Aptamer-based self-assembled supramolecular vesicles for pH-responsive targeted drug delivery

Article abstract of DOI:10.1007/s11426-016-0351-5

Supramolecular vesicles have received great attention in biomedical application due to their inherent features, including simple synthesis and tunable amphiphilicity of the building blocks. Despite tremendous research efforts, developing supramolecular vesicles with targeted recognition and controlled release remains a major challenge. Herein, we constructed a novel aptamer-based self-assembled supramolecular vesicle by host-guest complexation of pyrene, viologen lipid, and cucurbit[8]urils for pH-responsive and targeted drug delivery. The proposed supramolecular vesicles are easy to be assembled and offer simple drug loading. Based on confocal fluorescence microscopy and cytotoxicity experiments, the drug-loaded supramolecular vesicles were shown to possess highly efficient internalization and apparent cytotoxic effect on target cancer cells, but not control cells. Furthermore, through simple aptamer or drug substitution, supramolecular vesicles can be applied to a variety of target cell lines and drugs, making it widely applicable. Taking advantage of the easy preparation, good stability, rapid pH response, and cell targeting ability, the aptamer-based self-assembled supramolecular vesicles hold great promise in controlled-release biomedical applications and targeted cancer therapy.

Full text of DOI:10.1007/s11426-016-0351-5

SCIENCE CHINA
Chemistry
doi: 10.1007/s11426-016-0351-5
• ARTICLES •
Aptamer-based self-assembled supramolecular vesicles for
pH-responsive targeted drug delivery
Shuxian Wu1, Juan Li1, Hong Liang1, Liping Wang1, Xian Chen1, Guixiao Jin2*,
Xiaoping Xu1* & Huang-Hao Yang1*
1Key Laboratory of Analysis and Detection Technology for Food Safety of the Ministry of Education, Fujian Provincial Key Laboratory of
Analysis and Detection Technology for Food Safety, College of Chemistry, Fuzhou University, Fuzhou 350002, China
2College of Ecological Environment and Urban Construction, Fujian University of Technology, Fuzhou 350108, China
Received August 23, 2016; accepted September 21, 2016; published online December 7, 2016
Supramolecular vesicles have received great attention in biomedical application due to their inherent features, including simple
synthesis and tunable amphiphilicity of the building blocks. Despite tremendous research efforts, developing supramolecular
vesicles with targeted recognition and controlled release remains a major challenge. Herein, we constructed a novel
aptamer-based self-assembled supramolecular vesicle by host-guest complexation of pyrene, viologen lipid, and cucurbit[8]urils
for pH-responsive and targeted drug delivery. The proposed supramolecular vesicles are easy to be assembled and offer simple
drug loading. Based on confocal fluorescence microscopy and cytotoxicity experiments, the drug-loaded supramolecular vesicles
were shown to possess highly efficient internalization and apparent cytotoxic effect on target cancer cells, but not control cells.
Furthermore, through simple aptamer or drug substitution, supramolecular vesicles can be applied to a variety of target cell lines
and drugs, making it widely applicable. Taking advantage of the easy preparation, good stability, rapid pH response, and cell
targeting ability, the aptamer-based self-assembled supramolecular vesicles hold great promise in controlled-release biomedical
applications and targeted cancer therapy.
aptamer, supramolecular vesicle, pH-responsive, drug delivery
Citation:
Wu S, Li J, Liang H, Wang L, Chen X, Jin G, Xu X, Yang HH. Aptamer-based self-assembled supramolecular vesicles for pH-responsive targeted drug
delivery. Sci China Chem, doi: 10.1007/s11426-016-0351-5
1 Introduction
and coworkers [4] designed an amphiphilic prodrug capable
of self-assembling into vesicles that could decompose and re-
lease the drug when triggered by either glutathione or reac-
tive oxygen species. Among the stimuli-responsive vesicles,
pH-responsive vesicles have attracted great attention due to
their rapidness and simplicity [7,8]. It is worth noting that mi-
croenvironment in the tumor tissues is generally more acidic
than in normal tissues [9], pH as stimuli in drug delivery sys-
tem is capable of triggering the release of loaded drugs in
cancer cells [10,11].
