Synthesis and biological evaluation of novel isoxazole-piperazine hybrids as potential anti-cancer agents with inhibitory effect on liver cancer stem cells

Article abstract of DOI:10.1016/j.ejmech.2021.113489

In our effort for the development of novel anticancer therapeutics, a series of isoxazole-piperazine analogues were prepared, and primarily screened for their antiproliferative potential against hepatocellular carcinoma (HCC; Huh7/Mahlavu) and breast (MCF-7) cancer cells. All compounds demonstrated potent to moderate cytotoxicity on all cell lines with IC₅₀ values in the range of 0.09–11.7 μM. Further biological studies with 6a and 13d in HCC cells have shown that both compounds induced G1 or G2/M arrests resulting in apoptotic cell death. Subsequent analysis of proteins involved in cell cycle progression as well as proliferation of HCC cells revealed that 6a and 13d may affect cellular survival pathways differently depending on the mutation profiles of cells (p53 and PTEN), epidermal/mesenchymal characteristics, and activation of cell mechanisms through p53 dependent/independent pathways. Lastly, we have demonstrated the potential anti-stemness properties of these compounds in which the proportion of liver CSCs in Huh7 cells (CD133+/EpCAM+) were significantly reduced by 6a and 13d. Furthermore, both compounds caused a significant reduction in expression of stemness markers, NANOG or OCT4 proteins, in Mahlavu and Huh7 cells, as well as resulted in a decreased sphere formation capacity in Huh7 cells. Together, these novel isoxazole-piperazine derivatives may possess potential as leads for development of effective anti-cancer drugs against HCC cells with stem cell-like properties.

Full text of DOI:10.1016/j.ejmech.2021.113489

European Journal of Medicinal Chemistry 221 (2021) 113489
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Synthesis and biological evaluation of novel isoxazole-piperazine
hybrids as potential anti-cancer agents with inhibitory effect on liver
cancer stem cells
a
,
,
Kübra Ibis¸ 1, Esra Nalbat b 1, Burcu Çalıs¸ kan a, Deniz Cansen Kahraman b,
_
Rengul Cetin-Atalay b **, Erden Banoglu a
,
, *
a Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Gazi University, Ankara, Turkey
b Graduate School of Informatics, Cancer Systems Biology Laboratory, ODTU, Ankara, Turkey
a r t i c l e i n f o
a b s t r a c t
Article history:
In our effort for the development of novel anticancer therapeutics, a series of isoxazole-piperazine an-
alogues were prepared, and primarily screened for their antiproliferative potential against hepatocellular
carcinoma (HCC; Huh7/Mahlavu) and breast (MCF-7) cancer cells. All compounds demonstrated potent
Received 8 March 2021
Received in revised form
15 April 2021
Accepted 16 April 2021
Available online 24 April 2021
to moderate cytotoxicity on all cell lines with IC50 values in the range of 0.09e11.7 mM. Further biological
studies with 6a and 13d in HCC cells have shown that both compounds induced G1 or G2/M arrests
resulting in apoptotic cell death. Subsequent analysis of proteins involved in cell cycle progression as well
as proliferation of HCC cells revealed that 6a and 13d may affect cellular survival pathways differently
depending on the mutation profiles of cells (p53 and PTEN), epidermal/mesenchymal characteristics, and
activation of cell mechanisms through p53 dependent/independent pathways. Lastly, we have demon-
strated the potential anti-stemness properties of these compounds in which the proportion of liver CSCs
in Huh7 cells (CD133þ/EpCAMþ) were significantly reduced by 6a and 13d. Furthermore, both com-
pounds caused a significant reduction in expression of stemness markers, NANOG or OCT4 proteins, in
Mahlavu and Huh7 cells, as well as resulted in a decreased sphere formation capacity in Huh7 cells.
Together, these novel isoxazole-piperazine derivatives may possess potential as leads for development of
effective anti-cancer drugs against HCC cells with stem cell-like properties.
Keywords:
Cancer
Liver
Isoxazole
Piperazine
Cancer stem cell
© 2021 Elsevier Masson SAS. All rights reserved.
1. Introduction
these cancer types are significantly hampered, and many candidate
drugs did not produce clinical benefit in the overall population [7].
Cancer is a multifactorial disease, which is simultaneously
concerted by a combination of genetic, epigenetic, and environ-
mental factors, and is one of the leading cause of deaths globally
[1,2]. Hepatocellular carcinoma (HCC) is the most common type of
liver cancer accounting for about 75% of all primary liver cancers,
and is the 6th most frequent and the 2nd deadly cancer worldwide
[3e5]. Due to its various promoting factors (HBV, HCV, Aflatoxins,
obesity) HCC presents with high inter and intra tumor heteroge-
neity [6], and the development new cancer therapeutics against
In most cases, although the developed new agents initially
demonstrate efficacy, drug resistance is often seen as an inevitable
consequence of cancer's heterogeneity and is therefore likely to
underpin failures of the drug development for HCC therapy. One of
the reasons of these failures in HCC patients is the enrichment of
cancer stem cells (CSC), which are able to self-renew and differ-
entiate into cancer cells resulting in acquired resistance to drug
therapy as shown in sorafenib-resistant liver cancer cells [8e10].
Therefore, an endless effort has continuously been devoted to the
discovery and development of new and more effective anti-cancer
agents that are capable to intervene with these complex diseases.
Small molecule inhibitors (SMIs) comprise the most extensively
studied cancer therapeutics having the advantage to translocate
through the plasma membrane and interact with the cytoplasmic
domain of cell-surface receptors and intracellular signaling path-
ways [11,12]. Isoxazole derivatives as SMIs have been in the center
* Corresponding author.
** Corresponding author.
E-mail addresses: rengul@metu.edu.tr (R. Cetin-Atalay), banoglu@gazi.edu.tr
(E. Banoglu).
1
Equal Contribution.
https://doi.org/10.1016/j.ejmech.2021.113489
0223-5234/© 2021 Elsevier Masson SAS. All rights reserved.

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
of medicinal chemists, and used as versatile tools and building
blocks for the synthesis of small molecule cancer therapeutics [13].
For instance, a series of 4,5-diarylisoxazole derivatives, exemplified
by Luminespib (1), have been studied as potent inhibitors of heat
shock protein (HSP90) [14], which was found efficiently active
against various tumor xenografts, and has reached to Phase II
clinical trials [15]. Leflunomide (2), an immunosuppresory drug, is
also an isoxazole derivative, which was recently identified as a
potential anti-cancer drug [16]. 3,5-dimethylisoxazole moiety was
also identified as an effective acetylated lysine (KAc) mimic, which
was used as a tool for developing bromodomain inhibitors with
anti-cancer activity [17e20].
groups (6aet) were obtained following the reaction sequence
shown in Scheme 1. As shown, diethyl oxalate has been treated
with substituted 4-hydroxyacetophenone in the presence of a base
to obtain 1,3-diketoester 1. This intermediate (1) was subsequently
cyclized with hydroxylamine hydrochloride to provide isoxazole
ester 2. Reduction of 2 with LAH to alcohol 3 followed by alkylation
with appropriate benzylhalides furnished intermediates 4a-t.
Finally, these intermediates were brominated with CBr4/PPh3
providing isoxazole methylbromides 5a-t, which were treated with
4-trifluoromethylbenzylpiperazine to achieve target compounds
6aet. To further introduce diversity on the right-hand side of the
isoxazole ring, the 4-CF3-benzylpiperazine group in 6j was replaced
by reaction of the advanced intermediate 3-bromomethyl-5-(3-
cyanobenzyloxyphenyl)isozaxole (5j) with appropriate amine de-
rivatives in the presence of DIEA in DMF to obtain compounds 7a-n.
The analogues of compound 6j featuring different substituents
at the middle phenyl group (13a-d) and piperazine part (14e15)
were also synthesized by the route summarized in Scheme 2 using
the similar reaction conditions depicted in Scheme 1. All com-
pounds were purified by automated flash chromatography and
checked for purity by TLC and UPLC before being tested in biological
assays (purity was >97% based on the peak area percentage of UPLC
analysis). The structure of synthesized compounds was confirmed
by means of 1H NMR, 13C NMR and high-resolution mass spec-
trometry (HRMS).
Piperazine moiety is another commonly existing structural
fragment in many pharmacologically active substances, and a large
number of compounds having piperazine nucleus have been re-
ported as cytotoxic agents against various cancer cells [21e25]. For
example, studies on naftopidil (3) [26,27], a well-known a1
-
adrenergic receptor antagonist with an arylpiperazine motif, and
on several other arylpiperazines have demonstrated significant
cytotoxicity against prostate cancer cells [28e30]. In addition, a
vast number of piperazine derivatives have appeared in the liter-
ature with potent antiproliferative activities against numerous
cancer cells including colon, prostate, breast, lung and leukemia,
and shown to be effective for suppression of experimental tumor
models by mechanisms involving inhibition of microtubule syn-
thesis, inhibition of cell-cycle progression and angiogenesis [31,32].
Recently incorporation of arylpiperazine moiety in purine nucleo-
side analogues resulted in senescence-induced cell death in liver
cancer cells [24]. More detailed information on piperazine de-
rivatives as anti-cancer agents can be found elsewhere [33].
Inspired by the therapeutic potential of isoxazole and piperazine
derivatives, we recently reported a small series of isoxazole de-
rivatives incorporating an arylpiperazine moiety, exemplified by
compound 4 (Fig. 1), indicating that the substitution pattern on the
5-phenyl group of isoxazole had a significant impact on the cyto-
toxicity by favoring the larger lipophilic side chains [34]. Therefore,
in the course of our ongoing interest on the bioactive heterocycles
against cancer [34e38], we hereby report the structure-activity
relationship (SAR) and mechanistic biological evaluation of novel
isoxazole-piperazine hybrids furnished with various benzylox-
yphenyl side arm at the isoxazole part as potent antiproliferative
agents that are also effective on CSCs.
2.2. Biological evaluation and structure-activity relationship
In the present study, we aimed to explore (i) the influence of
differently positioned substituents on the phenyl ring A (SAR1), (ii)
the role of piperazine or various amine groups (SAR2), and (iii) the
influence of the substitution pattern at the middle phenyl ring B
(SAR3) for inhibition of cancer cells proliferation (Fig. 2).
First of all, the newly synthesized compounds (6aet, 7aen,
13aed and 14e15) were initially evaluated for their anti-
proliferative activities against epithelial human breast (MCF-7) and
liver (Huh7) cancer cells as well as mesenchymal liver cancer cells
(Mahlavu), using the sulforhodamine B (SRB) assay [39]. The PTEN
adequate drug sensitive epithelial Huh7 and PTEN deficient drug
resistant mesenchymal Mahlavu cell lines were chosen for
comparative evaluation of the compound's bioactivities. The results
are given as the half maximal inhibitory concentration (IC50) and
are shown in Table 1.
2. Results and discussion
In the first round, analogues 6a-t were evaluated for their
antiproliferative activities in order to simply investigate the effect
of substitutions on the phenyl ring (A) of the benzyloxyphenyl side
arm. As depicted in Table 1, the results suggested that the different
substitutions at the phenyl ring (A) had a significant influence on
antiproliferative activity against all tested cell lines, which indi-
cated that the benzyl moiety might contribute much to the potency
and selectivity. Among the isoxazole analogues, compound having
a non-substituted benzyloxyphenyl attachment at 5-position of the
isoxazole nucleus (6a) showed the least potent cytotoxic activity
2.1. Chemistry
The left-hand side chain substituents of the isoxazole were
installed according to the procedures described in Scheme 1 while
keeping the 4-CF3-benzylpiperazine to investigate the contribution
of isoxazole 5-substitution to the activity in new series as well as to
keep the synthesis of desired compounds as simple as possible,
which are simultaneously substituted at C (3) and C (5) of isoxazole.
Therefore, the analogues carrying differently substituted benzyl
against Mahlavu cell lines (IC50 ¼ 11.7
mM), while the potency
Fig. 1. Examples of isoxazole and piperazine derivatives with anti-cancer activity.
2

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
Scheme 1. Synthesis of Compounds 6a-t and 7a-n. Reagents and conditions: i) NaOEt, EtOH; ii) NH2OH$HCl, EtOH; iii) LiAlH4, THF; iv) BnBr derivatives, K2CO3, AcCN; v) CBr4, PPh3,
CH2Cl2; vi) Amine derivatives, DIEA, DMF (R1 and R2 groups are given in Tables 1 and 2).
Scheme 2. Synthesis of Compounds 13a-d and 14e15. Reagents and conditions: i) NaOEt, EtOH; ii) NH2OH$HCl, EtOH; iii) BBr3, DCM; iv) LiAlH4, THF; v) 3-CNBnBr, K2CO3, AcCN; vi)
CBr4, PPh3, CH2Cl2 for 12c-d or SOCl2, DMF, CH2Cl2 for 12a-b vii) Amine derivatives, DIEA, DMF.
MCF-7 cell lines. Among them, 6j with 3-CN and 6o with 2-OMe
showed good potency and selectivity for both Huh7 (IC50 ¼ 0.1
and 0.8
m
M, respectively) and MCF-7 (IC50 ¼ 0.8 and 0.3
mM,
respectively), while their activity against Mahlavu cell lines were
less pronounced (Table 1). In addition, both 6k with 4-CN and 6s
with 3,5-diOMe showed clear preference for MCF-7 cell lines with
IC50 of 0.1
mM. Lastly, 6e (3,5-diMe), 6p (3-OMe) and 6t (3,4,5-
triOMe) were identified as the most highly active compounds
Fig. 2. Major structural modifications about the isoxazole scaffold.
within the series against Huh7 cancer cell line with IC50 values at
0.6, 0.8, and 0.5 mM, respectively. However, none of the analogues
demonstrated significant activity against Mahlavu cell lines as they
did for Huh7 and MCF-7 cell lines (Table 1).
against Huh7 and MCF-7 was more pronounced (IC50 ¼ 1.7 and
2.9 mM, respectively). Although no obvious structure-activity re-
Based on the first screening, 3-CN (6j) was selected as the
preferred substitution for further optimization, and our research
was focused on the modification of piperazine ring at the right part
of the scaffold. As shown in Table 2, we randomly investigated the
effect of various aryl groups, i.e., differently substituted phenyl or
benzyl groups, of piperazine ring of the scaffold. The results
demonstrated that all compounds 7a-l, modified by introduction of
substituted benzyl or phenylpiperazines, showed moderate anti-
lationships (SAR) can be drawn from the cytotoxicity data of 6a-t, it
is clearly seen that certain substitutions demonstrated significant
contribution to the potency and selectivity of the compounds
against one or two of the cell lines tested. For example, among the
chlorine substituted analogues (6f-h), analogue 6g with 3-Cl-
benzyl group was identified as the most highly active compound
against Huh7 (IC50 ¼ 0.2
mM). Meanwhile, compounds bearing
cyano (6i-k) and methoxy (6o-t) substitutions also displayed very
tumor activities with IC50 values in the range of 1.4e8.4
mM for
potent antiproliferative activity for one or the two of the Huh7 and
MCF-7 and 1.5e6.1 M for Huh7 as compared to the corresponding
m
3

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
Table 1
In vitro cytotoxic activities of 6a-t with 72 h of treatment.
Cmpd No
R1
IC50 (mM)
MCF7
Huh7
Mahlavu
6a
6b
6c
6d
6e
6f
6g
6h
6i
6j
6k
6l
6m
6n
6o
6p
6r
6s
6t
H
2.9
3.7
4.0
1.2
1.6
2.8
1.4
6.7
4.0
0.8
0.1
3.0
2.5
7.9
0.3
2.0
1.3
0.1
1.8
1.7
1.2
5.0
1.5
0.6
1.0
0.2
4.0
5.0
0.1
1.0
1.5
1.3
2.0
0.9
0.8
3.2
1.5
0.5
11.7
6.8
2.5
7.5
6.0
3.2
4.1
3.7
3.5
10.6
4.3
3.1
2.9
3.1
3.9
1.4
4.9
4.3
5.8
2-Me
3-Me
4-Me
3,5-diMe
2-Cl
3-Cl
4-Cl
2-CN
3-CN
4-CN
2-F
3-F
4-F
2-OMe
3-OMe
4-OMe
3,5-diOMe
3,4,5-triOMe
IC50 values were calculated from the cell growth inhibition percentages obtained with five different concentrations in triplicates (R2 > 0.9).
analogue 6j with 4-CF3-benzylpiperazine against MCF-7
(IC50 ¼ 0.8 M) and Huh7 (IC50 ¼ 0.1 M). There was a slight
improvement of potency against Mahlavu cells with IC50 of
1.3e5.6 M for Mahlavu). Although two addi-
tional aminopiperidine derivatives (7m-n) were also tested as
opposed to piperazine ring, the activity was also moderate with
mesenchymal (Mahlavu and SNU-475) liver cancer cell lines with
the use of RT-CES (xCELLigence) system. It was shown that both 6a
and 13d displayed time and dose-dependent cell growth inhibitory
effects compared to the corresponding control groups (vehicle-
DMSO). The label-free dynamic monitoring results suggested that
compounds generate a dose-dependent kinetic pattern character-
istic, where growth inhibition begins after 40e50 h in Huh7 and
SNU-475 cells, whereas this effect is seen after 90 h of treatment in
Mahlavu and HepG2 cells. The cytotoxic effects of compounds reach
to their highest values upon 90, 130, 150 and 90 h in Mahlavu, SNU-
475, Huh7, and HepG2 cells, respectively. Many studies revealed
that RT-CES system can determine cell growth inhibition and
apoptosis in addition to cell growth rate and cell proliferation with
changes of cell index measurements (which indicate the degree of
the cell growth) from an exponentially growing state to a steady
state [40]. Therefore, these dynamic changes in cell index pattern
measurements might be related to the cells which undergo cell
cycle arrest or cell death in our compound treated mesenchymal
and epithelial liver cancer cells. In addition, the cell index values of
m
m
m
M (6j, IC50 ¼ 10.6
m
IC50 ¼ 2.1e3.0
mM for all three cell lines. Unfortunately, all these
derivatives led to less active than corresponding 6j against MCF-7
and Huh7 cell lines with a moderate improvement in activity
against Mahlavu cells.
Since the desired shift in structure-activity space is not achieved
with this strategy, we decided to investigate the substituent effect
on the middle phenyl ring (B) of the 6j to gain further insight on the
SAR at C (5) position of the isoxazole nucleus. To our delight, all of
the derivatives (13a-d) with methyl of fluorine at 2 or 3 positions as
R3 group (Fig. 2) exhibited excellent antiproliferative activities in
the single-digit micromolar range against MCF-7, Huh7, and Mah-
lavu cells (Table 3). Noteworthy, analogues 13b and 13d substituted
with methyl and fluorine at 3 position, respectively, exhibited much
greater antitumor activities than 6j in MCF-7, Huh7, and Mahlavu
both 6a and 13d treated cells with 2.5e10 mM concentrations ac-
cell lines with IC50 values in the range of 0.09e0.5
m
M. We also
quired with the RT-CES results correlated with the initial findings of
SRB assay results (Table S1). Data obtained from the RT-CES system
showed a continuous increase in the cell growth inhibition and,
hence, it is concluded that these compounds exhibit cytotoxic
rather than cytostatic effects (Fig. 3).
synthesized two different amine analogues (14e15) of the most
potent 13d, however, the potency was decreased indicating the
necessity of 4-CF3-Bn-piperazine for optimum activity. Based on
these encouraging results with these isoxazole-piperazine hybrids,
we selected the most potent 13d as well as the unsubstituted 6a for
comparison for further bioactivity analysis focusing on primary
liver cancer cells since there is a limited number of targeted small
molecule drugs available for this cancer.
2.4. Cell cycle arrest induced by 6a and 13d on HCC cells
To detect the effects of 6a and 13d on the cell cycle, Huh7,
HepG2, SNU-475, and Mahlavu cells analyzed by flow cytometry
and nuclear staining PI (Fig. 4A and Table S2). Following 48 h
treatment with 6a and 13d, cell cycle arrest at the G0/G1 phase and
an increase in the percentages of sub-G1 phase was observed in
Mahlavu cells. SNU-475 cells treated with 6a and 13d resulted in an
increase in S and G2/M phases after 48 h Huh7 cells treated with
2.3. Real-time cellular response of HCC cells with compounds 6a
and 13d treatment
Time and dose-dependent cytotoxic activities of 6a and 13d
were evaluated on both epithelial (Huh7 and HepG2), and
4

