Glutamates 78 and 122 in the Active Site of Saccharopine Dehydrogenase Contribute to Reactant Binding and Modulate the Basicity of the Acid-Base Catalysts

Article abstract of DOI:10.1074/jbc.M110.119826

Saccharopine dehydrogenase catalyzes the NAD-dependent oxidative deamination of saccharopine to give L-lysine and α-ketoglutarate. There are a number of conserved hydrophilic, ionizable residues in the active site, all of which must be important to the overall reaction. In an attempt to determine the contribution to binding and rate enhancement of each of the residues in the active site, mutations at each residue are being made, and double mutants are being made to estimate the interrelationship between residues. Here, we report the effects of mutations of active site glutamate residues, Glu⁷⁸ and Glu¹²², on reactant binding and catalysis. Site-directed mutagenesis was used to generate E78Q, E122Q, E78Q/E122Q, E78A, E122A, and E78A/E122A mutant enzymes. Mutation of these residues increases the positive charge of the active site and is expected to affect the pK_a values of the catalytic groups. Each mutant enzyme was completely characterized with respect to its kinetic and chemical mechanism. The kinetic mechanism remains the same as that of wild type enzymes for all of the mutant enzymes, with the exception of E78A, which exhibits binding of α-ketoglutarate to E and E·NADH. Large changes in V/K _Lys, but not V, suggest that Glu78 and Glu122 contribute binding energy for lysine. Shifts of more than a pH unit to higher and lower pH of the pK_a values observed in the V/KLys pH-rate profile of the mutant enzymes suggests that the presence of Glu⁷⁸ and Glu¹²² modulates the basicity of the catalytic groups.

Full text of DOI:10.1074/jbc.M110.119826

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 27, pp. 20756–20768, July 2, 2010
© 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.
Glutamates 78 and 122 in the Active Site of Saccharopine
Dehydrogenase Contribute to Reactant Binding and
Modulate the Basicity of the Acid-Base Catalysts*
Received for publication, March 3, 2010, and in revised form, April 27, 2010 Published, JBC Papers in Press, April 28, 2010, DOI 10.1074/jbc.M110.119826
Devi K. Ekanayake, Babak Andi, Kostyantyn D. Bobyk, Ann H. West, and Paul F. Cook1
From the Department of Chemistry and Biochemistry, University of Oklahoma, Norman, Oklahoma 73019
Saccharopine dehydrogenase catalyzes the NAD-dependent
oxidative deamination of saccharopine to give L-lysine and
␣-ketoglutarate. There are a number of conserved hydrophilic,
ionizable residues in the active site, all of which must be impor-
tant to the overall reaction. In an attempt to determine the con-
tribution to binding and rate enhancement of each of the resi-
dues in the active site, mutations at each residue are being made,
and double mutants are being made to estimate the interrela-
tionship between residues. Here, we report the effects of muta-
tions of active site glutamate residues, Glu78 and Glu122, on
reactant binding and catalysis. Site-directed mutagenesis was
used to generate E78Q, E122Q, E78Q/E122Q, E78A, E122A, and
E78A/E122A mutant enzymes. Mutation of these residues
increases the positive charge of the active site and is expected to
affect the pKa values of the catalytic groups. Each mutant
enzyme was completely characterized with respect to its kinetic
and chemical mechanism. The kinetic mechanism remains the
same as that of wild type enzymes for all of the mutant enzymes,
with the exception of E78A, which exhibits binding of ␣-ketogl-
utarate to E and E⅐NADH. Large changes in V/KLys, but not V,
suggest that Glu78 and Glu122 contribute binding energy for
lysine. Shifts of more than a pH unit to higher and lower pH of
the pKa values observed in the V/KLys pH-rate profile of the
mutant enzymes suggests that the presence of Glu78 and Glu122
modulates the basicity of the catalytic groups.
lyzes the final step of the ␣-aminoadipate pathway, the revers-
ible pyridine nucleotide-dependent oxidative deamination of
saccharopine using NAD as the oxidizing agent, to produce
␣-ketoglutarate (␣-Kg) and lysine (Scheme 1) (2). SDH from
Saccharomyces cerevisiae is a monomer with a molecular mass
of 41 kDa, with one active site (8).
On the basis of the pH dependence of the kinetic parame-
ters (9), dissociation constants for the competitive inhibitors
(1), and isotope effects (9), a chemical mechanism has been
proposed for SDH (1, 10). In the direction of saccharopine
oxidation, once NAD and saccharopine are bound, a group
with a pKa of 6.2 accepts a proton from the secondary amine
of saccharopine as it is oxidized. The imine of saccharopine
is hydrolyzed via general base-catalyzed activation of a water
molecule, via the intermediacy of carbinolamine intermedi-
ates. The base participating in the hydrolysis reaction has a
pKa of 7.2. Finally, the ⑀-amine of lysine is protonated by the
conjugate acid of the base with a pKa of 6.2, and products are
released (1, 9, 10). Isotope effects suggest that hydride trans-
fer and hydrolysis of the imine contribute to rate limitation
(9).
Structures of SDH have been solved in the apoenzyme
form (11) and with either AMP or oxalylglycine (OG), ana-
logues of NAD and ␣-Kg, bound (10). A semiempirical struc-
ture of the E⅐NAD⅐saccharopine ternary complex was gener-
ated on the basis of E⅐AMP and E⅐OG structures (Fig. 1) (10).
Given the semiempirical nature of the model, the relative
The ␣-aminoadipate pathway for lysine biosynthesis is positions of reactants and active site groups are estimates,
unique to fungi and euglenoids (1–3). Lysine is an essential and the overall model represents an open form of the
amino acid for most organisms. Human pathogenic fungi, enzyme, e.g. the distance for hydride transfer from the C␣
including Candida albicans, Aspergillus fumigatus, and Cryp- proton of the glutamyl moiety to the 4 position of the nico-
tococcus neoformans and the plant pathogen Magnaporthe tinamide ring is 4.7 Å, much too long for hydride transfer.
grisea, use this pathway for lysine biosynthesis (4–6). Knocking There are a number of ionizable residues in the active site,
out the LYS1 gene is lethal to the fungal cells, suggesting that and a multiple sequence alignment of the SDH from C. albi-
selective inhibition of one or more enzymes may help to control cans, Pichia guilliermondii, S. cerevisiae, A. fumigatus, and
or completely eradicate these pathogens in vivo (5, 7).
C. neoformans indicated that all are conserved in all five
Saccharopine dehydrogenase (SDH)2 (N6-(glutaryl-2)-L-ly- organisms, consistent with their importance in the mecha-
sine:NAD oxidoreductase (L-lysine forming) (EC 1.5.1.7)) cata- nism. In the ternary complex, Arg131 and Arg18 are likely
ion-paired to two of the carboxylates of saccharopine. In
addition, however, there are three lysine residues, Lys99 in
* Thisworkwassupported, inwholeorinpart, byNationalInstitutesofHealth
Grant GM 071417 (to P. F. C. and A. H. W.). This work was also supported by
the vicinity of the ␣-carboxylate of saccharopine, Lys77 in the
vicinity of the secondary amine of saccharopine, and Lys13
the Grayce B. Kerr Endowment to the University of Oklahoma (for P. F. C.).
1 To whom correspondence should be addressed: Dept. of Chemistry and
Biochemistry, University of Oklahoma, 620 Parrington Oval, Norman, OK
73019. Fax: 405-325-7182; E-mail: pcook@ou.edu.
2 The abbreviations used are: SDH, saccharopine dehydrogenase; ␣-Kg, ␣-ke-
toglutarate; OG, oxalylglycine; WT, wild type; D2O, deuterium oxide; Ni-
NTA, nickel-nitrilotriacetic acid; Ches, 2-(cyclohexylamino)ethanesulfonic
acid; Mes, 2-(N-morpholino)ethanesulfonic acid; Taps, 3-[tris(hydroxy-
methyl)methyl]aminopropanesulfonic acid; NADD, reduced nicotinamide
adenine dinucleotide with deuterium in the 4R position.
20756 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 27•JULY 2, 2010