Vesicles are enclosed structures and predominantly spherical
in shape. Due to the flexibility, the hollow vesicles are usu-
ally composed of a monolayer or bilayer membrane of nat-
ural or synthetic amphiphiles. The membrane can sequester
and delivery substances, showing promising applications in
drug/gene delivery [1,2] and nanoreactors [3]. Substantial
achievements have been made in recent years, especially in
stimuli responsive applications [4–6]. For example, Wang
Conventionally, vesicles are constructed by amphiphiles
which contain a hydrophobic tail and a hydrophilic head con-
nected by covalent bonds. The chemical synthesis process
*Corresponding authors (email: jinguixiao2008@126.com; xu@fzu.edu.cn;
hhyang@fzu.edu.cn)
© Science China Press and Springer-Verlag Berlin Heidelberg 2016
chem.scichina.com link.springer.com

2
Wu et al. Sci China Chem
is relatively complicated and labor-intensive. Compared to
common amphiphiles, supramolecules refer to molecules that
are linked by host-guest type interactions [12]. This construc-
tion has several advantages, such as simple synthesis and tun-
able amphiphilicity of the building blocks. Owing to these
characteristics, supramolecular vesicles hold great promise
in stimuli-responsive drug/gene delivery. The supramolecu-
lar vesicles based on pillar[6]arene and guest molecules, have
been constructed showing pH, Ca2+, and thermal-responsive-
ness [13]. However, each pillar[6]arene could only contain
one guest molecule, leaving few site to be modified. In-
stead of using pillar[6]arene, cucurbit[8]urils (CB[8]) have
attracted great interest in recent years. CB[8] is a macrocyclic
host known to join two guest molecules together with high
binding affinity in a non-covalent fashion in aqueous media
[14,15], and the supramolecules could be easily modified at
two ends as needed. These properties make it ideal as host for
assembling into supramolecular vesicles. However, there are
only a few reports of supramolecular vesicles based on CB[8]
[16].
CB[8], the weak interaction between pyrene and viologen
moieties also resulted in a slight reduction of fluorescence
intensity (Figure 1(b), green line).
Cell-specific delivery of anticancer drugs is an important is-
sue in order to improve cancer chemotherapy [17]. Aptamers
have received particular attention for their wide recognition
ability toward specific molecular targets ranging from small
inorganic and organic substances to proteins or cells [18–20].
Compared with other recognition elements, such as antibod-
ies, aptamers have multifarious advantages, such as simple
synthesis, good stability and design flexibility, making them
promising in targeted drug delivery and targeted treatment
[21,22].
Inspired by the advantages of CB[8] and aptamers, we
designed a aptamer-based self-assembled supramolecular
vesicle for targeted and controlled drug delivery (Figure 1).
Aptamer, which specifically binds to epithelial cell adhesion
molecule (EpCAM) was used as a model [23]. EpCAM
is an ideal antigen for clinical applications in cancer diag-
nosis, prognosis and therapy, and is overexpressed in most
solid cancers, such as breast, colorectal, and gastric cancers
[24]. We utilize the pyrene and viologen lipids as guests
for CB[8]. Pyrene-labeled aptamers are able to form the
supramolecular complex with viologen lipids (synthetic
results see Figure 2 and Figure 3) through CB[8] conjugation
(Figure 1(a)), since CB[8] can encapsulate the pyrene and
viologen lipids at the same time [17]. After conjugation, the
supramolecules can self-assemble to form vesicles. Emis-
sion spectra indicated a marked quenching of the pyrene
fluorescence after addition of the viologen lipid and CB[8]
(Figure 1(b), blue line). It is attributed to the electron accep-
tor-donor interactions between pyrene and viologen moieties
inside the CB[8] cavity, proving the formation of a ternary
complex inside the CB[8] cavity [17]. In the absence of
Figure 1 (a) Formation of ternary complex based on pyrene-labeled ap-
tamer, viologen lipid, and CB[8]. (b) Emission spectra of (excited at 303
nm): pyrene-labeled aptamer (25 μM, red line); pyrene-labeled aptamer and
viologen lipid (1:1, green line); pyrene-labeled aptamer, viologen lipid and
CB[8] (1:1:1, blue line). Inset shows the pictures of vials containing aqueous
solution, from left to right: pyrene-labeled aptamer; pyrene-labeled aptamer
and viologen lipid (1:1); pyrene-labeled aptamer, viologen lipid and CB[8]
(1:1:1) (color online).
