An investigative study of antitumor properties of a novel thiazolo[4,5-d]pyrimidine small molecule revealing superior antitumor activity with CDK1 selectivity and potent pro-apoptotic properties

Article abstract of DOI:10.1016/j.bmc.2020.115633

New thiazolo[4,5-d]pyrimidine analogues were synthesized and biologically assessed in-vitro for their antineoplastic activity. The growth inhibitory effects of these compounds were assessed through the National Cancer Institute-United States of America (NCI-USA) anticancer screening program. Compound 5 (7-Chloro-3-(2,4-dimethoxyphenyl)-5-methylthiazolo[4,5-d]pyrimidine-2(3H)-thione) was found to have a potent and broad-spectrum cytotoxic action against NCI panel with GI₅₀ (50% growth inhibition concentration) mean graph midpoint (MG-MID) = 2.88 μM. MTT assay was used to determine IC₅₀ values of the most potent agent against HCT-116 colorectal carcinoma and WI-38 human lung fibroblast cell lines; 5.33 μM ± 0.69 and 21.69 μM ± 1.04, respectively. Flow cytometric analysis revealed that compound 5 triggered apoptosis and G2/M cell cycle arrest. The ability of compound 5 to inhibit CDK1 (Cyclin-Dependent Kinase 1)/Cyclin B complex was evaluated, and its IC₅₀ value was 97 nM ± 2.33. Moreover, according to the gene expression analysis, compound 5 up-regulated p53, BAX, cytochrome c, caspases-3,-8 and-9 besides down-regulated Bcl-2. In conclusion, compound 5 exerted a potent pro-apoptotic activity through the activation of the intrinsic apoptotic pathway and arrested the cell cycle at the G2/M phase.

Full text of DOI:10.1016/j.bmc.2020.115633

Journal Pre-proofs
An investigative study of antitumor properties of a novel thiazolo[4,5-d]pyri‐
midine small molecule revealing superior antitumor activity with CDK1 se‐
lectivity and potent pro-apoptotic properties
Sameh H. Mohamed, Hossam R. Elgiushy, Heba Taha, Sherif F. Hammad,
Nageh A. Abou-Taleb, Khaled A. M. Abouzid, Hussein Sawaf, Zeinab
Hassan
PII:
DOI:
Reference:
S0968-0896(20)30463-6
https://doi.org/10.1016/j.bmc.2020.115633
BMC 115633
To appear in:
Bioorganic & Medicinal Chemistry
Received Date:
Revised Date:
Accepted Date:
4 April 2020
25 June 2020
30 June 2020
Please cite this article as: Mohamed, S.H., Elgiushy, H.R., Taha, H., Hammad, S.F., Abou-Taleb, N.A., A. M.
Abouzid, K., Sawaf, H., Hassan, Z., An investigative study of antitumor properties of a novel thiazolo[4,5-
d]pyrimidine small molecule revealing superior antitumor activity with CDK1 selectivity and potent pro-
apoptotic properties, Bioorganic & Medicinal Chemistry (2020), doi: https://doi.org/10.1016/j.bmc.2020.115633
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover
page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version
will undergo additional copyediting, typesetting and review before it is published in its final form, but we are
providing this version to give early visibility of the article. Please note that, during the production process, errors
may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2020 Published by Elsevier Ltd.

An investigative study of antitumor properties of a novel
thiazolo[4,5-d]pyrimidine small molecule revealing superior antitumor
activity with CDK1 selectivity and potent pro-apoptotic properties
Sameh H. Mohameda,*, Hossam R. Elgiushyb, Heba Tahac, Sherif F. Hammadb,d, Nageh
A. Abou-Talebb, Khaled A. M. Abouzide,f, Hussein Sawafa, Zeinab Hassanc.
a Department of Biochemistry, Faculty of Pharmacy, Egyptian Russian University, Egypt, Badr
11829, Cairo, Egypt
b Pharmaceutical Chemistry Department, Faculty of Pharmacy, Helwan University, Ain Helwan
11795, Cairo, Egypt.
c Biochemistry and Molecular biology department, Faculty of Pharmacy, Helwan University, Ain
Helwan 11795, Helwan, Cairo, Egypt
d
Basic and Applied Sciences Institute, Egypt-Japan University of Science and Technology (E-
JUST), New Borg El-Arab City, 21934, Alexandria, Egypt
e Pharmaceutical Chemistry Department, Faculty of Pharmacy, Ain Shams University, Abbassia
11566, Cairo, Egypt
f
Department of Organic and Medicinal Chemistry, Faculty of Pharmacy, University of Sadat
City, Sadat City, Egypt
*Corresponding author: SH Mohamed (sameh-hosam@eru.edu.eg)
Department of Biochemistry, Faculty of Pharmacy, Egyptian Russian University, Egypt, Badr
11829, Cairo, Egypt
1

ABSTRACT
New thiazolo[4,5-d]pyrimidine analogues were synthesized and biologically assessed
in-vitro for their antineoplastic activity. The growth inhibitory effects of these
compounds were assessed through the National Cancer Institute-United States of
America (NCI-USA) anticancer screening program. Compound 5 (7-Chloro-3-(2,4-
dimethoxyphenyl)-5-methylthiazolo[4,5-d]pyrimidine-2(3H)-thione) was found to have a
potent and broad-spectrum cytotoxic action against NCI panel with GI50 (50% growth
inhibition concentration) mean graph midpoint (MG-MID) = 2.88µM. MTT assay was
used to determine IC50 values of the most potent agent against HCT-116 colorectal
carcinoma and WI-38 human lung fibroblast cell lines; 5.33 µM ±0.69 and 21.69µM
±1.04, respectively. Flow cytometric analysis revealed that compound 5 triggered
apoptosis and G2/M cell cycle arrest. The ability of compound 5 to inhibit CDK1
(Cyclin-Dependent Kinase 1)/Cyclin B complex was evaluated, and its IC50 value was
97nM ± 2.33. Moreover, according to the gene expression analysis, compound 5 up-
regulated P53, BAX, cytochrome c, caspases 3,8 and 9 besides down-regulated Bcl-2. In
conclusion, compound 5 exerted a potent pro-apoptotic activity through the activation of
the intrinsic apoptotic pathway and arrested the cell cycle at the G2/M phase.
__________
Keywords: thiazolo[4,5-d]pyrimidine; anticancer activity; apoptosis; cell cycle arrest.
2