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
Table 2
In vitro cytotoxic activities of 7a-n with 72 h of treatment.
Cmpd No
R2
IC50 (mM)
MCF7
Huh7
Mahlavu
7a
7b
2.0
2.2
2.7
1.4
1.7
1.3
7c
7d
7e
2.4
1.8
1.4
1.5
1.6
2.4
2.2
1.5
2.3
7f
2.4
2.7
2.6
7g
7h
3.8
1.9
6.1
2.0
5.6
2.2
7i
3.8
2.2
4.1
7j
8.4
7.6
4.2
2.8
4.8
4.4
7k
7l
3.5
2.5
2.8
2.9
2.5
1.5
3.2
2.1
3.0
7m
7n
IC50 values were calculated from the cell growth inhibition percentages obtained with five different concentrations in triplicates (R2 > 0.9).
both 6a and 13d displayed higher cell populations in G2/M phase
after 48 h. An increase in the percentages of G0/G1 phase in HepG2
cells was observed for both 6a and 13d at similar time points.
Overall, results have shown that 6a and 13d induce cell cycle arrest
in four HCC cell lines. When dynamic monitoring results of HCC
cells are revisited, it was observed that compounds that caused G0/
G1 arrest caused growth inhibition in later stages while cells that
entered G2/M arrest showed earlier growth inhibition. Besides, cell
cycle analysis results were correlated with the real-time growth
inhibition patterns, which further supported the findings that the
growth inhibition is initiated after 48 h in HCC cells.
2.5. Characterization of cell death mechanism induced by 6a and
13d
To observe the cell death mechanism induced by 6a and 13d,
Annexin V staining by flow cytometry and Hoechst staining under
fluorescence microscopy were performed for Mahlavu, SNU-475,
Huh7 and HepG2 cells. Compared to the control group, the per-
centage of apoptotic populations in all cells treated with 6a or 13d
was increased after 72 h (Fig. 4B). Both compounds caused
apoptotic morphological changes (chromatin condensation, nu-
clear fragmentation, and apoptotic bodies) in the HCC cells after
5

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
Table 3
In vitro cytotoxic activities of 13a-d and 14e15 with 72 h of treatment.
Cmpd No
R3
R2
IC50 (mM)
MCF7
Huh7
Mahlavu
13a
13b
13c
13d
14
2-Me
3-Me
2-F
0.4
1.5
0.5
0.7
0.6
0.45
0.4
1.2
0.4
3-F
0.38
1.5
0.09
8.1
0.5
3-F
3.6
15
3-F
2.7
2.3
2.7
IC50 values were calculated from the cell growth inhibition percentages obtained with five different concentrations in triplicates (R2 > 0.9).
48 h treatment (Fig. 4C). Altogether, it was concluded that apoptotic
cell death was induced in HCC cells by the selected compounds.
acetyl-p53(K382) levels. Overall, compared to 13d, 6a was shown to
induce activity of p53 more prominently. On the other hand, both
compounds did not alter p53 activity status in epithelial HCC cells
(Huh7 and HepG2, data not shown). Both compounds led to in-
crease in levels of p21 protein in SNU-475 cells, while no p21
protein expression was seen in Mahlavu cells due to p53 mutation
in these cells [45] (Fig. 5A). These results might indicate that both
compounds act on cell cycle regulation and apoptosis through p53
dependent mechanisms [41] in mesenchymal HCC cells.
2.6. Analysis of cellular pathways targeted by 6a and 13d
Many studies revealed that p53 is a highly inducible transcrip-
tion factor by various stress signals such as DNA damage, drug
stress, oncogene activation, and nutrient deprivation. Mostly, the
outcomes of p53 activation are cell cycle arrest and apoptosis,
which are vital mechanisms for inhibiting tumor progression [41].
Some studies also showed that activation of p21/WAF1 may lead to
cell cycle arrest by p53 [42,43]. In addition to regulation of cell cycle
arrest, p21 also has other functions on regulation of some cellular
mechanisms such as apoptosis and DNA damage response. This is
related to the effects of p21 on the evolution of tumors, which
depends on the level of p53 expression profiles and this leads to
different levels of basal p21 protein in cancer cells [44]. Four
different hepatoma-derived cell lines Mahlavu, SNU-475, Huh7, and
HepG2 have different expression [45,46]. HepG2 cells have normal
p53 expression [45], while SNU-475 (A239G, T275C, A288G) [46],
Mahlavu (G249T), and Huh7 (C220T) [45] have mutations on p53
gene. Expression of p21 has been shown to be transcriptionally
regulated by p53 [45]. On the other hand, many studies have sug-
gested that p21 may also be regulated by p53-independent path-
ways [47]. Thus, we also checked whether activation of p53 protein
has a role in the regulation of cell cycle and apoptosis in HCC cells
upon treatment with selected compounds. While phosphorylation
of p53 protein at serine 15 is elevated to induce cell cycle arrest and
apoptosis [48] its acetylation at Lys382 enhances its tumor sup-
pressive activity [49]. Our results have shown that both phospho-
p53(S15) and acetyl-p53(K382) levels were increased upon treat-
ment with 13d in SNU-475 cells. 6a treated SNU-475 cells showed
only an increase in the phospho-p53(S15) levels. While increased
levels of phospho-p53(S15) and acetyl-p53(K382) were observed in
6a treated Mahlavu cells, 13d treatment only induced an increase in
Numerous studies have also revealed that PI3K/Akt signaling
pathway has a crucial role in the progression of HCC, and is involved
in various mechanisms such as cell proliferation, apoptosis, inva-
sion, and metastasis as well as cell cycle progression [50e54]. Akt is
one of the main components of PI3K/Akt signaling pathway which
has major roles in both cell survival and resistance to tumor therapy
[55]. Mahlavu cells and SNU-475 cells have hyperactivated Akt
pathway due to the loss of PTEN protein, while the pathway is
normoactive in PTEN adequate Huh7 and HepG2 cells [56,57].
Therefore, the poorly differentiated Mahlavu and SNU-475 cells
represent an aggressive HCC phenotype. Upon the findings that
compounds 6a and 13d led to cell cycle arrest and apoptosis,
several targets involved in these pathways at the protein level were
further investigated by Western blot analysis. Results have shown
that there was a decrease in expression levels of the activated form
of Akt (phospho-Akt (Ser473)) in Mahlavu cells upon treatment
with the both compounds, while only 13d decreased the phospho-
Akt (S473) levels in SNU-475 cells. However, no detectable p-Akt
was observed in Huh7 and HepG2 cells which is expected due to
normoactive Akt pathway in these cells (data not shown). c-Myc is
an oncogene, downstream of AKT, and mostly overexpressed in
cancer [58]. Since it has been reported that the PI3K/AKT/mTOR
pathway increases the expression of c-Myc [59], we checked the
expression of c-Myc in mesenchymal HCC cells. Treatment with 6a
and 13d in Mahlavu cells resulted in a decrease in c-Myc expression
(Fig. 5B). These results revealed that our compounds have effects on
6

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
Fig. 3. Real time cellular response of Mahlavu, SNU-475, Huh7, and HepG2 hepatocellular carcinoma cells treated with compounds 6a and 13d and DMSO control for 180 h. The
experiment was performed in triplicates and results were normalized to DMSO vehicle controls of 10-5-2.5 M concentrations 6a and 13d.
m
PI3K/AKT/c-Myc signaling pathway. Emerging studies have sug-
gested that PTEN may also regulate the MAPK pathway [60,61]. It is
known that ERK has a role in cell migration which is vital for cancer
invasion [62]. Besides, many studies revealed that cancer stem cells
(CSCs) may be responsible for initiation of the tumor, the migration
of cancer cells to distant tissues, and resistance to drugs [63]. A
recent study revealed that there is a positive correlation between
CSC markers and phospho-ERK in cancer [64]. Thus, we also
analyzed the expression level of ERK1/2 protein in both 6a and 13d
treated HCC cells. 6a and 13d treatment decreased the levels of
active form of ERK1/2 (phospho-ERK1/2 (T202/Y204) in all HCC
cells (Fig. 5C).
As a result, our data suggest that these compounds affect
cellular survival pathways differently depending on the mutation
profiles of cells (p53 and PTEN), epidermal/mesenchymal charac-
teristics, and activation of cell mechanisms through p53 depen-
dent/independent pathways in HCC cells.
2.7. 6a and 13d inhibits liver cancer stem cells associated traits
It is critical to identify novel compounds that can change the
enrichment of the cancer stem cell (CSC) population which is
responsible for the occurrence, development, relapse, drug resis-
tance and metastasis in histopathologically heterogeneous cancers
including hepatocellular carcinoma [65]. As we previously show
that liver cancer stem cells (LCSCs) bear several stemness surface
markers such as CD133 and EpCAM [9], which both promote sphere
formation, stemness gene expression and tumorigenicity. Huh7
cells contain CD133 and EpCAM expressing side-population which
displays CSC characteristics [9,66]. To determine the changes in the
expression of these stemness markers in Huh7, cells were treated
with 10
mM 6a and 13d for 72 h, and analyzed by flow cytometry. In
parallel, cells were also treated with 10
mM Notch-inhibitor DAPT, a
known CSC inhibitor [67], and Sorafenib, which is an FDA-approved
drug for HCC treatment in clinics, to determine the potency of
7

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
Fig. 4. Compound 6a and 13d induced cell cycle arrest and cell death. (A) The effects of compound 6a and 13d on cell cycle distributions in Mahlavu, SNU-475, Huh7, and HepG2
cells. Cells were treated with 5 M 6a or 13d for 48 h and analyzed by flow cytometry based on DNA content. Cell cycle was represented as G0/G1, S, G2/M, and Sub-G1 phases (B)
Flow cytometric analysis of Annexin V binding and propidium iodine staining in hepatocellular carcinoma cells undergoing apoptosis. HCC cells were treated with 5 M compound
m
m
6a and 13d and DMSO as control and were analyzed after 72 h. (C) Nuclear morphology was revealed by Hoechst staining under fluorescent microscopy. Apoptotic bodies were seen
in 6a and 13d treated cells after 48h.
selected compounds on LCSCs. We previously show that Sorafenib
causes an increase in LCSC population in Huh7 cells [66]. In parallel
with our previous study results, treatment of Huh7 cells with
Sorafenib enriched the CD133þ/EpCAM þ cells, while compounds
6a and 13d led to a significant decrease in the percentage of
CD133þ/EpCAM þ cells compared with DMSO controls (Fig. 6A).
These findings have suggested that the compounds may also be
effective against stemness properties of HCC cells.
LCSCs are regulated by different stemness-related genes such as
octamer-binding transcription factor 4 (OCT4) and NANOG. OCT4
and NANOG modulate self-renewal and pluripotency of embryonic
stem cells (ESCs) [67,68]. Moreover, overexpression of these key
regulators of ESC and targets are most frequently related to
different types of cancers [69] and many studies showed that these
stemness-related genes played a vital role in the development of a
malignant tumors, including HCC. NANOG has an active role in self-
renewal of LCSCs [70]. It has been reported that OCT4 induces tu-
mor vasculogenesis in LCSCs [71] and OCT4 expression is elevated
in chemoresistant HCC cells [72]. In order to understand the effects
of compounds on stemness related properties of HCC cells, mRNA
and protein levels of stemness-related transcription factors (OCT4
and NANOG) in PTEN deficient Mahlavu and PTEN-adequate Huh7
cells were determined by qRT-PCR and flow cytometry. Mahlavu
and Huh7 cells were treated with compounds 6a and 13d, DAPT (as
a positive control) and Sorafenib for 72 h. Sorafenib showed a sig-
nificant increase in mRNA expressions of NANOG and OCT4 genes
in both cell lines, whereas compounds 6a and 13d resulted in sig-
nificant reduction in OCT4 and NANOG mRNA levels in Huh7 cells
compared to control group. DAPT exhibited similar results with
both compounds for OCT4 and NANOG expressions. Compounds 6a,
13d and DAPT caused significant reduction in OCT4 mRNA levels,
whereas Sorafenib increased the OCT4 gene expression in Mahlavu
cells. 13d treated Mahlavu cells had decreased levels of NANOG
gene, whereas Sorafenib treated cells had approximately 10-fold
increase in NANOG mRNA levels. 13d treated Mahlavu cells had
slightly decreased levels of NANOG mRNA (Fig. 6B). On the other
hand, flow cytometry results revealed that 6a and 13d led to a
significant decrease in OCT4 and NANOG protein levels in Mahlavu
cells and a significant decrease in NANOG protein levels in Huh7
cells. The decrease in gene expression levels of OCT4 in Huh7 cells
could not be observed at the protein level, suggesting that changes
in NANOG protein levels might be more important in the possible
anti-stemness activity of 6a and 13d. Sorafenib, which enriches
LCSCs caused a significant increase in OCT4 expression, and a sig-
nificant drop in NANOG expression in Mahlavu cells when
compared to DMSO control group for 72 h treatment. (Fig. 6C).
8

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
Fig. 5. Western blot analysis of protein levels of Akt, p-Akt, c-Myc, ERK, p-ERK, p53, p-p53, acetyl-p53, and p21 respect to Calnexin (loading control) in 6a and 13d treated Mahlavu
and SNU-475 cell lines for 72h.
Elevated expression of NANOG in HCC patients was shown to be
significantly associated with poor clinical outcomes [68] and recent
studies revealed that elevated NANOG expression was related to
tumor growth through enriched CSCs [73,74]. Taken together, the
expression of stemness related transcription factors, NANOG and
OCT4, is important for tumor growth because of liver CSCs. Thus,
our results have suggested that the compounds are effective in
suppressing the expression of stemness-related transcription fac-
tors as well.
After 14 days, 6a and 13d treated Huh7 cells had significantly lower
sphere count and smaller average sphere size compared with the
control group, whereas Sorafenib treatment caused formation of
larger spheres (Fig. 7). These results have once again supported our
findings that 6a and 13d are not only effective against cancer cells
but are also potent Liver CSC growth inhibitors.
3. Conclusion
Sphere formation is an effective in vitro analysis model to
functionally study the self-renewal capacity of CSCs [75]. In order to
characterize sphere formation capacity of Huh7 cells treated with
6a, 13d, DAPT and Sorafenib for 72 h, Huh7 cells were collected and
grown in low-attachment plates for 14 days in sphere formation
media. After 7 and 14 days, sphere size and amount were measured.
6a, 13d and DAPT treated Huh7 cells had smaller sphere size and
relatively less sphere count compared to the control group after 7
days. Although Sorafenib treated Huh7 cells had smaller sphere
size, its sphere count was higher compared to the control group.
HCC is one of the most prevalent and the second deadly cancer
among other cancer types. Due to the highly heterogeneous nature
of HCC, the prognosis of patients is poor and the efficiency of cur-
rent FDA approved drugs such as sorafenib and regorafenib are still
not satisfactory due to acquired-drug resistance. Hence, it is crucial
to design and develop novel drug candidates to treat HCC, and
overcome mechanisms involved in drug resistance and recurrence
of cancer. Here, we explored the anti-cancer and anti-CSC activities
of novel isoxazole-piperazine derivatives, exemplified 6a and 13d,
as potential agents effective against HCC cells as well as liver CSC.
9

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
Fig. 6. Effects of compound 6a and 13d on stemness characteristics of HCC cells. (A) Representative flow cytometry plots (middle left panel) demonstrating positivity of Huh7 cells
for cancer stem cell markers CD133 and EpCAM for 72 h of treatment with 10 M DAPT (Notch inhibitor), Sorafenib, 6a, and 13d vs control vehicle (DMSO). Cells that survived after
m
each treatment were collected and stained fluorescently with anti-CD133-biotin, anti-biotin-PE and anti-EpCAM-FITC, antibodies. x-axis indicates CD133 positivity, and y-axis
10

