Plants contain two distinct classes of functional tryptophan synthase beta proteins

Article abstract of DOI:10.1016/j.phytochem.2010.07.006

Tryptophan synthase β-subunits (TSBs) catalyze the last step in tryptophan biosynthesis, i.e. The condensation of indole and serine yielding tryptophan. In microorganisms two subfamilies of TSBs (here designated as type 1 and type 2) are known, which are only distantly related. Surprisingly, in all genomes of multicellular plants analyzed genes encoding both types are present. While type 1 enzymes are well established as components of tryptophan synthase complexes, type 2 enzymes in plants have not yet been characterized. Tissue specific expression of the TSB genes from Arabidopsis thaliana was analyzed. While AtTSB1 is the predominantly expressed isoform in vegetative tissues, AtTSB1 and AtTSBtype2 reach similar transcript levels in seeds. AtTSBtype2 protein was expressed in Escherichia coli and purified. It converted indole and serine to tryptophan with a strikingly low K_m-value for indole of ca. 74 nM. Attsbtype2 T-DNA insertion mutants showed no obvious deviation from the wild type phenotype, indicating that AtTSBtype2 function is not essential under standard growth conditions. As example for a monocot enzyme, maize TSB type 2 was analyzed and found to be transcribed in various tissues. ZmTSBtype2 was also catalytically active and here a K_m-value for indole of ca. 7 μM was determined. These data indicate that TSB type 2 enzymes generally are functionally expressed in plants. Their potential biological role is discussed.

Full text of DOI:10.1016/j.phytochem.2010.07.006

Phytochemistry 71 (2010) 1667–1672
Contents lists available at ScienceDirect
Phytochemistry
journal homepage: www.elsevier.com/locate/phytochem
Plants contain two distinct classes of functional tryptophan synthase beta proteins
1
*
Ruohe Yin , Monika Frey, Alfons Gierl, Erich Glawischnig
Lehrstuhl für Genetik, Technische Universität München, Emil-Ramann-Str. 8, 85354 Freising, Germany
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 10 June 2010
Received in revised form 9 July 2010
Available online 9 August 2010
Tryptophan synthase b-subunits (TSBs) catalyze the last step in tryptophan biosynthesis, i.e. the conden-
sation of indole and serine yielding tryptophan. In microorganisms two subfamilies of TSBs (here desig-
nated as type 1 and type 2) are known, which are only distantly related. Surprisingly, in all genomes of
multicellular plants analyzed genes encoding both types are present. While type 1 enzymes are well
established as components of tryptophan synthase complexes, type 2 enzymes in plants have not yet
been characterized. Tissue specific expression of the TSB genes from Arabidopsis thaliana was analyzed.
While AtTSB1 is the predominantly expressed isoform in vegetative tissues, AtTSB1 and AtTSBtype2 reach
similar transcript levels in seeds. AtTSBtype2 protein was expressed in Escherichia coli and purified. It
converted indole and serine to tryptophan with a strikingly low Km-value for indole of ca. 74 nM. Attsb-
type2 T-DNA insertion mutants showed no obvious deviation from the wild type phenotype, indicating
that AtTSBtype2 function is not essential under standard growth conditions. As example for a monocot
enzyme, maize TSB type 2 was analyzed and found to be transcribed in various tissues. ZmTSBtype2
Keywords:
Arabidopsis thaliana
Brassicaceae
Zea mays
Gramineae
Tryptophan synthase beta
Indole
Evolution
was also catalytically active and here a Km-value for indole of ca. 7 lM was determined. These data indi-
cate that TSB type 2 enzymes generally are functionally expressed in plants. Their potential biological role
is discussed.
Ó 2010 Elsevier Ltd. All rights reserved.