1. Introduction
Apoptosis is a fundamental mechanism to maintain regular proliferation and
tissue homeostasis. Mainly, proper apoptotic signalling is paramount to preserve the
balance between cellular generation and turnover as well as safeguard the integrity of
genetic materials. This is substantial to protect the body from numerous diseases and
malignancies.1 Moreover, regular cell division is primarily dependent on the properly
controlled progression of the cell cycle that is monitored by several regulatory processes
and checkpoints, which ensure its flawless progression. Defects in these regulators can
stifle the damage's normal responses and can result in genomic instability and
malignancy. Cyclins and their associated cyclin-dependent kinases (CDKs) are
considered the chief regulators of the cell cycle.2
Thus, Induction of apoptosis and arresting the cell cycle have been known as
promising strategies for curbing cancer growth. Several intracellular molecules, such as
P53, can be targeted to achieve these strategies. For instance, p53 can suppress the tumor
formation through arresting the cell cycle at the G2/M phase and inducing apoptosis.3
This is because P53 inhibits the activity and reduces the protein level of both cyclin B1
and CDK1, both of which control the transition of cells to the M phase.4 Moreover, P53
triggers apoptosis through the pro-apoptotic protein (BAX) up-regulation and the anti-
apoptotic protein (Bcl-2) down-regulation. BAX, in turn, induces mitochondrial outer
membrane permeabilization (MOMP) and the subsequent cytochrome c release from the
mitochondria, which activates caspase-9 through apoptosome formation.5
Thiazolo[4,5-d]pyrimidine scaffold is a biological isostere of purine system, the
most naturally abundant nitrogenous base, which is responsible for a wide array of
physiological functions. Thiazolo[4,5-d]pyrimidine is perceived to be a medicinally
valuable scaffold.6 Regarding antitumor activity, many research papers reported
thiazolo[4,5-d]pyrimidine derivatives with considerable antitumor activity. Here, we
depicted six different sets of previously reported thiazolo[4,5-d]pyrimidine derivatives
that were evaluated for their antitumor activity, fig.1. The first three sets (set 1, 2 and 3)
were evaluated through NCI-USA in-vitro screening program at both single-dose and
five-doses levels. The 1st set represents the most active compounds among a series of
twenty compounds.7 Among this set, compound I was the most active with GI50 (50%
3

growth inhibition concentration) values of 0.004 and 0.003 µM/mL for ovarian and
prostate cancers, respectively. The 2nd set represents two compounds among a set of
twelve compounds selected for evaluation by the NCI-USA in vitro screening program.8
These two compounds were the only chosen compounds for five dose screening;
compound IV exhibited better antitumor activity and proved to be very potent against
lung cancer HOP-92 and ovarian cancer IGROV-1 with GI50 values of <0.01 µmol and
0.18 µmol, respectively. The 3rd set represents compound VI, which is the most active
among a set of five compounds. This compound was the only one selected by NCI-USA
for five dose screening against 60 cell line panel.9 It produced GI50 values of 0.0017
µM/mL for IGROV ovarian cancer cell line, 0.0012 µM/mL for NCI-H522 non-small
cell lung cancer (NSCLC) cell line and 0.0027 µM/mL for SW620 colon cancer cell line.
The 4th set indicates compounds VII, VIII and IX that are the most potent among a set of
twenty-two compounds according to their cytotoxic activity, with sub-micromolar IC50
values.10 Compounds X and XI in the 5th set are effective apoptosis-inducing agents that
showed significant antiproliferative activity and up-regulated the activity of caspase 3.11
Compounds XII and XIII from the 6th set inhibited the growth of cancer cells and
induced apoptosis; compound XII was able to constrain cellular growth of HL-60 cells
by 59% and raise the population of sub-G cells by 19%. Also, compound XIII inhibited
the growth of A549 cells by 81%, increased the sub-G population by 46% and caused a
G2 cell cycle arrest.12
4

Fig.1: Some reported thiazolo[4,5-d]pyrimidine derivatives exhibiting promising
antitumor activity.
In the present study, we report the synthesis and multilevel biological evaluation
of four target compounds based on thiazolo[4,5-d]pyrimidine scaffold, fig.2. Our target
compounds (compounds 3, 4, 5 and 6) keep the common structural features of most
potent compounds shown in the example sets 1, 2 and 3, fig.1, (Core thiazolo[4,5-
d]pyrimidine; 2-thioxo or 2-oxo at C2; 3-substitution: substituted phenyl; 5-substitution:
Methyl group; 7-substitution: chloro or oxo). The incorporation of two methoxy groups
at the phenyl substitution at position-3 (2,4-dimethoxyphenyl) is based on recent reports
that highlighted the crucial effect of methoxy group for enhancing the antiproliferative
effect of antitumour drug candidates.13–15
5

Fig.2: Target compounds.
2. Material and methods:
2.1. Chemistry
Starting materials, solvents and reagents were purchased from Merck (Darmstadt,
Germany), Sigma Aldrich (Missouri, USA) and Acros Organics (New Jersy, USA). Thin-
layer chromatography (TLC) was carried out to monitor the progression of the reaction
using silica gel pre-coated aluminum sheets (Kieselgel, pore size 60 Å, F254, Merck,
Darmstadt, Germany) and observed under a short-wavelength UV lamp effected
detection (254 nm). Column chromatography was performed using silica gel (pore size
60 Å, 230-400 mesh particle size, Merck, Darmstadt, Germany); elution was conducted
using hexane/ethyl acetate mixture (3:1). Melting points were determined in open
capillaries on a Stuart melting point apparatus (Stuart Scientific, Redhill, UK). All
evaporations were carried out under reduced pressure at 40˚C. IR spectra (KBr discs)
were obtained using an FT-IR spectrometer (Perkin Elmer, Waltham,
Massachusetts). NMR spectra were obtained using Bruker NMR spectrometer (Bruker
Biospin GmbH, Rheinstetten, Germany), operating at 400 MHz for 1H NMR and
100 MHz for 13C at Center for Drug Discovery Research and Development, Faculty of
Pharmacy Ain Shams University or using Varian NMR spectrometer (Varian Inc., Palo
Alto, California) operating at 300 MHz for 1H NMR and 75 MHz for 13C NMR at Dr.
Ahmed Farag Laboratory, Faculty of Science, Cairo University. Chemical shifts are
6

expressed in δ values (ppm) relative to TMS as an internal standard, using DMSO-d6 or
CDCl3 as solvents. Electron impact mass (EI-MS) spectra were obtained using Thermo
Scientific ISQ LT mass spectrometer (Thermo Fisher Scientific Inc., Waltham,
Massachusetts) at the Regional Center for Mycology and Biotechnology, Al-Azhar
University. Electrospray ionization mass (ESI-MS) spectra were recorded on Thermo
Scientific mass spectrometer LC-MS (Thermo Fisher Scientific Inc., Waltham,
Massachusetts) at the Faculty of Pharmacy, Helwan University Elemental analyses were
performed on a Thermo Scientific Flash 2000 elemental analyzer (Thermo Fisher
Scientific Inc., Waltham, Massachusetts) at Regional Center for Mycology and
Biotechnology, Al-Azhar University.
2.1.1. Synthesis of 2,4- Dimethoxyphenyl isothiocyanate (1)16:
Compound 1 was prepared using the general procedure described by Sun et al for
one-pot reaction for the synthesis of isothiocyanates from corresponding amines.17 2,4-
Dimethoxy aniline (3.06 g, 20 mmol) was added to a mixture of carbon disulfide (1.82g,
24 mmol) and K2CO3 (5.52 g, 40 mmol) in water (20 ml) and stirred for 10-12 h. to form
the intermediate dithiocarbamate salt. The reaction mixture was cooled to 0 °C in an ice
bath and a solution of trichlorotriazine (1.85 g, 10 mmol) in dichloromethane DCM (15
mL) was added dropwise and the mixture was stirred for further 0.5 h to finish the
reaction. The reaction mixture was then basified to pH >11 using 6 N NaOH and stirred
for an additional 0.5 h. The solution was then extracted using ethyl acetate or
dichloromethane DCM. Three successive extractions were carried out. Organic layers
were combined and dried over anhydrous sodium sulfate and evaporated under reduced
pressure. The isothiocyanate I was purified by column chromatography for the obtained
residue using hexane: ethyl acetate (3:1) mixture. Yellow solid, yield 95%, m.p. 52˚C as
reported.16
2.1.2. Synthesis of 4-Amino-3-(2,4-dimethoxyphenyl)-2-thioxo-2,3-dihydrothiazole-5-
carboxamide (2):
Compound 1 (1.95 g, 10 mmol) was added to a mixture of 2-cyanoacetamide
(0.84 g, 10 mmol), elemental sulfur (0.32g, 10 mmol) and triethylamine (1.01 g, 10
mmol) in dimethylformamide DMF (10 ml), stirred for 3-8 h at room temperature. The
reaction mixture was then stirred for 30 min with ice water. The precipitate was filtered
7