Figure 2 1H NMR spectra in D2O at 25 °C of 1-methyl-4,4′-bipyridinium
iodide.

Wu et al. Sci China Chem
3
instrument (Shumei, China).
2.2 Synthesis of 1-methyl-4,4′-bipyridinium iodide
A 500 mL RB flask was charged with 4,4′-bipyridine (10.0 g,
64 mM) in 150 mL dichloromethane. Methyl iodide (5.0 mL,
81 mM) in dichloromethane (50 mL) was added drop-wise
to the stirred flask. The mixture was refluxed for 1 h and
left to cool with stirring. The yellow product was filtered off,
washed with ether, and then purified by recrystallization from
methanol for two times, and finally washed with ether again.
1H NMR (400 MHz, D2O), δ (ppm): 8.83 (d, J=6.8 Hz, 2H),
8.69 (d, J=6.2 Hz, 2H), 8.31 (d, J=6.7 Hz, 2H), 7.83 (d, J=6.3
Hz, 2H), 4.37 (s, 3H).
Figure 3 1H NMR spectra in MeOD at 25 °C of 1-octadecyl-1′-methyl-4,4′-
bipyridinium bromide Iodide.
2.3 Synthesis of 1-octadecyl-1′-methyl-4,4′-bipyridinium
bromide iodide
2 Experimental
A 50 mL RB flask was charged with 1-methyl-4,4′-bipyri-
dinium iodide (0.6 g, 2 mM), 1-bromooctadecane (3.3 g, 10
mM) and acetonitrile (20 mL). The reaction mixture was
heated at reflux for 48 h. A red precipitate was collected
2.1 Materials and instrument
All reagents including 4,4′-bipyridine, dichloromethane,
methyl iodide, ether, methanol, 1-bromooctadecane, acetoni-
trile, ethanol, CB[8] were purchased from J&K scientific
Ltd. (Beijing, China). All chemicals were of analytical
grade and used as received without further purification.
Cell Counting Kit-8 (CCK-8) was purchased from Dojindo
(Japan). The water used in all the preparation was ultrapure,
which obtained from a Millipore water purification system
(resistivity 18.2 MΩ).
1
and recrystallized using ethanol/water. H NMR (400 MHz,
MeOD), δ (ppm): 9.31 (d, J=6.0 Hz, 2H), 9.22 (d, J=6.6
Hz, 2H), 8.69 (t, J=6.1 Hz, 4H), 4.77 (m, 2H), 4.56 (s, 3H),
2.11 (q, J=14.5, 8.2 Hz, 2H), 1.46 (d, J=4.4 Hz, 2H), 1.31 (s,
28H), 0.91 (t, J=6.8 Hz, 3H).
2.4 Dox encapsulation
To prepare Atp-vesicles@Dox, 5 mg/mL aqueous solution
of doxorubicin (Dox) was quickly added into a freshly pre-
pared aqueous solution of aptamer, CB[8] and viologen lipid,
the resulting mixture was sonicated for 30 min, and unloaded
Dox molecules were removed by dialysis against water. The
Dox encapsulation efficiency was calculated by the following
equation.
Human normal liver cell line L-02 and breast cancer cell
line MCF-7 were obtained by the cell center of our laboratory.
The HPLC-purified pyrene-labeled aptamer and control se-
quence were synthesized by Takara bio company (Dalian,
China) (Table 1). The DNA was dissolved in ultrapure water
as stock solutions.
Ultraviolet-visible-near-infrared (UV-Vis-NIR) absorption
spectra were collected in a standard 1-cm path length quartz
cuvette on an Infinite M200 PRO Microplate Reader (Tecan,
Switzerland). Other instruments used in the experiment
included fluorospectro photometer F-4600 (Hitachi, Japan),
atomic force microscope nanoscope IIId (Veeco, USA),
CO2 incubator Scientific HERAcell 150i (Thermo, USA),
confocal microscope C2/C2si (Nikon, Japan), ultrapure
water system CascadaTM (Pall, USA), acidimeter Starter 3C
(Ohaus, USA), and ultrasonic cleaning
Encapsulation efficiency (%)
= m
(
loaded / mDox × 100%
)
Dox
where mDox-loaded and mDox are mass of Dox encapsulated in
vesicles and mass of Dox added, respectively. The mass
of Dox was measured by the fluorescence emission spectra
which excited at 500 nm, and calculated as relative with a
standard calibration curve in the concentrations from 0.01
mg/mL to 1 mg/mL.