SDH Glu78 and Glu122 Modulate Active Site Basicity
near Lys77; three glutamates, Glu122 near Lys99, Glu78 near
Lys77 and Lys13, and Glu16 near Arg18; and an imidazole,
His96. In the ternary complex, the nicotinamide ring of NAD
is positively charged, but in the vicinity of Asp319, the sec-
ondary amine of saccharopine is positively charged given its
pKa of about 10 (9). The active site is positively charged, and
this will certainly affect the pKa values of all of the ionizable
residues in the site.
EXPERIMENTAL PROCEDURES
Materials—L-Saccharopine, L-lysine, ␣-Kg, ampicillin, chlor-
amphenicol, phenylmethylsulfonyl fluoride, horse liver alcohol
dehydrogenase, and bakers’ yeast aldehyde dehydrogenase
were obtained from Sigma. ␤-NADH, ␤-NAD, Luria-Bertani
(LB) broth, LB-agar, and imidazole were purchased form
U. S. Biochemical Corp. Ches, Hepes, Mes, Taps, Tris, and
imidazole were from Research Organics. Ethanol-d6 (99% atom
D) and D2O (99.9% atom D) were purchased from Cambridge
Isotope Laboratories. Ethyl alcohol (absolute, anhydrous) was
from Pharmaco-Aaper. Isopropyl-␤-D-1-thiogalactopyrano-
side was from Invitrogen, and the GenElute plasmid miniprep
kit was from Sigma. Ni-nitrilotriacetic acid (Ni-NTA)-agarose
resin was from Qiagen. The QuikChange site-directed
mutagenesis kit was from Stratagene, and the plasmid purifica-
tion kit was from Sigma. Bradford reagent (protein assay dye
reagent concentrate) was obtained from Bio-Rad. All chemicals
were obtained commercially, were of the highest grade avail-
able and were used without further purification.
In this paper the role of Glu78 and Glu122 was studied by
changing them to glutamine or alanine. Eliminating these
negatively charged residues will increase the positive charge
in the site and should affect the pKa values of the remaining
residues, including the catalytic groups. In addition, previ-
ous studies suggest that there is a neutral acid in the vicinity
of the secondary amine of saccharopine, and Glu78 and
Glu122 are candidates for this residue (9). Mutant enzymes
were characterized via the pH dependence of kinetic param-
eters and isotope effects. Data are discussed in terms of the
proposed mechanism of SDH.
Site-directed Mutagenesis—Site-directed mutagenesis was
performed using the plasmid sdhHX1, which contains the S.
cerevisiae LYS1 gene (1), as a template to change Glu78 and
Glu122 to Gln and Ala. The forward and reverse primers used
to generate the E78Q, E122Q, E78A, and E122A are listed in
the Table 1. Double mutant enzymes were prepared using the
E78Q forward and reverse primers and the E122Q mutant
gene to generate E78Q/E122Q, whereas E78A forward and
reverse primers were used with the E122A mutant gene to gen-
erate E78A/E122A. The PCR procedure was as follows. The
reaction mixtures were first heated to 94 °C for 1 min to activate
SCHEME 1. Reaction catalyzed by SDH.
FIGURE 1. Stereoview of the E⅐NAD⅐saccharopine complex from a semiempirical model (10). The figure was obtained from the structures of SDH from
S. cerevisiaewithoxalylglycinebound(2QRL), andAMPbound(2QRK)(10). ThenicotinamideringofNADisshowntothe leftofthefigurenearAsp319. Thefigure
was constructed using PyMOL.
JULY 2, 2010•VOLUME 285•NUMBER 27
JOURNAL OF BIOLOGICAL CHEMISTRY 20757

SDH Glu78 and Glu122 Modulate Active Site Basicity
TABLE 1
DNA sequences of the forward and reverse PCR primers
Primersa
DNA sequence from 5؅ to 3؅
E78Q Forward
E78Q Reverse
E122Q Forward
E122Q Reverse
E78A Forward
E78A Reverse
E122A Forward
E122A Reverse
AGAATCATTATAGGTTTGAAGCAATGCCTGAAACCGATACTTTC
GAAAGTATCGGTTTCAGGCATTGCTTCAAACCTATAATGATTCT
CGGTACTCTATATGATTTGCAATTTTTGGAAAATGACC
GGTCATTTTCCAAAAATTGCAAATCATATAGAGTACCG
CATTATAGGTTTGAAGCAAATGCCTGAAACCG
CGGTTTCAGGCATTTGCTTCAAACCTATAATG
CACGGTACTCTATATGATTTGGCATTTTTGGAAAATGACCAAGGT
ACCTTGGTCATTTTCCAAAAATGCCAAATCATATAGAGTACCGTG
a The mutated codon is indicated in bold letters.
the Pfu polymerase Turbo enzyme. Denaturation of double- both reaction directions, but only in the direction of saccharo-
stranded plasmid DNA was done at 94 °C for 1.5 min. Depend- pine formation for the E78A, E122A, E78Q/E122Q, and E78A/
ing on the melting temperatures of the respective primers, E122A mutant enzymes. All data were collected at 25 °C in 100
annealing was set at 50–60 °C for 2 min. Extension of the new mM Hepes, pH 7.2. In the direction of lysine formation, initial
DNA was carried out at 68 °C for 8 min. The cycle was repeated rates were measured for E78Q and E122Q mutant enzymes, as
18 times, and completion of existing transcripts was done at a function of saccharopine concentration (0.5–10 Km) at differ-
68 °C for 20 min. Original methylated plasmid was then ent fixed levels of NAD (0.5–10 Km). In the direction of saccha-
digested using the DpnI restriction enzyme. The presence of the ropine formation, initial velocities for E78Q and E122Q were
new plasmid was estimated by agarose gel electrophoresis, tak- measured as a function of lysine concentration (0.5–10 Km) at
ing samples before and after addition of DpnI, from the PCR different fixed levels of ␣-Kg (0.5–10 Km) with NADH main-
mixture. The XL-1-Blue competent cell strain of Escherichia tained near saturation (Ն10 Km). Additionally, initial velocity
coli was then transformed with the plasmids containing muta- studies were also carried out for WT SDH as described previ-
tions. The transformed cells were grown overnight at 37 °C in ously (1). Lysine was added as the hydrochloride salt. As a result
LB medium supplemented with ampicillin, 100 ␮g/ml. Plas- of the high concentrations of lysine used, as high as 1.2 M, the
mids were isolated and purified using the GenElute plasmid effect of added NaCl on the initial rate was tested; no effect was
minipreparation kit. The entire gene was then sequenced for all found.
six mutations at the Sequencing Core of the Oklahoma Medical
Research Foundation, Oklahoma City, OK.
Pairwise Analysis—Pairwise analyses were performed for
E78A, E122A, E78Q/E122Q, and E78A/E122A, as described
Expression and Purification of Mutant Enzymes—E. coli previously (1), in the direction of saccharopine formation. One
BL21 (DE3) RIL cells were transformed with plasmids contain- substrate was varied (0.5–10 Km) at different fixed concentra-
ing the E78Q, E122Q, E78A, E122A, E78Q/E122Q, or E78A/ tions of the second one (0.5–10 Km), maintaining the third sub-
E122A mutant gene. All mutant proteins were expressed as strate near saturation (Ն10 Km). This experiment was carried
described previously (1), using isopropyl ␤-D-1-thiogalactopy- out for all reactant pairs: Lys/␣-Kg, NADH/␣-Kg, and
ranoside for induction. Protein purification was also carried out NADH/Lys.
as for wild type (WT) enzyme (1) with the exception that the
Dead-end Inhibition Studies—Inhibition patterns were
imidazole concentration employed to elute the mutant protein measured for all mutant proteins at the extremes of pH (6 and
depended on the mutant enzyme being purified. Proteins 9) using OG, a structural analogue of ␣-Kg, as the dead-end
bound to the Ni-NTA column were eluted using an imidazole inhibitor. Lysine was varied at different fixed concentrations of
gradient, 30–300 mM, at pH 8. The E78Q mutant enzyme OG including zero, whereas NADH and ␣-Kg were maintained
eluted at 150–180 mM imidazole, whereas remaining mutant at saturation and at a low concentration (2 Km), respectively. To
proteins eluted at 180–300 mM imidazole. Purity of the pro- determine whether there was a change in the kinetic mecha-
teins was assessed using SDS-PAGE with the gel stained with nism, a dead-end inhibition pattern was also obtained for the
Coomassie Brilliant Blue G-250. Protein concentration was E78A/E122A mutant protein at pH 7.2. The initial rate was
measured by Bradford assay, by measuring the absorbance at measured at different fixed levels of NADH (around Ki NADH),
595 nm (12).
varying OG (0.5–5 Ki), with lysine and ␣-Kg maintained at 2
Enzyme Assay—The SDH reaction was monitored via the Km. A pattern was also obtained by varying Lys (0.5–10 Km), at
appearance or disappearance of NADH at 340 nm (⑀340 ϭ 6220 different fixed levels of OG, at fixed ␣-Kg (1.5 Km) and with
M
Ϫ1cmϪ1) using a Beckman DU 640 spectrophotometer. All NADH near saturation (10 Km). The appKi for OG in all cases
assays were carried out at 25 °C, and the temperature was main- was first estimated by measuring the rate as a function of OG
tained using a Neslab RTE-111 water bath. Rate measurements with other reactants fixed at Km, plotting 1/v versus I, and
were carried out in 0.5 ml of 100 mM Hepes, pH 7.2. Reactions extrapolating 1/v to zero.
were initiated by the addition of enzyme to a mixture contain-
pH Studies—To determine whether the mutations affected
ing all other reaction components, and the initial linear portion the pKa values observed in the pH-rate profile of the WT SDH,
of the time course was used to calculate the initial velocity. The initial velocity was measured in the direction of saccharopine
amount of enzyme added was determined using an enzyme formation as a function of pH at 25 °C. The pH dependence of
concentration series (v versus [E]) for each mutant enzyme.
V, the V/KLys, and V/K␣-Kg was measured as a function of pH
Initial Velocity Studies—Initial velocity patterns were (pH 5–10). The V/K values were obtained by measuring the
obtained for both the E78Q and E122Q mutant enzymes in initial rate as a function of one substrate with all others main-
20758 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 27•JULY 2, 2010