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
In summary, we initially tested the dose and time dependent
growth inhibitory effects of 6a and 13d in 4 different HCC cell lines
through RT-CES system. Our results revealed that compounds dis-
played a dose dependent inhibition in cell growth, which was
highly correlated with the initial SRB screening results. Further
analysis of cell cycle progression and characterization of cell death
mechanisms induced by 6a and 13d indicated that compounds
induced G1 or G2/M arrests which further resulted in apoptotic cell
death in HCC cells.
Furthermore, to understand the molecular mechanisms
involved in the action of these compounds, analysis of cellular
pathways involved in cell cycle progression as well as proliferation
and migration of HCC cells were performed. Our results have
demonstrated that 6a and 13d altered the activity of p53 protein,
which is an important transcription factor regulating cell cycle ar-
rest or apoptosis to inhibit tumor progression in mesenchymal HCC
cells. Yet the 13d was found to cause this effect more notably.
Additionally, the p53 status in epithelial HCC cells remained un-
changed. Similarly, the levels of active Akt protein, which is one of
the main components of PI3K/Akt signaling pathway, was shown to
decrease in mesenchymal HCC cells upon treatment with 6a and
13d. Phosphorylation of ERK1/2 protein that belongs to the Ras/Raf/
MEK/ERK pathway (another vital mechanism by which prolifera-
tion and survival of HCC cells are regulated) was shown to decrease
significantly in mesenchymal cells treated with both 6a and 13d.
Overall, these results have indicated the potential role of these
compounds on the inhibition of proliferation and survival in HCC
cells.
Liver CSCs are identified as a population of cells in the tumor
microenvironment, capable of re-establishing the tumor by them-
selves, causing inefficiencies in treatment of HCC patients. Thus, it
is also crucial to define the effects of novel compounds on these cell
populations to propose stronger drug candidates for HCC. Our re-
sults have provided the potential anti-stemness properties of these
compounds by different experimental approaches in comparison
with Sorafenib and a Notch pathway inhibitor (DAPT). Initially, we
have shown that the percentage of LCSCs in Huh7 cells (CD133þ/
EpCAMþ) were significantly decreased upon treatment with 6a and
13d. Further analysis of expression levels of stemness-related
transcription factors has shown that, these compounds caused a
significant reduction in expression of NANOG or OCT4 proteins in
Mahlavu and Huh7 cells. Moreover, supportive to these results, 6a
and 13d resulted in decreased sphere formation capacity in Huh7
cells, which is a well-known character of CSC. To the best of our
knowledge, this is the first study to reveal the anti-stemness effects
of isoxazole-piperazine derivatives, proposing novel lead com-
pounds for the treatment of HCC with higher efficiencies. Overall, it
is worth noting that according to the experimental data obtained in
this study, 13d was found to have more noticeable effects on HCC
cells and liver CSCs compared to 6a.
cancers.
4. Experimental
4.1. Chemistry
All chemicals were purchased from Sigma Aldrich Chemicals
(Sigma Aldrich Corp., St. Louis, MO, USA), Merck Chemicals (Merck
KGaA, Darmstadt, Germany), ABCR (abcr GmbH, Karlsruhe, Ger-
many). 1H and 13C NMR spectra were recorded in CDCl3 or DMSO‑d6
on a Varian Mercury 400 MHz spectrometer, Bruker Avance Neo
500 MHz or Bruker Ultrashield 300 MHz using tetramethylsilane as
the internal standard. All chemical shifts were recorded as d (ppm),
and coupling constants are reported as Hertz. High resolution mass
spectra data (HRMS) were collected using Waters LCT Premier XE
Mass Spectrometer (high sensitivity orthogonal acceleration time-
of-flight) operating in ESI (þ) or ESI (ꢀ) method, also coupled to an
AQUITY Ultra Performance Liquid Chromatography system (Waters
Corporation) using a UV detector monitoring at 254 nm. Purity for
all final compounds was >95%, according to the UPLC-MS method
using (A) water þ 0.1% Formic Acid and (B) acetonitrile þ 0.1%
Formic Acid; flow rate ¼ 0.3 mL/min, Column: Aquity BEH C18
column (2.1 ꢁ 100 mm, 1.7 mm). All microwave irradiation exper-
iments were carried out in a Biotage Initiator þ microwave appa-
ratus with Biotage sealed microvawe vials. Flash chromatography
on silica gel was performed on RediSep prepacked disposable silica
gel columns using Teledyne Isco Combiflash. Melting points of the
synthesized compounds were determined by an SMP50 automatic
melting point apparatus (Stuart, Staffordshire, ST15 OSA, UK). FTIR
spectra were recorded on a PerkinElmer Spectrum 400 FTIR/FTNIR
spectrometer equipped with a Universal ATR Sampling Accessory.
Elemental analyses were performed with a LECO-932 (C, H, N, S-
Elemental Analyzer) and the results were within 0.4% of the
theoretical values. Compounds 1e3 were synthesized according to
the previously published procedures [34]. Experimental data for all
intermediate compounds can be found in Supporting Information.
4.1.1. Synthesis of Compounds 6a-t, Compounds 7a-n, 13a-d, 14, 15
The mixture of the appropriate bromide (5a-t, 12 c-d), or chlo-
ride derivative (12a-b) (0.5 mmol, 1 eq), appropriate amine
(0.6 mmol, 1.2 eq) and DIEA (1 mmol, 2 eq) in DMF (2 ml) was
heated by microwave irradiation at 80 ꢂC for 20 min. Then, it was
poured into ice-water and formed precipitate was filtrated. The
crude product was purified by flash chromatography.
4.1.1.1. 5-(4-(Benzyloxy)phenyl)-3-((4-(4-(trifluoromethyl)benzyl)
piperazin-1-yl)methyl)isoxazole (6a). Purified by flash column
chromatography (0%/10% MeOH in DCM). Yield 63.7%; mp
137.7e137.9 ꢂC. IR (ATR)
n: 3098, 2947, 2805, 1613, 1328, 1246, 1117,
748 cmꢀ1. 1H NMR (500 MHz, CDCl3): dH 2.53 (br s, 4H, piperazine),
2.60 (br s, 4H, piperazine), 3.58 (s, 2H, -N-CH2-Ar), 3.66 (s, 2H, -N-
CH2-isoxazole), 5.14 (s, 2H, -O-CH2-Ar), 6.45 (s, 1H, isoxazole-H),
7.06 (d, J ¼ 8.9 Hz, 2H, AreH), 7.35e7.39 (m, 1H, AreH), 7.41e7.47
(m, 6H, AreH), 7.59 (d, J ¼ 8.0 Hz, 2H, AreH), 7.73 (d, J ¼ 8.9 Hz, 2H,
AreH). 13C NMR (125 MHz, CDCl3): dC 169.87, 161.77, 160.21, 142.47,
In conclusion, we have shown that these isoxazole-piperazine
derivatives exemplified by 6a and 13d potently inhibit not only
proliferation of HCC cells, but also cancer cells with stem-cell like
properties. Although our detailed analysis with 6a and 13d focuses
on liver cancer cells, the initial cytotoxicity of these isoxazole-
piperazine hybrids on MCF-7 breast cancer cells makes these
compounds candidate for further development against epithelial
2
136.42, 129.33 (q, JC-F ¼ 32.1 Hz), 129.20, 128.69, 128.19, 127.48,
127.40, 125.17 (q, 3JC-F ¼ 3.7 Hz), 124.48 (q, 1JC-F ¼ 270.0 Hz), 120.61,
indicates EpCAM positivity. Lower-left quadrant, CD133-/EpCAM-; Upper-left quadrant, CD133-/EpCAMþ; Lower-right quadrant, CD133þ/EpCAM-; upper-right quadrant, CD133þ/
EpCAMþ. Each treatment was compared to its corresponding DMSO control to define the changes in percentage of double positive population. DAPT was used as positive control for
CSC inhibition. Bar graph (middle right panel) indicates relative CD133/EpCAM positivity with respect to control group. Experiments were performed in 3 biological replicates at
different times. (B) Bar graphs illustrating relative expression of OCT4 and NANOG in Huh7 and Mahlavu cell lines with 10
mM Sorafenib, DAPT, 6a, and 13d treatment for 72h by
qRT-PCR Housekeeping gene GAPDH was used as internal control. (C) Relative Mean fluorescence intensity (MFI) values of 10
mM 6a, 13d, Sorafenib, DAPT and control treated
Mahlavu and Huh7 cells in terms of expression of OCT4 and NANOG are determined by flow cytometry. Experiments were performed in 3 biological replicates at different times.
11

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
Fig. 7. Compound 6a and 13d inhibits sphere formation on Huh7 cells. (A) Representative 10X microscopic images of sphere formation generated after 7 days and 14 days treated
with 10 M DAPT, Sorafenib, 6a and 13d. Scale bar: 100 M. (B) Bar graphs comparing the number of spheres for each treatment group and sphere size relative to DMSO control.
Quantification of sphere formation assay revealed that 6a and 13d reduced the sphere formation ability of Huh7 cells.
m
m
115.29, 98.34, 70.12, 62.37, 53.40, 53.08, 52.99. HRMS (m/z) [MþH]þ
4.1.1.3. 5-(4-((3-Methylbenzyl)oxy)phenyl)-3-((4-(4-(tri-
fluoromethyl)benzyl)piperazin-1-yl)methyl)isoxazole (6c).
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 74.5%; mp 131.5e133.4 ꢂC. IR (ATR)
: 3115, 2943, 2799,
1614, 1328, 1247, 1152, 1120, 1007, 787 cmꢀ1 1H NMR (400 MHz,
calcd for C29H29F3N3O2: 508.2212, found: 508.2192. Anal. Calcd for
C
29H28F3N3O2: C, 68.62; H, 5.56; N, 8.28. Found: C, 68.29; H, 5.39; N,
8.26.
n
.
CDCl3): dH 2.38 (s, 3H, Ar-CH3), 2.50 (br s, 4H, piperazine), 2.57 (br s,
4H, piperazine), 3.56 (s, 2H, -N-CH2-Ar), 3.63 (s, 2H, -N-CH2-iso-
xazole), 5.07 (s, 2H, -O-CH2-Ar), 6.43 (s, 1H, isoxazole-H), 7.03 (d,
J ¼ 9.2 Hz, 2H, AreH), 7.15 (d, J ¼ 7.6 Hz, 1H, AreH), 7.22e7.31 (m,
3H, AreH), 7.43 (d, J ¼ 7.6 Hz, 2H, AreH), 7.56 (d, J ¼ 7.6 Hz, 2H,
AreH), 7.70 (d, J ¼ 9.2 Hz, 2H, AreH). 13C NMR (100 MHz, CDCl3): dC
4.1.1.2. 5-(4-((2-Methylbenzyl)oxy)phenyl)-3-((4-(4-(tri-
fluoromethyl)benzyl)piperazin-1-yl)methyl)isoxazole
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 80%; mp 124.6e126.2 ꢂC. IR (ATR)
: 3117, 2950, 2801,
(6b).
n
2
1615,1326, 1242, 1130, 746 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 2.38
(s, 3H, Ar-CH3), 2.50 (br s, 4H, piperazine), 2.57 (br s, 4H, pipera-
zine), 3.56 (s, 2H, -N-CH2-Ar), 3.64 (s, 2H, -N-CH2-isoxazole), 5.08
(s, 2H, -O-CH2-Ar), 6.43 (s, 1H, isoxazole-H), 7.05 (d, J ¼ 8.6 Hz, 2H,
AreH), 7.22e7.27 (m, 3H, AreH), 7.39e7.45 (m, 3H, AreH), 7.56 (d,
J ¼ 8.0 Hz, 2H, AreH), 7.71 (d, J ¼ 8.6 Hz, 2H, AreH). 13C NMR
168.88, 161.76, 160.27, 142.45, 138.41, 136.30, 129.33 (q, JC-
3
¼ 30.5 Hz), 129.18, 128.95, 128.58, 128.22, 127.37, 125.15 (q, JC-
F
¼ 3.8 Hz),124.58, 124.25 (q, 1JC-F ¼ 269.8 Hz),120.55,115.26, 98.29,
F
70.18, 62.35, 53.39, 53.07, 52.98, 21.41. HRMS (m/z) [MþH]þ calcd
for C30H31F3N3O2: 522.2368, found: 522.2365. Anal. Calcd for
C
30H30F3N3O2: C, 69.08; H, 5.80; N, 8.06. Found: C, 69.00; H, 5.63; N,
8.16.
(100 MHz, CDCl3):
d 169.88, 161.77, 160.34, 142.46, 136.71, 134.23,
2
130.52, 129.34 (q, JC-F ¼ 31.5 Hz), 129.18, 128.63, 128.50, 127.41,
126.11, 125.16 (q, 3JC-F ¼ 3.8 Hz), 124.25 (q, 1JC-F ¼ 269,9 Hz), 120.61,
115.19, 98.32, 68.74, 62.36, 53.40, 53.08, 52.98, 18.90. HRMS (m/z)
[MþH]þ calcd for C30H31F3N3O2: 522.2368, found: 522.2374.
4.1.1.4. 5-(4-((4-Methylbenzyl)oxy)phenyl)-3-((4-(4-(tri-
fluoromethyl)benzyl)piperazin-1-yl)methyl)isoxazole
(6d).
Purified by flash column chromatography (0%/ 10% MeOH in
12

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
DCM). Yield 39.0%; mp 159.2e160.9 ꢂC. IR (ATR)
n
: 3113, 2944, 2801,
C
C
29H28ClF3N3O2: 542.1822, found: 542.1836. Anal. Calcd for
29H27ClF3N3O2: C, 64.26; H, 5.02; N, 7.75. Found: C, 64.38; H, 4.99;
1615, 1326, 1245, 1157, 1133 cmꢀ1 1H NMR (400 MHz, CDCl3): dH
.
2.36 (s, 3H, Ar-CH3), 2.50 (br s, 4H, piperazine), 2.57 (br s, 4H,
piperazine), 3.56 (s, 2H, -N-CH2-Ar), 3.63 (s, 2H, -N-CH2-isoxazole),
5.07 (s, 2H, -O-CH2-Ar), 6.42 (s, 1H, isoxazole-H), 7.03 (d, J ¼ 8.8 Hz,
2H, AreH), 7.20 (d, J ¼ 8.0 Hz, 2H, AreH), 7.32 (d, J ¼ 8.0 Hz, 2H,
AreH), 7.43 (d, J ¼ 7.8 Hz, 2H, AreH), 7.56 (d, J ¼ 7.8 Hz, 2H, AreH),
7.69 (d, J ¼ 8.8 Hz, 2H, AreH). 13C NMR (100 MHz, CDCl3): dC 169.89,
N, 7.71.
4.1.1.8. 5-(4-((4-Chlorobenzyl)oxy)phenyl)-3-((4-(4-(tri-
fluoromethyl)benzyl)piperazin-1-yl)methyl)isoxazole
Purified by flash column chromatography (0%/10% MeOH in
DCM). Yield 62.1%; mp 158.8e159.0 ꢂC. IR (ATR)
: 3136, 2943, 2800,
(6h).
n
2
161.70, 160.26, 142.39, 138.00, 133.34, 129.34, 129.32 (q, JC-
1615, 1322, 1244, 1134, 1009, 800 cmꢀ1. 1H NMR (400 MHz, CDCl3):
dH 2.50 (br s, 4H, piperazine), 2.57 (br s, 4H, piperazine), 3.55 (s, 2H,
-N-CH2-Ar), 3.63 (s, 2H, -N-CH2-isoxazole), 5.07 (s, 2H, -O-CH2-Ar),
6.43 (s, 1H, isoxazole-H), 7.01 (d, J ¼ 9.0 Hz, 2H, AreH), 7.36 (s, 4H,
AreH), 7.43 (d, J ¼ 8.0 Hz, 2H, AreH), 7.56 (d, J ¼ 8.0 Hz, 2H, AreH),
7.70 (d, J ¼ 9.0 Hz, 2H, AreH). 13C NMR (100 MHz, CDCl3): dC 169.74,
1
¼ 31.5 Hz), 129.18, 127.60, 127.35, 124.23 (q, JC-F ¼ 270.5 Hz),
F
125.15 (q, 3JC-F ¼ 3.5 Hz), 124.23, 120.47, 115.25, 98.27, 70.04, 62.32,
53.36, 53.04, 52.94, 21.18. HRMS (m/z) [MþH]þ calcd for
C
C
30H31F3N3O2: 522.2368, found: 522.2363. Anal. Calcd for
30H30F3N3O2: C, 69.08; H, 5.80; N, 8.06. Found: C, 69.45; H, 5.86; N,
2
7.87.
161.75, 159.89, 142.40, 134.89, 133.99, 129.33 (q, JC-F ¼ 32.0 Hz),
129.17, 128.85, 128.75, 127.41, 125.15 (q, 3JC-F ¼ 3.9 Hz), 124.23 (q, 1JC-
4.1.1.5. 5-(4-((3,5-Dimethylbenzyl)oxy)phenyl)-3-((4-(4-(tri-
¼ 270.1 Hz), 120.79, 115.23, 98.40, 69.29, 63.33, 53.36, 53.05,
F
fluoromethyl)benzyl)
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 86.0%; mp 111.8e112.8 ꢂC. IR (ATR)
: 3027, 2950, 2801,
piperazin-1-yl)methyl)isoxazole
(6e).
52.94. HRMS (m/z) [MþH]þ calcd for C29H28ClF3N3O2: 542.1822,
found: 542.1827.
n
1614, 1321, 1245, 1128, 1064, 799 cmꢀ1. 1H NMR (400 MHz, CDCl3):
dH 2.33 (s, 6H, Ar-CH3), 2.49 (br s, 4H, piperazine), 2.57 (br s, 4H,
piperazine), 3.56 (s, 2H, -N-CH2-Ar), 3.63 (s, 2H, -N-CH2-isoxazole),
5.03 (s, 2H, -O-CH2-Ar), 6.42 (s, 1H, isoxazole-H), 6.98 (s, 1H, AreH),
7.02e7.04 (m, 4H, AreH), 7.43 (d, J ¼ 7.6 Hz, 2H, AreH), 7.56 (d,
J ¼ 7.6 Hz, 2H, AreH), 7.70 (d, J ¼ 8.8 Hz, 2H, AreH). 13C NMR
(100 MHz, CDCl3): dC 169.91, 161.77, 160.35, 142.46, 138.32, 136.24,
4.1.1.9. 2-((4-(3-((4-(4-(Trifluoromethyl)benzyl)piperazin-1-yl)
methyl)isoxazol-5-yl)phenoxy)methyl)benzonitrile (6i). Purified by
flash column chromatography (0%/ 10% MeOH in DCM). Yield
75.9%; mp 148.9e151.2 ꢂC. IR (ATR)
n
: 3132, 2939, 2802, 2230, 1615,
1326, 1246, 1115, 1100, 774 cmꢀ1
.
1H NMR (400, MHz, CDCl3): dH
2.50 (br s, 4H, piperazine), 2.57 (br s, 4H, piperazine), 3.56 (s, 2H,
-N-CH2-Ar), 3.64 (s, 2H, -N-CH2-isoxazole), 5.31 (s, 2H, -O-CH2-Ar),
6.45 (s, 1H, isoxazole-H), 7.07 (d, J ¼ 9.0 Hz, 2H, AreH), 7.42e7.48
(m, 3H, AreH), 7.56 (d, J ¼ 7.6 Hz, 2H, AreH), 7.62e7.69 (m, 3H,
AreH), 7.73 (d, J ¼ 9.0 Hz, 2H, AreH). 13C NMR (100 MHz, CDCl3): dC
169.64, 161.83, 159.51, 142.48, 142.46, 140.01, 133.15, 132.99, 129.34
(q, 2JC-F ¼ 29.5 Hz), 129.19, 128.46, 127.52, 125.16 (q, 3JC-F ¼ 3.9 Hz),
2
129.86, 129.70 (q, JC-F ¼ 31.5 Hz), 129.18, 127.38, 125.39, 125.16 (q,
1
3JC-F ¼ 3.8 Hz), 124.20 (q, JC-F ¼ 270.0 Hz), 120.50, 115.25, 98.28,
70.26, 62.36, 53.40, 53.08, 52.99, 21.29. HRMS (m/z) [MþH]þ calcd
for C31H32F3N3O2: 536.2525, found: 536.2534. Anal. Calcd for
C
31H31F3N3O2: C, 69.65; H, 5.84; N, 7.86. Found: C, 69.56; H, 6.00; N,
1
8.06.
124.26 (q, JC-F ¼ 270.6 Hz), 121.28, 116.98, 115.32, 111.24, 98.59,
67.63, 62.36, 53.38, 53.09, 52.99. HRMS (m/z) [MþH]þ calcd for
4.1.1.6. 5-(4-((2-Chlorobenzyl)oxy)phenyl)-3-((4-(4-(tri-
C
C
30H28F3N4O2: 533.2164, found: 533.2161. Anal. Calcd for
30H27F3N4O2: C, 67.66; H, 5.11; N,10.52. Found: C, 67.65; H, 5.01; N,
fluoromethyl)benzyl)piperazin-1-yl)methyl)isoxazole
Purified by flash column chromatography (0%/10% MeOH in
DCM). Yield 59.0%; mp 127.9e128.5 ꢂC. IR (ATR)
: 3130, 2943, 2805,
(6f).
10.81.
n
1614, 1325, 1246, 1117, 765 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 2.50
(br s, 4H, piperazine), 2.57 (br s, 4H, piperazine), 3.56 (s, 2H, -N-
CH2-Ar), 3.64 (s, 2H, -N-CH2-isoxazole), 5.22 (s, 2H, -O-CH2-Ar),
6.44 (s, 1H, isoxazole-H), 7.04 (d, J ¼ 8.6 Hz, 2H, AreH), 7.27e7.32
(m, 2H, AreH), 7.40e7.44 (m, 3H, AreH), 7.53e7.57 (m, 3H, AreH),
7.71 (d, J ¼ 8.6 Hz, 2H, AreH).13C NMR (100 MHz, CDCl3): dC 169.79,
161.79, 159.91, 142.47, 134.16, 132.66, 129.49, 129.21, 128.19, 128.77,
127.45, 127.04, 125.17 (q, 3JC-F ¼ 3.6 Hz), 124.25 (q, 1JC-F ¼ 270.0 Hz),
120.86, 115.28, 98.42, 67.22, 62.36, 53.39, 53.08, 52.99. HRMS (m/z)
[MþH]þ calcd for C29H28ClF3N3O2: 542.1822, found: 542.1813. Anal.
Calcd for C29H27ClF3N3O2: C, 64.26; H, 5.02; N, 7.75. Found: C,
64.25; H, 4.94; N, 7.61.
4.1.1.10. 3-((4-(3-((4-(4-(Trifluoromethyl)benzyl)piperazin-1-yl)
methyl)isoxazol-5-yl)phenoxy)methyl)benzonitrile (6j). Purified by
flash column chromatography (0%/10% MeOH in DCM). Yield
85.0%; mp 164.9e166.0 ꢂC. IR (ATR)
n: 3071, 2952, 2810, 2229, 1616,
1324, 1249, 1118, 799 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 2.50 (br s,
4H, piperazine), 2.57 (br s, 4H, piperazine), 3.56 (s, 2H, -N-CH2-Ar),
3.64 (s, 2H, -N-CH2-isoxazole), 5.15 (s, 2H, -O-CH2-Ar), 6.45 (s, 1H,
isoxazole-H), 7.03 (d, J ¼ 8.8 Hz, 2H, AreH), 7.44 (d, J ¼ 8.0 Hz, 2H,
AreH), 7.52 (t, J ¼ 7.6 Hz, 1H, AreH), 7.56 (d, J ¼ 8.0 Hz, 2H, AreH),
7.64e7.69 (m, 2H, AreH), 7.73 (d, J ¼ 8.8 Hz, 2H, AreH), 7.75 (s, 1H,
AreH). 13C NMR (100 MHz, CDCl3): dC 169.59, 161.82, 159.52, 142.43,
2
138.09, 131.75, 131.45, 130.69, 129.50, 129.34 (q, JC-F ¼ 32.0 Hz),
129.18, 127.51, 125.15 (q, 3JC-F ¼ 3.9 Hz), 124.30 (q, 1JC-F ¼ 270.0 Hz),
121.16, 118.52, 115.20, 112.90, 98.56, 68.72, 62.34, 53.36, 53.07,
52.96. HRMS (m/z) [MþH]þ calcd for C30H28F3N4O2: 533.2164,
found: 533.2158. Anal. Calcd for C30H27F3N4O2ꢃ0.1 CH2Cl2: C, 66.82;
H, 5.07; N, 10.36. Found: C, 66.67; H, 5.05; N, 10.75.
4.1.1.7. 5-(4-((3-Chlorobenzyl)oxy)phenyl)-3-((4-(4-(tri-
fluoromethyl)benzyl)piperazin-1-yl)methyl)isoxazole
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 80.1; mp 117.4e118.0 ꢂC. IR (ATR)
: 3136, 2946, 2809,
(6g).
n
1614,1331, 1264, 1122, 835 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 2.50
(br s, 4H, piperazine), 2.57 (br s, 4H, piperazine), 3.56 (s, 2H, -N-
CH2-Ar), 3.63 (s, 2H, -N-CH2-isoxazole), 5.09 (s, 2H, -O-CH2-Ar),
6.43 (s, 1H, isoxazole-H), 7.02 (d, J ¼ 9.0 Hz, 2H, AreH), 7.31e7.32
(m, 3H, AreH), 7.42e7.44 (m, 3H, AreH), 7.56 (d, J ¼ 8.0 Hz, 2H,
AreH), 7.71 (d, J ¼ 9.0 Hz, 2H, AreH). 13C NMR (100 MHz, CDCl3): dC
4.1.1.11. 4-((4-(3-((4-(4-(Trifluoromethyl)benzyl)piperazin-1-yl)
methyl)isoxazol-5-yl)phenoxy)methyl)benzonitrile (6k). Purified by
flash column chromatography (0%/ 10% MeOH in DCM). Yield
75.3%; mp 140.2e141.8 ꢂC. IR (ATR)
n: 3046, 2917, 2820, 2236, 1615,
1319, 1248, 1114, 1101, 824 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 2.50
(br s, 4H, piperazine), 2.57 (br s, 4H, piperazine), 3.56 (s, 2H, -N-
CH2-Ar), 3.63 (s, 2H, -N-CH2-isoxazole), 5.17 (s, 2H, -O-CH2-Ar), 6.44
(s, 1H, isoxazole-H), 7.01 (d, J ¼ 8.4 Hz, 2H, AreH), 7.43 (d, J ¼ 8.0 Hz,
2
169.73, 161.79, 159.84, 142.4, 138.48, 134.63, 129.95, 129.33 (q, JC-
3
¼ 30.7 Hz), 129.18, 128.30, 127.44, 127.41, 125.33, 125.19 (q, JC-
F
¼ 3.6 Hz), 124.24 (q, 1JC-F ¼ 269.9 Hz), 120.87, 115.24, 98.43, 69.22,
F
62.35, 53.37, 53.07, 52.97. HRMS (m/z) [MþH]þ calcd for
2H, AreH), 7.54e7.56 (m, 4H, AreH), 7.68e7.73 (m, 4H, AreH). 13
C
13

