was best seen
following RLS-24 treatment (Fig S5c). Assessment of 4 liver and 2 pancreatic cancer cell
lines also identified RLS-24 to be most effective, compared with RLS-12 and RLS-96, on
viability and CFE (Fig. S5d, S5e, S5f, S5g; efficiency of Siah2 KD is shown in representative
Fig. S5c).
To verify that the effect of these compounds on cell viability is Siah1/2 dependent we used
the melanoma A375 cells that were subjected to Siah2 KD using corresponding shRNA (Fig
S5h; S5c), and then to treatment with each of these inhibitors. In the absence of Siah2, each
of these inhibitors was less effective in killing melanoma cells, in particular at the higher
concentration used (Fig S5i). Further, using murine melanoma cells in which Siah2 was
genetically inactivated by the CRISPR/CAS9 technology (confirmed by genomic sequencing;
not shown) and MEF cells with Siah1 and Siah2 double knockout (3,7), confirmed greater
resistance to RLS-12 and RLS-24, compared with RLS-96 (Fig. 5c & 5d). These findings
suggest RLS-96 may be more specific for Siah1, whereas RLS-12 and RLS-24 are more
Siah2-directed.
Siah inhibition can also be assessed by monitoring activity or availability of prolyl
hydroxylases, which are Siah substrates that hydroxylate on proline residues and hence
destabilize HIF1α. Since Siah2 targets PHD1/3 for degradation, resulting in elevated HIF1α
levels, Siah2 inhibition would increase PHD1/3 levels and promote robust HIF1α protein
degradation. Moreover, PHD inhibitors are available, allowing us to test their ability to
override Siah2 inhibition, as treatment with PHD inhibitors should increase HIF1α levels and
activity. Thus, we combined the pharmacological PHD inhibitor FG4592 with Siah2
inhibitors and monitored changes in HIF1α transcriptional activities, by assessing HRE-Luc
that was transfected into the indicated melanoma cells. While FG4592 treatment increased
HRE-Luc activity (due to PHD inhibition and increased HIF1α activity), the combined
treatment of FG4592 with the indicated Siah inhibitor dose-dependently decreased HRE-Luc

ACCEPTED MANUSCRIPT
activity (Fig 5e; S4d as proof of concept, using PHYL as positive control). Overall,
comparison of all the inhibitors assessed here suggest that RLS-24 may be the most effective
in antagonizing HRE-Luc activity, with RLS-12 exhibiting similar effectiveness (Fig. 5e).
The latter corresponds with the effect of these compounds on the level of HIF1α expression
(Fig. 5f).
Next, we compared the effect of the three inhibitors on in vitro ubiquitination of OGDCE2,
one of Siah substrates. Here again, RLS-24 was most effective, compared with the other two
inhibitors (Fig. 5g).
RNAseq analysis in murine melanoma subjected to CRISPR/CAS9 deletion of Siah2 led us
to determine whether Siah1/2 inhibitors will also attenuate their expression. Analysis of four
genes, Afap1/2, Neb, Fbn2, Casd1, that were upregulated in the Siah2 CRISPR’d YUMM1.7
murine melanoma cells (Fig 6a) revealed that they were also upregulated following treatment
by each of the Siah1/2 inhibitors (Fig. 6b). These findings further support the selectivity of
Siah1/2 inhibitors, which phenocopy effect of genetic Siah2 inactivation.
Lastly, we assessed the possible combination of Siah1/2 inhibitors, on viability of melanoma
cells. Parallel assessment of the 3 inhibitors allowed us to identify the IC50 for each, a
concentration that was used in assessing their possible additive or synergistic effect on
melanoma cell viability (Fig S6a). Notably, the combination of the three inhibitors was
superior, to their effect when tested individually (Fig. 6c). Likewise, combination of only two
out of the three compounds resulted in additive effect on melanoma cell viability (Fig. S6b,
S6c, S6d).