SDH Glu78 and Glu122 Modulate Active Site Basicity
tained at saturation. Experiments were carried out for only the weighting method. Data obtained from the initial velocity pat-
single mutant proteins, varying ␣-Kg with the other two sub- terns, in the absence of added products, were fitted using either
strates fixed at saturation (Ն10 Km). For both double mutant Equation 1 for a sequential mechanism or Equation 2 with the
enzymes, lysine inhibited the reaction at low concentrations of constant term absent, or Equation 3 for competitive inhibition
␣-Kg, and thus V/K␣-Kg was not determined. The pH was main- by B, in a sequential mechanism. Data obtained from dead-end
tained using the same buffers over the same pH range, as before inhibition patterns were fitted using Equations 4 and 5 for com-
(1). No buffer effects were observed on any mutant enzyme. petitive and parabolic competitive inhibition by OG, respec-
The pH was recorded before and immediately after measuring tively. Noncompetitive and uncompetitive inhibition data were
the initial velocity at 25 °C; no significant differences were fitted using Equations 6 and 7, respectively. Equations 1–7 are
detected.
standard and can be found in Refs. 15, 17.
Primary Substrate Deuterium Kinetic Isotope Effects—Iso-
tope effects were measured for all mutant enzymes in the pH-
independent region of their pH-rate profiles (pH 5 for E78A;
pH 9.5 for E78Q, E122Q, E122A and E78A/E122A; and pH 7.2
for E78Q/E122Q). Effects were measured in the direction of
saccharopine formation, using NADD as the deuterated sub-
strate (1). DV2 and D(V2/KLys) were obtained for all mutant pro-
teins, by measuring the initial rates in triplicate, as a function of
lysine concentration (0.5–10 Km), at saturating levels of ␣-Kg
(10 Km) and NADH(D) (10 Km).
VAB
␯ ϭ
(Eq. 1)
(Eq. 2)
(Eq. 3)
KiaKb ϩ KaB ϩ KbA ϩ AB
VAB
␯ ϭ
KaB ϩ KbA ϩ AB
VAB
␯ ϭ
B
͑K K ϩ K B͒ 1 ϩ
ϩ K A ϩ AB
b
ͩ ͪ
ia
b
a
KIB
4R-4-2H NADH and NADH were prepared as described previ-
ously (13). Briefly, ethanol-d6 (or ethanol) and NAD were incu-
bated with alcohol and aldehyde dehydrogenases in 6 mM Taps,
pH 9, at room temperature, for 1–2 h. The pH was maintained at
pH 9 using 0.1 N KOH throughout the reaction time course. After
2 h, the reaction was quenched by vortexing with a few drops of
carbon tetrachloride, and the aqueous layer was separated. The
purity of the final NADH(D) was estimated by measuring the
absorbance ratio at 260/340 nm; a ratio of 2.27 Ϯ 0.06 was
obtained similar to the value of 2.15 Ϯ 0.05 for pure compound
(13). The concentrations of NADH(D) were estimated using a ⑀340
of 6220 MϪ1cmϪ1. The initial rates measured using the same con-
VA
␯ ϭ
␯ ϭ
␯ ϭ
␯ ϭ
(Eq. 4)
(Eq. 5)
(Eq. 6)
(Eq. 7)
Ka͑1 ϩ I͞Kis͒ ϩ A
VA
Ka͑1 ϩ I͞Kis1 ϩ I2͞Kis1Kis2͒ ϩ A
VA
Ka͑1 ϩ I͞Kis͒ ϩ A͑1 ϩ I͞Kii͒
VA
Ka ϩ A͑1 ϩ I͞Kii͒
centrations of commercial NADH and the NADH prepared as In Equations 1–7, v and V are initial and maximum velocities, A,
above, were similar. The NADH(D), was used immediately after B, and I are substrate and inhibitor concentrations, Ka and Kb
preparation without further purification.
are Michaelis constants for substrates A and B, respectively. In
Solvent Deuterium Kinetic Isotope Effects—The isotope Equations 1 and 3, Kia is the dissociation constant for A from
effects were obtained by direct comparison of initial rates, in the EA complex and KIB is the substrate inhibition constant for
triplicate, in D2O and H2O, in the pH(D)-independent region of B. In Equations 4–7, Kis and Kii are the slope and intercept
the pH-rate profiles (14). For rates measured in D2O, substrate inhibition constants, respectively. Parabolic competitive inhi-
preparation and pH(D) adjustments were done as described bition requires two molecules of I to bind in sequence to E. Kis1
previously (1). Initial rates were measured varying lysine at and Kis2 are the inhibition constants for E⅐I and E⅐I2 complexes,
fixed saturating levels of NADH and ␣-Kg (Ն10 Km). Reactions respectively.
were initiated by adding a small amount of each of the mutant
enzymes in H2O.
Data for pH-rate profiles that decreased with a slope of 1 at
low pH and a slope of Ϫ1 at high pH were fitted using Equation
Multiple Solvent Deuterium/Substrate Deuterium Kinetic Isotope 8. Data for pH-rate profiles with a slope of ϩ1 at low pH were
Effects—Multiple isotope effects were determined in the direction of fitted using Equation 9, whereas data for pH-rate profiles with a
saccharopine formation, for all mutant enzymes, by direct compari- slope of Ϫ1 at high pH were fitted using Equation 10. Data for
son of the initial rates in H2O and D2O as above, varying lysine at a the E78A V2/Et pH-rate profile were fitted to Equation 11. Data
fixed saturating concentration of NADD and ␣-Kg (Ն10 Km).
for pH-rate profiles with a slope of ϩ1 at low pH and a partial
Data Analysis—Initial rate data were first analyzed graphi- change at high pH were fitted using Equation 12. Similarly, data
cally, using double reciprocal plots of initial velocities versus for pH-rate profiles with a slope of Ϫ1 at high pH and a partial
substrate concentrations and suitable secondary and tertiary change at low pH were fitted using Equation 13. Data for pH-
plots to determine the quality of the data and the proper rate rate profiles with limiting slopes of ϩ1 and Ϫ1 at low and high
equation for data fitting. Data were then fitted using the appro- pH, respectively, and with a partial change in the middle, were
priate equations according to Cleland (15). and the Marquardt- fitted using Equation 14. Equations 8–12 are standard and can be
Levenberg algorithm (16), supplied with the EnzFitter program found in Refs. 15, 17. Equations 12 and 13 are derived from a com-
from BIOSOFT, Cambridge, U.K. Kinetic parameters and their bination of 9 and 11 and 10 and 11, respectively, whereas Equation
corresponding standard errors were estimated using a simple 14 is derived from a combination of Equations 8 and 11.
JULY 2, 2010•VOLUME 285•NUMBER 27
JOURNAL OF BIOLOGICAL CHEMISTRY 20759