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
NMR (100 MHz, CDCl3): dC 169.78, 162.02, 159.73, 142.62, 142.05,
C
8.13.
29H27F4N3O2: C, 66.28; H, 5.18; N, 8.00. Found: C, 66.71; H, 4.74; N,
2
132.69, 129.54 (q, JC-F ¼ 31.5 Hz), 129.38, 127.77, 127.71, 125.36 (q,
1
3JC-F ¼ 3.8 Hz), 124.44 (q, JC-F ¼ 270.0 Hz), 121.37, 118.77, 115.41,
112.18, 98.76, 69.17, 62.55, 53.57, 53.28, 53.16. HRMS (m/z) [MþH]þ
4.1.1.15. 5-(4-((2-Methoxybenzyl)oxy)phenyl)-3-((4-(4-(tri-
calcd for C30H28F3N4O2: 533.2164, found: 533.2177. Anal. Calcd for
fluoromethyl)benzyl)
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 91.0%; mp 113.2e113.9 ꢂC. IR (ATR)
: 3132, 2944, 2802,
piperazin-1-yl)methyl)isoxazole
(6o).
C
30H27F3N4O2: C, 67.66; H, 5.11; N,10.52. Found: C, 67.60; H, 4.81; N,
10.25.
n
1615, 1465, 1326, 1249, 1117, 752 cmꢀ1. 1H NMR (400 MHz, CDCl3):
dH 2.50 (br s, 4H, piperazine), 2.57 (br s, 4H, piperazine), 3.56 (s, 2H,
-N-CH2-Ar), 3.63 (s, 2H, -N-CH2-isoxazole), 3.87 (s, 3H, Ar-OCH3),
5.16 (s, 2H, -O-CH2-Ar), 6.42 (s, 1H, isoxazole-H), 6.92 (d, J ¼ 8.0 Hz,
1H, AreH), 6.98 (td, J ¼ 8.0 Hz, 0.8 Hz, 1H, AreH), 7.05 (d, J ¼ 8.6 Hz,
2H, AreH), 7.31 (td, J ¼ 8.0 Hz, 2.0 Hz, 1H, AreH), 7.42e7.44 (m, 3H,
AreH), 7.56 (d, J ¼ 8.0 Hz, 2H, AreH), 7.69 (d, J ¼ 8.6 Hz, 2H, AreH).
13C NMR (100 MHz, DMSO‑d6): dC 168.90, 161.75, 159.99, 157.00,
4.1.1.12. 5-(4-((2-Fluorobenzyl)oxy)phenyl)-3-((4-(4-(tri-
fluoromethyl)benzyl)piperazin-1-yl)methyl)isoxazole
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 79.5%; mp 137.6e138.0 ꢂC. IR (ATR)
: 3124, 2944, 2817,
1614, 1454, 1324, 1247, 1116, 1064, 806 cmꢀ1 1H NMR (400 MHz,
(6l).
n
.
CDCl3): dH 2.50 (br s, 4H, piperazine), 2.57 (br s, 4H, piperazine),
3.56 (s, 2H, -N-CH2-Ar), 3.63 (s, 2H, -N-CH2-isoxazole), 5.18 (s, 2H,
-O-CH2-Ar), 6.43 (s, 1H, isoxazole-H), 7.05 (d, J ¼ 8.8 Hz, 2H, AreH),
7.07e7.13 (m, 1H, AreH), 7.15e7.19 (m, 1H, AreH), 7.30e7.36 (m, 1H,
AreH), 7.43 (d, J ¼ 7.6 Hz, 2H, AreH), 7.50 (td, J ¼ 7.6 Hz, 1.6 Hz, 1H,
AreH), 7.55 (d, J ¼ 7.6 Hz, 2H, AreH), 7.72 (d, J ¼ 8.8 Hz, 2H, AreH).
2
143.27, 129.58, 129.35, 129.29, 127.57 (q, JC-F ¼ 31.2 Hz), 127.28,
125.02 (q, 3JC-F ¼ 3.8 Hz), 124.35 (q, 1JC-F ¼ 270.5 Hz), 124.16, 120.31,
119.73,115.27, 110.96, 99.04, 64.82, 61.22, 55.46, 52.49, 52.45. HRMS
(m/z) [MþH]þ calcd for C30H31F3N3O3: 538.2318, found: 538.2319.
Anal. Calcd for C30H30F3N3O3: C, 67.03; H, 5.62; N, 7.82. Found: C,
67.14; H, 5.24; N, 7.98.
1
13C NMR (100 MHz, CDCl3): dC 169.79, 161.77, 160.46 (d, JC-
¼ 245.5 Hz),159.94, 142.45,129.95 (d, 3JC-F ¼ 8.4 Hz),129.67 (d, 3JC-
F
¼ 3.9 Hz), 129.33 (q, 2JC-F ¼ 30.7 Hz), 129.18, 127.41, 125.15 (q, 3JC-
F
¼ 3.6 Hz),124.33 (d, 4JC-F ¼ 3.9 Hz),124.33 (d, 4JC-F ¼ 3.9 Hz),124.24
4.1.1.16. 5-(4-((3-Methoxybenzyl)oxy)phenyl)-3-((4-(4-(tri-
F
(q, 1JC-F ¼ 270.6 Hz), 123.59 (d, 2JC-F ¼ 14.1 Hz), 120.80, 115.44 (d, 2JC-
fluoromethyl)benzyl)
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 82.0%; mp 100.8e101.1 ꢂC. IR (ATR)
: 3119, 2944, 2807,
piperazin-1-yl)methyl)isoxazole
(6p).
3
¼ 20.5 Hz), 115.21, 98.39, 63.79 (d, JC-F ¼ 4.4 Hz), 62.35, 53.38,
F
53.07, 52.98. HRMS (m/z) [MþH]þ calcd for C29H28F4N3O2:
526.2118, found: 526.2123. Anal. Calcd for C29H27F4N3O2: C, 66.28;
H, 5.18; N, 8.00. Found: C, 66.19; H, 5.15; N, 8.33.
n
1614,1455,1155,1117,1010, 776 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH
2.50 (br s, 4H, piperazine), 2.57 (br s, 4H, piperazine), 3.56 (s, 2H,
-N-CH2-Ar), 3.63 (s, 2H, -N-CH2-isoxazole), 3.82 (s, 3H, Ar-OCH3),
5.09 (s, 2H, -O-CH2-Ar), 6.42 (s, 1H, isoxazole-H), 6.86e6.89 (m, 1H,
AreH), 6.98e7.04 (m, 4H, AreH), 7.31 (t, J ¼ 7.8 Hz, 1H, AreH), 7.43
(d, J ¼ 7.8 Hz, 2H, AreH), 7.56 (d, J ¼ 7.8 Hz, 2H, AreH), 7.70 (d,
J ¼ 8.8 Hz, 2H, AreH). 13C NMR (100 MHz, CDCl3): dC 169.85, 161.76,
4.1.1.13. 5-(4-((3-Fluorobenzyl)oxy)phenyl)-3-((4-(4-(tri-
fluoromethyl)benzyl)piperazin-1-yl)methyl)isoxazole
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 71.2%; mp 112.6e113.1 ꢂC. IR (ATR)
: 3126, 2946, 2803,
(6m).
n
2
1614, 1325, 1247, 1117, 1065, 766 cmꢀ1. 1H NMR (400 MHz, CDCl3):
dH 2.50 (br s, 4H, piperazine), 2.57 (br s, 4H, piperazine), 3.56 (s, 2H,
-N-CH2-Ar), 3.63 (s, 2H, -N-CH2-isoxazole), 5.11 (s, 2H, -O-CH2-Ar),
6.43 (s, 1H, isoxazole-H), 7.00e7.04 (m, 3H, AreH), 7.15e7.21 (m,
2H, AreH), 7.33e7.39 (m, 1H, AreH), 7.43 (d, J ¼ 7.8 Hz, 2H, AreH),
7.56 (d, J ¼ 7.8 Hz, 2H, AreH), 7.70 (d, J ¼ 8.8 Hz, 2H, AreH). 13C NMR
160.14, 159.90, 142.45, 138.00, 129.74, 129.33 (q, JC-F ¼ 30.7 Hz),
129.18, 127.38, 125.15 (q, 3JC-F ¼ 3.6 Hz), 124.24 (q, 1JC-F ¼ 270.6 Hz),
120.62, 119.58, 115.27, 113.59, 112.94, 98.32, 69.96, 62.35, 55.25,
53.38, 53.07, 52.97. HRMS (m/z) [MþH]þ calcd for C30H31F3N3O3:
538.2318, found: 538.2322. Anal. Calcd for C30H30F3N3O3ꢃ0.8
EtOAc: C, 65.58; H, 6.03; N, 6.91. Found: C, 65.23; H, 5.65; N, 6.63.
1
(100 MHz, CDCl3): dC 169.74, 163.00 (d, JC-F ¼ 246.1 Hz), 161.77,
3
3
159.86, 142.43, 139.01 (d, JC-F ¼ 6.8 Hz), 130.23 (d, JC-F ¼ 7.6 Hz),
129.33 (q, 2JC-F ¼ 30.5 Hz), 129.18, 127.43, 125.15 (q, 3JC-F ¼ 3.8 Hz),
124.24 (q, 1JC-F ¼ 269.8 Hz), 122.69 (d, 4JC-F ¼ 2.3 Hz), 120.84, 115.24,
115.02 (d, 2JC-F ¼ 21.3 Hz), 114.21 (d, 2JC-F ¼ 22.1 Hz), 98.42, 69.24 (d,
4JC-F ¼ 1.5 Hz), 62.34, 53.37, 53.06, 52.96. HRMS (m/z) [MþH]þ calcd
for C29H28F4N3O2: 526.2118, found: 526.2113. Anal. Calcd for
4.1.1.17. 5-(4-((4-Methoxybenzyl)oxy)phenyl)-3-((4-(4-(tri-
fluoromethyl)benzyl)
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 82.0%; mp 161.9e162.7 ꢂC. IR (ATR)
: 3044, 2944, 2801,
1613, 1513, 1324, 1242, 1155, 1127, 802 cmꢀ1 1H NMR (400 MHz,
piperazin-1-yl)methyl)isoxazole
(6r).
n
.
CDCl3): dH 2.50 (br s, 4H, piperazine), 2.57 (br s, 4H, piperazine),
3.56 (s, 2H, -N-CH2-Ar), 3.63 (s, 2H, -N-CH2-isoxazole), 3.82 (s, 3H,
Ar-OCH3), 5.04 (s, 2H, -O-CH2-Ar), 6.42 (s, 1H, isoxazole-H), 6.93 (d,
J ¼ 9.0 Hz, 2H, AreH), 7.03 (d, J ¼ 9.0 Hz, 2H, AreH), 7.36 (d,
J ¼ 9.0 Hz, 2H, AreH), 7.43 (d, J ¼ 8.0 Hz, 2H, AreH), 7.56 (d,
J ¼ 8.0 Hz, 2H, AreH), 7.69 (d, J ¼ 9.0 Hz, 2H, AreH). 13C NMR
(100 MHz, CDCl3): dC 169.88, 161.75, 160.26, 159.61, 142.44, 129.31
C
29H27F4N3O2: C, 66.28; H, 5.18; N, 8.00. Found: C, 66.36; H, 5.05; N,
8.39.
4.1.1.14. 5-(4-((4-Fluorobenzyl)oxy)phenyl)-3-((4-(4-(tri-
fluoromethyl)benzyl)piperazin-1-yl)methyl)isoxazole
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 84.2%; mp 155.7e156.1 ꢂC. IR (ATR)
: 3050, 2945,
(6n).
2
3
n
(q, JC-F ¼ 31.0 Hz), 129.25, 129.16, 128.38, 127.34, 125.14 (q, JC-
2806, 1614, 1512, 1226, 1115, 820 cmꢀ1. 1H NMR (400 MHz, CDCl3):
dH 2.50 (br s, 4H, piperazine), 2.57 (br s, 4H, piperazine), 3.56 (s, 2H,
-N-CH2-Ar), 3.63 (s, 2H, -N-CH2-isoxazole), 5.06 (s, 2H, -O-CH2-Ar),
6.43 (s, 1H, isoxazole-H), 7.02 (d, J ¼ 8.8 Hz, 2H, AreH), 7.08 (t,
J ¼ 8.6 Hz, 2H, AreH), 7.39e7.44 (m, 4H, AreH), 7.56 (d, J ¼ 7.6 Hz,
2H, AreH), 7.70 (d, J ¼ 8.8 Hz, 2H, AreH).13C NMR (100 MHz, CDCl3):
dC 169.77, 162.59 (d, 1JC-F ¼ 245.6 Hz), 161.74, 159.99, 142.40, 132.15
¼ 3.8 Hz), 124.23 (q, 1JC-F ¼ 270.5 Hz), 120.48, 115.26, 114.08, 98.27,
F
69.91, 62.34, 55.30, 53.38, 53.06, 52.97. HRMS (m/z) [MþH]þ calcd
for C30H31F3N3O3: 538.2318, found: 538.2318. Anal. Calcd for
C
30H30F3N3O3ꢃ0.3 CH2Cl2: C, 64.62; H, 5.48; N, 7.46. Found: C,
64.57; H, 5.27; N, 7.38.
4.1.1.18. 5-(4-((3,5-Dimethoxybenzyl)oxy)phenyl)-3-((4-(4-(tri-
4
3
2
(d, JC-F ¼ 3.2 Hz), 129.34 (d, JC-F ¼ 8.3 Hz), 129.32 (q, JC-
fluoromethyl)benzyl)
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 76.0%; mp 111.3e113.8 ꢂC. IR (ATR)
: 3044, 2936, 2811,
1591, 1457, 1316, 1250, 1114, 1062, 829 cmꢀ1 1H NMR (400 MHz,
CDCl3): dH 2.50 (br s, 4H, piperazine), 2.57 (br s, 4H, piperazine),
piperazin-1-yl)methyl)isoxazole
(6s).
¼ 32.0 Hz), 129.18, 127.40, 125.15 (q, 3JC-F ¼ 3.9 Hz), 124.23 (q, 1JC-
F
¼ 270.6 Hz), 120.72, 115.59 (d, 2JC-F ¼ 21.8 Hz), 115.22, 98.38, 69.42,
n
F
62.33, 53.36, 53.05, 52.94. HRMS (m/z) [MþH]þ calcd for
.
C
29H28F4N3O2: 526.2118, found: 526.2112. Anal. Calcd for
14