and recrystallized from an appropriate solvent (ethanol: DMF 1:1). Yellowish-brown
1
powder; yield 96%; m.p. 211-212˚C; H NMR (400 MHz, DMSO-d6) δ ppm: 3.76 (s,
3H, OCH3), 3.85 (s, 3H, OCH3), 6.68 (dd, J = 9.22, 2.50 Hz, 1H, aromatic), 6.72 (s, 2H,
NH2), 6.79 (d, J = 2.36 Hz, 1H, aromatic), 7.02 (s, 2H, NH2), 7.16 (d, J = 8.68 Hz, 1H,
aromatic), MS (EI) m/z (%): 311.81 (M+, 16.73), 92.92 (Bp, 100).
2.1.3. Synthesis of 3-(2,4-Dimethoxyphgenyl)-5-methyl-2-thioxo-2,3-dihydrothiazolo[4,5-
d]pyrimidin-7(6H)-one (3):
A mixture of 2 (10 g, 32.1 mmol.) and excess acetic anhydride (28.1 g, 275
mmol) was heated for 6-10 h at refluxing temperature. The reaction mixture was cooled
down, and the formed precipitate was recrystallized using ethanol. Light to dark brown
powder; yield 81%; m.p. >300˚C; IR (KBr) ν cm-1: 3138 (NH), 1660 (C=O), 1588
1
(C=N), 1264 (C-S-C), 1211 (C-O); H NMR (400 MHz, DMSO-d6) δ ppm: 2.27 (s, 3H,
CH3), 3.72 (s, 3H, OCH3), 3.85 (s, 3H, OCH3), 6.67 (dd, J = 8.71, 2.55 Hz, 1H, aromatic
), 6.79 (d, J = 2.51 Hz, 1H, aromatic ), 7.20 (d, J = 8.63 Hz, 1H, aromatic ), 12.99 (s,1H,
6-NH); 13C NMR (75 MHz, DMSO-d6) δ ppm: 21.01 (CH3), 55.45 (OCH3), 55.95
(OCH3), 99.9, 105.95, 116.96, 130.81, 155.33, 155.64, 157.029, 160.167, 161.783
(aromatic), 163.612 (C7 amide) 189.72 (C2, thioxo); MS (EI) m/z (%): 335.07 (M+,
4.37), 92.92 (Bp, 100); Anal. Calcd. for C14H13N3O3S2 (335.04): C, 50.14; H, 3.91; N,
12.53; S, 19.12. Found: C, 50.19; H, 3.9; N, 12.55; S, 19.14.
2.1.4. Synthesis of 3-(2,4-Dimethoxyphenyl)-5-methylthiazolo[4,5-d]pyrimidine-2,7-
(3H,6H)-dione (4):
A mixture of 3 (3 g, 8.9 mmol) and dimethyl sulphate DMS (3 ml, 17.8 mmol, 2
equiv.) was heated for 3 h at 150-160˚C in DMF (10 ml). The formation of thiazolium
intermediate was monitored using TLC. The reaction was allowed to cool down to room
temperature, then water (10 ml, excess) and a catalytic amount of triethylamine TEA (3-
5 drops) were added, and the mixture was heated for 30 min at 120-150˚C. The obtained
precipitate was filtered and recrystallized from absolute ethanol.
Light brown powder; yield 78%; m.p. 293 ˚C; IR (KBr) ν cm-1: 3444 (NH), 3421,
3347 (OH tautomeric), 1703 (C=O), 1655 (C=O), 1591 (C=N), 1293 (C-S-C), 1211 (C-
O); 1H NMR (400 MHz, DMSO-d6) δ ppm: 2.25 (s, 3H, CH3), 3.73 (s, 3H, OCH3), 3.83
8

(s, 3H, OCH3), 6.63 (d, J = 8.44 Hz, 1H, aromatic) 6.75 (s, 1H, aromatic), 7.26 (d, J =
8.56 Hz, 1H, aromatic), 12.82 (s, 1H, NH); 13C NMR (100 MHz, DMSO-d6) δ ppm:
21.59 (CH3), 56.05 (OCH3), 56.46 (OCH3), 97.25, 99.86, 105.80, 115.42, 131.21, 154.11,
156.52, 156.85, 159.83 (9C, aromatic), 161.9 (C7, amide), 168.55 (C2, carbonyl); MS
(ESI) m/z %: 319.76 (M+, 30%), 260.8 (BP, 100%); Anal. Calcd. for C14H13N3O4S
319.33: C, 52.66; H, 4.10; N, 13.16; S, 10.04. found: C, 52.69; H, 4.12; N, 13.12; S,
10.03.
2.1.5. Synthesis of 7-Chloro-3-(2,4-dimethoxyphenyl)-5-methylthiazolo[4,5-d]pyrimidine-
2(3H)-thione (5):
Compound 3 (5 g, 14.9 mmol) was refluxed with excess phosphorus oxychloride
(25 ml) for 3-6 h. The reaction was allowed to cool down to room temperature, then
poured portion-wise on ice water with vigorous stirring and filtered off. The obtained
precipitate was recrystallized from absolute ethanol.
Yellow crystals; yield 61%; m.p.125-127˚C; IR (KBr) ν cm-1: 1613 (C=N), 1258
(C-S-C), 1210 (C-O). 1H NMR (400 MHz, CDCl3) δ ppm: 2.64 (s, 3H, CH3), 3.76 (s, 3H,
OCH3), 3.91 (s, 3H, OCH3), 6.68 (m, 2H, aromatic), 7.18 (d, J = 8.99 Hz, 1H, aromatic);
13C NMR (100 MHz, DMSO-d6) δ ppm: 24.98 (CH3), 55.52 (OCH3), 55.99 (OCH3)
99.74, 105.86, 116.13, 120.6, 130.37, 149.34, 155.56, 160.53, 161.8 (9C, aromatic)
166.52 (C7, attached to chloro) 189.910 (C2, thioxo); MS (EI) m/z (%): 353.68 (M+,
12.63), 77.09 (Bp, 100); Anal. Calcd. for C14H12ClN3O2S2 353.01: C, 47.52; H, 3.42; N,
11.88; S, 18.12 Found: C, 47.54; H, 3.41; N, 11.9; S, 18.11.
2.1.6. Synthesis of 7-Chloro-3-(2,4-dimethoxyphenyl)-5-methylthiazolo[4,5-d]pyrimidin-
2(3H)-one (6):
Compound 4 (3 g, 9.39 mmol) was refluxed with phosphorus oxychloride (20ml)
for 3-6 h following the procedure as previously described for compound 5.
Yellow crystals; Yield 88%; m.p. 148˚C; IR (KBr) ν cm-1: 1718 (C=O), 1612
1
(C=N), 1249 (C-S-C), 1211 (C-O); H NMR (400 MHz, DMSO-d6) δ ppm: 2.49 (s, 3H,
CH3), 3.74 (s, 3H, OCH3), 3.85 (s, 3H, OCH3), 6.69 (dd, J = 8.68, 2.43 Hz, 1H,
13
aromatic), 6.79 (d, J = 2.35 Hz, 1H, aromatic), 7.36 (d, J = 8.66 Hz, 1H,aromatic); C
NMR (75 MHz, DMSO-d6) δ ppm: 25.19 (CH3), 55.71 (OCH3), 56.08 (OCH3), 99.57,
9