1. Introduction
et al., 2008; Radwanski et al., 1995), here referred to as type 1
TSBs. In maize, two highly homologous TSB type 1 genes are
The penultimate step of tryptophan biosynthesis is the cleavage
of indole-3-glycerol phosphate to glyceraldehyde-3-phosphate and
indole – the tryptophan synthase alpha (TSA) reaction. Indole then
condenses with serine yielding tryptophan – the tryptophan syn-
thase beta (TSB) reaction. In enterobacteria, such as Escherichia coli
and Salmonella typhimurium, the two reactions are tightly coupled
in a heterotetrameric tryptophan synthase complex, which allows
efficient channelling of intermediary indole from the active site in
TSA to the catalytic centre in TSB. In fungi tryptophan synthases
occur as TSA–TSB fusion proteins, which also provides metabolic
channelling of indole (for review, see Miles, 2001).
In plants tryptophan, in addition to its role as a protein compo-
nent, is the precursor of the phytohormone indole-3-acetic
acid (IAA), and a large number of defence compounds, such as
indole alkaloids and indole glucosinolates (Kriechbaumer and
Glawischnig, 2005). Consistent with this diversified function,
plants typically contain two or more isoforms of TSA and TSB.
Tryptophan synthase complexes are formed, which contain TSB
subunits homologous to the TSBs of enterobacteria (Kriechbaumer
known, which are essential for tryptophan biosynthesis (Wright
et al., 1992). Arabidopsis thaliana has three TSB type 1 genes: AtTSB1
(At5g54810), AtTSB2 (At4g27070) and AtTSB3 (At5g28237). Impor-
tance of AtTSB1 for tryptophan biosynthesis has been demon-
strated based on mutant analysis (Last et al., 1991).
Recently an alternative type of TSBs (TrpB2) has been charac-
terized in both Bacteria and Archeae (Hettwer and Sterner,
2002; Leopoldseder et al., 2006). To avoid ambiguity with the
established nomenclature for maize and Arabidopsis, for TrpB2
homologs we here refer to TSB type 2. These type 2 beta subunits
are only distantly related to the ‘‘classical” TrpB1 (type 1) en-
zymes and have been discussed to be the more ancient variants,
from which type 1 enzymes have evolved during early prokaryote
evolution (Merkl, 2007). The TSB type 2 enzymes from Thermot-
hoga maritima and Sulfolobus solfataricus were analyzed biochem-
ically. They were present as dimers and did not form a stable
tryptophan synthase complex with the corresponding TrpA (TSA)
protein (Hettwer and Sterner, 2002; Leopoldseder et al., 2006).
Characteristic for both TrpB2 proteins was a low Km-value for in-
dole. For T. maritima it was proposed that the biological role of TSB
type 2 is to prevent highly hydrophobic indole, which has escaped
the tryptophan synthase complex, from travelling through the
membrane and to channel it back into metabolism (Hettwer and
Sterner, 2002).
* Corresponding author. Tel.: +49 8161 715643; fax: +49 8161 715636.
E-mail address: egl@wzw.tum.de (E. Glawischnig).
1
Present address: Institute of Biochemical Plant Pathology, Helmholtz Zentrum
München, 85764 Neuherberg, Germany.
0031-9422/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.phytochem.2010.07.006

1668
R. Yin et al. / Phytochemistry 71 (2010) 1667–1672
Surprisingly, a gene encoding a TSB type 2 homolog (AtTSB-
TSB types have been retained since the origin of plants, with pos-
sible loss of the type 2 orthologs in some lineages of algae.
To establish a potential biological role for plant TSB type 2,
which so far have not been investigated, we have functionally ana-
lyzed the isoform from A. thaliana.
type2; At5g38530) is also found in the genome of A. thaliana. It is
more closely related to T. maritima TrpB2 or S. solfataricus TrpB2
than to the other TSBs in Arabidopsis. In this work we surveyed
plant genomes for TSB type 2 genes and functionally analyzed the
Arabidopsis and maize orthologs.