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
3.56 (s, 2H, -N-CH2-Ar), 3.63 (s, 2H, -N-CH2-isoxazole), 3.80 (s, 6H,
Ar-OCH3), 5.05 (s, 2H, -O-CH2-Ar), 6.41e6.43 (m, 2H, isoxazole-H,
AreH), 6.58 (d, J ¼ 2.4 Hz, 2H, AreH), 7.02 (d, J ¼ 9.0 Hz, 2H,
AreH), 7.43 (d, J ¼ 7.8 Hz, 2H, AreH), 7.56 (d, J ¼ 7,8 Hz, 2H, AreH),
7.69 (d, J ¼ 9.0 Hz, 2H, AreH). 13C NMR (100 MHz, CDCl3): dC 169.84,
4.1.1.22. 3-((4-(3-((4-(4-Fluorophenyl)piperazin-1-yl)methyl)iso-
xazol-5-yl)phenoxy) methyl)benzonitrile (7c). Purified by flash col-
umn chromatography (0%/ 10% MeOH in DCM). Yield 51.3%; mp
141.6e142.0 ꢂC. IR (ATR)
n: 3084, 2951, 2810, 2229, 1614, 1514, 1250,
1059, 802 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 2.71 (t, J ¼ 4.8 Hz, 4H,
piperazine), 3.15 (t, J ¼ 4.8 Hz, 4H, piperazine), 3.70 (s, 2H, -N-CH2-
isoxazole), 5.15 (s, 2H, -O-CH2-Ar), 6.50 (s, 1H, isoxazole-H),
6.86e6.89 (m, 2H, AreH), 6.96 (t, J ¼ 8.8 Hz, 2H, AreH), 7.04 (d,
J ¼ 9.0 Hz, 2H, AreH), 7.52 (t, J ¼ 7.6 Hz, 1H, AreH), 7.64 (d,
J ¼ 7.6 Hz, 1H, AreH), 7.68 (d, J ¼ 7.6 Hz, 1H, AreH), 7.74 (d,
J ¼ 9.0 Hz, 2H, AreH), 7.76 (s,1H, AreH). 13C NMR (100 MHz, CDCl3):
dC 169.75, 161.74, 159.56, 157.21 (d, 1JC-F ¼ 235.1 Hz), 147.88 (d, 4JC-F
¼ 2.3 Hz), 138.07, 131.77, 131.46, 130.70, 129.51, 127.55, 121.11,
2
161.75, 161.09, 160.11, 142.44, 138.79, 129.33 (q, JC-F ¼ 30.7 Hz),
129.18, 127.37, 125.15 (q, 3JC-F ¼ 3.9 Hz), 124.25 (q, 1JC-F ¼ 270.0 Hz),
120.63, 115.28, 105.19, 99.94, 98.33, 70.03, 62.34, 55.36, 53.38,
53.07, 52.97. HRMS (m/z) [MþH]þ calcd for C31H33F3N3O4:
568.2423, found: 568.2411. Anal. Calcd for C30H30F3N3O3: C, 65.60;
H, 5.68; N, 7.40. Found: C, 65.16; H, 5.38; N, 7.14.
4.1.1.19. 3-((4-(4-(Trifluoromethyl)benzyl)piperazin-1-yl)methyl)-5-
(4-((3,4,5-trimethoxybenzyl)oxy)phenyl)isoxazole (6t). Purified by
flash column chromatography (0%/ 10% MeOH in DCM). Yield
3
2
118.53, 117.91 (d, JC-F ¼ 7.6 Hz), 115.52 (d, JC-F ¼ 22.1 Hz), 115.22,
112.91, 99.55, 68.74, 53.40, 53.14, 50.09. HRMS (m/z) [MþH]þ calcd
for C28H26FN4O2: 469.2040, found: 469.2056. Anal. Calcd for
81.0%; mp 95.9e97.8 ꢂC. IR (ATR)
n: 3111, 2940, 2807, 1592, 1463,
1326,1239,1116,1002, 810 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 2.50
(br s, 4H, piperazine), 2.57 (br s, 4H, piperazine), 3.56 (s, 2H, -N-
CH2-Ar), 3.64 (s, 2H, -N-CH2-isoxazole), 3.85 (s, 3H, Ar-OCH3), 3.88
(s, 6H, Ar-OCH3), 5.03 (s, 2H, -O-CH2-Ar), 6.43 (s, 1H, isoxazole-H),
6.66 (s, 2H, AreH), 7.04 (d, J ¼ 8.8 Hz, 2H, AreH), 7.43 (d,
J ¼ 7.8 Hz, 2H, AreH), 7.55 (d, J ¼ 7.8 Hz, 2H, AreH), 7.71 (d,
J ¼ 8.8 Hz, 2H, AreH). 13C NMR (100 MHz, CDCl3): dC 169.78, 161.78,
C
28H25FN4O2ꢃ0.5 EtOAc: C, 70.30; H, 5.70; N, 10.93. Found: C, 70.15;
H, 5.35; N, 10.64.
4.1.1.23. 3-((4-(3-((4-(4-Fluorobenzyl)piperazin-1-yl)methyl)iso-
xazol-5-yl)phenoxy) methyl)benzonitrile (7d). Purified by flash col-
umn chromatography (0%/ 10% MeOH in DCM). Yield 76.5%; mp
128.5e129.5 ꢂC. IR (ATR)
n: 3110, 2944, 2807, 2235, 1614, 1508, 1428,
2
160.11, 153.51, 142.43, 137.88, 131.91, 129.32 (q, JC-F ¼ 32.5 Hz),
1240, 1010, 795 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 2.50 (br s, 4H,
piperazine), 2.57 (br s, 4H, piperazine), 3.49 (s, 2H, -N-CH2-Ar), 3.64
(s, 2H, -N-CH2-isoxazole), 5.14 (s, 2H, -O-CH2-Ar), 6.45 (s, 1H,
isoxazole-H), 6.98 (t, J ¼ 8.4 Hz, 2H, AreH), 7.02 (d, J ¼ 8.6 Hz, 2H,
AreH), 7.25e7.29 (m, 2H, AreH), 7.51 (t, J ¼ 7.6 Hz, 1H, AreH), 7.64
(d, J ¼ 7.6 Hz, 1H, AreH), 7.67 (d, J ¼ 7.6 Hz, 1H, AreH), 7.72 (d,
J ¼ 8.6 Hz, 2H, AreH), 7.75 (s,1H, AreH). 13C NMR (100 MHz, CDCl3):
dC 169.58, 162.02 (d, 1JC-F ¼ 243.8 Hz), 161.80, 159.51, 138.09, 131.76,
129.17, 127.40, 125.15 (q, 3JC-F ¼ 3.9 Hz), 124.24 (q, 1JC-F ¼ 270.6 Hz),
120.72, 115.24, 104.64, 98.37, 70.40, 62.34, 60.85, 56.15, 53.37, 53.07,
52.97. HRMS (m/z) [MþH]þ calcd for C32H35F3N3O5: 598.2529,
found: 598.2519. Anal. Calcd for C30H30F3N3O3: C, 64.31; H, 5.73; N,
7.03. Found: C, 64.23; H, 5.38; N, 6.74.
4.1.1.20. 3-((4-(3-((4-(4-(Trifluoromethyl)phenyl)piperazin-1-yl)
methyl)isoxazol-5-yl)phenoxy)methyl)benzonitrile (7a). Purified by
flash column chromatography (0%/ 10% MeOH in DCM). Yield
3
131.45, 130.70, 130.64, (d, JC-F ¼ 7.0 Hz), 129.49, 127.51, 121.16,
118.52, 115.19, 115.01 (d, 2JC-F ¼ 21.4 Hz), 112.91, 98.58, 68.73, 62.08,
53.34, 53.02, 52.79. HRMS (m/z) [MþH]þ calcd for C29H28FN4O2:
483.2196, found: 483.2183. Anal. Calcd for C29H27FN4O2: C, 72.18; H,
5.64; N, 11.61. Found: C, 72.30; H, 5.45; N, 11.67.
89.4%; mp 159.5e160.3 ꢂC. IR (ATR)
n: 3136, 2814, 2777, 2232, 1615,
1334, 1251, 1105, 797 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 2.69 (t,
J ¼ 4.8 Hz, 4H, piperazine), 3.31 (t, J ¼ 4.8 Hz, 4H, piperazine), 3.70
(s, 2H, -N-CH2-isoxazole), 5.15 (s, 2H, -O-CH2-Ar), 6.50 (s, 1H,
isoxazole-H), 6.92 (d, J ¼ 9.0 Hz, 2H, AreH), 7.04 (d, J ¼ 8.8 Hz, 2H,
AreH), 7.47 (d, J ¼ 9.0 Hz, 2H, AreH), 7.52 (t, J ¼ 7.6 Hz, 1H, AreH),
7.63e7.69 (m, 2H, AreH), 7.72e7.75 (m, 3H, AreH). 13C NMR
(100 MHz, CDCl3): dC 169.84, 161.57, 159.60, 153.18, 138.06, 131.76,
4.1.1.24. 3-((4-(3-((4-(2-Fluorobenzyl)piperazin-1-yl)methyl)iso-
xazol-5-yl)phenoxy) methyl)benzonitrile (7e). Purified by flash col-
umn chromatography (0%/ 10% MeOH in DCM). Yield 73.3%; mp
104.6e105.1 ꢂC. IR (ATR)
n
: 3138, 2955, 2804, 2227,1612,1433, 1225,
3
131.44, 130.70, 129.50, 127.55, 126.39 (q, JC-F ¼ 3.8 Hz), 124.70 (q,
767 cmꢀ1
.
1H NMR (400 MHz, CDCl3): dH 2.55e2.59 (br s, 8H,
2
1JC-F ¼ 269.1 Hz), 121.06, 120.61 (q, JC-F ¼ 32.0 Hz), 118.51, 115.23,
piperazine), 3.63 (s, 4H, -N-CH2-Ar, -N-CH2-isoxazole), 5.14 (s, 2H,
-O-CH2-Ar), 6.45 (s, 1H, isoxazole-H), 6.99e7.04 (m, 3H, AreH), 7.09
(t, J ¼ 7.2 Hz, 1H, AreH), 7.21e7.25 (m, 1H, AreH), 7.37 (t, J ¼ 7.2 Hz,
1H, AreH), 7.52 (t, J ¼ 7.6 Hz, 1H, AreH), 7.63 (d, J ¼ 7.6 Hz, 1H,
AreH), 7.67 (d, J ¼ 7.6 Hz, 1H, AreH), 7.71 (d, J ¼ 8.4 Hz, 2H, AreH),
7.75 (s, 1H, AreH). 13C NMR (100 MHz, CDCl3): dC 169.58, 161.82,
114.59, 112.92, 98.52, 68.74, 53.37, 52.80, 47.90. HRMS (m/z)
[MþH]þ calcd for C29H26F3N4O2: 519.2008, found: 519.2003. Anal.
Calcd for C29H25F3N4O2ꢃ0.3 CH2Cl2: C, 64.69; H, 4.74; N, 10.30.
Found: C, 64.25; H, 4.93; N, 10.28.
4.1.1.21. 3-((4-(3-((4-(5-(Trifluoromethyl)pyridin-2-yl)piperazin-1-
161.41 (d, 1JC-F ¼ 244.0 Hz), 159.50, 138.09, 131.75, 131.67 (d, 3JC-F
¼
3
yl)methyl)isoxazol-5-yl)phenoxy)methyl)benzonitrile
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 89.0%; mp 156.2e157.3 ꢂC. IR (ATR)
: 3149, 2946, 2808,
2226, 1610, 1515, 1431, 1251, 1109, 787 cmꢀ1 1H NMR (400 MHz,
(7b).
3.8 Hz), 131.45, 130.70, 129.49, 128.87 (d, JC-F ¼ 7.6 Hz), 127.51,
4
2
123.86 (d, JC-F ¼ 3.8 Hz), 121.16, 118.52, 115.24 (d, JC-F ¼ 22.1 Hz),
115.18, 112.90, 98.58, 68.72, 55.04, 53.33, 52.99, 52.54. HRMS (m/z)
[MþH]þ calcd for C29H28FN4O2: 483.2196, found: 483.2176. Anal.
Calcd for C29H27FN4O2ꢃ0.2 CH2Cl2: C, 70.21; H, 5.53; N, 11.22.
Found: C, 70.56; H, 5.42; N, 10.92.
n
.
CDCl3): dH 2.65 (t, J ¼ 4.8 Hz, 4H, piperazine), 3.68 (t, J ¼ 4.8 Hz, 4H,
piperazine), 3.70 (s, 2H, -N-CH2-isoxazole), 5.15 (s, 2H, -O-CH2-Ar),
6.50 (s, 1H, isoxazole-H), 6.63 (d, J ¼ 8.8 Hz, 1H, AreH), 7.04 (d,
J ¼ 9.2 Hz, 2H, AreH), 7.52 (t, J ¼ 7.6 Hz, 1H, AreH), 7.60e7.69 (m,
3H, AreH), 7.73e7.76 (m, 3H, AreH), 8.39 (s, 1H, AreH). 13C NMR
4.1.1.25. 3-((4-(3-((4-(3-Fluorobenzyl)piperazin-1-yl)methyl)iso-
xazol-5-yl)phenoxy) methyl)benzonitrile (7f). Purified by flash col-
umn chromatography (0%/ 10% MeOH in DCM). Yield 55.0%; mp
(100 MHz, CDCl3): dC 169.84, 161.56, 160.31, 159.60, 145.72 (q, 3JC-F
¼
3
4.3 Hz), 138.06, 134.48 (q, JC-F ¼ 3.1 Hz), 131.77, 131.46, 130.70,
129.51, 127.56, 124.57 (q, 1JC-F ¼ 268.3 Hz), 121.05, 118.53, 115.25 (q,
2JC-F ¼ 32.7 Hz), 115.23, 112.91, 105.58, 98.52, 68.74, 53.43, 52.73,
44.59. HRMS (m/z) [MþH]þ calcd for C28H25F3N5O2: 520.1960,
found: 520.1962. Anal. Calcd for C28H24F3N5O2ꢃ0.6 CH2Cl2: C, 60.21;
H, 4.45; N, 12.28. Found: C, 60.14; H, 4.54; N, 12.37.
111.1e112.0 ꢂC. IR (ATR)
n: 3115, 2942, 2808, 2233, 1613, 1511, 1428,
1250, 1133, 798 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 2.51 (br s, 4H,
piperazine), 2.60 (br s, 4H, piperazine), 3.52 (s, 4H, -N-CH2-Ar), 3.64
(s, 4H, -N-CH2-isoxazole), 5.14 (s, 2H, -O-CH2-Ar), 6.46 (s, 1H,
isoxazole-H), 6.91e6.96 (m, 1H, AreH), 7.01e7.09 (m, 4H, AreH),
7.23e7.29 (m, 1H, AreH), 7.52 (t, J ¼ 7.6 Hz, 1H, AreH), 7.64 (d,
15