SDH Glu78 and Glu122 Modulate Active Site Basicity
TABLE 2
Kinetic parameters for the E78Q, E122Q, and E78Q/E122Q
Kinetic parameters were determined in both reaction directions for E78Q and E122Q. For E78Q/E122Q mutant enzyme it was determined only in the direction of
saccharopine formation. The reactions were monitored at 25 °C and at pH 7.2.
Kinetic parameters
SDH-WT
E78Q
E122Q
E78Q/E122Q
at pH 7.2
Forward reaction
Ϫ1
V1/Et (s
)
1.1 Ϯ 0.1
(1.2 Ϯ 0.1) ϫ 103
(1.6 Ϯ 0.3) ϫ 102
6.7 Ϯ 1.4
3.95 Ϯ 0.01
ϩ3.6
0.76 Ϯ 0.04
Ϫ1.45
NDa
ND
Fold change
V1/KNADEt (MϪ1s
Fold change
)
(3.62 Ϯ 0.58) ϫ 103
ϩ 3.1
(2.31 Ϯ 0.3) ϫ 102
Ϫ5.2
Ϫ1
Ϫ1
V1/KSacEt (MϪ1s
)
(2.1 Ϯ 0.4) ϫ 103
ϩ13
(5.5 Ϯ 0.3) ϫ 101
Ϫ3
ND
ND
ND
Fold change
K
Sac (mM)
2.0 Ϯ 0.4
Ϫ3.4
14.0 Ϯ 0.8
ϩ2.1
Fold change
NAD (mM)
Fold change
K
0.9 Ϯ 0.1
1.1 Ϯ 0.2
ϩ1.2
3.3 Ϯ 0.4
ϩ3.7
ND
KiNAD (mM)
1.1 Ϯ 0.3
0.5 Ϯ 0.3
Ϫ2.0
1.9 Ϯ 0.3
ϩ1.7
ND
ND
Fold change
Reverse reaction
Ϫ1
V2/Et (s
)
20.0 Ϯ 1.0
(1.6 Ϯ 0.2) ϫ 106
(2.5 Ϯ 0.4) ϫ 104
(2.8 Ϯ 0.7) ϫ 105
0.019 Ϯ 0.002
1.1 Ϯ 0.2
11.2 Ϯ 0.4
Ϫ1.2
4.3 Ϯ 0.1
Ϫ4.6
24.7 Ϯ 2.6
ϩ1.2
Fold change
V2/KNADHEt (MϪ1s
)
(8.0 Ϯ 0.3) ϫ 105
Ϫ2
(1.9 Ϯ 0.2) ϫ 105
Ϫ8.4
(2.0 Ϯ 0.2) ϫ 105
Ϫ8
Ϫ1
Fold change
V2/KLysEt (MϪ1s
)
(2.8 Ϯ 0.2) ϫ 103
Ϫ8.8
(4.100 Ϯ 0.001) ϫ 102
Ϫ60.7
(9.1 Ϯ 0.9) ϫ 102
Ϫ27.4
Ϫ1
Fold change
V2/K␣-Kg Et (MϪ1s
Fold change
)
(4.9 Ϯ 0.3) ϫ 104
Ϫ5.7
(1.50 Ϯ 0.07) ϫ 104
Ϫ18
(1.3 Ϯ 0.1) ϫ 104
Ϫ22
Ϫ1
K
NADH (mM)
0.014 Ϯ 0.004
Ϫ1.4
0.025 Ϯ 0.002
ϩ1.3
0.12 Ϯ 0.01
ϩ6.3
Fold change
Lys (mM)
Fold change
K
4.0 Ϯ 0.4
ϩ3.6
11.0 Ϯ 0.6
ϩ10
27.1 Ϯ 1.3
ϩ24.5
K
␣-Kg (mM)
0.11 Ϯ 0.03
0.23 Ϯ 0.02
ϩ2.1
0.30 Ϯ 0.01
ϩ2.7
2.0 Ϯ 0.5
ϩ17.8
Fold change
a ND, not determined.
Isotope effect data were fitted using Equations 15 and 16,
which allow the isotope effects on V and V/K to be independent
or equal, respectively. Equations 15 and 16 are standard and can
be found in reference (15).
H
K2
logy ϭ log C/ 1 ϩ
ϩ
(Eq. 8)
(Eq. 9)
ͩ
ͪ
ͬ
ͫ
K1
H
H
logy ϭ log C/ 1 ϩ
ͩ ͪ
ͫ
ͬ
ͬ
K1
VA
␯ ϭ
␯ ϭ
(Eq. 15)
K2
Ka͑1 ϩ FiEV/K͒ ϩ A͑1 ϩ FiEV͒
logy ϭ log C/ 1 ϩ
(Eq. 10)
(Eq. 11)
(Eq. 12)
ͩ ͪ
ͫ
ͫ
ͫ
H
VA
(Eq. 16)
YL͑K1/H͒ ϩ YH
1 ϩ ͑K1/H͒
͑Ka ϩ A͒͑1 ϩ FiEv͒
logy ϭ log
ͬ
In Equations 15 and 16, Fi is the fraction of deuterium label in
the substrate or D2O in the solvent, EV/K and EV are the isotope
effects Ϫ1 on V/K and V, respectively, and Ev is the isotope
effect Ϫ1 on V and V/K, when they are equal to one another. All
other parameters are as defined above.
K2
H
K2
logy ϭ log Y
1 ϩ
ϩ Y
1 ϩ
ͩ ͪ
Ͳ
ͩ ͪ
Ͳ
ͩ ͪ
ͬ
L
H
H
K1
H
H
Y
ͩ ͪ
H
K1
H
Molecular Graphics—The active site figure of SDH was pre-
pared using PyMOL version 0.99 (18).
logy ϭ log YL ϩ
1 ϩ
(Eq. 13)
(Eq. 14)
Ͳ
ͩ ͪ
K2
K1
΄
΅
1 ϩ
ͩ ͪ
H
RESULTS
H
K2
K3
Cell Growth, Protein Expression, and Purification—Expres-
sion of the E78Q, E122Q, E78Q/E122Q, E78A, E122A, and
E78A/E122A mutant enzymes was nearly three times lower
than that of the WT SDH using the same conditions employed
for WT. The E78Q mutant enzyme was eluted from the Ni-
Y
1 ϩ
ϩ Y
1 ϩ
ͩ
Ͳ
ͩ ͪ ͩ ͪ
Ͳ
ͩ ͪͪ
ͫ
L
H
ͬ
K1
H
H
logy ϭ log
K2
1 ϩ
ͩ ͪ
H
In Equations. 8–14, y is the observed value of the parameter (V NTA column with buffer containing 150–180 mM imidazole at
or V/K) at any pH, C is the pH-independent value of y, H is pH 8, whereas all others eluted at Ն180 mM imidazole. Purity of
hydrogen ion concentration, K1, K2, and K3 represent acid dis- the proteins was assessed using SDS-PAGE, and all of the
sociation constants for enzyme or substrate functional groups, mutant proteins were estimated to be Ͼ98% pure. The amount
and YL and YH are constant values of V or V/K at the low and of purified enzyme obtained from a 1-liter culture for E78Q,
high pH, respectively.
E122Q, E78A, E122A, E78Q/E122Q, and E78A/E122A was 1,
20760 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 27•JULY 2, 2010

SDH Glu78 and Glu122 Modulate Active Site Basicity
0.7, 4, 3, 2.7, and 3.7 mg, respectively. His-tagged mutant SDH
proteins are active and stable for months when kept at 4 °C in
100 mM Tris and 300 mM KCl at pH 8.
Initial Velocity Studies of E78Q, E122Q, and E78Q/E122Q—
Double reciprocal initial velocity patterns were obtained at pH
7, in both reaction directions, for the E78Q and E122Q mutant
enzymes as discussed under “Experimental Procedures.” How-
ever, the cost of saccharopine prohibited measuring initial rate
data for all of the mutant enzymes in the direction of Lys for-
mation, and data were obtained only in the direction of saccha-
ropine formation for the remaining mutant enzymes. Initial
velocity patterns intersect to the left of the 1/v axis (data not
shown), consistent with the sequential mechanism proposed
for the WT enzyme. For the E78Q/E122Q mutant enzyme, the
NADH/Lys pair exhibited a parallel double reciprocal plot,
whereas the Lys/␣-Kg pair illustrated inhibition by lysine at low
␣-Kg levels. The Michaelis constants for Lys and ␣-Kg
increased 25- and 18-fold, respectively, for E78Q/E122Q.
V2/KLysEt decreased about 60-fold for E122Q, whereas the V/K
values for lysine and ␣-Kg decreased at least 22-fold for E78Q/
E122Q. Kinetic parameters are summarized in Table 2.
Pairwise Analysis—Initial velocity patterns for E78A, in the
direction of saccharopine formation, for all three variable pairs,
Lys/␣-Kg, ␣-Kg/NADH, and NADH/Lys, are similar to WT (1).
Patterns intersect to the left of the ordinate for Lys/␣-Kg pair,
whereas ␣-Kg/NADH and NADH/Lys gave a series of parallel
lines (data not shown). For E122A, the double reciprocal plot
for the Lys/␣-Kg pair exhibited a parallel pattern (data not
shown). Inhibition by ␣-Kg and lysine is observed at low NADH
concentrations for ␣-Kg/NADH (data not shown) and the
NADH/Lys pairs, respectively. The pattern, exhibiting compet-
itive substrate inhibition by Lys for NADH/Lys pair is shown in
Fig. 2A as an example. For E78A/E122A, the double reciprocal
plot for ␣-Kg/NADH differed from that of the WT and exhibits
a pattern that intersects to the left of the ordinate (Fig. 2B),
suggesting there might be a change in kinetic mechanism. The
Lys/␣-Kg and NADH/Lys pairs, exhibited inhibition by lysine,
at low concentrations of ␣-Kg or NADH, respectively. For the
E122A and E78A/E122A mutant enzymes, KLys increased more
FIGURE 2. Initial velocity patterns for the E122A and E78A/E122A mutant
enzymes. A, double reciprocal plot of initial rate (E122A) as a function of the
concentrationofNADH, asshownatdifferentfixedlevelsoflysine:20mM (ࡗ),
29.4 mM (f), 52.6 mM (Œ), and 300 mM (F). The concentration of ␣-Kg was
fixed at 5 mM (saturation). Data exhibit competitive substrate inhibition by
lysine. The points are experimental, whereas the lines are based on a fit to
Equation 3. B, double reciprocal plot of initial rate (E78A/E122A), as a function
of the concentration of ␣-Kg as shown at different fixed levels of NADH: 0.025
mM (ࡗ), 0.036 mM (Œ), 0.068 mM (F), and 0.54 mM (f). The concentration of
Lys was fixed at 1200 mM (saturation). The points are experimental, whereas
the lines are based on a fit to Equation 1.
than 30- and 170-fold, respectively, whereas K
increased
40-fold for E78A/E122A. The V/K for lysine ␣d-eKcgreased for
TABLE 3
Kinetic parameters for E78A, E122A, and E78A/E122A mutant enzymes in the direction of saccharopine formation at 25 °C and pH 7.2
Kinetic parameters
at pH 7.2
SDH-WT
20.0 Ϯ 1.0
E78A
E122A
E78A/E122A
Ϫ1
V2/Et (s
)
88.8 Ϯ 4.7
19.4 Ϯ 0.8
24.80 Ϯ 0.04
Fold change
ϩ4.4
ϳ1
ϩ1.2
V2/KNADHEt (MϪ1s
)
(1.6 Ϯ 0.2) ϫ 106
(2.5 Ϯ 0.4) ϫ 104
(2.8 Ϯ 0.7) ϫ 105
0.019 Ϯ 0.002
1.1 Ϯ 0.2
(2.5 Ϯ 0.1) ϫ 106
ϩ1.53
(3.1 Ϯ 0.1) ϫ 105
Ϫ5.1
(2.20 Ϯ 0.03) ϫ 105
Ϫ7.3
Ϫ1
Fold change
V2/KLysEt (MϪ1s
Fold change
)
(1.43 Ϯ 0.08) ϫ 105
ϩ5.7
(5.3 Ϯ 0.2) ϫ 102
Ϫ47
(1.300 Ϯ 0.002) ϫ 102
Ϫ192
Ϫ1
V2/K␣-Kg Et (MϪ1s
)
(4.9 Ϯ 0.4) ϫ 105
ϩ1.8
(3.5 Ϯ 0.2) ϫ 104
Ϫ8
(5.11 Ϯ 0.01) ϫ 103
Ϫ55
Ϫ1
Fold change
K
NADH (mM)
0.036 Ϯ 0.003
ϩ1.9
0.062 Ϯ 0.034
ϩ3.3
0.113 Ϯ 0.001
ϩ5.9
Fold change
Lys (mM)
Fold change
␣-Kg (mM)
Fold change
K
0.62 Ϯ 0.01
Ϫ1.76
36.5 Ϯ 1.1
ϩ33.0
190.7 Ϯ 1.4
ϩ176
K
0.11 Ϯ 0.03
0.180 Ϯ 0.002
ϩ1.6
0.556 Ϯ 0.004
ϩ5.1
4.850 Ϯ 0.001
ϩ44.1
K
iNADH (mM)
0.017 Ϯ 0.003
0.038 Ϯ 0.001
ϩ2.2
0.019 Ϯ 0.003
N/Aa
0.015 Ϯ 0.002
N/A
Fold change
a N/A, not applicable.
JULY 2, 2010•VOLUME 285•NUMBER 27
JOURNAL OF BIOLOGICAL CHEMISTRY 20761