2.2. Expression pattern of A. thaliana TSB type 2
2. Results
Publicly available array data (AtGenExpress) were analyzed for
expression of AtTSBtype2 in relation to AtTSB1 and AtTSB2. In most
tissues AtTSBtype2 expression was low in relation to AtTSB1. In con-
trast, AtTSBtype2 transcript levels strongly increased during seed
development. AtTSB3 was not included in the Affimetrix array. To
get a complete overview on TSB expression in A. thaliana, quantita-
tive RT-PCR was performed in different tissues. In all tissues except
seeds, AtTSB1 was expressed at much higher level in comparison to
any of the other three TSB genes (Fig. 2). This observation is in
accordance with a morphological phenotype of the TSB1 mutant
trp2 (Last et al., 1991). In Arabidopsis, tryptophan biosynthesis is
strongly induced upon pathogen infection, providing tryptophan
as precursor for camalexin (for review see Glawischnig, 2007). Re-
sponse to a Nep-1-like protein from Phythium aphanidermatum
(PaNie), which triggers a multitude of pathogen defence reactions
(Qutob et al., 2006) was assayed in plants expressing PaNie under
control of an ethanol inducible promoter (Alc:PaNie) (Rauhut et al.,
2009). The three type 1 isoforms were strongly induced by expres-
sion of PaNie toxin triggered by spraying Alc:PaNie plants with
ethanol. This was not observed for AtTSBtype2 (Fig. 2A). In contrast
to other tissues analyzed, AtTSBtype2 transcript levels in seeds
were in the same range as AtTSB1 and AtTSB2 levels (Fig. 2B).
2.1. TSB type 2 is widespread in plants
The large set of sequenced microbial genomes, allowed a com-
prehensive survey of TSB genes of type 1 and type 2. Among Bac-
teria and Archeae, phylogenetic subgroups, which contain either
of the two or both types were identified (Merkl, 2007). We have
now analyzed the genomes of the following plant species for TSB
genes: A. thaliana, Populus trichocarpa (poplar), Vitis vinifera (grape-
vine), Zea mays (maize), Sorghum bicololor, Oryza sativa (rice), the
lycophyte Selaginella moellendorffii, and the moss Physcomitrella
patens. All these plant genomes analyzed contain at least one ‘‘clas-
sical” type 1 TSB gene. In dicots these type 1 genes cluster in two
subgroups, an AtTSB1 group related to the monocot type 1 genes,
and an AtTSB3 group (Fig. 1). In addition, in each genome there is
one type 2 TSB gene present. These type 2 genes show a much
higher degree of homology to the type 2 genes from Bacteria and
Archeae (up to 70% identity on amino acid level) than to other
plant TSB genes (e.g. AtTSB1/AtTSBtype2: 29% amino acid identity)
(Fig. 1). The accession numbers of identified TSB genes, classified as
type 1 or type 2 are available in Supplementary Table 1.
While in the genomes of the red alga Cyanidioschyzon merolae
and the green algae Ostreococcus lucimarinus and Chlamydomonas
reinhardtii only one TSB type 1 gene was detected, the green alga
Chlorella sp. NC64A contains both type 1 and type 2 genes, each
showing homology to corresponding genes from the cyanobacte-
rium Cyanothece sp. PCC 7822 (Fig. 1). This indicates that both
2.3. AtTSBtype2 insertion mutants are fully viable
Five putative T-DNA-insertion lines were analyzed for insertion
in AtTSBtype2. Only SALK_011904 was confirmed containing a
Fig. 1. Phylogenetic reconstruction of TSB protein sequences. For plants with full or extensive genome sequence information available and for selected microorganisms all TSB
genes are indicated. All multicellular plants analyzed contained one ‘‘type 2” and at least one ‘‘type 1” gene. Phylogenetic reconstruction of the inferred amino-acid sequence
was accomplished by SplitsTree (Huson, 1998). Type 1 genes: Acronym_isoform; type 2 genes Acronym_T2. Definitions of organismal acronyms and accession numbers are
found in Supplementary Table 1. UGT78D2 (At5g17050) was used as outgroup.