99.67, 105.77, 114.42, 130.53, 155.97, 156.17, 157.55, 159.34, 161.88 (10C, aromatic),
168.55 (C2, amide); MS (EI) m/z (%): 337.2 (M+, 8.46), 119.77 (Bp, 100); Anal. Calcd.
for C14H12ClN3O3S 337.78: C, 49.78; H, 3.58; N, 12.44; S, 9.49. Found: C, 49.75; H,
3.61; N, 12.48; S, 9.52.
2.2. Biological evaluation
2.2.1. NCI-USA In vitro antiproliferative screening
The NCI-USA drug evaluation program includes two subsequent stages that aim
to evaluate the anticancer activity of novel compounds. In the single-dose stage, each
compound was tested for its growth inhibitory effect against the NCI tumor cell lines
panel at 10 µM. Compounds that exhibited potent activity were chosen to enter the five-
dose screening stage, where cells were treated with the compound at five different
concentrations to obtain a dose-response curve and determine GI50, TGI (total growth
inhibition concentration) and LC50 (concentration that reduces the original cellular
population by 50 %) values.18,19
2.2.2. Cell lines
Human colorectal carcinoma HCT-116 and human lung fibroblast WI-38 cell
lines were obtained from VACSERA Tissue Culture Unit (Giza, Egypt). Tissue culture
media and antibiotics were obtained from Lonza Verviers SPRL (Verviers, Belgium), and
fetal bovine serum (FBS) was purchased from Life Science Group Ltd (Bedford, UK).
Cell culture media were supplemented with 10% (v/v) FBS and antibiotics (100
units/ml penicillin and 100 mg/ml streptomycin sulfate. RPMI 1640 medium was used to
maintain HCT-116 cell line, while Dulbecco's modified Eagle's medium (DMEM) was
used for maintaining WI-38 cell line. Cell cultures were incubated at 370C under a 5%
CO2 humidified atmosphere.
2.2.3. MTT cytotoxicity assay
MTT assay was carried out as previously described by Mosmann.20 Briefly, HCT-
116 and WI-38 cells were seeded in a 96-well plate at a density of 1×104 cells per well.
After overnight incubation, cells were treated with compound 5 and roscovitine (LC
Laboratories, Woburn, MA) as a positive control at concentrations of 0.1, 0.5, 1, 5, 10,
10

25, 50, 100 µm and the vehicle [0.1% dimethylsulfoxide (DMSO)] in triplicates prior to
incubation for 48 h. The treatment medium was aspirated and replaced with 10 µL MTT
(Tocris Bioscience, Bristol, UK) solution (5 mg/mL) within 100 µL cell culture media.
Plates were maintained at 37˚C for 4 h, then MTT solution was removed, and 100 µL
DMSO was used to solubilize the formed formazan crystals. The optical density (OD)
was recorded using a Multi-mode Varioskan microplate reader (Thermo Fisher Scientific
Inc., Waltham, MA) at 570 nm.
2.2.4. Cell cycle analysis using flow cytometry
In order to assess HCT-116 and WI-38 cells distribution throughout different cell
cycle stages, the DNA content of propidium iodide (PI) stained nuclei was measured by
flow cytometry.21 Accordingly, after overnight incubation, cells were exposed to the
tested compound at IC50 concentration for 48 h. Cells were then trypsinized, and PBS was
used for washing, then the cells were fixed in absolute ice-cold alcohol. Propidium iodide
flow cytometry kit (ab139418; Abcam, Cambridge, MA) was used for staining cells,
according to the manufacturer's instructions.20 Cell cycle distribution was analyzed using
the FACS Calibur flow cytometer (BD Biosciences, San Jose, CA) and calculated using
CELLQUEST software (Becton Dickinson Immunocytometry Systems, San Jose, CA).
2.2.5. Apoptosis and necrosis detection
Apoptotic and necrotic cells were distinguished using annexin-V-FITC and
propidium iodide apoptosis detection kit (Cat. No. K101; BioVision, Inc., Milpitas, CA),
according to the manufacturer's protocol.22,23 Briefly, HCT-116 and WI-38 cells were
treated with compound 5 at the IC50 concentration and incubated for 48 h then trypsinized
and washed with PBS. Next, 1x105 cells were resuspended in 500 µL of binding buffer
before staining with 5 μL of Annexin V-FITC and 5 μL PI and incubation at room
temperature for 5 min. Cells were analyzed using a FACS Calibur flow cytometer (BD
Biosciences, San Jose, CA) and CELLQUEST software (Becton Dickinson
Immunocytometry Systems, San Jose, CA).
2.2.6. CDK1/Cyc B kinase assay
11

The ability of compound 5 to inhibit CDK1/Cyc B complex was evaluated using
CDK1/CycB Kinase assay kit (Cell Signaling Technology, Inc., Danvers, MA) as
described by the manufacturer. Fluorescence emission was detected at 615nm using
Robonik P2000 Eliza Reader (Robonik India Pvt. Ltd, Thane, India).
2.2.7. Gene expression analysis (real-time PCR)
Extraction of total mRNA from treated and untreated cells by RNeasy Mini Kit
(Qiagen, Hilden, Germany) according to the manufacturer's protocol. 1 x 105 cells were
lysed using RLT buffer. Followed by adding ethanol to create the appropriate conditions
for membrane binding, then the lysate was applied to the Rneasy Mini spin column that
kept the RNA while the contaminants were effectively removed. Rnase-free water was
used to elute high-quality RNA.
Real-time PCR was used to assess the gene expression levels of P53, Bax, Bcl-2,
cytochrome c and caspases 3, 8 and 9 using the iScript one-step RT-PCR kit with
SYBR® green (Bio-Rad, Hercules, CA). RT-PCR was carried out in a final volume of 50
μl included 10 μl RNA template, 25 μl 2X SYBR® Green RT-PCR Reaction Mix, 1.5 μl
forward and reverse primer, Table 1, 11 μl Nuclease-Free Water and 1 μl iScript Reverse
Transcriptase for One-Step RT-PCR according to manufacturer's protocol.24 The 2−ΔΔCT
method was used to quantify the relative gene expression.
Table 1 Forward and reverse primer sequences of targeted genes (Sigma-Aldrich, St.
Louis, MO)
Gene
P-53 25
Bcl-2 25
Forward primer Sequence
Reverse primer Sequence
5’- CCCCTCCTGGCCCCTGTCATCTTC-3’
5'-CCTGTG GAT GAC TGA GTA CC-3'
5’- AGTGGCAGCTGACATGTTTT -3’
5’-AGTGTTCCCAGTGCCACACCG -3’
5’-TTCATTATTCAGGCCTGCCGAGG-3’
5’-GCCTCCCTCAAGTTCCT -3’
5’-GCAGCGCCTCACAACCTCCGTCAT-3’
5'-GAGACA GCC AGG AGA AAT CA-3’
5’- GGAGGAAGTCCAATGTCCAG -3’
5’-TCCTCTCCCCAGAATGATGCCTTT -3’
5’-TTCTGACAGGCCATGTCATCCTCA-3’
5’-CCTGGAGTCTCTGGAATAACA -3’
5’-ACCTCACCAAATCCTCCAGAAC-3’
5’-ACAGGATGTCAAAACTGCCC-3’
Bax 26
Cytochrome-C 26
Caspase-3 27
Caspase-8 28
Caspase-9 28
β-actin 29
5’-CGAACTAACAGGCAAGCAG -3’
5’-GTGACATCCACACCCAGAGG-3’
3. Results and discussion:
3.1. Chemistry:
12

