Cloning and functional characterization of a chalcone isomerase from trigonella foenum-graecum L

Article abstract of DOI:10.1055/s-0030-1250566

Flavonoids belong to a group of plant natural products with variable phenolic structures and play important roles in protection against biotic and abiotic stress. Fenugreek (Trigonella foenum-graecum L.) seeds and stems contain flavonol glycosides and isoflavone derivatives. Up to now, the molecular features of fenugreek flavonoid biosynthesis have not been characterized. Here we present cloning of a cDNA encoding a chalcone isomerase (namely TFGCHI1) from the leaves of T. foenum-graecum which convert chalcones to flavanones in vitro. Transformation of Arabidopsis loss-of-function tt5 (chi) mutant with a TFGCHI1 cDNA complemented tt5 and produced higher levels of flavonol glycosides than wild-type Col-0. Georg Thieme Verlag KG Stuttgart · New York.

Full text of DOI:10.1055/s-0030-1250566

Original Papers 765
Cloning and Functional Characterization
of a Chalcone Isomerase from
Trigonella foenum-graecum L.
1
1
2
1
1
3
1,2
Authors
Jian-chun Qin *, Lin Zhu *, Ming-jun Gao , Xian Wu , Hong-yu Pan , Yan-sheng Zhang , Xiang Li
1
Affiliations
College of Plant Science, Jilin University, Changchun, China
Saskatoon Research Center, Agriculture and Agri-food Canada, Saskatoon, Canada
Wuhan Botanical Garden, Chinese Acedamy of Science, Wuhan, China
2
3
Key words
Abstract
flavanones in vitro. Transformation of Arabidopsis
loss-of-function tt5 (chi) mutant with a TFGCHI‑1
cDNA complemented tt5 and produced higher
levels of flavonol glycosides than wild-type Col-0.
"
l Trigonella foenum‑graecum L.
!
"
l Leguminosae
Flavonoids belong to a group of plant natural
products with variable phenolic structures and
play important roles in protection against biotic
and abiotic stress. Fenugreek (Trigonella foenum-
graecum L.) seeds and stems contain flavonol gly-
cosides and isoflavone derivatives. Up to now, the
molecular features of fenugreek flavonoid biosyn-
thesis have not been characterized. Here we
present cloning of a cDNA encoding a chalcone
isomerase (namely TFGCHI‑1) from the leaves of
T. foenum-graecum which convert chalcones to
"
l chalcone isomerase
"
l Arabidopsis
"
l tt5
Abbreviations
!
TFGCHI-1: Trigonella foenum-graecum L.
chalcone isomerase
tt5:
transparent testa 5
RACE:
LB:
rapid amplification of cDNA ends
lysogeny broth
received
revised
accepted
July 1, 2010
October 16, 2010
October 25, 2010
Introduction
merase (CHI), flavonol-3-hydroxylase (F3H), fla-
vonol-3′-hydroxylase (F3′H), flavonol synthase
(FLS), isoflavone synthase (IFS), 2-hydroxyisofla-
vanone dehydratase (HID), dihydroflavonol re-
ductase (DFR), and anthocyanidin synthase (ANS)
[12]. Chalcone isomerase is one of the key en-
zymes in the flavonoid biosynthesis pathway cat-
alyzing conversion of chalcones to flavanones
which are intermediates of the subsequent flavo-
noid metabolism [13]. The first crystal structure
of CHI was elucidated in Medicago sativa and pro-
vided insight into the enzyme architecture re-
sponsible for catalyzing a nearly diffusion con-
trolled cyclization reaction that is primarily driv-
en by entropy and induced fit [14]. It was also re-
ported that introduction of the petunia CHI gene
into tomato resulted in a 78-fold increase of peel
flavonols in transgenic fruit [15]. As result of our
effort on analyzing the flavonoid biosynthesis
pathway in Trigonella foenum-graecum L., we
cloned a key flavonoid structural gene TFGCHI‑1
and characterized it functionally by complemen-
tation of an Arabidopsis tt5 mutant and by in vitro
enzyme assay.
!
Fenugreek (Trigonella foenum-graecum L.; Legu-
minosae) is an annual herbaceous aromatic legu-
minous, widely cultivated in Mediterranean
countries and Asia [1]. In traditional Chinese
medicine (TCM), the seeds have been prescribed
as a tonic and for stomach disorders, and the
whole aerial part of the plant is also used as a folk
medicine for the treatment of renal diseases [2].
Phytochemical analysis showed that this plant
contained flavonol glycosides, isoflavones, steroi-
dal sapogenins, 4-hydroxyisoleucine, and the
main impact odor compound sotolone (3-hy-
droxy-4,5-dimethyl-2(5H)-furanone) [3–10]. Fla-
vonoids include flavonols, flavones, anthocyanins,
isoflavones, and the polymeric proanthocyani-
dins (PAs, also called condensed tannins) [11].
Flavonoid biosynthesis genes are downstream to
the phenylpropanoid pathway and can be catego-
rized into two different groups: structural gene
Bibliography
DOI http://dx.doi.org/
0.1055/s-0030-1250566
Published online November 23,
010
Planta Med 2011; 77: 765–770
Georg Thieme Verlag KG
1
2
©
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Prof. Dr. Xiang Li
College of Plant Science,
Jilin University
5
333 XiʼAn Road
Changchun, 130062
China
Phone: + 8643187835724
Fax: + 8643187836251
li_xiang@jlu.edu.cn
Correspondence
Prof. Dr. Yan-sheng Zhang
Wuhan Botanical Garden,
Chinese Academy of Sciences
No. 1 Lumo Road
Wuhan, 430074
China
Phone: + 862787617026
Fax: + 862787510251
zhangys@wbgcas.cn
"
and regulatory gene. Structural genes (l Fig. 1)
include chalcone synthase (CHS), chalcone iso-
* These authors contributed equally to this work and are
considered co-first authors.
Qin J-c et al. Cloning and Functional… Planta Med 2011; 77: 765–770