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
J ¼ 7.6 Hz, 1H, AreH), 7.68 (d, J ¼ 7.6 Hz, 1H, AreH), 7.73 (d,
J ¼ 8.4 Hz, 2H, AreH), 7.76 (s,1H, AreH). 13C NMR (100 MHz, CDCl3):
dC 169.60, 162.93 (d, 1JC-F ¼ 243.8 Hz), 161.77, 159.51, 138.10, 131.76,
5.13 (s, 2H, -O-CH2-Ar), 6.45 (s, 1H, isoxazole-H), 7.02 (d, J ¼ 8.8 Hz,
2H, AreH), 7.51 (t, J ¼ 7.6 Hz, 1H, AreH), 7.63 (d, J ¼ 7.6 Hz, 1H,
AreH), 7.67 (d, J ¼ 7.6 Hz, 1H, AreH), 7.71 (d, J ¼ 8.8 Hz, 2H, AreH),
7.75 (s, 1H, AreH). 13C NMR (100 MHz, CDCl3): dC 169.52, 161.90,
159.47, 138.09, 131.74, 131.45, 130.69, 129.48, 127.50, 121.20, 118.52,
115.17, 112.89, 98.61, 68.72, 68.12, 63.26, 53.63, 53.37, 52.97, 30.36,
25.37. HRMS (m/z) [MþH]þ calcd for C27H31N4O3: 459.2396, found:
459.2393. Anal. Calcd for C27H30N4O3ꢃ0.5 CH2Cl2: C, 65.93; H, 6.24;
N, 11.18. Found: C, 65.59; H, 6.33; N, 11.63.
3
131.45, 130.70, 129.62 (d, JC-F ¼ 8.4 Hz), 129.50, 127.53, 124.54,
2
2
121.17, 118.53, 115.75 (d, JC-F ¼ 21.3 Hz), 115.20, 113.96 (d, JC-F
¼
21.3 Hz), 112.91, 98.59, 68.73, 62.30, 53.34, 53.03, 52.86. HRMS (m/
z) [MþH]þ calcd for C29H28FN4O2: 483.2196, found: 483.2174.
4.1.1.26. Tert-butyl-4-((5-(4-((3-cyanobenzyl)oxy)phenyl)isoxazol-3-
yl)methyl) piperazine-1-carboxylate (7g). Purified by flash column
chromatography (0%/ 10% MeOH in DCM). Yield 61.3%; mp
4.1.1.30. 3-((4-(3-((4-(Cyclopropanecarbonyl)piperazin-1-yl)methyl)
isoxazol-5-yl)phenoxy) methyl)benzonitrile (7k). Purified by flash
column chromatography (0%/ 10% MeOH in DCM). Yield 66.6%;
132.2e132.6 ꢂC. IR (ATR)
n: 3129, 2972, 2818, 2230,1682, 1613,1424,
1242, 1129, 795 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 1.45 (s, 9H, -O-
C(CH3)3), 2.48 (br t, 4H, piperazine), 3.45 (br t, 4H, piperazine), 3.64
(s, 4H, -N-CH2-isoxazole), 5.14 (s, 2H, -O-CH2-Ar), 6.45 (s, 1H,
isoxazole-H), 7.03 (d, J ¼ 8.8 Hz, 2H, AreH), 7.51 (t, J ¼ 7.6 Hz, 1H,
AreH), 7.63 (d, J ¼ 7.6 Hz, 1H, AreH), 7.67 (d, J ¼ 7.6 Hz, 1H, AreH),
7.73 (d, J ¼ 8.8 Hz, 2H, AreH), 7.75 (s, 1H, AreH). 13C NMR (100 MHz,
CDCl3): dC 169.75, 161.55, 159.55, 154.68, 138.06, 131.76, 131.44,
130.69, 129.49, 127.53, 121.06, 118.51, 115.20, 112.90, 98.49, 79.73,
68.72, 53.43, 52.85, 28.39. HRMS (m/z) [MþH]þ calcd for
mp 125.8e126.8 ꢂC. IR (ATR)
n
: 3005, 2946, 2849, 2232, 1644, 1609,
1439, 1253, 1230, 1031, 796 cmꢀ1
.
1H NMR (400 MHz, CDCl3): dH
0.72e0.77 (m, 2H, cyclopropane CH2), 0.95e0.99 (m, 2H, cyclo-
propane CH2), 1.68e1.74 (m, 1H, cyclopropane CH), 2.55 (br s, 4H,
piperazine), 3.65 (s, 2H, -N-CH2-isoxazole), 3.67 (br s, 4H, pipera-
zine), 5.14 (s, 2H, -O-CH2-Ar), 6.46 (s, 1H, isoxazole-H), 7.03 (d,
J ¼ 9.0 Hz, 2H, AreH), 7.51 (t, J ¼ 7.6 Hz, 1H, AreH), 7.63 (d,
J ¼ 7.6 Hz, 1H, AreH), 7.67 (d, J ¼ 7.6 Hz, 1H, AreH), 7.73 (d,
J ¼ 9.0 Hz, 2H, AreH), 7.75 (s,1H, AreH). 13C NMR (100 MHz, CDCl3):
dC 171.95, 169.83, 161.44, 159.59, 138.05, 131.76, 131.44, 130.70,
129.50, 127.55, 121.02, 118.51, 115.22, 112.90, 98.47, 68.73, 53.32,
53.14, 52.84, 45.32, 41.99, 10.89, 7.41. HRMS (m/z) [MþH]þ calcd for
C
C
27H31N4O4: 475.2345, found: 475.2334. Anal. Calcd for
27H30N4O4ꢃ0.3 CH2Cl2: C, 65.57; H, 6.17; N, 11.20. Found: C, 65.80;
H, 6.26; N, 11.03.
4.1.1.27. 3-((4-(3-((4-(Furan-2-carbonyl)piperazin-1-yl)methyl)iso-
xazol-5-yl)phenoxy)methyl) benzonitrile (7h). Purified by flash col-
umn chromatography (0%/ 10% MeOH in DCM). Yield 68.7%; mp
C
C
26H27N4O3: 443.2083, found: 443.2078. Anal. Calcd for
26H26N4O3ꢃ0.25 CH2Cl2: C, 67.99; H, 5.76; N, 12.08. Found: C,
68.28; H, 5.872; N, 11.68.
118.7e119.9 ꢂC. IR (ATR)
n: 3145, 2993, 2823, 2229,1606,1435,1253,
1179, 772 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 2.60 (t, J ¼ 5.0 Hz, 4H,
piperazine), 3.67 (s, 2H, -N-CH2-isoxazole), 3.83 (br s, 4H, pipera-
zine), 5.14 (s, 2H, -O-CH2-Ar), 6.46e6.47 (m, 2H, isoxazole-H,
AreH), 6.98 (dd, J ¼ 3.6, 0.8 Hz, 1H, AreH), 7.03 (d, J ¼ 8.8 Hz, 2H,
AreH), 7.45e7.46 (m, 1H, AreH), 7.51 (t, J ¼ 7.6 Hz, 1H, AreH), 7.63
(d, J ¼ 7.6 Hz, 1H, AreH), 7.67 (d, J ¼ 7.6 Hz, 1H, AreH), 7.73 (d,
J ¼ 8.8 Hz, 2H, AreH), 7.75 (s,1H, AreH). 13C NMR (100 MHz, CDCl3):
dC 169.86, 161.37, 159.60, 159.06, 147.90, 143.64, 138.06, 131.75,
131.43, 130.69, 129.48, 127.55, 121.03, 118.57, 116.42, 115.23, 112.92,
111.26, 98.45, 68.74, 53.28, 53.20. HRMS (m/z) [MþH]þ calcd for
4.1.1.31. 3-((4-(3-((4-(Cyclopropylmethyl)piperazin-1-yl)methyl)iso-
xazol-5-yl)phenoxy) methyl)benzonitrile (7l). Purified by flash col-
umn chromatography (0%/10% MeOH in DCM). Yield 48.0%; mp
98.7e99.3 ꢂC. IR (ATR)
n: 3078, 2945, 2808, 2229, 1616, 1514, 1434,
1253, 1173, 797 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 0.07e0.11 (m,
2H, cyclopropane CH2), 0.48e0.51 (m, 2H, cyclopropane CH2),
0.84e0.87 (m, 1H, cyclopropane CH), 2.26 (d, J ¼ 6.8 Hz, 2H,
piperazine-CH2-cyclopropane), 2.60 (s, 8H, piperazine), 3.64 (s, 4H,
-N-CH2-isoxazole), 5.14 (s, 2H, -O-CH2-Ar), 6.45 (s, 1H, isoxazole-H),
7.02 (d, J ¼ 8.6 Hz, 2H, AreH), 7.51 (t, J ¼ 7.6 Hz, 1H, AreH), 7.63 (d,
J ¼ 7.6 Hz, 1H, AreH), 7.67 (d, J ¼ 7.6 Hz, 1H, AreH), 7.72 (d,
J ¼ 8.6 Hz, 2H, AreH), 7.75 (s,1H, AreH). 13C NMR (100 MHz, CDCl3):
dC 169.54, 161.86, 159.48, 138.09, 131.75, 131.44, 130.69, 129.48,
127.50, 121.19, 118.51, 115.18, 112.90, 98.60, 68.72, 63.68, 53.41,
53.10, 53.05, 8.28, 3.87. HRMS (m/z) [MþH]þ calcd for C26H29N4O2:
429.2291, found: 429.2289.
C
27H25N4O4: 469.1876, found: 469.1870.
4.1.1.28. 3-((4-(3-((4-(Tetrahydrofuran-2-carbonyl)piperazin-1-yl)
methyl)isoxazol-5-yl)phenoxy) methyl)benzonitrile (7i).
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 60.1%; mp 109.8e111.2 ꢂC. IR (ATR)
: 3142, 2936, 2813,
2231, 1656, 1618, 1435, 1242, 1017, 800 cmꢀ1 1H NMR (400 MHz,
n
.
CDCl3): dH 1.86e2.04 (m, 3H), 2.24e2.29 (m, 1H), 2.53 (br s, 4H,
piperazine), 3.55e3.65 (m, 6H), 3.80e3.95 (m, 2H), 4.58 (t,
J ¼ 6.9 Hz, tetrahydrofuran CH), 5.14 (s, 2H, -O-CH2-Ar), 6.46 (s, 1H,
isoxazole-H), 7.02 (d, J ¼ 8.6 Hz, 2H, AreH), 7.51 (t, J ¼ 7.6 Hz, 1H,
AreH), 7.63 (d, J ¼ 7.6 Hz, 1H, AreH), 7.67 (d, J ¼ 7.6 Hz, 1H, AreH),
7.72 (d, J ¼ 8.6 Hz, 2H, AreH), 7.75 (s, 1H, AreH). 13C NMR (100 MHz,
CDCl3): dC 169.86, 169.80, 159.59, 138.04, 131.76, 131.44, 130.69,
129.49, 127.55, 121.00, 118.50, 115.22, 112.90, 98.46, 75.84, 69.06,
68.72, 53.27, 53.14, 52.79, 45.21, 41.83, 28.39, 25.70. HRMS (m/z)
[MþH]þ calcd for C27H29N4O4: 473.2189, found: 473.2181.
4.1.1.32. 3-((4-(3-(((1-Benzylpiperidin-4-yl)amino)methyl)isoxazol-
5-yl)phenoxy) methyl)benzonitrile (7m). Purified by flash column
chromatography (0%/10% MeOH in DCM). Yield 44.7%; mp
93.7e94.8 ꢂC. IR (ATR)
n: 3119, 3060, 2938, 2795, 2229, 1615, 1517,
1434, 1253, 1174, 787 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 1.40e1.50
(m, 2H, piperidine CH2), 1.88e1.91 (m, 2H, piperidine CH2),
2.01e2.07 (m, 2H, piperidine CH2), 2.53e2.56 (m, 1H, piperidine
CH), 2.84e2.87 (m, 2H, piperidine CH2), 3.50 (s, 2H, -N-CH2-Ar),
3.91 (s, 2H, -N-CH2-isoxazole), 5.13 (s, 2H, -O-CH2-Ar), 6.42 (s, 1H,
isoxazole-H), 7.02 (d, J ¼ 8.4 Hz, 2H, AreH), 7.23e7.31 (m, 5H,
AreH), 7.51 (t, J ¼ 7.6 Hz, 1H, AreH), 7.63 (d, J ¼ 7.6 Hz, 1H, AreH),
7.67 (d, J ¼ 7.6 Hz, 1H, AreH), 7.72 (d, J ¼ 8.4 Hz, 2H, AreH), 7.75 (s,
1H, AreH). 13C NMR (100 MHz, CDCl3): dC 169.55, 163.92, 159.50,
138.09, 131.76, 131.44, 130.70, 129.49, 129.15, 128.18, 127.52, 127.00,
121.17, 118.52, 115.18, 112.90, 97.86, 68.72, 62.98, 54.25, 52.17, 42.03,
32.48. HRMS (m/z) [MþH]þ calcd for C30H31N4O2: 479.2447, found:
479.2451. Anal. Calcd for C30H30N4O2ꢃ0.6 MeOH: C, 73.83; H, 6.56;
N, 11.25. Found: C, 73.81; H, 6.43; N, 10.89.
4.1.1.29. 3-((4-(3-((4-((Tetrahydrofuran-2-yl)methyl)piperazin-1-yl)
methyl)isoxazol-5-yl)phenoxy)methyl)benzonitrile (7j). Purified by
flash column chromatography (0%/ 10% MeOH in DCM). Yield
35.0%; mp 90.8e91.8 ꢂC. IR (ATR)
n: 3120, 2943, 2804, 2228, 1614,
1517, 1442, 1261, 1249, 1059, 836 cmꢀ1. 1H NMR (400 MHz, CDCl3):
dH 1.43e1.52 (m,1H),1.77e1.90 (m, 2H),1.92e2.03 (m,1H), 2.41 (dd,
J ¼ 13.0, 4.0 Hz, 1H), 2.49 (dd, J ¼ 13.0, 4.0 Hz, 1H), 2.58 (s, 8H), 3.62
(s, 2H), 3.69e3.83 (m, 1H), 3.85e3.89 (m, 1H), 3.98e4.05 (m, 1H),
16

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
4.1.1.33. Tert-butyl-4-(((5-(4-((3-cyanobenzyl)oxy)phenyl)isoxazol-
3-yl)methyl)amino) piperidine-1-carboxylate (7n). Purified by flash
column chromatography (0%/10% MeOH in DCM). Yield 72.2%;
AreH), 6.87 (dd, J ¼ 9.2 Hz, 2.4 Hz,1H, AreH), 7.44 (d, J ¼ 8.0 Hz, 2H,
AreH), 7.51e7.56 (m, 3H, AreH), 7.64e7.67 (m, 2H, AreH), 7.74 (s,
1H, AreH), 7.87 (t, J ¼ 8.8 Hz,1H, AreH). 13C NMR (100 MHz, CDCl3):
dC 163.66 (d, 3JC-F ¼ 3.2 Hz),161.84,160.55 (d, 3JC-F ¼ 10.9 Hz),160.00
mp 145.3e146.3 ꢂC. IR (ATR)
n: 3341, 3151, 2936, 2851, 2233, 1671,
1617, 1426, 1231, 1170, 1020, 798 cmꢀ1. 1H NMR (400 MHz, CDCl3):
dH 1.25e1.34 (m, 2H, piperidine CH2), 1.44 (s, 9H, -O-C(CH3)3),
1.86e1.89 (m, 2H, piperidine CH2), 2.68e2.74 (m, 1H, piperidine
CH), 2.77e2.83 (m, 2H, piperidine CH2), 3.93 (m, 2H, piperidine
CH2), 4.01 (br s, 2H, -N-CH2-isoxazole), 5.14 (s, 2H, -O-CH2-Ar), 6.43
(s, 1H, isoxazole-H), 7.02 (d, J ¼ 8.6 Hz, 2H, AreH), 7.51 (t, J ¼ 7.6 Hz,
1H, AreH), 7.63 (d, J ¼ 7.6 Hz, 1H, AreH), 7.67 (d, J ¼ 7.6 Hz, 1H,
AreH), 7.71 (d, J ¼ 8.6 Hz, 2H, AreH), 7.75 (s, 1H, AreH). 13C NMR
(100 MHz, CDCl3): dC 169.72, 163.52, 159.57, 154.78, 138.07, 131.74,
131.42, 130.68, 129.48, 127.53, 121.09, 118.49, 115.21, 112.92, 97.80,
79.44, 68.74, 54.24, 42.43, 41.90, 32.23, 28.43. HRMS (m/z) [MþH]þ
calcd for C28H33N4O4: 489.2502, found: 489.2508. Anal. Calcd for
(d, JC-F ¼ 252.0 Hz), 137.49 131.93, 131.44, 130.69, 129.57, 129.22,
1
3
3
1
128.57 (d, JC-F ¼ 3.8 Hz), 125.17 (q, JC-F ¼ 3.8 Hz), 124.21 (q, JC-
¼ 270.0 Hz), 118.42, 113.01, 111.21 (d, 4JC-F ¼ 3.2 Hz), 109.57 (d, 2JC-
F
2
4
¼ 12.8 Hz), 103.14 (d, JC-F ¼ 25.0 Hz), 102.39 (d, JC-F ¼ 10.2 Hz),
F
69.07, 62.28, 53.28, 52.90. HRMS (m/z) [MþH]þ calcd for
C
C
30H27F4N4O2: 551.2070, found: 551.2073. Anal. Calcd for
30H26F4N4O2: C, 65.45; H, 4.76; N, 10.18. Found: C, 65.36; H, 4.56;
N, 9.84.
4.1.1.37. 3-((2-Fluoro-4-(3-((4-(4-(trifluoromethyl)benzyl)piperazin-
1-yl)methyl)
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 59.5%; mp 143.2e144.0 ꢂC. IR (ATR)
: 3075, 2935,
isoxazol-5-yl)phenoxy)methyl)benzonitrile
(13d).
C
28H32N4O4ꢃ0.2 CH2Cl2: C, 66.56; H, 6.43; N, 10.99. Found: C, 66.37;
n
H, 6.71; N, 10.89.
2814, 2228, 1624, 1518, 1323, 1285, 1119, 1064, 789 cmꢀ1. 1H NMR
(400 MHz, CDCl3): dH 2.54 (br s, 4H, piperazine), 2.61 (br s, 4H,
piperazine), 3.59 (s, 2H, -N-CH2-Ar), 3.66 (s, 2H, -N-CH2-isoxazole),
5.20 (s, 2H, -O-CH2-Ar), 6.50 (s, 1H, isoxazole-H), 7.04 (t, J ¼ 8.4 Hz,
1H, AreH), 7.44e7.57 (m, 7H, AreH), 7.64 (d, J ¼ 7.6 Hz, 1H, AreH),
7.69 (d, J ¼ 8.0 Hz, 1H, AreH), 7.76 (s, 1H, AreH). 13C NMR (75 MHz,
4.1.1.34. 3-((3-Methyl-4-(3-((4-(4-(trifluoromethyl)benzyl)piper-
azin-1-yl)methyl)isoxazol-5-yl)phenoxy)methyl)benzonitrile (13a).
Purified by flash column chromatography (0%/10% MeOH in
DCM). Yield 32.0%; mp 122.3e123.6 ꢂC. IR (ATR)
n: 3038, 2939, 2817,
2227, 1615, 1320, 1124, 1062, 798 cmꢀ1. 1H NMR (400 MHz, CDCl3):
dH 2.49 (s, 3H, Ar-CH3), 2.58 (br s, 4H, piperazine), 2.66 (br s, 4H,
piperazine), 3.61 (s, 2H, -N-CH2-Ar), 3.71 (s, 2H, -N-CH2-isoxazole),
5.12 (s, 2H, -O-CH2-Ar), 6.42 (s, 1H, isoxazole-H), 6.85e6.88 (m, 2H,
AreH), 7.45e7.52 (m, 3H, AreH), 7.57 (d, J ¼ 8.4 Hz, 2H, AreH), 7.62
(d, J ¼ 7.6 Hz, 1H, AreH), 7.66 (d, J ¼ 8.4 Hz, 2H, AreH), 7.74 (s, 1H,
AreH). 13C NMR (100 MHz, DMSO‑d6): dC 168.71, 161.28, 159.00,
143.29, 138.49, 137.74, 132.40, 131.70, 131.02, 129.74, 129.68, 129.31,
DMSO‑d6): dC 168.14 (d, JC-F ¼ 2.2 Hz), 162.43, 152.18 (d, JC-
4
1
2
¼ 243.7 Hz), 147.84 (d, JC-F ¼ 10.5 Hz), 143.71, 138.31, 133.13,
F
132.48, 131.78, 130.36, 129.82, 128.03 (q, 2JC-F ¼ 30.7 Hz), 125.49 (q,
3JC-F ¼ 3.0 Hz), 124.81 (q, 1JC-F ¼ 270.0 Hz), 122.88 (d, 4JC-F ¼ 3.0 Hz),
120.92 (d, 3JC-F ¼ 7.5 Hz), 119.06, 116.26, 114.05 (d, 2JC-F ¼ 20.2 Hz),
111.99,100.70, 69.60, 61.68, 52.94, 52.89. HRMS (m/z) [MþH]þ calcd
for C30H27F4N4O2: 551.2070, found: 551.2066. Anal. Calcd for
C
30H26F4N4O2: C, 65.45; H, 4.76; N, 10.18. Found: C, 65.36; H, 4.57;
2
3
127.54 (q, JC-F ¼ 31.6 Hz), 124.99 (q, JC-F ¼ 4.1 Hz), 124.32 (q, 1JC-
N, 9.79.
¼ 270.4 Hz), 119.67, 118.62, 117.51, 112.66, 111.45, 102.15, 68.03,
F
61.21, 52.49, 52.44, 21.22. HRMS (m/z) [MþH]þ calcd for
4.1.1.38. 3-((2-Fluoro-4-(3-((4-(furan-2-carbonyl)piperazin-1-yl)
methyl)isoxazol-5-yl)phenoxy)methyl)benzonitrile (14). Purified by
flash column chromatography (0%/ 10% MeOH in DCM). Yield
C
C
31H30F3N4O2: 547.2321, found: 547.2325. Anal. Calcd for
31H29F3N4O2: C, 68.12; H, 5.35; N, 10.25. Found: C, 67.89; H, 5.45;
N, 10.16.
83.0%; mp 129.9e131.2 ꢂC. IR (ATR)
n: 3111, 2941, 2804, 2231, 1604,
1519, 1442, 1285, 1118, 802 cmꢀ1. 1H NMR (400 MHz, CDCl3): dH 2.61
(br s, 4H, piperazine), 3.69 (s, 2H, -N-CH2-isoxazole), 3.84 (br s, 4H,
piperazine), 5.21 (s, 2H, -O-CH2-Ar), 6.47 (dd, J ¼ 3.6, 2.0 Hz, 1H),
6.51 (s, 1H, isoxazole-H), 6.99 (dd, J ¼ 3.6, 0.8 Hz, 1H, AreH), 7.05 (t,
J ¼ 8.4 Hz, 1H, AreH), 7.46 (dd, J ¼ 2.0, 0.8 Hz, 1H, AreH), 7.49e7.55
(m, 3H, AreH), 7.65 (d, J ¼ 7.6 Hz, 1H, AreH), 7.70 (d, J ¼ 8.0 Hz, 1H,
AreH), 7.76 (s, 1H, AreH). 13C NMR (100 MHz, CDCl3): dC 168.65 (d,
4.1.1.35. 3-((2-Methyl-4-(3-((4-(4-(trifluoromethyl)benzyl)piper-
azin-1-yl)methyl) isoxazol-5-yl)phenoxy)methyl)benzonitrile (13b).
Purified by flash column chromatography (0%/10% MeOH in
DCM). Yield 19.0%; mp 124.3e125.0 ꢂC. IR (ATR)
n: 3130, 2937, 2808,
2233, 1617, 1328, 1117, 1055, 806 cmꢀ1. 1H NMR (400 MHz, CDCl3):
dH 2.33 (s, 3H, Ar-CH3), 2.58 (br s, 4H, piperazine), 2.66 (br s, 4H,
piperazine), 3.61 (s, 2H, -N-CH2-Ar), 3.69 (s, 2H, -N-CH2-isoxazole),
5.15 (s, 2H, -O-CH2-Ar), 6.50 (s, 1H, isoxazole-H), 6.88 (d, J ¼ 8.4 Hz,
1H, AreH), 7.46 (d, J ¼ 8.0 Hz, 2H, AreH), 7.52 (t, J ¼ 7.6 Hz, 1H,
AreH), 7.56e7.59 (m, 4H, AreH), 7.64 (d, J ¼ 7.6 Hz, 1H, AreH), 7.68
(d, J ¼ 7.6 Hz, 1H, AreH), 7.75 (s, 1H, AreH). 13C NMR (75 MHz,
DMSO‑d6): dC 169.46, 162.21, 157.98, 143.72, 139.17, 132.62, 132.15,
1
4JC-F ¼ 2.6 Hz), 161.60, 159.01, 152.72 (d, JC-F ¼ 246.8 Hz), 147.87,
2
147.68 (d, JC-F ¼ 10.3 Hz), 143.67, 137.55, 131.96, 131.50, 130.70,
4
3
129.59, 122.22 (d, JC-F ¼ 3.9 Hz), 121.61 (d, JC-F ¼ 7.7 Hz), 118.45,
4
2
116.47, 115.66 (d, JC-F ¼ 2.0 Hz), 114.20 (d, JC-F ¼ 20.5 Hz), 112.96,
111.28, 99.28, 70.04, 53.23, 53.10. HRMS (m/z) [MþH]þ calcd for
C
C
27H24FN4O4: 487.1782, found: 487.1781. Anal. Calcd for
27H23FN4O4: C, 66.66; H, 4.77; N, 11.52. Found: C, 66.72; H, 4.83; N,
2
131.22, 130.28, 129.82, 128.41, 128.03 (q, JC-F ¼ 31.5 Hz), 127.55,
125.48 (q, 3JC-F ¼ 3.7 Hz), 125.24, 124.81 (q, 1JC-F ¼ 270.0 Hz), 120.13,
119.16, 112.55, 111.93, 99.50, 68.60, 61.69, 52.93, 16.50. HRMS (m/z)
[MþH]þ calcd for C31H30F3N4O2: 547.2321, found: 547.2330. Anal.
Calcd for C31H29F3N4O2: C, 68.12; H, 5.35; N, 10.25. Found: C, 68.20;
H, 5.26; N, 10.61.
11.62.
4.1.1.39. 3-((4-(3-(((1-Benzylpiperidin-4-yl)amino)methyl)isoxazol-
5-yl)-2-fluorophenoxy)methyl)benzonitrile (15). Purified by flash
column chromatography (0%/ 10% MeOH in DCM). Yield 68.5%;
mp 78.1e79.5 ꢂC. IR (ATR)
n
: 3323, 3146, 2940, 2808, 2234, 1622,
4.1.1.36. 3-((3-Fluoro-4-(3-((4-(4-(trifluoromethyl)benzyl)piperazin-
1435, 1283, 1131, 1096, 810 cmꢀ1
.
1H NMR (400 MHz, CDCl3): dH
1-yl)methyl)
isoxazol-5-yl)phenoxy)methyl)benzonitrile
(13c).
1.47e1.51 (m, 2H, piperidine CH2), 1.91e1.93 (m, 2H, piperidine
CH2), 2.09 (br s, 2H, piperidine CH2), 2.57 (br s, 1H, piperidine CH),
2.87e2.91 (m, 2H, piperidine CH2), 3.55 (s, 2H, -N-CH2-Ar), 3.91 (s,
2H, -N-CH2-isoxazole), 5.20 (s, 2H, -O-CH2-Ar), 6.44 (s, 1H,
isoxazole-H), 7.04 (t, J ¼ 8.4 Hz, 1H, AreH), 7.26e7.32 (m, 5H,
AreH), 7.47e7.54 (m, 3H, AreH), 7.64 (d, J ¼ 7.0 Hz, 1H, AreH), 7.70
(d, J ¼ 7.6 Hz, 1H, AreH), 7.76 (s, 1H, AreH). 13C NMR (100 MHz,
Purified by flash column chromatography (0%/ 10% MeOH in
DCM). Yield 60.0%; mp 109.7e110.8 ꢂC. IR (ATR)
n: 3044, 2941, 2806,
2234, 1626, 1321, 1166, 1110, 811 cmꢀ1. 1H NMR (400 MHz, CDCl3):
dH 2.51 (br s, 4H, piperazine), 2.58 (br s, 4H, piperazine), 3.57 (s, 2H,
-N-CH2-Ar), 3.67 (s, 2H, -N-CH2-isoxazole), 5.13 (s, 2H, -O-CH2-Ar),
6.62 (d, J ¼ 4.0 Hz,1H, isoxazole-H), 6.78 (dd, J ¼ 12.8 Hz, 2.4 Hz, 1H,
17