SDH Glu78 and Glu122 Modulate Active Site Basicity
OG versus NADH was obtained at
pH 7.2. For E78A/E122A, at pH 7.2,
OG was an uncompetitive inhibitor
versus NADH with a Kii of 0.50 Ϯ
0.03 mM, whereas it was noncom-
petitive against lysine, with Kis and
Kii values of 0.70 Ϯ 0.05 and 1.40 Ϯ
0.06 mM, respectively, suggesting
binding of OG after NADH as found
for WT.
pH Studies—The pH dependence
of kinetic parameters was deter-
mined, for all of the mutant
enzymes, in the direction of saccha-
ropine formation, at 25 °C. Results
are shown in Figs. 4–9. All mutant
enzymes were active and stable over
the pH range 5–10. pKa values and
pH-independent values of parame-
ters are summarized in Table 5.
V2/Et of E78Q, E122A, and E78A/
E122A is independent of pH over
the range used. V2/KLysEt is bell-
shaped for E122Q, E78A, and
E122A as for WT, but the pKa values
of the groups involved in binding
and or catalysis have been shifted to
lower and higher pH compared with
WT. The exception is E122A, which
FIGURE 3. Parabolic competitive inhibition by OG against lysine. Double reciprocal plot of initial rate as a
function of lysine concentration is shown at different fixed levels of OG: 0 mM (f), 0.01 mM (F), 0.05 mM (Œ), and 0.1
mM (ࡗ). TheconcentrationsofNADHand␣-Kgwerefixedat0.4mM (saturation)and0.4mM (2Km), respectively. The
points are experimental, whereas the lines are theoretical on the basis of a fit to Equation 5. The inset shows a plot of
slope versus OG, illustrating the parabolic slope effect. The curve is determined using Equation 5.
TABLE 4
Inhibition constants for OG at pH 6 and 9
exhibits a partial change on the acid side. On the acid side of the
E78Q V2/KLysEt pH-rate profile, the pKa of the group observed
for the WT enzyme is absent. The V2/K␣-KgEt pH-rate profiles
for E122Q and E122A are bell-shaped, giving a pKa on the acid
side of the profile, not observed for WT.
Mutant
enzyme
pH
Kis
Kii
Patterna
mM
mM
E78Q
6
9
6
9
6
9
6
0.06 Ϯ 0.01
0.12 Ϯ 0.03
0.6 Ϯ 0.10
0.28 Ϯ 0.07
0.13 Ϯ 0.01
1.52 Ϯ 0.2
0.27 Ϯ 0.06
NC
NC
0.48 Ϯ 0.09
E122Q
0.056 Ϯ 0.010
0.26 Ϯ 0.07
NC
Substrate Deuterium Kinetic Isotope Effects—Primary deute-
rium kinetic isotope effects were measured by direct compari-
son of initial rates as a function of Lys concentrations at pH 7.2
for E78A, E78Q, and E122Q; at pH 5 and 9 for E78A; and at pH
7.0 for E78A/E122A and E78Q/E122Q. Experiments were car-
ried out at 25 °C, using A-side NADD as the labeled substrate.
With one exception, mutant enzymes exhibited finite isotope
effects on both V and V/K. The exception is E78A, which gave a
D(V) of 0.9 Ϯ 0.1. Given isotope effects larger than WT, hydride
transfer appears to contribute to rate limitation somewhat
more for the E78A/122A, E122A, and E122Q mutant enzymes.
Data obtained for all mutant enzymes are summarized in
Tables 6 and 7.
NC
E78Q/E122Q
E78A
0.53 Ϯ 0.08
NC
0.47 Ϯ 0.08
NC
K
is1 ϭ 0.030 Ϯ 0.008
is2 ϭ 0.005 Ϯ 0.003
0.40 Ϯ 0.01
C-Parabolic
K
9
6
9
6
9
C
E122A
0.07 Ϯ 0.01
0.28 Ϯ 0.07
0.24 Ϯ 0.02
1.88 Ϯ 0.6
2.03 Ϯ 0.06
NC
NC
NC
NC
1.08 Ϯ 0.22
E78A/E122A
0.71 Ϯ 0.10
1.60 Ϯ 0.08
a NC, noncompetitive; C, competitive.
E122A and E78A/E122A by more than 45- and 190-fold,
respectively, and the V/K for ␣-Kg decreased 55-fold for E78A/
E122A. However, kcat did not show significant changes, com-
pared with WT, for any of the mutant enzymes. Plots are not
shown, but the kinetic parameters obtained at pH 7.2 and 25 °C
for all mutant proteins are summarized in Tables 2 and 3.
Dead-end Inhibition Studies—Dead-end inhibition data were
obtained for all mutant proteins. With the exception of E78A,
noncompetitive inhibition by OG against lysine was observed at
pH 6 and 9. On the other hand, E78A gave competitive inhibi-
tion by OG against lysine. At pH 9, linear competitive inhibition
was observed, whereas parabolic competitive inhibition was
observed at pH 6 (Fig. 3). Data are summarized in Table 4.
To determine whether the kinetic mechanism of the E78A/
Solvent Kinetic Deuterium Isotope Effects—Isotope effects
were measured by direct comparison of the initial rates as a
function of Lys concentration in H2O and D2O in the pH(D)-
independent range of the V and V/K pH-rate profiles. For E78A,
solvent isotope effects could only be measured at pH 9; different
␣-Kg concentrations were required in D2O and H2O. E78Q,
E122A, E122Q, E78Q/E122Q, and E78A/E122A had solvent
isotope effects similar to those of WT, whereas E78A had rela-
tively small but significant solvent isotope effects. Data are
E122A mutant enzyme remains the same as WT, inhibition by summarized in Tables 6 and 7.
20762 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285•NUMBER 27•JULY 2, 2010

SDH Glu78 and Glu122 Modulate Active Site Basicity
Multiple Solvent Deuterium/Sub-
strate Kinetic Deuterium Isotope
Effects—Multiple isotope effects
were measured in H2O and D2O
using NADD as the dinucleotide
substrate to examine whether the
substrate and solvent isotope effects
reflect the same or different steps.
E78A/E122A exhibited the largest
multiple isotope effect, approxi-
mately 3.5, on V and V/K. E78A also
exhibited larger multiple isotope
effects, approximately 2.7, relative
to a value of about 1.6 for WT. Data
obtained for all mutant enzymes are
summarized in Tables 6 and 7.
DISCUSSION
On the basis of the semiempirical
model of the E⅐NAD⅐saccharopine
ternary complex of the S. cerevisiae
SDH (10), there are a number of ion-
izable residues in the active site, as
FIGURE 4. pH dependence of kinetic parameters for the SDH E78Q mutant enzyme in the direction of
saccharopine formation. Data were obtained at 25 °C for V2/Et (D), V2/KLysEt (E), and V2/K␣-KgEt (F). Data for WT
SDHareincludedforcomparison(V2/Et (A), V2/KLysEt (B), andV2/K␣-KgEt (C))(9). Thepointsaretheexperimentally
determined values, whereas the curves are theoretical based on fits of the data using Equation 7 for E and F;
V2/Et is pH-independent, and an average value is given.
discussed in the Introduction.
Although all cannot participate in
general base catalysis, they are all
completely conserved in all of the
enzymes for which a sequence is available. As a result, they must
be important for the overall reaction. Our long term goal is to
obtain an estimate of the contribution of each of the residues in
the active site to reactant binding and catalysis, directly or indi-
rectly. This will require estimates of the reactant Kd values,
microscopic rate constants for the catalytic steps, and pH-rate
profiles to show whether the residues changed have an effect on
pKa values. In this paper we have looked at the effect of Glu78
and Glu122 on the overall reaction. Elimination of either or both
of the glutamate side chains increases positive charge in the site,
and the effect of mutating these side chains is discussed below.
With the exception of the E78Q and E122Q mutant enzymes,
all other mutant enzymes were only characterized in the reverse
reaction direction due to the expense of saccharopine.
Kinetic Mechanism—The kinetic mechanism of SDH from S.
cerevisiae is ordered in the direction of lysine formation with
NAD bound before saccharopine, whereas in the reverse reac-
tion direction NADH binds to E, but lysine and ␣-Kg bind in
random order (1). In addition, above pH 8 the mechanism in the
reverse reaction direction changes to ordered with ␣-Kg bind-
ing after NADH and before lysine (9). With the exception of
E78A mutant enzyme, data indicate that the kinetic mechanism
of all mutant enzymes is the same as WT. In agreement, OG
dead-end inhibition patterns at pH 6 and 9 are noncompetitive
against lysine, for all mutant enzymes with the exception of
E78A. The largest changes in Kis and Kii for OG are observed for
the double mutant enzymes, E78Q/E122Q and E78A/E122A,
and the E122A single mutant enzyme. The noncompetitive
inhibition by OG versus ␣-Kg is indicative of binding of OG to
E⅐NADH and E⅐NADH⅐Lys complexes. The increase in the val-
ues of Kis and Kii is consistent with the observed decrease in
FIGURE5. pHdependenceofkineticparametersfortheSDHE78Amutant
enzymeinthedirectionofsaccharopineformation. Datawereobtainedat
25 °C for V2/Et (A), V2/KLysEt (B), and V2/K␣-KgEt (C). The points are the experi-
mentally determined values, whereas the curves are theoretical based on fits
of the data using Equation 9 for A and Equation 8 for B and C.
JULY 2, 2010•VOLUME 285•NUMBER 27
JOURNAL OF BIOLOGICAL CHEMISTRY 20763