R. Yin et al. / Phytochemistry 71 (2010) 1667–1672
1669
Fig. 2. Expression analysis of the four Arabidopsis TSB genes. (A) Transcript levels in different tissues of Col-0 WT or in rosette leaves of Col-0 plants expressing the Nep1-like
protein PaNie under control of an alcohol inducible promoter 0, 2, 6 and 8 h after ethanol induction. TSB1 was predominant in all tissues. TSB1, TSB2, and TSB3 were strongly
induced by PaNie expression. Actin1 was used for normalisation. (B) TSB expression in dry seeds. No reproducible detection of TSB3 and Actin1 reference gene could be
achieved. Hence, here the data are normalized with respect to total RNA, n = 3.
T-DNA insertion in an exon. In addition, AtTSBtype2 was expressed
under control of the 35S promoter. Three independent lines, each
expressing AtTSBtype2 ca. 5–8-fold with respect to wild type, were
subsequently used as biological replicates in phenotype analysis.
No alteration in plant morphology was observed for T-DNA inser-
tion lines in comparison to the wild type (data not shown). Specif-
ically, seedling root growth was not significantly changed in the
knockout mutant in comparison to the wild type (Supplementary
Fig. 1).
ported for microbial TSB type 2 orthologs (Hettwer and Sterner,
2002; Leopoldseder et al., 2006).
2.5. Functional TSB Type 2 is expressed in maize
TSB type 2 genes are widespread, possibly universal, in the mul-
ticellular plants. Maize was chosen as a monocot species for func-
tional analysis, as here TSA homologs and TSB type 1 enzymes have
been previously analyzed in detail (Frey et al., 1997; Frey et al.,
2000; Kriechbaumer et al., 2008; Wright et al., 1992). Based on Z.
mays PCO109765 mRNA sequence, a full length ZmTSBtype2 cDNA
clone was isolated from a k-phage seedling cDNA library. The
expression pattern of the maize TSB genes was analyzed by quan-
titative RT-PCR. Low but clearly detectable expression of ZmTSB-
type2 was observed in all tissues analyzed (Supplementary Fig. 3)
with no clear preference to developing kernels.
2.4. TSB type 2 from A. thaliana shows very strong binding of indole
To test whether AtTSBtype2 protein has TSB activity, it was ex-
pressed as His-Tag fusion in E. coli BL21 (DE3) and purified. AtTSB-
type2 readily converted indole and serine to tryptophan, which
was quantified by fluorescence detection after HPLC separation.
No product was observed in boiled control, or if indole or serine
was missing from the reaction mixture. The kinetic properties of
AtTSBtype2 were determined (Fig. 3). Strikingly, an extremely
low Km-value for indole of 74 12 nM was detected. For serine a
Km-value of 35 5 mM was determined. A kcat-value of app.
0.01 sÀ1 (0.0070 sÀ1 (Fig. 3A)/0.0155 sÀ1 (Fig. 3B)) was determined,
which is low in comparison to microbial TSB type 2 proteins
(T. maritima TrpB2: 0.44 sÀ1, S. solfataricus TrpB2i: 0.20 sÀ1, TrpB2i:
0.032 sÀ1), (Hettwer and Sterner, 2002; Leopoldseder et al., 2006).
Serine deaminase activity, which was proposed for TSB related
proteins (Leopoldseder et al., 2006; Xie et al., 2002), was not
observed.
ZmTSBtype2 was expressed in E. coli, purified, and its kinetic
parameters were determined (Fig. 3C and D). ZmTSBtype2 showed
TSB activity, with an apparent Km-value for serine of ca. 6.2 mM
and for indole of ca. 6.8 lM. In comparison to AtTSBtype2 the
strong affinity of ZmTSBtype2 towards indole was less pronounced.
Again, a striking difference between the Km-values for the two sub-
strates was observed, which however was three orders of magni-
tude less in comparison to AtTSBtype2. A kcat-value of app.
0.02 sÀ1 (0.010 sÀ1 (Fig. 3C)/0.022 sÀ1 (Fig. 3D)) was determined,
which is one order of magnitude lower in comparison to ZmTSB1
(0.29 sÀ1, Kriechbaumer et al., 2008).