2.5 Fluorescence confocal imaging
Table 1 The DNA sequences employed in this work
Name
Sequence (5′–3′)
Human normal liver cell line L-02 and breast cancer cell
line MCF-7 were maintained in RPMI 1640 medium sup-
plemented with 15% fetal bovine serum, penicillin (100
unit/mL) and streptomycin (100 μg/mL) at 37 °C in a humid-
ified 5% CO2 atmosphere. For cell imaging, cells (2×105)
pyrene-AAACACTACAGAGGTTGCGTCTGTC-
CCACGTTGTCATGGGGGGTTGGCCTG
EpCAM aptamer
pyrene-AAAGGTGTGAAGCTACCGTTGAG-
CACCCGGCAAGGAGCUGGAAGGCUGGGA
Control sequence

4
Wu et al. Sci China Chem
were cultured on 35 mm diameter petridish and incubated for
24 h. After cell adhesion, culture media was removed, then
culture media which included Atp-vesicles@Dox (the con-
centration was 300 nM) were added into each dish, and cells
were incubated for 1 h. After cell incubation, culture media
was removed, and washed with phosphate buffered saline
(PBS) three times. Fresh culture media was added in each
dish. Finally, the petridishes were detected in fluorescence
confocal.
cells were plated in 96 well plates for 24 h and added with
desired concentrations of Apt-vesicles, Apt-vesicles@Dox,
control-vesicles@Dox. After incubation for 1 h, culture me-
dia was removed, and washed with PBS three times. Fresh
culture media was added in each dish, and cell viability was
measured with CCK-8 according to the manufacture’s proto-
col after incubation for 24 h.
Cell viability (%) = (ODtreated ODblank) /
(ODcontrol ODblank) × 100%
2.6 In vitro release of Dox
Apt-vesicles@Dox were incubated in PBS of pH 7.4 and 5.5
over different periods of time 0.5, 1, 2, 4, 6, 8, 12 h. The
solution was filtered by 3 kDa filters to wash away released
Dox. The fluorescence intensity of Dox was used to calibrate
the released Dox concentration.
where ODcontrol was obtained in the absence of vesicles,
ODtreated obtained in the presence of vesicles, and ODblank ob-
tained in the presence of culture medium and CCK-8 solution
but without cells. Each result was the average of three wells,
and 100% viability was determined from untreated cells.
Release rate (%) = m
released / mDox
× 100%
(
)
Dox
loaded
where mDox-released and mDox-loaded are mass of Dox released from
vesicles and encapsulated in vesicles, respectively. The mass
of Dox was measured by the fluorescence emission spectra
which excited at 500 nm, and calculated as relative with a
standard calibration curve in the concentrations from 0.01
mg/mL to 1 mg/mL.
3 Results and discussion
3.1 Characterization of Apt-vesicles
On account of the amphiphilic nature, after formation of the
ternary complex, they can self-assemble to form double-layer
vesicles, atomic force microscopy (AFM) images provided
direct evidence for the formation of vesicles. As shown in
Figure 4(a), the AFM images showed the spherical morphol-
2.7 Evaluation of cytotoxicity
For the in vitro cell toxicity assay, L-02 cells and MCF-7
Figure 4 (a) AFM image of the formation of Apt-vesicles (pH 7.4); (b) height of the Apt-vesicles in AFM image; (c, d) DLS data of the Apt-vesicles in
different pH solution. (c) pH 7.4; (d) pH 5.0 (color online).

Wu et al. Sci China Chem
5
ogy with a diameter ranging from 140 to 220 nm, and the
height of the selected vesicles was about 5.5 nm (Figure 4(b)),
convincingly indicating the formation of aptamer-based
supramolecular vesicles (Apt-vesicles).
gree of protonation of the host and guest. Knowledge of such
protonation effects is important in supramolecular chemistry
[26,27]. To the Apt-vesicles developed in this experiment, the
major driving forces for the Apt-vesicles formation include
as follows: (1) charge-transfer interaction between the elec-
tron-rich pyrene and the electron-deficient viologen moieties
[17,28]; (2) noncovalent interactions such as host-guest in-
teractions [29]. The pH-responsive behavior of Apt-vesicles
could be explained when the solution pH changed to acidic,
two guest molecules and the polar oxygen atoms in carbonyl
groups at the CB[8] portals were easily protonated in acidic
condition [25,30], and thereby impact the charge-transfer in-
teraction between two guest molecules, reducing the driv-
ing force for formation of supermolecular complex. We pre-
sumed this change would induce the incompact packing of
drugs in the Apt-vesicles, realizing the pH-responsive release
of drugs in tumor acid microenviroment.