4
. Discussion
Ubiquitin ligases, which regulate signaling in numerous cell contexts, are highly desirable
targets in medicine, as their deregulation results in disease-related phenotypes [30, 31]. Yet,
ubiquitin ligases are also challenging drug targets, given that with the exception of HECT
domain family of ligases, RING finger ubiquitin ligases lack catalytic activity and their
inhibition likely requires the disruption of specific protein-protein interactions.

ACCEPTED MANUSCRIPT
Among two members of the Siah ubiquitin ligases family, Siah2 has been linked to oncogenic
activities and shown by independent laboratories to function in melanoma, breast, and
prostate cancers [4, 5, 18, 32, 33]. Siah2 inhibition reportedly attenuates melanoma growth,
development, and metastatic capacity and antagonizes formation of neuroendocrine prostate
cancer and evolution of hormone-refractory prostate tumors, albeit by distinct mechanisms.
Thus, inhibiting Siah2 is desirable in these conditions. Our earlier attempts to inhibit Siah
ubiquitin ligases have included a Meso-scale based analysis (Meso Scale Discovery) that
identified menadione as Siah1/2 inhibitory small molecule. Later, using a structure-based
approach, we designed small peptides that effectively inhibited Siah by covalent binding,
with proven effect in vitro and in cultured cells.
Here we employed three independent platforms to identify putative Siah inhibitors. Each
resulted in identification of distinct small molecule inhibitors that inhibit Siah activity,
measured by a number of independent parameters. The effect on HIF1α protein levels was
used as first surrogate marker, given Siah1/2 inhibition of its regulator prolyl-hydroxylase 3.
Along those lines, a more rigorous assessment for Siah1/2 putative inhibitors was their ability
to reverse the effect of FG4592 – PHD inhibitors, which was measured at the level of HIF1α
transcriptional activities. Further, assessment of Siah2 ubiquitin ligase activity in vitro,
confirmed the ability of inhibitors identified here, to attenuate, albeit to different degrees, its
ability to ubiquitinate one of its select substrates. Independent assessment for Siah1/2
inhibitors also relied on their effectiveness on cells lacking Siah2, confirming greater
resistance, varying among the inhibitors tested. Since changes in gene expression were
mapped for melanoma cells lacking Siah2, we were able to confirm that such changes can be
phenocopied by the inhibitors characterized here. Collectively, these independent
assessments establish the impact of Siah1/2 inhibitors we have identified in independent
screening campaigns, on Siah1/2 related cellular functions as on its own activity as ubiquitin
ligases. The select inhibitors were effective in inhibition of melanoma, but also prostate and
to lesser degree liver and pancreatic cancer viability and colony formation, attesting to their
overall impact on these tumor cells.
Each inhibitor was also capable of decreasing viability of both melanoma and to a greater
extent prostate cancer cultures and decreasing CFE, indicative of a positive anti-tumor effect.

ACCEPTED MANUSCRIPT
The most effective compound identified in the 3 campaigns was adapalene/RLS-24 and its
analogue (RLS-30), both of which promoted effective cell death at nanomolar concentrations,
effectively inhibited Siah2 ubiquitin ligase activity in vitro, and altered HIF1α activity in a
PHD-dependent manner. At times, inhibitors were more potent in prostate cancer cells
compared with melanoma, and others, melanoma better then prostate cancer cells. Among the
plausible explanations are the differential activity of Siah1/2 genes in the different tumor
cells, and correspondingly, different affinity of RLS’s to Siah1 vs. Siah2. The latter is
supported by the observation that certain RLS are more effective in Siah1 KO compared with
Siah2 KO MEFs and vice versa, requiring further assessment of RLS to each of the Siah
proteins.
Since initial characterization of these inhibitors took place individually, we have repeated key
assessments by comparing these inhibitors in parallel. These assessments clearly identified
RLS-24 as the most potent inhibitor, in each of the assays performed in this study, with RLS-
1
2 and RLS-96 following, albeit with lower potency and effectiveness. Clearly, combination
of RLS-12 and RLS-96 using IC20-IC50 for each inhibitor, revealed a clear additive effect.