The majority of freshly purified AtTSBtype2 protein separated
by size exclusion chromatography (Kriechbaumer et al., 2008)
eluted at ca. 90 kD (Supplementary Fig. 2). This is consistent with
formation of homodimers, and similar observations have been re-
3. Discussion
Tryptophan synthase beta genes have diverged into two dis-
tinct subclasses, here referred to as ‘‘type 1” and ‘‘type 2”, early

1670
R. Yin et al. / Phytochemistry 71 (2010) 1667–1672
Fig. 3. Kinetic analysis of TSB activity. Tryptophan formation by purified AtTSBtype2 (A, B) or ZmTSBtype2 (C, D) was quantified applying varying concentrations of indole (A,
C) or serine (B, D). A strikingly low Km-value of ca. 74 nM was determined for AtTSBtype2 and the substrate indole.
in evolution of microorganisms (Merkl, 2007). Surprisingly the
genomes of all vascular plants for which a full or largely complete
sequence was available, the moss P. patens, and the green alga
Chlorella sp. NC64A contain members of both types. This demon-
strates that both types have been retained since the origin of
plants and are widespread, if not universally found in higher
plants. Therefore it is likely that type 2 enzymes have a unique
function that was positively selected during plant evolution.
To address a potential biological role for TSB type 2 we have
analyzed the expression pattern of the genes from maize and A.
thaliana and characterized the corresponding enzymatic activities.
In both the monocot and the dicot species the genes were ex-
pressed and the corresponding proteins were catalytically active.
In particular the Arabidopsis enzyme exhibited a strikingly low
Km-value for indole. Based on their enzymatic characteristics,
two different hypothetical functions for plant TSB type 2 proteins
can be proposed:
formation was observed (data not shown), leaving it open,
whether AtTSBtype2 catalyzes the reaction of indole with a
molecule other than serine.
(ii) Efficient removal of free indole: For T. maritima it has been
proposed that TrpB2 prevents metabolic loss of free indole
by converting it to tryptophan (Hettwer and Sterner,
2002). Plants form tryptophan synthase complexes
(Kriechbaumer et al., 2008), but these complexes are possi-
bly leaky. In addition, functional TSA monomers (indole-3-
glycerol phosphate lyases), such as maize Bx1 (Frey et al.,
1997) and IGL (Frey et al., 2000) are optimized for the syn-
thesis of free indole. Recent data suggest that such formation
of free indole is widespread in plants (Schullehner et al.,
2008). Indole is a known extracellular signal in bacteria
(Lee et al., 2007; Wang et al., 2001). In maize, indole is syn-
thesized by IGL as a signal for tritrophic interaction (Frey
et al., 2000). Possibly, plants also use indole, synthesized
by functional indole-3-glycerol phosphate lyases, as signal-
ling compound for cellular regulation (Schullehner et al.,
2008). As with all signalling processes, it is crucial that the
initial signal is removable. TSB type 2 could possibly func-
tion in elimination of the transient indole signal. So far it
is unclear, whether indole is a signalling component e.g. in
Arabidopsis. We have surveyed publicly available transcri-
ptomics data (AtGenExpress) for expression pattern of
AtTSBtype2. Specific characteristic responses to phytohor-
mones, biotic and abiotic stress signals, or co-regulation
with AtTSA (At3g54640) or AtTSA2 (At4g02610), which could
be involved in indole formation, were not observed. Accord-
ingly, ZmTSBtype2 transcript levels (Supplementary Table 2)
(i) Biosynthesis of a metabolite analogous to tryptophan: Simi-
lar to TrpB2 proteins from microorganisms (Leopoldseder
et al., 2006), the Km-value for serine of TSB type 2 from Ara-
bidopsis or maize was in the milimolar range. This contrasts
with the characteristics of type 1 enzymes, e.g. ZmTSB1 has a
Km-value for indole of ca. 24 lM (Kriechbaumer et al., 2008).