SDH Glu78 and Glu122 Modulate Active Site Basicity
FIGURE 8. pH dependence of kinetic parameters for the SDH E78Q/E122Q
mutant enzyme in the direction of saccharopine formation. Data were
obtained at 25 °C for V2/Et (A) and V2/KLysEt (B). The points are the experimen-
tally determined values, whereas the curves are theoretical drawn by eye, and
pKa values were estimated graphically.
FIGURE 6. pH dependence of kinetic parameters for the SDH E122Q
mutant enzyme in the direction of saccharopine formation. Data were
obtained at 25 °C for V2/Et (A), V2/KLysEt (B), and V2/K␣-KgEt (C). The points are
the experimentally determined values, whereas the curves are theoretical
based on fits of the data using Equation 9 for A and Equation 8 for B and C.
FIGURE 9. pH dependence of kinetic parameters for the SDH E78A/E122A
mutant enzyme in the direction of saccharopine formation. Data were
obtained at 25 °C for V2/Et (A) and V2/KLysEt (B). The points are the experimen-
tally determined values, whereas curves are drawn by eye. An average value is
given for V2/Et.
are the largest for E122Q, E122A, and the double mutants
E78Q/E122Q and E78A/E122A; changes in V are small (Ͻ5-
fold), but high values for KLys were observed, suggesting that
Glu122 contributes to lysine binding.
However, in the case of E78A, at both pH 6 and 9, OG exhib-
its competitive inhibition, indicating that OG competes with
Lys and binds to the same binding site as Lys. OG is somewhat
structurally similar to Lys, so the subtle changes occurring in
the active site due to mutagenesis likely permit this. At pH 6,
E78A exhibits parabolic competitive inhibition, indicating that
OG binds to both E⅐NADH and E⅐NADH⅐OG complexes. The
dissociation constants for OG suggest that binding OG to
E⅐NADH makes it much more favorable for binding the second
OG.
FIGURE 7. pH dependence of kinetic parameters for the SDH E122A
mutant enzyme in the direction of saccharopine formation. Data were
obtained at 25 °C for V2/Et (A), V2/KLysEt (B), and V2/K␣-KgEt (C). The points are
the experimentally determined values, whereas the curves are theoretical
based on fits of the data using Equation 8 for C. The curve for B was drawn by
eye, and an average value is given for A.
At pH 7, for E78A/E122A, uncompetitive dead-end inhibi-
tion by OG versus NADH indicates that ␣-Kg binds after
affinity for ␣-Kg to the mutant enzymes, compared with the NADH is bound to the enzyme, whereas noncompetitive inhi-
WT. Data are consistent with the change in kinetic parameters bition from OG versus Lys suggests binding of ␣-Kg to both
(Tables 2 and 3). Most changes are small, but those for V/KLys E⅐NADH and E⅐NADH⅐Lys complexes. The kinetic mechanism
20764 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 27•JULY 2, 2010

SDH Glu78 and Glu122 Modulate Active Site Basicity
TABLE 5
Data obtained from pH rate profiles
V and V/K represent the pH-independent values in the respective profile; VH and V/KH represent the highest pH-independent value, VL and V/KL represent the lower
pH-independent value, and VL0 and V/KL0 represent the lowest pH-independent values, for the respective pH profile. Units of V and V/K are sϪ1 and MϪ1 sϪ1, respectively.
pK1 indicates the pKa of the group involved in the acid side of the profile whereas pK2 and pK3 indicate the pKa values of the groups involved, in the base side of the profiles.
Enzyme
WT
V2/Et
V2/KLysEt
V2/K␣-KgEt
V ϭ (5.8 Ϯ 0.3) ϫ 101
pK1 ϭ 5.8
V/K ϭ (1.44 Ϯ 0.07) ϫ 105
(pK1 ϩ pK2)/2 ϭ 7.2
V/K ϭ (2.16 Ϯ 0.08) ϫ 105
pK2 ϭ 8.9
pK2 ϭ 8.4
E78Q
V ϭ (2.00 Ϯ 0.05)
V/K ϭ (5.2 Ϯ 0.2) ϫ 103
pK2 ϭ 8.45 Ϯ 0.03
V/K ϭ (9.92 Ϯ 0.15) ϫ 104
pK2 ϭ 8.50 Ϯ 0.01
E122Q
V ϭ 5.09 Ϯ 0.03
V/K ϭ (5.05 Ϯ 0.07) ϫ 102
pK1 ϭ 6.50 Ϯ 0.04
V/K ϭ (1.9 Ϯ 0.4) ϫ 104
pK1 ϭ 6.30 Ϯ 0.04
pK1 ϭ 5.90 Ϯ 0.03
pK2 ϭ 8.80 Ϯ 0.05
pK2 ϭ 8.95 Ϯ 0.10
E78Q/E122Q
V
H ϭ 20.9 Ϯ 0.5
V/KH ϭ 75.6 Ϯ 5.3
V/KL ϭ 29.2 Ϯ 1.6
VL ϭ 5.24 Ϯ 0.33
NDa
pK2 ϭ (8.20 Ϯ 0.07)b
V/KL0 ϭ 2.06 Ϯ 0.60
pK1 ϭ 6.05 Ϯ 0.07b
pK2 ϭ 8.01 Ϯ 0.14
pK3 ϭ 9.21 Ϯ 0.18
E78A
V
H ϭ (1.5 Ϯ 0.1) ϫ 102
V/K ϭ (1.8 Ϯ 0.1) ϫ 105
pK1 ϭ 6.1 Ϯ 0.1
V/K ϭ (4.2 Ϯ 0.3) ϫ 105
pK2 ϭ 8.4 Ϯ 0.1
VL ϭ 11.6 Ϯ 0.6
pK1 ϭ 6.8 Ϯ 0.06
pK2 ϭ 8.5 Ϯ 0.1
V/KH ϭ (4.9 Ϯ 0.2) ϫ 102
V/KL ϭ (2.8 Ϯ 0.4) ϫ 101
pK1 ϭ (6.98 Ϯ 0.06)b
pK2 ϭ 8.7 Ϯ 0.1
V/K ϭ (1.96 Ϯ 0.23) ϫ 104
pK1 ϭ 6.3 Ϯ 0.12
E122A
V ϭ 14.12 Ϯ 0.14
V ϭ 22.4 Ϯ 0.2
pK2 ϭ 8.7 Ϯ 0.12
V/KH ϭ (2.19 Ϯ 0.03) ϫ 102
V/KL ϭ (2.7 Ϯ 0.1) ϫ 101
pK1 ϭ 6.66 Ϯ 0.03b
pK2 ϭ 8.4 Ϯ 0.1
E78A/E122A
ND
a ND, not determined.
b Groups that were important but not essential for catalysis/binding. Wild type data are also included for comparative purposes.
TABLE 6
proton transfer in the transition state for the hydride transfer
step (1).
Isotope effects data obtained for the E78Q, E122Q, and E78Q/E122Q
All isotope effects were measured in the direction of saccharopine formation. Lysine
was varied while maintaining NADH and ␣-Kg at saturation (Ͼ10 Km) at 25 °C.
Data were measured at the following pH values: 7.2 for E78Q and E122Q and 7 for
E78Q/E122Q. Wild type data are included for comparative purposes.
All of the mutant enzymes exhibited finite substrate deute-
rium isotope effects on V and V/K. In addition, all values are
similar to those of WT. Data suggest that hydride transfer con-
tributes to rate limitation of the SDH reaction. The value of
D(V) for the E122A and E78A/E122A mutant enzymes is greater
than that of WT, as is D(V/K) for E78A/E122A, suggesting that
Glu122 is catalytically important but not essential.
Parameter
Wild type SDH
E78Q
E122Q
E78Q/E122Q
D(V)
1.50 Ϯ 0.07
1.60 Ϯ 0.05
2.2 Ϯ 0.1
1.48 Ϯ 0.04 1.60 Ϯ 0.01 1.30 Ϯ 0.03
1.48 Ϯ 0.04 2.30 Ϯ 0.04 1.30 Ϯ 0.03
2.5 Ϯ 0.1 1.96 Ϯ 0.04 2.01 Ϯ 0.06
2.5 Ϯ 0.1 1.96 Ϯ 0.04 2.01 Ϯ 0.06
D(V/KLys
)
D2O(V)
D2O(V/KLys
D2O(V)D
)
1.9 Ϯ 0.1
1.76 Ϯ 0.08 (80% D2O) 2.40 Ϯ 0.04 1.60 Ϯ 0.01 1.200 Ϯ 0.001
1.86 Ϯ 0.08 (80% D2O) 1.60 Ϯ 0.03 1.60 Ϯ 0.01 1.400 Ϯ 0.003
D2O(V/KLys D
)
In the case of the Gln mutant enzymes, the isotope effects are
very similar to those of WT (Table 6). Data suggest that only
minor changes in the relative rates of steps along the reaction
pathway result from the E78Q and E122Q single mutations or
from the E78Q/E122Q double mutation. Thus, the glutamine
side chain can effectively replace the glutamate side chain at
neutral pH, i.e. the negative charge is not critical to the overall
reaction. However, when Glu78 and Glu122 are changed to A,
the isotope effects differ from those of WT. For the E78A
mutant enzyme, the first and second order rate constants, V
and V/K, are slightly higher than WT at high pH, whereas the
isotope effects are close to unity for primary substrate deute-
rium, solvent and multiple kinetic isotope effects at high pH.
Thus, it appears that steps other than chemistry limit this
mutant enzyme. (The low pH effect will be discussed below
when pH-rate profiles are considered.) In the case of E122A and
E78A/E122A mutant enzymes, results are similar; isotope
effects are either the same as those of WT or higher. Overall
data suggest that the chemical steps contribute more to rate
limitation, and this is especially true in the case of the E78A/
E122A double mutant, where the multiple isotope effect is the
largest observed for SDH thus far. Of the two residues consid-
of this enzyme at pH 7 remains the same as that of WT. The
intersecting pattern observed in the initial velocity pattern
when ␣-Kg and NADH are varied (Fig. 2B) is likely a result of a
lysine concentration that is not sufficiently saturating.
Isotope Effect Data—The kinetic mechanism of SDH in the
direction of saccharopine formation at neutral pH can be writ-
ten as shown in Scheme 2. In Scheme 2, A, B, C, P, and Q
represent NADH, ␣-Kg, Lys, saccharopine, and NAD, respec-
tively. The rate constants k1 and k2 are for binding and dissoci-
ation of NADH. k3, k4, k7, and k8 are for binding and dissocia-
tion of ␣-Kg; and k5, k6, k9, and k10 are for binding and
dissociation of lysine; k11 and k12 are the forward and reverse
net rate constants for the catalytic pathway; and k13 and k15 are
for the release of saccharopine and NAD, respectively.
The substrate deuterium-sensitive step, hydride transfer,
contained in k11, the net rate constant for catalysis, may exhibit
an isotope effect upon deuteration of NADH at the C-4 pro-R
hydrogen of the dihydronicotinamide ring if the transition state
for reduction of the imine (II in Scheme 3) contributes to rate
limitation. The solvent isotope effect reflects protons in flight in
the transition state for formation of the imine (Scheme 3, II) ered, Glu122 appears to be important for the overall integrity of
from the carbinolamine (Scheme 3, III) and to a lesser extent, the catalytic machinery, although it is almost certainly not a
JULY 2, 2010•VOLUME 285•NUMBER 27
JOURNAL OF BIOLOGICAL CHEMISTRY 20765