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
CDCl3): dC 168.35, 164.14, 152.72 (d, 1JC-F ¼ 246.2 Hz), 147.59 (d, 3JC-
4.2.4. Cell cycle analysis with flow cytometry
Mahlavu, SNU-475, Huh7, and HepG2 cells were cultured onto
100 mm dishes. After 24 h, cells were treated with 5 M compound
6a, compound 13d and, DMSO as a negative control. At the end of
the 48 h and 72 h treatment period, cells were fixed with ice-cold
70% (v/v) EtOH for 3 h at ꢀ20 ꢂC. Cell cycle analysis was carried
out by PI (Propidium Iodide) staining using flow cytometry ac-
cording to the Muse™ cell cycle kit manufacturer's recommenda-
tions (Millipore, MCH1000106). Analysis of cells were done using
Novocyte Flow Cytometer (ACEA).
¼ 10.9 Hz), 138.53, 137.60, 131.96, 130.71, 131.50, 129.59, 129.09,
F
4
3
128.16, 126.93, 122.18 (d, JC-F ¼ 3.2 Hz), 121.81 (d, JC-F ¼ 7.1 Hz),
m
4
2
118.46, 115.65 (d, JC-F ¼ 1.9 Hz), 114.18 (d, JC-F ¼ 20.5 Hz), 112.97,
98.74, 70.06, 63.06, 54.41, 52.26, 42.01, 32.63. HRMS (m/z) [MþH]þ
calcd for C30H30FN4O2: 497.2353, found: 497.2352. Anal. Calcd for
C
30H29FN4O2: C, 72.56; H, 5.89; N, 11.28. Found: C, 73.00; H, 5.60; N,
11.57.
4.2. Biological studies
4.2.5. Cell death analysis with flow cytometry
Mahlavu, SNU-475, Huh7, and HepG2 cells were cultured onto
100 mm dishes. After 24 h, cells were treated with 5 mM compound
6a and compound 13d by keeping DMSO as a negative control. At
the end of the 48 h and 72 h treatment period, cells were also
collected for programmed cell death Annexin V assay to be stained
with PI and Annexin V (Roche, #11858 777 001) dyes and incubated
for 15 min at room temperature in dark prior to analysis by flow
cytometry.
4.2.1. Cell Culture
Mahlavu (mesenchymal), Huh7, and HepG2 (epithelial) human
hepatocellular carcinoma (HCC) cells and MCF-7 (epithelial) human
breast cancer carcinoma cells were maintained in Dulbecco's
Modified Eagles Medium (DMEM) supplemented with 10% fetal
bovine serum (FBS) (Gibco/Thermo Fisher Scientific) and 0.1 mM
non-essential amino acid (Gibco/Thermo Fisher Scientific), while
SNU-475 cells were cultured in RPMI (Gibco/Thermo Fisher Scien-
tific) supplemented with 10% fetal bovine serum (FBS) (Gibco/
Thermo Fisher Scientific) and 2 mM L-Glutamine (Gibco/Thermo
Fisher Scientific). Growth mediums contained 100 Units/mL Peni-
cillin/Streptomycin. Cells were maintained in 37 ꢂC in a humidified
incubator under %5 CO2.
4.2.6. Immunofluorescence staining for detection of cell death
Mahlavu and SNU-475 (30.000 cell/well), Huh7 (60.000 cell/
well), and HepG2 (100.000 cell/well), cells were seeded onto cover
slides for 24 h. Cells were treated with compound 6a, compound
13d or DMSO as a control for 24 h, 48 h, and 72 h. Then, cells were
washed with 1X PBS three times and fixed with 100% ice-cold
4.2.2. NCI-60 sulforhodamine B (SRB) cytotoxicity assay
Mahlavu, SNU-475, Huh7, HepG2 and MCF-7 cells were inocu-
lated in 96-well plates and were grown in an incubator for 24 h. The
cells were treated with compound 6a, compound 13d, and DMSO
methanol to be stained with 1
mg/ml Hoechst (#33258, Sigma).
Nuclei of cells were imaged under fluorescent microscopy for nu-
clear fragmentation.
(Sigma) control in a concentration range starting from 40
mM to
0.6 M. After 72 h of treatment, the cells were fixed with cold 10%
(w/v) trichloroacetic acid (MERCK) for an hour, washed with
ddH2O, and left for drying. The proteins were stained by incubating
m
4.2.7. Western blotting
Cells were treated for 72 h with 5
mM of compound 6a and
compound 13d or DMSO as a control. Cells were collected with a
scraper and total lysates were prepared. Protein concentrations
were calculated with Bradford assay. The levels of proteins were
examined by using protein electrophoresis according to the man-
ufacturer's protocol for Western blot analysis (Mini-PROTEAN®
Tetra Cell Systems, Bio-Rad). The compound treated samples were
the plates with sulforhodamine B (SRB) dye solution (Sigma) (50 ml
of a 0.4% (w/v) of SRB in 1% acetic acid (Sigma)) at RT for 10 min. To
get rid of unbound SRB dye, the plates were washed with 1% acetic
acid for three times and left to air-drying. The protein-bound SRB
dye was solubilized using 100 ml/well 10 mM Tris-Base solution,
and their absorbances were measured with 96-well plate reader at
515 nm wavelength (ELx800, BioTek). To check the reproducibility
of the data, all experiments were performed in triplicates and
DMSO was used as a control for treatment. IC50 values were
calculated and only data with R2 values larger than 0.9 are
considered as significant.
loaded onto TGX™ precast gels (20e40 mg/well) and proteins were
transferred to an LF-PVDF membrane using the Trans-Blot Turbo
Transfer System (Bio-Rad) Primary antibodies; phospho-Akt
(Ser473) (CST, #9271L), Akt (CST, #9272), Erk ½ (CST, #9107S),
phospho-Erk 1/2 (Thr202/Tyr204) (CST, 9106S), p53 (Millipore,
#05e224), phospho-p53 (Ser15) (CST, #9286S), acetyl-p53
(Lys382) (CST, #2525S), p21/Waf1, Cip1 (CST, #2946),c-Myc (Santa
Cruz, #sc42), Calnexin (CST, #2679)) and secondary antibodies
(IRDye 680RD Goat Anti Mouse (Li-cor, # 92668070), IRDye-
800CW Goat Anti Rabbit (Licor, # 926e32211)) were used for
immunoblotting, and the proteins were visualized fluorescently
using Odyssey CLx- LICOR imaging system [76].
4.2.3. Real-time cell growth surveillance by electronic sensing (RT-
CES)
To monitor the cell growth of cells and cytotoxicity of compound
6a and compound 13d, the real-time cell growth system (xCelli-
gence, Roche Applied Sciences) was used. The cells were plated
onto 96-well E-plate (Mahlavu and SNU-475: 1000 cell/well,
Huh7:2500 cell/well, HepG2:3500 cell/well) in 100
dium/well. To check the proliferation of the cells, the cellular
growth was measured as cell index (CI) every 30 min for 24 h. After
m
l of the me-
4.2.8. Flow cytometry analysis for detection of cancer cell stemness
markers
Mahlavu (100.000 cells/plate) and Huh7 (200.000 cells/plate)
treatment with the compounds in 2.5, 5 and 10 mM concentrations,
cells were cultured into 100 mm2 culture plates. After 24 h incu-
the CI values were recorded every 10 min for 24 h (fast drug
response) and then every 30 min for the remaining time (long-term
drug response). The inhibitory effects of compound 6a and 13d in
response to DMSO controls were analyzed by calculating CIcom-
pound/CI DMSO. To check the reproducibility of the data, all experi-
ments were performed in triplicates [34]. Quantitative analysis of
RT-CES results for compounds’ cytotoxicity doses were also sum-
bation, cells were treated with 10 mM Sorafenib, FDA-approved
drug for HCC, DAPT (Notch inhibitor) as a positive control, com-
pound 6a, compound 13d or DMSO as a negative control for 72 h
incubation. All staining procedures and analysis of cells were per-
formed as previously described [9]. Briefly, the plates were washed
with 1X PBS to remove dead cells and remained attached cells were
collected into tubes to be fixed with 4% paraformaldehyde for
25 min at RT. For anti-CD133 and EpCAM staining in Huh7 cells,
cells were washed with FACS buffer and stained using PE anti-
marized in Table S1. If the IC50 value is larger than 10
mM or less
than 2.5 M, it is shown as >10 or <2.5 in table, respectively.
m
18

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
human CD133 (Biolegend, #372804), FITC anti-human CD326
(EpCAM) (Immunostep, #326F-100T) and with their isotype con-
trols PE-Mouse-IgG1 Isotype Control (Immunostep, #ICIGG1PE-50)
and FITC-Mouse-IgG1 Isotype Control (Immunostep, #ICIGG1F-
100). The similar staining protocol was performed for analysis of
HCC cells to detect OCT4 (Alexa Fluor® 488 Mouse anti-Oct3/4, BD
Pharmingen, #560253) and NANOG (Alexa Fluor® 647 Mouse anti-
Mouse NANOG, BD Pharmingen, #560279) and cancer stemness
markers. The 90% (v/v) ice-cold methanol was used to incubate cells
before antibody blocking for the detection of stemness marker
expressions permeabilization of cells. The stained cells were incu-
bated for 40 min at RT in dark. After staining, the cells were washed
with FACS buffer and analyzed using the Novocyte flow cytometer
(ACEA Biosciences).
appeared to influence the work reported in this paper.
Acknowledgements
This study was supported by The Scientific and Technological
Research Council of Turkey (TUBITAK Project No. 214S062).
Appendix A. Supplementary data
Supplementary data to this article can be found online at
https://doi.org/10.1016/j.ejmech.2021.113489.
References
[1] D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation, Cell 144
(2011) 646e674.
4.2.9. Sphere formation assay
Sphere formation assay was performed as previously described
[9]. Briefly, Huh7 (200.000 cells/plate) cells were inoculated into
[2] T.A. Wallace, D.N. Martin, S. Ambs, Interactions among genes, tumor biology
and the environment in cancer health disparities: examining the evidence on
a national and global scale, Carcinogenesis 32 (2011) 1107e1121.
[3] G. Baffy, E.M. Brunt, S.H. Caldwell, Hepatocellular carcinoma in non-alcoholic
fatty liver disease: an emerging menace, J. Hepatol. 56 (2012) 1384e1391.
[4] B.W. Stewart, C.P. Wild, reportWorld Cancer Report, Lyon, 2014.
[5] B. Sun, M. Karin, Obesity, inflammation, and liver cancer, J. Hepatol. 56 (2012)
704e713.
[6] H. Unsal, C. Yakicier, C. Marcais, M. Kew, M. Volkmann, H. Zentgraf,
K.J. Isselbacher, M. Ozturk, Genetic heterogeneity of hepatocellular carcinoma,
Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 822e826.
[7] E.M.F. De Sousa, L. Vermeulen, E. Fessler, J.P. Medema, Cancer heterogeneity–a
multifaceted view, EMBO Rep. 14 (2013) 686e695.
100 mm2 culture plates. After 24 h, cells were treated with 10
mM
Sorafenib, DAPT, compound 6a, compound 13d, and DMSO for 72h.
The plates were washed with 1X PBS to remove non-attached dead
cells. The collected cells were inoculated into ultra-low attachment
96-well plates using sphere formation medium for 14 days. Spheres
were imaged under light microscopy and sphere size and count
measurements were done using the ZEN Blue microscopy software.
[8] A.K. Chow, L. Ng, C.S. Lam, S.K. Wong, T.M. Wan, N.S. Cheng, T.C. Yau, R.T. Poon,
R.W. Pang, The Enhanced metastatic potential of hepatocellular carcinoma
(HCC) cells with sorafenib resistance, PloS One 8 (2013), e78675.
[9] D.C. Kahraman, G. Hanquet, L. Jeanmart, S. Lanners, P. Sramel, A. Bohac,
R. Cetin-Atalay, Quinoides and VEGFR2 TKIs influence the fate of hepatocel-
lular carcinoma and its cancer stem cells, MedChemComm 8 (2017) 81e87.
[10] H.W. Xin, C.M. Ambe, D.M. Hari, G.W. Wiegand, T.C. Miller, J.Q. Chen,
A.J. Anderson, S. Ray, J.E. Mullinax, T. Koizumi, R.C. Langan, D. Burka,
M.A. Herrmann, P.K. Goldsmith, A. Stojadinovic, U. Rudloff, S.S. Thorgeirsson,
I. Avital, Label-retaining liver cancer cells are relatively resistant to sorafenib,
Gut 62 (2013) 1777e1786.
[11] S. Hoelder, P.A. Clarke, P. Workman, Discovery of small molecule cancer
drugs: successes, challenges and opportunities, Mol. Oncol. 6 (2012) 155e176.
[12] V. Lavanya, A.A. Mohammed Adil, A. Neesar, A.K. Rishi, J. Shazia, Small
molecule inhibitors as emerging cancer therapeutics, Integr. Cancer Sci.
Therap. 1 (2014) 39e46.
[13] A. Sysak, B. Obminska-Mrukowicz, Isoxazole ring as a useful scaffold in a
search for new therapeutic agents, Eur. J. Med. Chem. 137 (2017) 292e309.
[14] S.A. Eccles, A. Massey, F.I. Raynaud, S.Y. Sharp, G. Box, M. Valenti, L. Patterson,
A. de Haven Brandon, S. Gowan, F. Boxall, W. Aherne, M. Rowlands, A. Hayes,
V. Martins, F. Urban, K. Boxall, C. Prodromou, L. Pearl, K. James, T.P. Matthews,
K.M. Cheung, A. Kalusa, K. Jones, E. McDonald, X. Barril, P.A. Brough,
J.E. Cansfield, B. Dymock, M.J. Drysdale, H. Finch, R. Howes, R.E. Hubbard,
A. Surgenor, P. Webb, M. Wood, L. Wright, P. Workman, NVP-AUY922: a novel
heat shock protein 90 inhibitor active against xenograft tumor growth,
angiogenesis, and metastasis, Canc. Res. 68 (2008) 2850e2860.
[15] E. Felip, F. Barlesi, B. Besse, Q. Chu, L. Gandhi, S.W. Kim, E. Carcereny,
L.V. Sequist, P. Brunsvig, C. Chouaid, E.F. Smit, H.J.M. Groen, D.W. Kim, K. Park,
E. Avsar, S. Szpakowski, M. Akimov, E.B. Garon, Brief report: phase 2 study of
the HSP-90 inhibitor AUY922 in previously treated and molecularly defined
patients with advanced non-small cell lung cancer, J. Thorac. Oncol. 13 (4)
(2017) 576e584.
4.2.10. Quantitative RT-PCR (qRT-PCR)
After total RNA isolation using the RNeasy RNA-purification kit
(Qiagen), cDNA synthesis was performed using the RevertAid First
Strand cDNA synthesis kit (Thermo Scientific). The specific stem-
ness markers' and GAPDH as an internal control gene primer se-
quences used for qRT-PCR are; OCT4 forward primer: 50
CGGAGGAGTCCCAGGACATCAA 30, OCT4 reverse primer: 50 AAA-
TAGAACCCCCAGGGTGAGC 30, NANOG forward primer: 50 TACCT-
CAGCCTCCAGCAGATG
30,
NANOG
reverse
primer:
50
TCTTCGGCCAGTTGTTTTTCTG 30, and GAPDH forward primer: 50
TATGACAACGAATTTGGCTAC 30, GAPDH reverse primer: 50
TCTCTCTTCCTCTTGTGCTCT 3’ and detailed information was shown
in Table S3. Quantitative PCR was done using Light Cycler ® 480
SYBR Green I Master (Roche) following steps: preincubation at
95 ꢂC for 10 min, amplification for 45 cycles (95 ꢂC 10 s followed by
60 ꢂC 10 s and 72 ꢂC 10 s) and melting at 95 ꢂC 10 s followed by 65 ꢂC
for 60 s and 97 ꢂC for 1 s (Table S4). The experimental cycle
threshold (Ct) was adjusted against GAPDH control product. All
amplifications were performed in triplicates. The DDCt method was
exhibited to determine the amount of target gene in compound
treated cells relative to that expressed by control (DMSO) treated
cells.
4.3. Statistical analysis
[16] C. Zhang, M. Chu, Leflunomide: a promising drug with good antitumor po-
tential, Biochem. Biophys. Res. Commun. 496 (2) (2018) 726e730.
[17] P. Bamborough, H. Diallo, J.D. Goodacre, L. Gordon, A. Lewis, J.T. Seal,
D.M. Wilson, M.D. Woodrow, C.W. Chung, Fragment-based discovery of bro-
modomain inhibitors part 2: optimization of phenylisoxazole sulfonamides,
J. Med. Chem. 55 (2012) 587e596.
[18] C.W. Chung, A.W. Dean, J.M. Woolven, P. Bamborough, Fragment-based dis-
covery of bromodomain inhibitors part 1: inhibitor binding modes and im-
plications for lead discovery, J. Med. Chem. 55 (2012) 576e586.
[19] D.S. Hewings, O. Fedorov, P. Filippakopoulos, S. Martin, S. Picaud, A. Tumber,
C. Wells, M.M. Olcina, K. Freeman, A. Gill, A.J. Ritchie, D.W. Sheppard,
A.J. Russell, E.M. Hammond, S. Knapp, P.E. Brennan, S.J. Conway, Optimization
of 3,5-dimethylisoxazole derivatives as potent bromodomain ligands, J. Med.
Chem. 56 (2013) 3217e3227.
In this study, all data were accessed from three independent
experiments and standard deviation (S.D) values were determined
accordingly. Student's t-tests were applied using Graphpad (Prism)
for statistical analysis. The mean of the fluorescence intensity was
used for flow cytometry analysis of cancer stemness markers and
results were provided in Figure S1. All experiments were performed
with n ꢄ 3 biological replicates. Statistically significant results were
shown as follows: ns: not significant, *p < 0.05, **p < 0.01,
***p < 0.001 and ****p < 0.0001.
[20] D.S. Hewings, M. Wang, M. Philpott, O. Fedorov, S. Uttarkar,
P. Filippakopoulos, S. Picaud, C. Vuppusetty, B. Marsden, S. Knapp, S.J. Conway,
T.D. Heightman, 3,5-dimethylisoxazoles act as acetyl-lysine-mimetic bromo-
domain ligands, J. Med. Chem. 54 (2011) 6761e6770.
Declaration of competing interest
The authors declare that they have no known competing
financial interests or personal relationships that could have
[21] M.K. Akkoc, M.Y. Yuksel, I. Durmaz, R.C. Atalay, Design, synthesis, and
19