Likewise, combination of all 3 inhibitors, each at low concentrations that had limited impact
on tumor cells viability, confirmed their significant additive effect. These observations point
to the possible evaluation of such combination for in vivo assessment of tumor models where
Siah1/2 were demonstrated to play critical role, including melanoma and prostate cancer.
Initial assessments in xenografts for prostate and melanoma tumors revealed that further
development of these compounds properties and formulations is needed, to improve
solubility and stability.
Among lessons learned from our exhaustive approach to identify Siah1/2 inhibitors are: (i)
the need to use diverse assay platforms; (ii) the importance of assessing Siah2 inhibition
using a cell-based screen; (iii) the consideration for studying larger molecules, including
natural products, to target large protein-protein complexes, characteristic of ubiquitin ligase
complexes; and (iv) the consideration of using additional approaches, including cereblon-
tethered structures, to develop Siah2-specific inhibitors. Future studies should also consider
the possible need to distinguish Siah2 inhibition from the inhibition of Siah1, given the
notion that these two family members, although shares some of the substrates identified so

ACCEPTED MANUSCRIPT
far, may also have distinct targets and biological properties, which may be cell type
dependent.
In all, our screening campaigns identified inhibitor prototypes for the ubiquitin ligases
Siah1/2 which provide the basis for further development to improve their overall potency and
to optimize their drug-like properties and formulation.
5
. Acknowledgements
This work is dedicated to the memory of Dr. Gregory Roth, who has contributed to the AS-
MS screen and synthesis of related analogs, guiding our first steps in the quest to identify and
study novel Siah1/2 small molecule inhibitors. We also thank Drs. Shiri Ashkenazi for
generating the CRISPR Siah2 melanoma cells and to Stephanie Meyers for their
characterization, Brian James for help with their RNAseq, Hyungsoo Kim for critical review
of this manuscript, and members of the Ronai lab for continued discussions.
Funding: Support by DOD grant W81XWH-14-1-0551 and P01 grant P01 CA128814-08 (to
ZAR) is gratefully acknowledged.
Conflict of Interest
Authors declare they do not have any conflict of interest pertaining to the studies
performed in this manuscript.

ACCEPTED MANUSCRIPT
References:
1] K. Nakayama, I.J. Frew, M. Hagensen, M. Skals, H. Habelhah, A. Bhoumik, T. Kadoya, H.
[
Erdjument-Bromage, P. Tempst, P.B. Frappell, D.D. Bowtell, Z. Ronai, Siah2 regulates
stability of prolyl-hydroxylases, controls HIF1alpha abundance, and modulates
physiological responses to hypoxia, Cell, 117 (2004) 941-952.
[
2] J. Qi, H. Kim, M. Scortegagna, Z.A. Ronai, Regulators and effectors of Siah ubiquitin
ligases, Cell Biochem Biophys, 67 (2013) 15-24.
3] M. Scortegagna, H. Kim, J.L. Li, H. Yao, L.M. Brill, J. Han, E. Lau, D. Bowtell, G. Haddad,
[
R.J. Kaufman, Z.A. Ronai, Fine tuning of the UPR by the ubiquitin ligases Siah1/2, PLoS
Genet, 10 (2014) e1004348.
[
4] J. Qi, K. Nakayama, S. Gaitonde, J.S. Goydos, S. Krajewski, A. Eroshkin, D. Bar-Sagi, D.
Bowtell, Z. Ronai, The ubiquitin ligase Siah2 regulates tumorigenesis and metastasis by
HIF-dependent and -independent pathways, Proc Natl Acad Sci U S A, 105 (2008)
16713-16718.
[
5] J. Qi, K. Nakayama, R.D. Cardiff, A.D. Borowsky, K. Kaul, R. Williams, S. Krajewski, D.
Mercola, P.M. Carpenter, D. Bowtell, Z.A. Ronai, Siah2-dependent concerted activity of
HIF and FoxA2 regulates formation of neuroendocrine phenotype and neuroendocrine
prostate tumors, Cancer Cell, 18 (2010) 23-38.