Therefore the question can be addressed, whether serine is a
substrate and tryptophan indeed a product of TSB type 2
reaction in vivo. As a candidate reaction, we have tested AtT-
SBtype2 catalyzed condensation of glyoxylic acid and indole,
which are the reactants in the chemical synthesis of indole-
3-acetic acid (IAA) (Johnson and Crosby, 1973). No product

R. Yin et al. / Phytochemistry 71 (2010) 1667–1672
1671
did not correlate with Bx1 or IGL expression (Kriechbaumer
et al., 2008). However, a regulatory circuit could also be
functional with TSB type 2 being constitutively expressed
at low levels allowing constant removal of free indole.
from cDNA bank of bx1 seedlings treated with volicitin (Frey et al.,
2000). The coding sequence, excluding a 45 N-terminal amino acid
putative plastid targeting sequence, was amplified with the follow-
ing primers:GAGAAGCTTGCATATGACCACTAGGGCC/CATGTGCAGT
TGGAGCTCGAATTC TCAGACTTTG. PCR products were cloned into
pET28a His-tag vector, re-sequenced, and the proteins were heter-
ologously expressed and purified under native conditions by His-
tag affinity purification via Ni–NTA agarose and protein concentra-
tions were determined colorimetrically (Bio-Rad Protein Assay),
according to the manufacturers’ suggestions (Qiagen, Hilden,
Germany; Bio-Rad, Munich, Germany).
4. Conclusion
Tryptophan synthase beta type 2 enzymes are functionally ex-
pressed in both Arabidopsis and maize. They convert indole and
serine to tryptophan with a strikingly low Km-value for indole.
Their biological function remains to be subject of speculation; as
yet there is no clear evidence for a function of TSB type 2 in pre-
venting loss of indole, signalling, or alternative biosynthetic path-
ways. No mutant phenotype for Arabidopsis TSB type 2 was yet
observed, indicating TSB type 2 is not essential under optimal
growth conditions. However, TSB type 2 genes are present in all
genomes of multicellular plants completely sequenced so far and
are phylogenetically related. This demonstrates that they have an
important but yet undiscovered function for plant fitness.
TSB reaction was performed with 2
in 80 mM potassium phosphate buffer, pH 8.2 containing the fol-
lowing substrates: 50 M indole, 60 mM L-serine, 50 M pyridoxal
lg purified protein at 30 °C,
l
l
phosphate; concentration ranges were analyzed for determination
of kinetic parameters. For test of glyoxylic acid turnover 10 mM or
50 mM final concentration and pH 7.6 were used. After 20 min the
reaction was stopped by the addition of 1 vol MeOH. Tryptophan
and IAA were quantified by HPLC (RP-column: LiChroCART
125–4, RP-18, 5 lm; Merck, West Point, PA) using diode array
(PDA-100, Dionex, Idstein, Germany) and fluorescence detection
(RF-10AXL, Shimadzu, Duisburg, Germany; excitation: 285 nm,
emission: 360 nm). The mobile phase was delivered with a flow
rate of 1 ml minÀ1 with an initial mixture of 15% (v/v) MeOH in
0.3% (v/v) HCOOH followed by a 15 min linear gradient to 100%
MeOH. For calibration, standard curves were generated using
authentic standards covering the relevant concentration ranges.
Based on the determined protein concentrations and its molecular
weight, turnover was calculated as nmol tryptophan sÀ1 nmolÀ1
TSB type 2. kcat-Values were determined in two series of measure-
ments, varying indole or serine concentrations, respectively. En-
zyme preparations were analyzed for serine deaminase activity
for 4 h at 37 °C in 0.1 M KPi, pH 7.8, 40 mM Ser, 10 mM reduced
glutathione, 0.2 mM pyridoxal phosphate, 80 mM NADH, 190 U
lactate dehydrogenase (Tsai et al., 1978).
5. Experimental
5.1. Sequence analysis
TSB protein sequences (Supplementary Table 1) were retrieved
by homology search using Arabidopsis TSB1 (At5g54810) and TSB
type 2 (At5g38530). Amino-acid sequences were aligned in Clu-
stalW and a phylogenetic network was calculated with SplitsTree
(Huson, 1998) excluding parsimony–uninformative sites, using
UGT78D2 (At5g17050) as outgroup.