To prove this hypothesis, we evaluated the controlled drug
release property of the Apt-vesicles. Herein, as a model drug,
doxorubicin (Dox), one kind of hydrophobic anticancer drugs
and fluorescence dyes, was used to investigate whether Dox
could be encapsulated in the vesicles as well as its release
behavior upon external stimuli. Compared with unloaded
Apt-vesicles solution, the fluorescence of Dox-loaded Apt-
vesicles (Apt-vesicles@Dox) solution became much stronger
(Figure 6(a)), which represented the characteristic fluores-
cence of Dox in aqueous solution. Meanwhile, unloaded vesi-
cles present colorless. However, the Apt-vesicles@Dox so-
lution turned to pink after removing unloaded Dox molecules
by dialysis, demonstrating that Dox was successfully encap-
sulated into the vesicles (Figure 6(a)). According to fluores-
cence emission spectra, the Dox encapsulation efficiency was
calculated to be 8.2%, indicating a good drug-loading capa-
bility of the above Apt-vesicles. According to the reported
supermolecular vesicles [13,17,31], especially the CB[8] su-
permolecular vesicle designed by Jiao and coworkers [16],
we speculate the Apt-vesicles are double-layer vesicles, and
the Dox was encapsulated in hollow cavity.
For further characterization of Apt-vesicles, we used dy-
namic light scattering (DLS) to determine the average par-
ticle size. DLS revealed that the average hydrodynamic di-
ameter of Apt-vesicles was 180 nm at pH 7.4 (Figure 4(c)).
The stability of the Apt-vesicles was investigated and no ob-
vious changes were observed two weeks after preparation
(Figure 5). However, when the solution pH was adjusted
to 5.0, the average size of Apt-vesicles increased to 280 nm
(Figure 4(d)). These results suggested that the Apt-vesicles
were responsive to pH.
3.2 Drug release property of the Apt-vesicles
As far as we know, there is no report of the pH-responsive
behavior of CB[8]-based supramolecular vesicles. Marquez
and coworks [25] used cucurbit[6]uril (CB[6], the homologue
of CB[8]) and cyclohexylmethylamine as models to form the
supramolecular complex. The pH proved crucial for the ki-
netics and the rate constants turned out to be related to the de-
Figure 5 Stability experiment of Apt-vesicles.
Figure 6 (a) Fluorescence emission spectra of unloaded Apt-vesicles and Apt-vesicles@Dox in water (pH 7.4). Inset shows the pictures of color changes
of Apt-vesicles@Dox (right) compared with unloaded Apt-vesicles (left). (b) pH-dependent Dox release from the Apt-vesicles@Dox in different pH solution
(excited at 500 nm) (color online).

6
Wu et al. Sci China Chem
Subsequently, to characterize the functionality of the
3.4 Cytotoxicity of Apt-vesicles@Dox
pH-sensitive release of Dox, Apt-vesicles@Dox were in-
cubated under different pH, and the release kinetics was
investigated. As shown in Figure 6(b), the release of Dox
was significantly accelerated by increasing buffer acidity.
The cumulative release of Dox was approximately 78.8%
at pH 5.5 in the first 12 h. However, the cumulative release
of Dox was only 19% within 12 h under the physiological
conditions (pH 7.4). It is well documented that most cancer
tumor tissues have lower extracellular pH (pH 6.0–7.0) than
normal tissues and the bloodstream (pH 7.4), decreasing even
more inside cell lysosomes (pH 4.5–5.5) and endosomes (pH
5.5–6.0) [9,32]. Thus, the predictable release of Dox would
be facilitated under the increased acidity in both lysosome
and endosome, making these pH-responsive vesicles suitable
for intracellular drug delivery [31,33].