[6] J. Qi, M. Tripathi, R. Mishra, N. Sahgal, L. Fazli, S. Ettinger, W.J. Placzek, G. Claps, L.W.
Chung, D. Bowtell, M. Gleave, N. Bhowmick, Z.A. Ronai, The E3 ubiquitin ligase Siah2
contributes to castration-resistant prostate cancer by regulation of androgen receptor
transcriptional activity, Cancer Cell, 23 (2013) 332-346.
[
7] H. Kim, G. Claps, A. Moller, D. Bowtell, X. Lu, Z.A. Ronai, Siah2 regulates tight junction
integrity and cell polarity through control of ASPP2 stability, Oncogene, 33 (2014)
004-2010.
8] M. Shah, J.L. Stebbins, A. Dewing, J. Qi, M. Pellecchia, Z.A. Ronai, Inhibition of Siah2
2
[
ubiquitin ligase by vitamin K3 (menadione) attenuates hypoxia and MAPK signaling and
blocks melanoma tumorigenesis, Pigment Cell Melanoma Res, 22 (2009) 799-808.
[
9] J.L. Stebbins, E. Santelli, Y. Feng, S.K. De, A. Purves, K. Motamedchaboki, B. Wu, Z.A.
Ronai, R.C. Liddington, M. Pellecchia, Structure-based design of covalent Siah inhibitors,
Chem Biol, 20 (2013) 973-982.
[
10] P. Cloutier, M. Lavallee-Adam, D. Faubert, M. Blanchette, B. Coulombe, A newly
uncovered group of distantly related lysine methyltransferases preferentially interact
with molecular chaperones to regulate their activity, PLoS Genet, 9 (2013) e1003210.
[11] E. Santelli, M. Leone, C. Li, T. Fukushima, N.E. Preece, A.J. Olson, K.R. Ely, J.C. Reed,
M. Pellecchia, R.C. Liddington, S. Matsuzawa, Structural analysis of Siah1-Siah-
interacting protein interactions and insights into the assembly of an E3 ligase
multiprotein complex, J Biol Chem, 280 (2005) 34278-34287.
[12] N.A. Lack, P. Axerio-Cilies, P. Tavassoli, F.Q. Han, K.H. Chan, C. Feau, E. LeBlanc, E.T.
Guns, R.K. Guy, P.S. Rennie, A. Cherkasov, Targeting the binding function 3 (BF3) site of
the human androgen receptor through virtual screening, J Med Chem, 54 (2011) 8563-
8
573.
[13] F. Ban, K. Dalal, H. Li, E. LeBlanc, P.S. Rennie, A. Cherkasov, Best Practices of
Computer-Aided Drug Discovery: Lessons Learned from the Development of a
Preclinical Candidate for Prostate Cancer with a New Mechanism of Action, J Chem Inf
Model, 57 (2017) 1018-1028.

ACCEPTED MANUSCRIPT
[
14] MolecularOperatingEnvironment, https://www.chemcomp.com/, Molecular
Operating Environment (MOE), Chemical Computing Group ULC, 1010 Sherbooke St.
West, Suite #910, Montreal, QC, Canada, H3A 2R7, 2017., (2016).
[15] T.A. Halgren, R.B. Murphy, R.A. Friesner, H.S. Beard, L.L. Frye, W.T. Pollard, J.L.
Banks, Glide: a new approach for rapid, accurate docking and scoring. 2. Enrichment
factors in database screening, J Med Chem, 47 (2004) 1750-1759.
[
16] Z. Zsoldos, D. Reid, A. Simon, S.B. Sadjad, A.P. Johnson, eHiTS: a new fast, exhaustive
flexible ligand docking system, J Mol Graph Model, 26 (2007) 198-212.
17] J. Banerjee, R. Mishra, X. Li, R.S. Jackson, 2nd, A. Sharma, N.A. Bhowmick, A
reciprocal role of prostate cancer on stromal DNA damage, Oncogene, 33 (2014) 4924-
931.