5.2. Plant material and growth conditions
Arabidopsis plants were grown in soil mixed with sand (3:1) in
a growth chamber at 12 h light, 21 °C, 80–100 lmol of photons per
square meter per second and 40% relative humidity.
For the detection of TSB type 2 dimerisation in vitro, size exclu-
sion chromatography was performed as described (Kriechbaumer
et al., 2008) in the following buffer: 100 mM Tris, pH 8.0,
100 mM KCl.
SALK line 011904 was confirmed as T-DNA insertion mutant in
the 1st exon of AtTSBtype2. SALK line 124293 was shown to carry a
T-DNA insertion in the 4th intron, SALK lines 082810 and 162268
and SAIL_46_G06 could not be confirmed as insertion mutants in
AtTSBtype2. For the generation of plants expressing AtTSBtype2 un-
der the control of the 35S promoter the coding sequence was
cloned with the USER strategy into pCambia 330035Su (Nour-Eldin
et al., 2006) after amplification with the following primers:
GGCTTAAUATGGCCTCTCAATTGCTTTTACC, GGTTTAAUTTAAACAA-
CATGAGGAACCTTGG. Three independent overexpression lines,
confirmed by quantitative RT-PCR using leave tissue, were pheno-
typically analyzed in detail.
Acknowledgement
We thank Prof. Reinhard Sterner and co-workers for fruitful dis-
cussions, Andreas Braun, Sina Habib, Charlotte Kirchhelle, and Sab-
rina Kutznia for practical assistance, Dr. Thomas Rauhut for
supporting cloning work, Dr. Verena Kriechbaumer and Kerstin
Schuster for helpful suggestions, Prof. Barbara Halkier for providing
pCambia 330035Su, and the Deutsche Forschungsgemeinschaft for
financial support.
5.3. RNA extraction and quantitative RT-PCR
Appendix A. Supplementary data
Total RNA was isolated from the Arabidopsis Col-0 or the maize
line B73 and quantitative real time PCR was carried out using the
LightCycler/SybÒ-Green dye system (Roche, Mannheim, Germany).
Transcript analysis in maize tissues was performed as described
(Kriechbaumer et al., 2008). Primers are given in Supplementary
Table 2.
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.phytochem.2010.07.006.
References
Frey, M., Chomet, P., Glawischnig, E., Stettner, C., Grün, S., Winklmair, A., Eisenreich,
W., Bacher, A., Meeley, R.B., Briggs, S.P., Simcox, K., Gierl, A., 1997. Analysis of a
chemical plant defense mechanism in grasses. Science 277, 696–699.
Frey, M., Stettner, C., Pare, P.W., Schmelz, E.A., Tumlinson, J.H., Gierl, A., 2000. An
herbivore elicitor activates the gene for indole emission in maize. Proc. Natl.
Acad. Sci. USA. 97, 14801–14806.
5.4. Protein expression and characterisation
The coding sequence of AtTSBtype2, excluding a 53 N-terminal
amino acid putative plastid targeting sequence, was amplified from
Col-0 leaf cDNA with the following primers: CTAGCTTAAGACATAT
GGCAGCTTTGAGA/TTATGGGGCCATGGATCCT TAAACAACA. Based
on Z. mays PCO109765 mRNA sequence, ZmTSBtype2 was isolated
Glawischnig, E., 2007. Camalexin. Phytochemistry 68, 401–406.
Hettwer, S., Sterner, R., 2002. A novel tryptophan synthase beta-subunit from the
hyperthermophile Thermotoga maritima. Quaternary structure, steady-state
kinetics, and putative physiological role. J. Biol. Chem. 277, 8194–8201.

1672
R. Yin et al. / Phytochemistry 71 (2010) 1667–1672
Huson, D.H., 1998. SplitsTree: analyzing and visualizing evolutionary data.