Having shown that Dox could be selectively transported into
target cells by Apt-vesicles, the resultant cytotoxicity was
evaluated. The cytotoxicity of Apt-vesicles@Dox vs. con-
trol-vesicles@Dox in both L-02 and MCF-7 cells was com-
pared, and the results were shown in Figure 8. Unloaded Apt-
vesicles exhibited negligible cytotoxicity to both cell lines,
indicating good biocompatibility of the proposed Apt-vesi-
cles. Control-vesicles@Dox showed dose-dependent cyto-
toxicity in both cell lines, since the control DNA could not
guide vesicles into cells effectively. In contrast, Apt-vesi-
cles@Dox exhibited efficient and dose-dependent cytotoxi-
city for MCF-7 cells, but the smaller cytotoxicity for L-02
cells.
Since Apt-vesicles@Dox specifically enters target cancer
cells through receptor-mediated endocytosis, thereby provid-
ing improved cellular internalization. These findings demon-
strate that, under the optimal conditions, Apt-vesicles@Dox
are able to selectively kill tumor cells without unwanted tox-
icity on control cells, which is critical for in vivo application
of a nanoscale drug-delivery system.
3.3 Cellular uptake of the Apt-vesicles
To further investigate the cellular uptake of the Apt-vesicles,
human normal liver cells L-02 and breast cancer cells MCF-7
were incubated with Apt-vesicles@Dox. MCF-7 cells, which
have a high expression of EpCAM, were chosen as target can-
cer cells, whereas L-02 cells with little EpCAM expressed on
the cell membrane were used as control cells. A strong red
fluorescence was observed in MCF-7 cells, but very weak flu-
orescence was seen in L-02 cells (Figure 7(a–d)). The perfor-
mance of control-vesicles@Dox for L-02 cells and MCF-7
cells were shown in Figure 7(e, f). The results showed that
control-vesicles@Dox was hard to enter into L-02 cells and
MCF-7 cells without aptamer, which further proved the tar-
geted cellular MCF-7 uptake of Apt-vesicles. Therefore, the
introduction of the aptamer recognition element significantly
improved the specific targeting of vesicles into target MCF-7
cells.
4 Conclusions
In summary, we have successfully constructed novel ap-
tamer-based self-assembled supramolecular vesicles by
host-guest complexation of pyrene, viologen lipid, and CB[8]
for pH-responsive and targeted drug delivery. The proposed
supramolecular vesicles were easy to be assembled and
offer simple drug loading. Based on confocal fluorescence
microscopy and cytotoxicity experiments, the drug-loaded
supramolecular vesicles were shown to possess highly effi-
cient internalization and apparent cytotoxic effect on target
cancer cells, but not control cells. Furthermore, through sim-
Figure 7 Confocal fluorescence images of (a, b) L-02 cells and (c, d) MCF-7 cells treated with Apt-vesicles@Dox; (e, f) L-02 cells and (g, h) MCF-7 cells
treated with control-vesicles@Dox (excited at 543 nm). Scale bar: 50 μm (color online).

Wu et al. Sci China Chem
7
Figure 8 Cytotoxicity of unloaded Apt-vesicles, control-vesicles@Dox and Apt-vesicles@Dox in (a) L-02 cells (control cells) and (b) MCF-7 cells (target
cells) (color online).
ple aptamer or drug substitution, supramolecular vesicles can
be applied to a variety of target cell lines and drugs, making
it widely applicable. Collectively, these simple and versatile
supramolecular vesicles have great potential in controlled-
release biomedical applications and targeted cancer therapy.
14 Rauwald U, Scherman OA. Angew Chem Int Ed, 2008, 47:
3950–3953
15 Kim J, Jung IS, Kim SY, Lee E, Kang JK, Sakamoto S, Yamaguchi K,
Kim K. J Am Chem Soc, 2000, 122: 540–541
16 Jiao D, Geng J, Loh XJ, Das D, Lee TC, Scherman OA. Angew Chem
Int Ed, 2012, 51: 9633–9637
17 Li J, Zheng C, Cansiz S, Wu C, Xu J, Cui C, Liu Y, Hou W, Wang
Y, Zhang L, Teng I, Yang HH, Tan W. J Am Chem Soc, 2015, 137:
1412–1415
Acknowledgments This work was supported by the National Natural
Science Foundation of China (21475026, U1505221, 21505021, 21622502,
21635002), the Natural Science Foundation of Fujian Province of China
(2015H6011, 2016J05035), the Program for Changjiang Scholars and
Innovative Research Team in University (IRT15R11), and the Independent
Research Project of State Key Laboratory of Photocatalysis on Energy and
Environment (2014B02).