The adopted synthetic route to obtain the target compounds is illustrated in
scheme 1 and was detailed under the experimental section. We managed to synthesize
2,4-dimethoxyphenyl isothiocyanate 1 a commercially unavailable isothiocyanate from
the corresponding aniline in high yield applying a highly efficient one-pot general
synthetic procedure recently reported by Sun et al.17 Furthermore we obtained compound
2 applying Gewald reaction.30 Compound 2 is a functionalized thiazole through 4-amino
and 5-carboxamide which together form a 1,3-diamino species thus was easily annulated
to pyrimidine via reflux with acetic anhydride yielding compound 3 which in turn was
easily chlorinated via reaction with POCl3 yielding compound 5. The formation of the
1
thiazole intermediate 2 was confirmed as follows; the H NMR revealed two singlet
signals at δ 3.76, 3.85 ppm attributed to the six protons of the 2,4-dimethoxy groups,
three signals; a doublet of doublet at δ 6.68 ppm integrated to one proton J= 9.22, 2.5 Hz,
a doublet signal at δ 6.72 ppm integrated to one proton J= 2.36 Hz, and a doublet signal
at δ 7.16 ppm integrated to one proton J=8.68 Hz; these three signals are attributed to
aromatic protons. The two protons of 4-amino thiazole produced a singlet signal
integrated to two protons at δ 7.02 ppm and the two protons of the 5-carboxamide amino
group produced a singlet signal at δ 6.72 ppm integrated to two protons. The MS
spectrum revealed the molecular ion peak at m/z = 311.81. The formation of 3 was
confirmed as follows; the IR spectrum showed absorption band at 3138 cm-1 (NH) and
1660 cm-1 (C=O). The 1H NMR revealed the disappearance of the aforementioned signals
of four protons of 4-amino (two protons) and 5-carboxamide amino (two protons) of the
thiazole moiety at δ 6.72, 7.02 ppm and the appearance of singlet signal of 6-NH (of the
formed pyrimidine) at δ 12.99 ppm as well as a singlet signal at δ 2.22 ppm integrated to
three protons that was assigned to 5-CH3. 13C NMR displayed the appearance of a signal
at δ 21.01 ppm assigned to 5–CH3, and signals at δ 163.61, 189.72 ppm assigned to C=O
and C=S, also the MS analysis revealed the molecular ion peak at m/z =335.07. The
formation of 5 was confirmed via different methods; a preliminary copper wire test
(Beilstein test) was performed and produced the characteristic green fluorescence of
copper halides, the IR spectrum lacked peaks in the (C=O) region; the 1H NMR spectrum
revealed the disappearance of the 6-NH proton signal at δ 12.99 ppm. 13C NMR revealed
a change of the value for the chemical shift of C7 from δ 163.612 to 166.518 ppm. The
13

MS spectrum revealed the molecular ion peak at m/z = 353.68 and the presence of the
characteristic (M+2) peak (isotope peak).
Compound 4 the 2-oxo analogue of compound 3 was obtained through reflux with
dimethyl sulfate in dimethyl formamide followed by the addition of water and reflux.
Compound 4 was in turn chlorinated via reflux with POCl3 yielding compound 6. The
formation of 4 was confirmed via different spectral analyses. IR spectrum showed
absorption bands at 3444, 3421, 3347 cm-1 for NH and probably tautomeric OH, two
13
absorption bands at 1703, 1655 cm-1 assigned to the two (C=O). The C NMR revealed
the disappearance of the C2 thioxo peak at 189 ppm and the appearance of C2 amide
carbonyl at 168.55 ppm. MS spectrum shows the molecular ion peak at m/z = 319.33. The
formation of 6 was confirmed via different spectral analyses IR spectrum shows only one
1
absorption band at 1718 cm-1 assigned for (C=O) at C2. The H NMR revealed the
disappearance of 6–NH signal at 12.82 ppm. The 13C NMR spectrum lacked the C7 C=O
signal of pyrimidine at δ 161.9 ppm and showed a signal for C2 (C=O) at δ 168.55 ppm.
MS spectrum showed the appearance of molecular ion peak at m/z = 337.2 with the
presence of characteristic (M+2) peak.
14

Scheme.1: Synthesis of target 3-(2,4-dimethoxyphenyl)-5-methyl-2-thioxo-2,3-
dihydrothiazolo[4,5-d]pyrimidin-7(6H)-one (3) / 2,7(6H,6H) dione (4) and their chloro
derivatives (5, 6).
Reagents and conditions: (a) CS2 (1.2equiv.)/k2CO3(2 equiv.) aqueous medium stirring
10-12h. trichlorotriazine(0.5equiv) stirring 0˚C, 0.5h., 6N NaOH, stirring, 0.5h. (b)
cyanoacetamide (1 equiv.), elemental sulfur (1 equiv.), Triethylamine (1 equiv.),DMF 50-
70˚C, (c) Acetic anhydride, reflux 140-150˚C (d) POCl3, reflux 180˚C, 3-6 h. (e)
dimethyl sulfate (2equiv.), DMF 10 ml, reflux 150˚C, 3hrs, and then add10 ml H2O,
triethyl amine few drops. (f) POCl3, reflux 180 ˚C, 3-6h.
15

3.2. Biological evaluation
3.2.1. NCI-USA In vitro antiproliferative screening
The antiproliferative activity of compounds 3-6 was assessed through the NCI-
USA Developmental Therapeutics Program against cancer cell lines panel that includes
nine cancer subtypes. According to the results, compound 3 (NSC: D - 802942 / 1),
and 4 (NSC: D - 802948 / 1) had no antiproliferative activity towards the 60 human
cancer cell lines; however, compounds 5 (NSC: D - 802943 / 1) and 6 (NSC: D - 802949
/ 1) have shown a significant growth inhibitory activity with mean percentages of 67.21
and 23.48 over the human cancer cell lines panel, respectively. Based on the results of the
single-dose screening, only compound 5 was able to cause more than 50% growth
inhibition in 35 cancer cell lines, fig.3. The most affected cancer subtypes were leukemia,
CNS and colon cancers, fig.4.
Fig.3: The percentage of growth inhibition for compound 5 over the most sensitive cell
lines.
16