SDH Glu78 and Glu122 Modulate Active Site Basicity
TABLE 7
Isotope effects for the E78A, E122A, and E78A/E122A mutant enzymes
Parameter
Wild type SDH
1.50 Ϯ 0.07
E78A
E122A
2.1 Ϯ 0.1
E78A/E122A
2.24 Ϯ 0.10
D(V)
(pH 5) 0.9 Ϯ 0.1
(pH 9) 1.13 Ϯ 0.03
(pH 5) 1.9 Ϯ 0.1
D(V/KLys
D2O(V)
)
1.60 Ϯ 0.05
1.5 Ϯ 0.1
2.24 Ϯ 0.10
(pH 9) 1.13 Ϯ 0.03
(pH 9) 1.43 Ϯ 0.05
(pH 9) 1.43 Ϯ 0.05
(pH 5) 2.90 Ϯ 0.02
(pH 9) 1.20 Ϯ 0.01
(pH 5) 2.90 Ϯ 0.02
(pH 9) 1.20 Ϯ 0.01
2.2 Ϯ 0.1
1.9 Ϯ 0.1
1.8 Ϯ 0.1
2.6 Ϯ 0.2
2.40 Ϯ 0.05
2.40 Ϯ 0.05
3.6 Ϯ 0.1
D2O(V/KLys
D2O(V)D
)
1.76 Ϯ 0.08 (80% D2O)
2.10 Ϯ 0.04
D2O(V/KLys D
)
1.86 Ϯ 0.08 (80% D2O)
2.50 Ϯ 0.08
3.6 Ϯ 0.1
⌬⌬Gc0oupling ϭ ⌬⌬GW0 T-E78/E122
Ϫ ͓⌬⌬GW0 T-E78 ϩ ⌬⌬GW0 T-E122
͔ (Eq. 19)
where ⌬⌬G0coupling is the interaction energy between Glu78 and
Glu122. Thermodynamic cycles for the Gln and Ala mutant
enzymes, respectively, are shown in Scheme 4.3 In the case of
the Gln and Ala mutant enzymes, the following estimates are
obtained (20),
⌬⌬Gc0oupling ϭ Ϫ7.51Ϯ0.14 kJ/mol
Ϫ ͓Ϫ2.75 Ϯ 0.07 kJ/mol Ϫ 7.20 Ϯ 0.16 kJ/mol͔
ϭ 2.44 kJ/mol (Eq. 20)
SCHEME 2. Kinetic mechanism proposed for SDH from S. cerevisiae.
catalytic group given the small changes in V/Et observed. To
obtain quantitative estimates of the contribution of the two
residues to catalysis, estimates of microscopic rate constants
must be obtained. Although obtaining these estimates is
planned, they require extensive multiple isotope effects includ-
ing primary 15N, and ␣- and ␤-secondary isotope effects, and
these studies are beyond the scope of this paper. Enough infor-
mation is provided for the reader to know that the plan of pro-
cedure, although labor-intensive, will ultimately provide a com-
prehensive and quantitative description of how the active site of
the enzyme catalyzes the oxidative deamination reaction.
Lysine Binding—The kinetic parameter most affected by
mutation of Glu78 and Glu122 is V/KLys, and as a result KLys. The
dissociation constants for Lys from the E⅐NADH⅐␣-Kg⅐Lys
complex can be calculated from the isotope effects according to
Klinman and Matthews (19); [DVϪ1]/[D(V/K)Ϫ1] ϭ Km/Kd. If
the isotope effects are equal to one another, Km ϭ Kd; but if they
are not, Kd can be estimated from the remaining known values.
Kd values estimated in this way are given in Table 8.
⌬⌬Gc0oupling ϭ Ϫ12.35 Ϯ 0.32 kJ/mol
Ϫ ͓1.83 Ϯ 0.30 kJ/mol Ϫ 6.26 Ϯ 0.04 kJ/mol͔
ϭ 7.92 kJ/mol (Eq. 21)
and thus Glu78 and Glu122 cooperate in the binding of lysine.
The difference in the coupling free energies for Gln and Ala
mutations suggests that the effect includes contributions from
charge (2.4 kJ/mol) and other (including dipolar and perhaps
steric) interactions (5.5 kJ/mol). The charge effect is expected
given the negatively charged glutamate side chains and the pos-
itively charged ␣- and ⑀-amines of lysine (lysine is net positively
charged as it binds to enzyme). The E78A mutant enzyme has a
slightly lower Kd compared with the WT, indicative of a slightly
tighter binding of lysine, perhaps because of a better accommo-
dation of the lysine side chain. However, the effect is small (0.4
kcal/mol) and does not affect the interpretation of the role of
Glu78. The larger effect of replacing the side chain suggests
changes to the overall site, including an increase in volume, and
perhaps an increase in proximity of like-charged residues; there
are a number of lysines in the site (Fig. 1).
From the dissociation constants in Table 8, the contribution
of Glu78 and Glu122 to lysine binding can be calculated, and a
thermodynamic cycle can be constructed to show the interac-
tion between the two residues (20). The free energy of binding
lysine to the E⅐NADH⅐␣-Kg complex is calculated from ⌬G0 ϭ
ϪRT ln(1/Kd) and the change resulting from the mutation is
estimated from the expression
⌬⌬G0 ϭ RT[ln(1/Kd mutant) Ϫ ln͑1/Kd WT)].
It is known that
⌬⌬GW0 T-E78/E122 ϭ ⌬⌬GW0 T-E78 ϩ ⌬⌬GE078-E122 ϭ
(Eq. 17)
pH Rate Profiles—As suggested above and in Scheme 2, SDH
exhibits random addition of lysine and ␣-Kg from pH 5 to 8.5,
whereas outside this range the mechanism becomes ordered
with ␣-Kg binding prior to lysine (1). The V/KLys pH-rate pro-
file exhibits groups in the E⅐NADH⅐␣-Kg complex and free
⌬⌬GW0 T-E122 ϩ ⌬⌬GE0122-E78 (Eq. 18)
where ⌬⌬G0WT-E78/E122 is the total change from WT to double
mutant enzyme independent of whether Glu78 or Glu122 is
changed first, ⌬⌬G0WT-E78 and ⌬⌬GW0 T-E122 are the changes
resulting from the single mutations, and ⌬⌬G0E78-E122 and
⌬⌬G0E122-E78 are the changes from the single to the double
mutant enzymes. If there is a synergistic interaction between
the two residues,
3 A similar analysis can be carried out for V and V/K, but the interpretation is
not straightforward. These are macroscopic rate constants that include
contributions from a number of steps, and it is thus difficult to determine
which of the several rate processes contribute to the change. The analysis
should be restricted to cases in which chemistry limits the overall reaction,
and isotope effects are invaluable in establishing the steps that contribute
to rate limitation.
20766 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 27•JULY 2, 2010