18 Yan L, Shi H, He D, He X, Wang K, Xu F. Sci China Chem, 2016, 59:
802–808
19 Huang R, Xi Z, He N. Sci China Chem, 2015, 58: 1122–1130
20 Li J, Mo L, Lu CH, Fu T, Yang HH, Tan W. Chem Soc Rev, 2016, 45:
1410–1431
21 Li L, Hou J, Liu X, Guo Y, Wu Y, Zhang L, Yang Z. Biomaterials,
2014, 35: 3840–3850
Conflict of interest
interest.
The authors declare that they have no conflict of
22 Zhao X, Huang Y, Yang CJ, Mao B. Sci China Chem, 2015, 58:
1858–1865
1
2
3
4
Allen TM, Cullis PR. Science, 2004, 303: 1818–1822
Guo X, Szoka FC. Acc Chem Res, 2003, 36: 335–341
23 Song Y, Zhu Z, An Y, Zhang W, Zhang H, Liu D, Yu C, Duan W, Yang
CJ. Anal Chem, 2013, 85: 4141–4149
Christensen SM, Stamou DG. Sensors, 2010, 10: 11352–11368
Wang J, Sun X, Mao W, Sun W, Tang J, Sui M, Shen Y, Gu Z. Adv
Mater, 2013, 25: 3670–3676
24 Munz M, Baeuerle PA, Gires O. Cancer Res, 2009, 69: 5627–5629
25 Marquez C, Nau WM. Angew Chem Int Ed, 2001, 40: 3155–3160
26 Ghosh M, Zhang R, Lawler RG, Seto CT. J Org Chem, 2000, 65:
735–741
5
6
Song J, Zhou J, Duan H. J Am Chem Soc, 2012, 134: 13458–13469
Ren T, Liu Q, Lu H, Liu H, Zhang X, Du J. J Mater Chem, 2012, 22:
12329–12338
27 Wash PL, Renslo AR, Rebek, Jr. J. Angew Chem Int Ed, 2001, 40:
1221–1222
7
8
Du J, Armes SP. J Am Chem Soc, 2005, 127: 12800–12801
Rodríguez-Hernández J, Lecommandoux S. J Am Chem Soc, 2005,
127: 2026–2027
28 Kim HJ, Heo J, Jeon WS, Lee E, Kim J, Sakamoto S, Yamaguchi K,
Kim K. Angew Chem Int Ed, 2001, 40: 1526–1529
29 Percec V, Glodde M, Bera TK, Miura Y, Shiyanovskaya I, Singer
KD, Balagurusamy VSK, Heiney PA, Schnell I, Rapp A, Spiess HW,
Hudson SD, Duan H. Nature, 2002, 417: 384–387
30 Buschmann HJ, Cleve E, Schollmeyer E. Inorg Chim Acta, 1992, 193:
93–97
9
Tannock IF, Rotin D. Cancer Res, 1989, 49: 4373–4384
10 Li J, Wu S, Wu C, Qiu L, Zhu G, Cui C, Liu Y, Hou W, Wang Y, Zhang
L, Teng IT, Yang HH, Tan W. Nanoscale, 2016, 8: 8600–8606
11 Lin LS, Cong ZX, Li J, Ke KM, Guo SS, Yang HH, Chen GN. J Mater
Chem B, 2014, 2: 1031–1037
31 Duan Q, Cao Y, Li Y, Hu X, Xiao T, Lin C, Pan Y, Wang L. J Am
Chem Soc, 2013, 135: 10542–10549
12 Yang H, Yuan B, Zhang X, Scherman OA. Acc Chem Res, 2014, 47:
2106–2115
32 Gerweck LE, Seetharaman K. Cancer Res, 1996, 56: 1194–1198
33 Yang X, Grailer JJ, Rowland IJ, Javadi A, Hurley SA, Matson VZ,
Steeber DA, Gong S. ACS Nano, 2010, 4: 6805–6817
13 Cao Y, Hu XY, Li Y, Zou X, Xiong S, Lin C, Shen YZ, Wang L. J Am
Chem Soc, 2014, 136: 10762–10769