Fig.4: The effect of compound 5 on each cancer subtype as a mean of the percentages of
growth inhibition of the cell lines of each subtype.
Accordingly, it was selected to be furtherly evaluated at the NCI five-dose assay
(0.01 – 100 µM). The results are represented in Table 2, as GI50, TGI and LC50 against
each cell line. Compound 5 was found to cause growth inhibition in numerous cell lines
from different cancer subtypes with GI50 mean graph midpoint (MG-MID) = 2.88µM.
The obtained results for compounds 5 and 6 and their antiproliferative superiority over
compounds 3 and 4 suggest that this superiority may be attributed to the reactive center
of the chloropyrimidine (C7) at both compounds 5 and 6, that is suspected to allow non-
specific covalent binding through SNAr mechanism. This also required that further
investigations should assess the cytotoxicity to normal cell line and the selectivity index
towards malignant tissues.
Table 2 GI50, LC50 and TGI results for compound 5 against human cancer cell line panel
Subtype/tumor cell line
GI50 (µM)
TGI (µM) LC50 (µM) Subtype/tumor cell line
GI50 (µM)
TGI (µM)
LC50 (µM)
MALME-3M
2.24
1.86
2.14
2.04
2.19
2.34
2.04
6.17
4.07
3.89
3.98
4.57
5.62
4.68
27.54
8.91
Leukemia
CCRF-CEM
HL-60(TB)
K-562
2.69
1.41
1.20
2.14
3.47
1.41
7.41
5.89
3.80
5.50
14.13
5.50
>100
>100
>100
>100
>100
>100
M14
MDA-MB-435
SK-MEL-2
SK-MEL-28
UACC-257
UACC-62
7.24
7.76
MOLT-4
RPMI-8226
SR
9.77
18.20
12.02
NSCLC
Ovarian Cancer
17

A549/ATCC
EKVX
4.47
4.57
2.57
2.51
3.24
1.82
2.04
3.09
2.45
15.85
16.98
7.76
6.46
12.02
3.89
8.51
9.12
5.89
40.74
43.65
26.92
22.39
44.67
8.32
IGROV1
OVCAR-3
OVCAR-4
OVCAR-5
OVCAR-8
NCI/ADR-RES
SK-OV-3
1.95
1.78
3.98
3.24
8.32
5.89
HOP-62
4.68
15.49
20.89
7.41
41.69
53.70
40.74
>100
52.48
NCI-H322M
NCI-H226
NCI-H522
HOP-92
6.17
2.69
13.18
14.13
72.44
27.54
31.62
48.98
57.54
NCI-H460
NCI-H23
Renal Cancer
786-0
A498
4.47
11.48
2.09
6.17
2.00
2.82
4.68
3.63
20.42
23.99
3.98
81.28
48.98
7.59
Colon Cancer
HCT-116
HCC-2998
COLO 205
KM12
1.82
16.22
3.80
3.31
2.40
1.95
2.57
3.72
30.90
13.18
11.48
6.31
7.59
ACHN
CAKI-1
RXF 393
SN12C
TK-10
58.88
47.86
37.15
57.54
41.69
28.84
19.50
4.07
45.71
8.32
9.12
36.31
58.88
39.81
HT29
18.62
15.49
HCT-15
SW-620
5.37
UO-31
5.50
Prostate Cancer
DU-145
PC-3
1.86
2.40
3.24
5.89
5.75
CNS Cancer
SF-539
SF-295
SF-268
2.09
7.08
2.19
4.57
19.95
5.25
10.00
46.77
16.98
22.91
Breast Cancer
HS 578T
MDA-MB-
231/ATCC
MCF7
2.63
3.16
7.76
>100
34.67
U251
1.91
3.63
6.92
10.23
SNB-75
SNB-19
1.95
2.40
4.27
5.37
9.33
3.63
2.00
6.46
2.00
15.49
6.61
87.10
93.33
56.23
9.12
16.98
MDA-MB-468
T-47D
21.88
4.27
Melanoma
LOX IMVI
1.70
3.16
6.03
BT-549
3.2.2. MTT cytotoxicity assay
MTT assay was performed to assess the cytotoxic activity of compound 5 on
HCT-116 and WI-38 cell lines, where roscovitine was used as a reference compound.
Fig.5 represents the results as the average IC50 ± standard error values of three separated
experiments; IC50 value of compound 5 on HCT-116 cells was significantly lower than
roscovitine IC50 value, 5.34 ± 0.4 and 15.54 ± 0.76 µM, respectively, with P value ≥ 0.01.
In addition, in WI-38 cell line, the IC50 value of roscovitine was higher than
compound 5 IC50 value, 24.12 ± 0.25 and 21.7 ± 0.6, respectively, with P value ≥0.05.
Through comparing the results of both compound 5 and roscovitine on both cancer and
normal cells, the therapeutic index of each drug was calculated. Interestingly, the
18

selectivity index of compound 5 was 4 compared to 1.55 for roscovitine. These findings
suggest that compound 5 exhibited a more selective and potent cytotoxic effect than
roscovitine.
Fig.5: Average IC50 value of compound 5 and roscovitine on both HCT-116 and WI-38
cell lines ± SE, * P ≥ 0.05, ** P ≥ 0.01
3.2.3. Cell cycle analysis using flow cytometry
Numerous antiproliferative agents inhibit cell growth through interfering with cell
cycle progression at a certain point. Flow cytometric analysis is considered a reliable tool
to determine and analyze the parameters of the cell cycle.31 Herein, HCT-116 and WI-38
cells were treated with compound 5 using IC50 concentrations. In HCT-116 cell line, the
cellular population of both G1 and S phases was 42.5% and 41.3% in control untreated
cells while it decreased to 22.4% and 30.1% in treated cells, respectively. Also,
compound 5 was able to cause a significant rise in cells in the G2/M phase to reach
29.8% compared to 13.7% in control. While in treated WI-38 cells, there was a slight
decrease in G1 and S phases’ population and also a slight increase in cells in the G2/M
phase, fig.6 and 7.
Additionally, the results revealed that compound 5 produced a significant increase
in the cell population at the sub-G phase in HCT-116 cells as compared to the control
(17.7% versus 2.4%, respectively). While it only caused a slight increase in WI38 cell as
compared to the control (6.1% versus 1.3%, respectively), fig.6 and 7. After analyzing
the results of compound 5 on both cell lines, compound 5 was found to be able to arrest
19

the cell cycle at the G2/M phase and induce apoptosis. The results also revealed that
compound 5 was more effective in cancer cells than normal cells.
Fig.6: Effect of compound 5 on the cell cycle of both HCT-116 and WI-38 cells
compared to untreated control cells.
20