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
biological evaluation of indole-based 1,4-disubstituted piperazines as cyto-
toxic agents, Turk. J. Chem. 36 (2012) 515e525.
tumor suppressor gene in normal and malignant ovarian epithelial cells, Clin.
Canc. Res. 2 (9) (1996) 1571e1575.
[22] Z.W. Mao, X. Zheng, Y. Qi, M.D. Zhang, Y. Huang, C.P. Wan, G.X. Rao, Synthesis
and biological evaluation of novel hybrid compounds between chalcone and
piperazine as potential antitumor agents, RSC Adv. 6 (2016) 7723e7727.
[23] A.M. Saab, M. Dobmeier, B. Koenig, E. Fabri, A. Finotti, M. Borgatti,
I. Lampronti, F. Bernardi, T. Efferth, R. Gambari, Antiproliferative and erythroid
differentiation of piperazine and triphenyl derivatives against k-562 human
chronic myelogenous leukemia, Anticancer Res. 33 (2013) 3027e3032.
[24] M. Tuncbilek, E.B. Guven, T. Onder, R. Cetin Atalay, Synthesis of novel 6-(4-
substituted piperazine-1-yl)-9-(beta-D-ribofuranosyl)purine derivatives,
which lead to senescence-induced cell death in liver cancer cells, J. Med.
Chem. 55 (2012) 3058e3065.
[25] A.M. Waszkielewicz, A. Gunia, N. Szkaradek, K. Pytka, A. Siwek, G. Satala,
A.J. Bojarski, E. Szneler, H. Marona, Synthesis and evaluation of pharmaco-
logical properties of some new xanthone derivatives with piperazine moiety,
Bioorg. Med. Chem. Lett 23 (2013) 4419e4423.
[26] Y. Hori, K. Ishii, H. Kanda, Y. Iwamoto, K. Nishikawa, N. Soga, H. Kise, K. Arima,
Y. Sugimura, Naftopidil, a selective {alpha}1-adrenoceptor antagonist, sup-
presses human prostate tumor growth by altering interactions between tu-
mor cells and stroma, Cancer Prev. Res. 4 (2011) 87e96.
[27] H. Kanda, K. Ishii, Y. Ogura, T. Imamura, M. Kanai, K. Arima, Y. Sugimura,
Naftopidil, a selective alpha-1 adrenoceptor antagonist, inhibits growth of
human prostate cancer cells by G1 cell cycle arrest, Int. J. Cancer 122 (2008)
444e451.
[28] H. Chen, X. Liang, F. Xu, B. Xu, X. He, B. Huang, M. Yuan, Synthesis and
cytotoxic activity evaluation of novel arylpiperazine derivatives on human
prostate cancer cell lines, Molecules 19 (2014) 12048e12064.
[29] H. Chen, B.B. Xu, T. Sun, Z. Zhou, H.Y. Ya, M. Yuan, Synthesis and antitumor
activity of novel arylpiperazine derivatives containing the saccharin moiety,
Molecules 22 (2017).
[30] H. Chen, F. Xu, X. Liang, B.B. Xu, Z.L. Yang, X.L. He, B.Y. Huang, M. Yuan, Design,
synthesis and biological evaluation of novel arylpiperazine derivatives on
human prostate cancer cell lines, Bioorg. Med. Chem. Lett 25 (2015) 285e287.
[31] E.H. Cho, S.G. Chung, S.H. Lee, H.S. Kwon, J.E. Lee, D.W. Kang, J.H. Joo, Y.H. Lee,
Piperazine Derivatives and Process for the Preparation Thereof, in,
WO1998000402 A1, 1998.
[48] H. Zhao, F. Traganos, Z. Darzynkiewicz, Phosphorylation of p53 on Ser15
during cell cycle caused by Topo I and Topo II inhibitors in relation to ATM
and Chk2 activation, Cell Cycle 7 (2008) 3048e3055.
[49] H. Yamaguchi, N.T. Woods, L.G. Piluso, H.H. Lee, J. Chen, K.N. Bhalla,
A. Monteiro, X. Liu, M.C. Hung, H.G. Wang, p53 acetylation is crucial for its
transcription-independent proapoptotic functions, J. Biol. Chem. 284 (2009)
11171e11183.
[50] K. Han, C. Li, X. Zhang, L. Shang, DUXAP10 inhibition attenuates the prolif-
eration and metastasis of hepatocellular carcinoma cells by regulation of the
Wnt/beta-catenin and PI3K/Akt signaling pathways, Biosci. Rep. 39 (2019).
[51] J.S. Liu, C.Y. Huo, H.H. Cao, C.L. Fan, J.Y. Hu, L.J. Deng, Z.B. Lu, H.Y. Yang, L.Z. Yu,
Z.X. Mo, Z.L. Yu, Aloperine induces apoptosis and G2/M cell cycle arrest in
hepatocellular carcinoma cells through the PI3K/Akt signaling pathway,
Phytomedicine 61 (2019) 152843.
[52] X. Sun, M. Wang, F. Zhang, X. Kong, Inhibition of NET-1 suppresses prolifer-
ation and promotes apoptosis of hepatocellular carcinoma cells by activating
the PI3K/AKT signaling pathway, Exp. Ther. Med. 17 (2019) 2334e2340.
[53] X. Wang, K. Dong, Q. Jin, Y. Ma, S. Yin, S. Wang, Upregulation of lncRNA
FER1L4 suppresses the proliferation and migration of the hepatocellular car-
cinoma via regulating PI3K/AKT signal pathway, J. Cell. Biochem. 120 (2019)
6781e6788.
[54] P. Zhu, Z. Liu, J. Zhou, Y. Chen, Tanshinol inhibits the growth, migration and
invasion of hepatocellular carcinoma cells via regulating the PI3K-AKT
signaling pathway, OncoTargets Ther. 12 (2019) 87e99.
[55] V. Nogueira, Y. Park, C.C. Chen, P.Z. Xu, M.L. Chen, I. Tonic, T. Unterman,
N. Hay, Akt determines replicative senescence and oxidative or oncogenic
premature senescence and sensitizes cells to oxidative apoptosis, Canc. Cell 14
(2008) 458e470.
[56] G. Augello, R. Puleio, M.R. Emma, A. Cusimano, G.R. Loria, J.A. McCubrey,
G. Montalto, M. Cervello, A PTEN inhibitor displays preclinical activity against
hepatocarcinoma cells, Cell Cycle 15 (2016) 573e583.
[57] F. Buontempo, T. Ersahin, S. Missiroli, S. Senturk, D. Etro, M. Ozturk,
S. Capitani, R. Cetin-Atalay, M.L. Neri, Inhibition of Akt signaling in hepatoma
cells induces apoptotic cell death independent of Akt activation status, Invest.
N. Drugs 29 (2011) 1303e1313.
[32] J.H. Lee, D.W. Kang, H.S. Kwon, S.H. Lee, S.K. Park, S.G. Chung, E.H. Cho,
S.Y. Paik, J.H. Lee, Microtubule inhibitory effects of various SJ compounds on
tissue culture cells, Arch Pharm. Res. (Seoul) 27 (2004) 436e441.
[33] A.K. Rathi, R. Syed, H.S. Shin, R.V. Patel, Piperazine derivatives for therapeutic
[58] D.M. Miller, S.D. Thomas, A. Islam, D. Muench, K. Sedoris, c-Myc and cancer
metabolism, Clin. Canc. Res. 18 (2012) 5546e5553.
[59] H.F. Zhang, C. Wu, A. Alshareef, N. Gupta, Q. Zhao, X.E. Xu, J.W. Jiao, E.M. Li,
L.Y. Xu, R. Lai, The PI3K/AKT/c-MYC Axis promotes the acquisition of cancer
stem-like features in esophageal squamous cell carcinoma, Stem Cell. 34
(2016) 2040e2051.
use:
a patent review (2010-present), Expert Opin. Ther. Pat. 26 (2016)
777e797.
[34] B. Caliskan, E. Sinoplu, K. Ibis, E. Akhan Guzelcan, R. Cetin Atalay, E. Banoglu,
Synthesis and cellular bioactivities of novel isoxazole derivatives incorpo-
rating an arylpiperazine moiety as anticancer agents, J. Enzym. Inhib. Med.
Chem. 33 (2018) 1352e1361.
[35] O. Akbulut, D. Lengerli, O. Saatci, E. Duman, U.O.S. Seker, A. Isik, A. Akyol,
B. Caliskan, E. Banoglu, O. Sahin, A highly potent TACC3 inhibitor as a novel
anticancer drug candidate, Mol. Canc. Therapeut. 19 (2020) 1243e1254.
[36] S.N. Baytas, N. Inceler, A. Yilmaz, A. Olgac, S. Menevse, E. Banoglu, E. Hamel,
R. Bortolozzi, G. Viola, Synthesis, biological evaluation and molecular docking
[60] M.A. Chetram, C.V. Hinton, PTEN regulation of ERK1/2 signaling in cancer,
J. Recept. Signal Transduct. Res. 32 (2012) 190e195.
[61] J. Gu, M. Tamura, K.M. Yamada, Tumor suppressor PTEN inhibits integrin- and
growth factor-mediated mitogen-activated protein (MAP) kinase signaling
pathways, J. Cell Biol. 143 (1998) 1375e1383.
[62] H. Chen, G. Zhu, Y. Li, R.N. Padia, Z. Dong, Z.K. Pan, K. Liu, S. Huang, Extra-
cellular signal-regulated kinase signaling pathway regulates breast cancer cell
migration by maintaining slug expression, Can. Res. 69 (2009) 9228e9235.
[63] C.A. O'Brien, A. Pollett, S. Gallinger, J.E. Dick, A human colon cancer cell
capable of initiating tumour growth in immunodeficient mice, Nature 445
(2007) 106e110.
studies of trans-indole-3-acrylamide derivatives,
a new class of tubulin
polymerization inhibitors, Bioorg. Med. Chem. 22 (2014) 3096e3104.
[37] B. Caliskan, A. Yilmaz, I. Evren, S. Menevse, O. Uludag, E. Banoglu, Synthesis
and evaluation of analgesic, anti-inflammatory, and anticancer activities of
new pyrazole-3(5)-carboxylic acid derivatives, Med. Chem. Res. 22 (2013)
782e793.
[64] X. Zhang, R. Hua, X. Wang, M. Huang, L. Gan, Z. Wu, J. Zhang, H. Wang,
Y. Cheng, J. Li, W. Guo, Identification of stem-like cells and clinical significance
of candidate stem cell markers in gastric cancer, Oncotarget
7 (2016)
9815e9831.
[38] S. Cankara Pirol, B. Caliskan, I. Durmaz, R. Atalay, E. Banoglu, Synthesis and
preliminary mechanistic evaluation of 5-(p-tolyl)-1-(quinolin-2-yl)pyrazole-
3-carboxylic acid amides with potent antiproliferative activity on human
cancer cell lines, Eur. J. Med. Chem. 87 (2014) 140e149.
[39] P. Skehan, R. Storeng, D. Scudiero, A. Monks, J. McMahon, D. Vistica,
J.T. Warren, H. Bokesch, S. Kenney, M.R. Boyd, New colorimetric cytotoxicity
assay for anticancer-drug screening, J. Natl. Cancer Inst. 82 (1990) 1107e1112.
[40] K. Solly, X. Wang, X. Xu, B. Strulovici, W. Zheng, Application of real-time cell
electronic sensing (RT-CES) technology to cell-based assays, Assay Drug Dev.
Technol. 2 (2004) 363e372.
[41] J. Chen, The cell-cycle arrest and apoptotic functions of p53 in tumor initiation
and progression, Cold Spring Harb Perspect Med 6 (2016) a026104.
[42] W.S. el-Deiry, T. Tokino, V.E. Velculescu, D.B. Levy, R. Parsons, J.M. Trent,
D. Lin, W.E. Mercer, K.W. Kinzler, B. Vogelstein, WAF1, a potential mediator of
p53 tumor suppression, Cell 75 (1993) 817e825.
[43] J.W. Harper, G.R. Adami, N. Wei, K. Keyomarsi, S.J. Elledge, The p21 Cdk-
interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent ki-
nases, Cell 75 (1993) 805e816.
[65] K. Nio, T. Yamashita, S. Kaneko, The evolving concept of liver cancer stem cells,
Mol. Canc. 16 (2017) 4.
[66] D.C. Kahraman, T. Kahraman, R. Cetin-Atalay, Targeting PI3K/Akt/mTOR
pathway identifies differential expression and functional role of IL8 in liver
cancer stem cell enrichment, Mol. Canc. Therapeut. 18 (2019) 2146e2157.
[67] A. Rizzino, Concise review: the Sox2-Oct4 connection: critical players in a
much larger interdependent network integrated at multiple levels, Stem Cell.
31 (2013) 1033e1039.
[68] J. Shan, J. Shen, L. Liu, F. Xia, C. Xu, G. Duan, Y. Xu, Q. Ma, Z. Yang, Q. Zhang,
L. Ma, J. Liu, S. Xu, X. Yan, P. Bie, Y. Cui, X.W. Bian, C. Qian, Nanog regulates
self-renewal of cancer stem cells through the insulin-like growth factor
pathway in human hepatocellular carcinoma, Hepatology 56 (2012)
1004e1014.
[69] J.U. Marquardt, P.R. Galle, A. Teufel, Molecular diagnosis and therapy of he-
patocellular carcinoma (HCC): an emerging field for advanced technologies,
J. Hepatol. 56 (2012) 267e275.
[70] N. Gawlik-Rzemieniewska, I. Bednarek, The role of NANOG transcriptional
factor in the development of malignant phenotype of cancer cells, Canc. Biol.
Ther. 17 (2016) 1e10.
[71] H.L. Liu, H.T. Tang, H.L. Yang, T.T. Deng, Y.P. Xu, S.Q. Xu, L. Peng, Z. Wang,
Q. Fang, X.Y. Kuang, Q.S. Li, Oct4 regulates the transition of cancer stem-like
cells to tumor endothelial-like cells in human liver cancer, Front. Cell Dev.
Biol. 8 (2020) 563316.
[72] X.Q. Wang, W.M. Ongkeko, L. Chen, Z.F. Yang, P. Lu, K.K. Chen, J.P. Lopez,
R.T. Poon, S.T. Fan, Octamer 4 (Oct4) mediates chemotherapeutic drug resis-
tance in liver cancer cells through a potential Oct4-AKT-ATP-binding cassette
G2 pathway, Hepatology 52 (2010) 528e539.
[44] V.S. Romanov, K.L. Rudolph, p21 shapes cancer evolution, Nat. Cell Biol. 18
(2016) 722e724.
[45] B. Bhardwaj, G. Bhardwaj, J.Y. Lau, Expression of p21 and p27 in hepatoma cell
lines with different p53 gene profile, J. Hepatol. 31 (1999) 386.
[46] M.S. Kang, H.J. Lee, J.H. Lee, J.L. Ku, K.P. Lee, M.J. Kelley, Y.J. Won, S.T. Kim,
J.G. Park, Mutation of p53 gene in hepatocellular carcinoma cell lines with
HBX DNA, Int. J. Cancer 67 (1996) 898e902.
[47] A.A. Elbendary, F.D. Cirisano, A.C. Evans, P.L. Davis, J.D. Iglehart, J.R. Marks,
A. Berchuck, Relationship between p21 expression and mutation of the p53
20

_
K. Ibis¸, E. Nalbat, B. Çalıs¸kan et al.
European Journal of Medicinal Chemistry 221 (2021) 113489
[73] C.R. Jeter, M. Badeaux, G. Choy, D. Chandra, L. Patrawala, C. Liu, T. Calhoun-
Davis, H. Zaehres, G.Q. Daley, D.G. Tang, Functional evidence that the self-
renewal gene NANOG regulates human tumor development, Stem Cell. 27
(2009) 993e1005.
[74] K. Zhang, M. Fowler, J. Glass, H. Yin, Activated 5'flanking region of NANOGP8
in a self-renewal environment is associated with increased sphere formation
and tumor growth of prostate cancer cells, Prostate 74 (2014) 381e394.
[75] H.F. Bahmad, K. Cheaito, R.M. Chalhoub, O. Hadadeh, A. Monzer, F. Ballout,
A. El-Hajj, D. Mukherji, Y.N. Liu, G. Daoud, W. Abou-Kheir, Sphere-formation
assay: three-dimensional in vitro culturing of prostate cancer stem/progenitor
sphere-forming cells, Front. Oncol. 8 (2018) 347.
[76] A.S. Rifaioglu, E. Nalbat, V. Atalay, M.J. Martin, R. Cetin-Atalay, T. Dogan,
DEEPScreen: high performance drug-target interaction prediction with con-
volutional neural networks using 2-D structural compound representations,
Chem. Sci. 11 (2020) 2531e2557.
21