Bioinformatics 14, 68–73.
Johnson, H.E., Crosby, D.G., 1973. Synthesis of indole-3-acetic acid. Org. Synth. 5, 654.
Kriechbaumer, V., Glawischnig, E., 2005. Auxin biosynthesis within the network of
tryptophan metabolism. J. Nanobiotechnol. 2, 55–58.
Kriechbaumer, V., Weigang, L., Fiesselmann, A., Letzel, T., Frey, M., Gierl, A.,
Glawischnig, E., 2008. Characterisation of the tryptophan synthase alpha
subunit in maize. BMC Plant Biol. 8, 44.
Last, R.L., Bissinger, P.H., Mahoney, D.J., Radwanski, E.R., Fink, G.R., 1991.
Tryptophan mutants in Arabidopsis: the consequences of duplicated
tryptophan synthase beta genes. Plant Cell 3, 345–358.
Lee, J., Jayaraman, A., Wood, T., 2007. Indole is an inter-species biofilm signal
mediated by SdiA. BMC Microbiol. 7, 42.
Leopoldseder, S., Hettwer, S., Sterner, R., 2006. Evolution of multi-enzyme
complexes: the case of tryptophan synthase. Biochemistry 45, 14111–14119.
Merkl, R., 2007. Modelling the evolution of the archeal tryptophan synthase. BMC
Evol. Biol. 7, 59.
Lacombe, B., Watanabe, N., Lam, E., Schlichting, R., Scheel, D., Nau, K., Dodt, G.,
Hubert, D., Gijzen, M., Nürnberger, T., 2006. Phytotoxicity and innate immune
responses induced by nep1-like proteins. Plant Cell 18, 3721–3744.
Radwanski, E.R., Zhao, J., Last, R.L., 1995. Arabidopsis thaliana tryptophan synthase
alpha: gene cloning, expression, and subunit interaction. Mol. Gen. Genet. 248,
657–667.
Rauhut, T., Luberacki, B., Seitz, H.U., Glawischnig, E., 2009. Inducible expression of a
Nep1-like protein serves as a model trigger system of camalexin biosynthesis.
Phytochemistry 70, 185–189.
Schullehner, K., Dick, R., Vitzthum, F., Schwab, W., Brandt, W., Frey, M., Gierl, A.,
2008. Benzoxazinoid biosynthesis in dicot plants. Phytochemistry 69, 2668–
2677.
Tsai, M.D., Schleicher, E., Potts, R., Skye, G.E., Floss, H.G., 1978. Stereochemistry and
mechanism of reactions catalyzed by tryptophan synthetase and its beta2
subunit. J. Biol. Chem. 253, 5344–5349.
Wang, D., Ding, X., Rather, P.N., 2001. Indole can act as an extracellular signal in
Escherichia coli. J. Bacteriol. 183, 4210–4216.
Miles, E.W., 2001. Tryptophan synthase:
a
multienzyme complex with an
Wright, A.D., Moehlenkamp, C.A., Perrot, G.H., Neuffer, M.G., Cone, K.C., 1992. The
maize auxotrophic mutant orange pericarp is defective in duplicate genes for
tryptophan synthase beta. Plant Cell 4, 711–719.
Xie, G., Forst, C., Bonner, C., Jensen, R.A., 2002. Significance of two distinct types of
tryptophan synthase beta chain in Bacteria, Archaea and higher plants. Genome
Biol. 3, 4.
intramolecular tunnel. Chem. Rec. 1, 140–151.
Nour-Eldin, H.H., Hansen, B.G., Norholm, M.H., Jensen, J.K., Halkier, B.A., 2006.
Advancing uracil-excision based cloning towards an ideal technique for cloning
PCR fragments. Nucleic Acids Res. 34, e122.
Qutob, D., Kemmerling, B., Brunner, F., Küfner, I., Engelhardt, S., Gust, A.A.,
Luberacki, B., Seitz, H.U., Stahl, D., Rauhut, T., Glawischnig, E., Schween, G.,