Fig.7: Cell cycle distributions of HCT-116 and WI-38 cells treated with compound 5
compared to untreated control.
3.2.4. Apoptosis and necrosis detection
Annexin-V and PI double staining assay was used to determine the mode of
inducing cell death in HCT-116 and WI-38 cancer cell lines. During early and late
apoptosis, phosphatidylserine (PS) is translocated to the outer surface of the plasma
membrane. Subsequently, PS can be used for the detection of apoptosis through staining
with annexin V. While during late apoptosis and necrosis, the integrity of the cellular
membrane is lost, which allows the incorporation of PI into the cell.32 Therefore, this
assay can differentiate between healthy cells (negative annexin V; negative PI), early
apoptotic cells (positive annexin V; negative PI), late apoptotic cells (positive annexin V;
positive PI), and necrotic cells (negative annexin V; positive PI).33 Cells were treated
with compound 5 at the IC50 concentrations for 48 hours. The obtained results are
21

represented in fig.8 and 9. Compound 5 was found to be able to cause an increase in the
percentage of apoptosis in HCT-116 cells from 1.95% in untreated control cells to reach
18.16%, while the percentage of necrotic cells was slightly increased to 3.31% compared
to 0.51% in untreated cells. Moreover, in WI-38 cell line, the apoptotic cells population
of the treated cells was slightly higher than the untreated cells with only 5%; in addition,
compound 5 was able to raise the necrotic population with about 1% only. These results
suggested that compound 5 causes cell death mainly through apoptosis rather than
necrosis and confirms that its activity is more selective to cancerous cells than normal
cells.
Fig.8: Percentage of apoptotic and necrotic cells in HCT-116 and WI-38 treated and
control cells
22

Fig.9: Percentage of early apoptotic, late apoptotic and necrotic cells of compound 5
treated HCT-116 and WI-38 cells in relation to control untreated cells.
3.2.5. CDK1/Cyc B kinase assay
CDK1 plays a crucial role in cell cycle regulation. It regulates G2/M transition
through complexation with cyclin B. Inhibition of CDK1 increases the G2/M population
during the cell cycle and results in cell cycle arrest.34 Therefore, the ability of compound
5 to inhibit the CDK1/Cyc B complex and the IC50 concentrations was determined in
comparison to roscovitine as a reference compound. The results are shown in fig.10; the
average IC50 concentrations of compound 5 and roscovitine for CDK1/Cyc B are 97nM ±
2.33 and 81.7nM ± 1.5, respectively, with P value > 0.001. These results showed that
compound 5 is a potent CDK1/Cyc B inhibitor; however, its potency is slightly less than
roscovitine.
23

Fig.10: The average IC50 concentration (nM) of Compound 5 and roscovitine in for
CDK1/Cyc B complex ± SE values, P ≥ 0.001
3.2.6. Evaluation of P53, Bax and Bcl-2 expression patterns
P53 is a tumor suppressor that plays an essential role in maintaining the integrity
of mammalian genetic information through inducing apoptosis upon DNA damage.35 P53
exerts its pro-apoptotic activity by regulating other genes, which promoter regions
contain p53 binding sites such as the anti-apoptotic Bcl-2 and the pro-apoptotic Bax.36
Therefore, the gene expression patterns of p53, Bcl-2 and Bax were examined after
treating cells with the test compound using RT-PCR analysis. Interestingly, the levels of
transcription of both P53 and BAX genes were increased by 13.1 and 9.9 folds after
treatment, respectively, whereas the transcription level of Bcl-2 gene was decreased by
3.64 folds in treated cells, fig.11. Such results prove the activation of p53, which has a
fundamental role in the pro-apoptotic activity of compound 5.
24

Fig.11: Effect of compound 5 on the gene expression level of p53, BAX, Bcl-2,
cytochrome c caspase 3, 8 and 9, in HCT-116 cells as average fold change ± SE values
3.2.7. Evaluation of cytochrome c expression
Bax up-regulation and Bcl-2 down-regulation lead to the release of the
mitochondrial cytochrome c into the cytoplasm and the subsequent activation of the
executioner caspases.37 Thus, the expression level of cytochrome c was measured using
RT-PCR analysis. As the results show in fig.11, the expression level of cytochrome c
increased by 8.02 folds, which provides more evidence for the involvement of the
intrinsic apoptotic pathway.
3.2.8. Effect on caspases cascade
Caspases are cysteine proteases comprising a fundamental part of apoptosis.38
Therefore, the impact of compound 5 on the gene expression levels of caspases 3, 8 and 9
were estimated in order to study its pro-apoptotic effect, besides identifying which of the
extrinsic or the intrinsic pathway was involved in apoptosis. Treating HCT-116 cells with
compound 5 caused a significant up-regulation in the expression level of caspase-3 by
11.2 folds compared to the expression level in untreated cells, as shown in fig.11. In
addition, scrutinizing compound 5 effect on caspase 8 and caspase 9 levels revealed that
it potentiated levels of both by 7.9 and 15.9 folds, respectively, compared to untreated
control. These findings suggest that compound 5 induced apoptosis in HCT-116 cells
through the intrinsic pathway; however, the extrinsic pathway was less involved.
25

4. Conclusion
In conclusion, four compounds have been synthesized and assessed at the NCI-
USA drug evaluation program for their antiproliferative activity. Compound 5 was the
most potent one and was selected for 5 dose assay by NCI. Also, it induced apoptosis
significantly and arrested the cell cycle at the G2/M phase. Its activity was associated
with the up-regulation of P53, which consequently increased the expression of BAX and
decreased the expression of Bcl-2. These alterations resulted in increasing the release of
cytochrome c and subsequently activating the caspase cascade.
Conflicts of interest
The authors declare no conflict of interest.
Acknowledgment
We would like to thank the center of scientific excellence HSBR for providing the facility
for practical work, HSBR is supported from STDF (ID: 5290).
Funding
This research did not receive any specific grant from funding agencies in the public,
commercial, or not-for-profit sectors
References
1.
De Vitto H, Valencia JP, Radosevich JA. General View of the Cytoplasmic and
Nuclear Features of Apoptosis. In: Apoptosis and Beyond. Hoboken, NJ, USA:
John Wiley & Sons, Inc.; 2018:1-12. doi:10.1002/9781119432463.ch1
2.
3.
Hartwell L, Kastan M. Cell cycle control and cancer. Science (80- ).
1994;266(5192):1821-1828. doi:10.1126/science.7997877
Suh H, Choi K, Lee C-H. CR389, a Benzoimidazolyl Pyridinone Analog, Induces
Cell Cycle Arrest and Apoptosis via p53 Activation in Human Ovarian Cancer PA-
1 Cells. J Microbiol Biotechnol. 2015;25(3):418-422. doi:10.4014/jmb.1412.12080
Pietenpol J., Stewart Z. Cell cycle checkpoint signaling: Cell cycle arrest versus
4.
5.
apoptosis.
Toxicology.
2002;181-182:475-481.
doi:10.1016/S0300-
483X(02)00460-2
Findley HW, Gu L, Yeager AM, Zhou M. Expression and Regulation of Bcl-2,
26