18] J. Qi, M. Pellecchia, Z.A. Ronai, The Siah2-HIF-FoxA2 axis in prostate cancer - new
markers and therapeutic opportunities, Oncotarget, 1 (2010) 379-385.
19] H. Axelsson, H. Almqvist, B. Seashore-Ludlow, T. Lundback, Screening for Target
[
4
[
[
Engagement using the Cellular Thermal Shift Assay - CETSA, in: G.S. Sittampalam, N.P.
Coussens, K. Brimacombe, A. Grossman, M. Arkin, D. Auld, C. Austin, J. Baell, B. Bejcek,
T.D.Y. Chung, J.L. Dahlin, V. Devanaryan, T.L. Foley, M. Glicksman, M.D. Hall, J.V. Hass, J.
Inglese, P.W. Iversen, S.D. Kahl, S.C. Kales, M. Lal-Nag, Z. Li, J. McGee, O. McManus, T. Riss,
O.J. Trask, Jr., J.R. Weidner, M. Xia, X. Xu (Eds.) Assay Guidance Manual, Bethesda (MD),
2004.
[
20] M. Ocker, C. Herold, M. Ganslmayer, E.G. Hahn, D. Schuppan, The synthetic retinoid
adapalene inhibits proliferation and induces apoptosis in colorectal cancer cells in vitro,
Int J Cancer, 107 (2003) 453-459.
[
21] X.N. Shi, H. Li, H. Yao, X. Liu, L. Li, K.S. Leung, H.F. Kung, M.C. Lin, Adapalene inhibits
the activity of cyclin-dependent kinase 2 in colorectal carcinoma, Mol Med Rep, 12
2015) 6501-6508.
22] M. Ocker, C. Herold, M. Ganslmayer, S. Zopf, E.G. Hahn, D. Schuppan, Potentiated
anticancer effects on hepatoma cells by the retinoid adapalene, Cancer Lett, 208 (2004)
1-58.
23] T. Han, M. Goralski, E. Capota, S.B. Padrick, J. Kim, Y. Xie, D. Nijhawan, The
antitumor toxin CD437 is a direct inhibitor of DNA polymerase alpha, Nat Chem Biol, 12
2016) 511-515.
24] G. Polekhina, C.M. House, N. Traficante, J.P. Mackay, F. Relaix, D.A. Sassoon, M.W.
(
[
5
[
(
[
Parker, D.D. Bowtell, Siah ubiquitin ligase is structurally related to TRAF and modulates
TNF-alpha signaling, Nat Struct Biol, 9 (2002) 68-75.
[25] Q. Zhang, Z. Wang, F. Hou, R. Harding, X. Huang, A. Dong, J.R. Walker, Y. Tong, The
substrate binding domains of human SIAH E3 ubiquitin ligases are now crystal clear,
Biochim Biophys Acta, 1861 (2017) 3095-3105.
[
26] A.H. Tang, T.P. Neufeld, E. Kwan, G.M. Rubin, PHYL acts to down-regulate TTK88, a
transcriptional repressor of neuronal cell fates, by a SINA-dependent mechanism, Cell,
0 (1997) 459-467.
27] X. Dong, L. Tsuda, K.H. Zavitz, M. Lin, S. Li, R.W. Carthew, S.L. Zipursky, ebi regulates
epidermal growth factor receptor signaling pathways in Drosophila, Genes Dev, 13
1999) 954-965.
28] S.J. Boulton, A. Brook, K. Staehling-Hampton, P. Heitzler, N. Dyson, A role for Ebi in
neuronal cell cycle control, EMBO J, 19 (2000) 5376-5386.
29] C.M. House, I.J. Frew, H.L. Huang, G. Wiche, N. Traficante, E. Nice, B. Catimel, D.D.
Bowtell, A binding motif for Siah ubiquitin ligase, Proc Natl Acad Sci U S A, 100 (2003)
101-3106.