SDH Glu78 and Glu122 Modulate Active Site Basicity
identical to that of WT, suggesting
that there is no effect on the rate
processes in the pathway where
␣-Kg binds to the E⅐NADH⅐lysine
complex, including all steps to
release of the saccharopine product.
There are changes in V at pH values
Ͻ6, specifically, the group with a
pKa of about 6 is not observed for
either E78Q or E78A, and in addi-
tion, the partial change observed at
high pH is suppressed in the E78Q
mutant enzyme. The biggest
change, however, is in the V/KLys
.
The pKa values observed for the WT
enzyme, an average of 7.2 (9), and
reflecting enzyme side chains in the
E⅐NADH⅐␣-Kg complex, are per-
turbed to lower and higher pH in the
E78Q and E78A mutant enzymes.
On average, they are perturbed by
ϳ1.5 pH units in E78Q and by ϳ1.2
in E78A. Data suggest that both glu-
tamate side chains contribute to set-
ting the pKa values of the catalytic
groups near neutrality, likely a result
of their effective charge and/or
direct interaction with the catalytic
group(s). The active site of SDH is
net neutral when NADH and ␣-Kg
are bound, given an equal number of
lysine and glutamate residues and
His96, which is likely neutral (Fig. 1).
The changes observed when
Glu122 is mutated are similar in
some respects and differ in others.
The V pH-rate profile for E122A is
SCHEME 3. Chemical mechanism proposed for SDH. I, Michaelis E⅐NAD⅐saccharopine complex with NAD and
saccharopine bound; II, imine intermediate; III, neutral carbinolamine intermediate; IV, protonated carbinol-
amine intermediate; V, product E⅐NADH⅐␣-Kg⅐Lys complex with a neutral lysine ⑀-amine; VI, product E⅐NADH⅐␣-
Kg⅐Lys complex with a protonated lysine ⑀-amine.
TABLE 8
Kd values for lysine calculated from DV and D(V/K) and KLys
missing the partial change at high pH that was indicative of a
change in kinetic mechanism from random addition of lysine
and ␣-Kg at neutral pH to ordered addition of ␣-Kg prior to
lysine at high pH. Data suggest that the kinetic mechanism is
random over the entire pH range. In agreement, the E122Q and
E122A pH-rate profiles for V/K␣-Kg and V/KLys both exhibit
pKa values for the acid and base catalysts as is true for the WT
V/KLys pH-rate profile. However, as is true for the E78Q and
E78A mutant enzymes, the pKa values are perturbed outward.
The group with the base side pKa in the V/KLys pH-rate profile
Enzyme
Kd
mM
WT-SDH
E78Q
1.32 Ϯ 0.17
4.0 Ϯ 0.4
E122Q
23.85 Ϯ 1.53
27.1 Ϯ 1.3
0.62 Ϯ 0.01
16.5 Ϯ 2.3
190.7 Ϯ 1.1
E78Q/E122Q
E78A
E122A
E78A/E122A
lysine over the entire pH range, whereas V/K␣-Kg exhibits is more sensitive to the substitution at Glu122 and is perturbed
groups in the E⅐NADH⅐lysine complex and free ␣-Kg from pH ϳ1.6 pH units higher, whereas that on the acid side is decreased
5–8.5 and the E⅐NADH complex and free ␣-Kg outside this pH by slightly less than 1 pH unit. In addition, the decrease in the
range. The V pH-rate profile exhibits groups on enzyme in cen- V/KLys pH-rate profile appears to be partial at low pH, and this
tral complexes (chemical steps contribute to rate limitation) (9) may indicate the influence of one of the other active site resi-
over the pH range 5–8.5.
dues on binding of lysine. As for the Gln mutant enzymes the
Changes in kinetic parameters and isotope effects are not explanation is likely similar, with Glu122 closer to one of the
consistent with a direct catalytic role for Glu78 and Glu122. The catalytic residues than the other. It is tempting to say the resi-
pH-rate profiles provide the best evidence for how the gluta- due that is closest to Glu122 is His96, but the ternary complex
mate side chains function in the reaction. The E78Q and E78A pictured in Fig. 1 is semiempirical, and this aspect will have to
mutant enzymes exhibit a V/K␣-Kg pH-rate profile that is nearly await future studies.
JULY 2, 2010•VOLUME 285•NUMBER 27
JOURNAL OF BIOLOGICAL CHEMISTRY 20767

SDH Glu78 and Glu122 Modulate Active Site Basicity
tion of the basicity of the catalytic groups in the active site of
SDH, i.e. the pK values of the acid-base catalysts are tuned to a
pH near neutrality. Additional residues in the active site are
now being considered to further evaluate potential catalytically
important groups in the SDH active site.
REFERENCES
1. Xu, H., West, A. H., and Cook, P. F. (2006) Biochemistry 45, 12156–12166
2. Xu, H., Andi, B., Qian, J., West, A. H., and Cook, P. F. (2006) Cell Biochem.
Biophys. 46, 43–64
3. Zabriskie, T. M., and Jackson, M. D. (2000) Nat. Prod. Rep. 17, 85–97
4. Bhattacharjee, J. K. (1985) Crit. Rev. Microbiol. 12, 131–151
5. Garrad, R. C., and Bhattacharjee, J. K. (1992) J. Bacteriol. 174, 7379–7384
6. Johansson, E., Steffens, J. J., Lindqvist, Y., and Schneider, G. (2000) Struc-
ture 8, 1037–1047
7. Ye, Z. H., and Bhattacharjee, J. K. (1988) J. Bacteriol. 170, 5968–5970
8. Ogawa, H., and Fujioka, M. (1978) J. Biol. Chem. 253, 3666–3670
9. Xu, H., Alguindigue, S. S., West, A. H., and Cook, P. F. (2007) Biochemistry
46, 871–882
10. Andi, B., Xu, H., Cook, P. F., and West, A. H. (2007) Biochemistry 46,
12512–12521
11. Burk, D. L., Hwang, J., Kwok, E., Marrone, L., Goodfellow, V., Dmitrienko,
G. I., and Berghuis, A. M. (2007) J. Mol. Biol. 373, 745–754
12. Bradford, M. M., and Williams, W. L. (1976) Fed. Proc. 35, 274
13. Viola, R. E., Cook, P. F., and Cleland, W. W. (1979) Anal. Biochem. 96,
334–340
SCHEME 4. Thermodynamic analysis of lysine binding in Glu78 and Glu122
glutamine and alanine mutant enzymes. Binding free energies and esti-
mated ⌬⌬G0 values for lysine binding in the E78Q, E122Q, and E78Q/E122Q 14. Schowen, K. B., and Schowen, R. L. (1982) Methods Enzymol. 87, 551–606
mutant enzymes (A) and E78A, E122A, and E78A/E122A mutant enzymes (B).
15. Cleland, W. W. (1979) Methods Enzymol. 63, 103–138
⌬G0 valueswerecalculatedusingthedissociationconstantforlysinefromthe
16. Bishop, C. M. (1995) in Neural Networks for Pattern Recognition, pp.
290–291, Oxford University Press, Oxford, UK
17. Cook, P. F., and Cleland, W. W. (2007) Enzyme Kinetics and Mechanism,
Garland Science, New York
E⅐NADH⅐␣-Kg⅐Lys complex, and ⌬⌬G0 values are the difference in the ⌬G0
values.
The pH-rate profiles for the double mutant enzymes appear
to be a sum of those of the single mutant enzymes. However,
they are weighted toward the effect of mutating Glu122, which
exhibits larger effects than mutating Glu78.
18. Delano, W. L. (2004) The PyMOL Molecular Graphics System, Delano
Scientific, San Carlos, CA
19. Klinman, J. P., and Matthews, R. G. (1985) J. Am. Chem. Soc. 107,
1058–1060
Considering all of the data, Glu78 and Glu122 do not play a
direct role in catalysis, but their presence provides a modula-
20. Chen, Y. I., Chen, Y. H., Chou, W. Y., and Chang, G. G. (2003) Biochem. J.
374, 633–637
20768 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 285•NUMBER 27•JULY 2, 2010