Bcl-xl, and Bax Correlate With p53 Status and Sensitivity to Apoptosis in
Childhood Acute Lymphoblastic Leukemia. Blood. 1997;89(8):2986-2993.
doi:10.1182/blood.V89.8.2986
6.
7.
Kuppast B, Fahmy H. Thiazolo[4,5-d]pyrimidines as a privileged scaffold in drug
discovery.
Eur
J
Med
Chem.
2016;113:198-213.
doi:10.1016/J.EJMECH.2016.02.031
Fahmy HTY, Rostom SAF, Saudi MN, Zjawiony JK, Robins DJ. Synthesis andin
vitro evaluation of the anticancer activity of novel fluorinated thiazolo[4, 5-
d]pyrimidines.
Arch
Pharm
(Weinheim).
2003;336(45):216-225.
doi:10.1002/ardp.200300734
8.
9.
Becan L, Wagner E. Synthesis and Antitumor Screening of Novel 3-
Phenylthiazolo [4,5-d]pyrimidin-2-thione Derivatives. Arzneimittelforschung.
2011;58(10):521-528. doi:10.1055/s-0031-1296552
Becan L, Wagner E. Synthesis and anticancer evaluation of novel 3,5-diaryl-
thiazolo[4,5-d]pyrimidin-2-one derivatives. Med Chem Res. 2013;22(5):2376-
2384. doi:10.1007/s00044-012-0231-7
10. Lin R, Johnson SG, Connolly PJ, et al. Synthesis and evaluation of 2,7-diamino-
thiazolo[4,5-d] pyrimidine analogues as anti-tumor epidermal growth factor
receptor (EGFR) tyrosine kinase inhibitors. Bioorganic Med Chem Lett.
2009;19(8):2333-2337. doi:10.1016/j.bmcl.2009.02.067
11. Mohamed KO, Nissan YM, El-Malah AA, et al. Design, synthesis and biological
evaluation of some novel sulfonamide derivatives as apoptosis inducers. Eur J
Med Chem. 2017;135:424-433. doi:10.1016/j.ejmech.2017.04.069
12. Singh B, Guru SK, Kour S, et al. Synthesis, antiproliferative and apoptosis-
inducing activity of thiazolo[5,4-d]pyrimidines. Eur J Med Chem. 2013;70:864-
874. doi:10.1016/j.ejmech.2013.10.039
13. Liew SK, Malagobadan S, Arshad NM, Nagoor NH. A review of the structure—
activity relationship of natural and synthetic antimetastatic compounds.
Biomolecules. 2020;10(1). doi:10.3390/biom10010138
14. Bingul M, Tan O, Gardner CR, et al. Synthesis, characterization and anti-cancer
activity of hydrazide derivatives incorporating a quinoline moiety. Molecules.
27

2016;21(7):916. doi:10.3390/molecules21070916
15. Romagnoli R, Baraldi PG, Prencipe F, et al. Design and synthesis of potent in vitro
and in vivo anticancer agents based on 1-(3’,4’,5’-trimethoxyphenyl)-2-Aryl-1H-
imidazole. Sci Rep. 2016;6(1):1-17. doi:10.1038/srep26602
16. Liao Y-Y, Deng J-C, Ke Y-P, et al. Isothiocyanation of amines using the Langlois
reagent. Chem Commun. 2017;53(45):6073-6076. doi:10.1039/C7CC02373A
17. Sun N, Li B, Shao J, et al. A general and facile one-pot process of isothiocyanates
from amines under aqueous conditions. Beilstein J Org Chem. 2012;8(1):61-70.
doi:10.3762/bjoc.8.6
18. Skehan P, Storeng R, Scudiero D, et al. New Colorimetric Cytotoxicity Assay for
Anticancer-Drug Screening. J Natl Cancer Inst. 1990;82(13):1107-1112.
doi:10.1093/jnci/82.13.1107
19. Rubinstein L V, Shoemaker RH, Paull KD, et al. Comparison of In Vitro
Anticancer-Drug-Screening Data Generated With a Tetrazolium Assay Versus a
Protein Assay Against a Diverse Panel of Human Tumor Cell Lines. JNCI J Natl
Cancer Inst. 1990;82(13):1113-1117. doi:10.1093/jnci/82.13.1113
20. Mosmann T. Rapid colorimetric assay for cellular growth and survival:
Application to proliferation and cytotoxicity assays. J Immunol Methods.
1983;65(1-2):55-63. doi:10.1016/0022-1759(83)90303-4
21. ABAZA M-SI, BAHMAN A-M, AL-ATTIYAH RJ. Valproic acid, an anti-
epileptic drug and a histone deacetylase inhibitor, in combination with proteasome
inhibitors exerts antiproliferative, pro-apoptotic and chemosensitizing effects in
human colorectal cancer cells: Underlying molecular mechanisms. Int J Mol Med.
2014;34(2):513-532. doi:10.3892/ijmm.2014.1795
22. Pollet M, Shaik S, Mescher M, et al. The AHR represses nucleotide excision repair
and apoptosis and contributes to UV-induced skin carcinogenesis. Cell Death
Differ. 2018;25(10):1823-1836. doi:10.1038/s41418-018-0160-1
23. Liu X, Wei X, Niu W, Wang D, Wang B, Zhuang H. Downregulation of FOXK2
is associated with poor prognosis in patients with gastric cancer. Mol Med Rep.
2018;18(5):4356-4364. doi:10.3892/mmr.2018.9466
24. Ntika S, Thombare K, Aryapoor M, Kristinsson H, Bergsten P, Krizhanovskii C.
28

Oleate increase neutral lipid accumulation, cellular respiration and rescues
palmitate-exposed GLP-1 secreting cells by reducing ceramide-induced ROS.
Biochimie. 2019;159:23-35. doi:10.1016/j.biochi.2018.11.017
25. Mohamed MS, Abdelhamid AO, Almutairi FM, Ali AG, Bishr MK. Induction of
apoptosis by pyrazolo[3,4-d]pyridazine derivative in lung cancer cells via
disruption of Bcl-2/Bax expression balance. Bioorganic Med Chem.
2018;26(3):623-629. doi:10.1016/j.bmc.2017.12.026
26. Zhang Q, Li ZH, Li YY, et al. Hypericin-photodynamic therapy induces human
umbilical vein endothelial cell apoptosis. Sci Rep. 2015;5:18398.
doi:10.1038/srep18398
27. Liang L, Weng J, You Y, He Q, Fan Y, Liao G. Role of Noxa in proliferation,
apoptosis, and autophagy in human adenoid cystic carcinoma. J Oral Pathol Med.
2019;48:52-59. doi:10.1111/jop.12787
28. Huang GM, Sun Y, Ge X, Wan X, Li CB. Gambogic acid induces apoptosis and
inhibits colorectal tumor growth via mitochondrial pathways. World J
Gastroenterol. 2015;21(20):6194-6205. doi:10.3748/wjg.v21.i20.6194
29. Nazmy EA, El-Khouly OA, Zaki MMA, et al. Targeting p53/TRAIL/caspase-8
signaling by adiponectin reverses thioacetamide-induced hepatocellular carcinoma
in
rats.
Environ
Toxicol
Pharmacol.
2019;72:103240.
doi:10.1016/j.etap.2019.103240
30. Gewald K. Heterocyclen aus CH-aciden Nitrilen. VI. Reaktion von
methylenaktiven Nitrilen mit Senfölen und Schwefel. J für Prakt Chemie.
1966;32(1-2):26-30. doi:10.1002/prac.19660320104
31. Ibrahim MK, Taghour MS, Metwaly AM, et al. Design, synthesis, molecular
modeling and anti-proliferative evaluation of novel quinoxaline derivatives as
potential DNA intercalators and topoisomerase II inhibitors. Eur J Med Chem.
2018;155:117-134. doi:10.1016/j.ejmech.2018.06.004
32. Reyes-Reyes EM, Jin Z, Vaisberg AJ, Hammond GB, Bates PJ. Physangulidine A,
a Withanolide from Physalis angulata , Perturbs the Cell Cycle and Induces Cell
Death by Apoptosis in Prostate Cancer Cells. J Nat Prod. 2013;76(1):2-7.
doi:10.1021/np300457g
29