9
[
(
[
[
3

ACCEPTED MANUSCRIPT
[
30] S. Lipkowitz, A.M. Weissman, RINGs of good and evil: RING finger ubiquitin ligases
at the crossroads of tumour suppression and oncogenesis, Nat Rev Cancer, 11 (2011)
29-643.
31] C.S. Wong, A. Moller, Siah: a promising anticancer target, Cancer Res, 73 (2013)
400-2406.
32] T.R. Sarkar, S. Sharan, J. Wang, S.A. Pawar, C.A. Cantwell, P.F. Johnson, D.K.
6
[
2
[
Morrison, J.M. Wang, E. Sterneck, Identification of a Src tyrosine kinase/SIAH2 E3
ubiquitin ligase pathway that regulates C/EBPdelta expression and contributes to
transformation of breast tumor cells, Mol Cell Biol, 32 (2012) 320-332.
[
33] C.S. Wong, J. Sceneay, C.M. House, H.M. Halse, M.C. Liu, J. George, T.C. Hunnam, B.S.
Parker, I. Haviv, Z. Ronai, C. Cullinane, D.D. Bowtell, A. Moller, Vascular normalization by
loss of Siah2 results in increased chemotherapeutic efficacy, Cancer Res, 72 (2012)
1694-1704.

ACCEPTED MANUSCRIPT
Figure Legends
Figure 1. AS-MS screen and characterization of RLS-7 as a Siah small molecule
inhibitor. (a) Inhibition of hypoxia-induced HIF1α induction by seven representative
compounds from 3 scaffolds. HEK293 cells were incubated with either vehicle (DMSO) or
1
0 µM of indicated compounds for 6 h under hypoxia. Cells were harvested and whole cell
lysates were immunoblotted with the indicated antibodies. (N – normoxia; H - hypoxia).
Quantification of the proteins in immunoblots was performed with the aid of BioRad
densitometer, relative to loading control, noted under the respective gels. (b) RLS-7 structure.
(c) Comparison of RLS-6 with RLS-7 and close analogs. Cells were treated with different
compounds at 3 µM and 10 µM and subjected to Western Blot, as described above.
Quantification of immunoblots was performed using BioRad densitometer, relative to loading
controls, noted under the westerns (d) Inhibition of HRE luciferase activity by RLS-7. 293T
cells were transfected with HRE-firefly and renilla luciferase plasmids for 24 hours and
treated with indicated concentrations of RLS-7 under hypoxia. After 24 hours, cells were
lysed and subjected to a luciferase assay. Data were calculated relative to DMSO-treated
cells. Meansꢁ±ꢁstandard errors calculated from three independent experiments. *pꢁ<ꢁ0.05,
*
*pꢁ<ꢁ0.01, ***pꢁ<ꢁ0.001, ****pꢁ<ꢁ0.0001 compared to controls (one-way ANOVA with
Dunnett’s test). (e) Inhibition of HEK293 and melanoma cell viability by RLS-7. HEK293
and different melanoma cells were plated in 96-well plates and incubated with indicated
concentrations of RLS-7. Cell viability was assessed by ATPlite after 72 h. Growth inhibition
was calculated as percentage of DMSO-treated controls. Each bar represents the
meanꢁ±ꢁstandard deviation of three experiments. Shown is a representative experiment.
*
***pꢁ<ꢁ0.0001 as compared to the control (one-way ANOVA with Dunnett’s test). (f)
Colony formation assay. Indicated cultures were plated at low density (500 cells/well in 6-
well plates) and grown in medium containing vehicle, or 2 µM or 10 µM RLS-7. The number
of colonies formed after 10 days in culture was determined by crystal violet staining. (g)
Prostate cancer cell lines RV1 and PC3 were treated with indicated concentrations of RLS-7.
Cell viability was assessed 72 h later. ****pꢁ<ꢁ0.0001 as compared with the control, as
described above (one-way ANOVA with Dunnett’s test). (h) RV1 and Du145 cells were
plated at low density and grown in medium containing indicated concentrations of RLS-7.
The number of colonies formed after 2 weeks was determined by crystal violet staining.