7
66 Original Papers
Fig. 1 Flavonoid biosynthesis pathway; CHS: chal-
cone synthase, CHI: chalcone isomerase, IFS: isofla-
vone synthase, HID: 2-hydroxyisoflavanone dehy-
dratase, F3H: flavonol-3-hydroxylase, F3′H: flavonol-
3′-hydroxylase, FLS: flavonol synthase, DFR: dihy-
droflavonol reductase, ANS: anthocyanidin syn-
thase.
Materials and Methods
!
Sequence alignment, phylogenetic analysis,
and structural modeling of TFGCHI-1
Chemicals, E. coli strains, plant materials, and plasmids
Narigenin chalcone, narigenin, and isoliquiritigenin were pur-
chased from Sigma-Aldrich and Chromadex, respectively. All sol-
vents used in this study were HPLC grade. 3′- and 5′-RACE kits
were purchased from TAKARA. Escherichia coli strains DH10B
and Bl-21 (DE3) (Invitrogen), expression vector pET28a (Nova-
gen), and the sequence vector PGEM‑T Easy (Promega) were used
for cloning and overexpression of the TFGCHI‑1 genes. Seeds of
Trigonella foenum-graecum L. (voucher no. XC-090718) were
kindly provided and identified by Prof. Dr. Yi-nan Zheng, College
of Chinese Medicinal Materials, Jilin Agicultural University. Arabi-
dopsis seeds were purchased from ABRC (Department of Plant
Cellular and Molecular Biology at The Ohio State University). Ara-
bidopsis and Trigonella foenum-graecum L. seeds were cold-treat-
ed at 4°C for 3 days and then allowed to germinate and grow in a
greenhouse or on ½-strength MS medium containing 1% agar
and 2% sucrose in a controlled growth cabinet (16-h light and 8-
h dark cycle) at 20°C.
Amino acid sequences were aligned using the AlignX program,
part of the Vector NTI suite (Invitrogen), with default settings of
parameters (gap opening penalty, 10; gap extension penalty,
0.05; gap separation penalty range, 8; identity for alignment de-
lay, 40%) [16]. The phylogenetic tree was constructed using the
neighbor-joining algorithm with MEGA version 4.0 [17] with
1000 bootstrap trials performed. For structural modeling, the se-
quences of the TFGCHI-1 protein were introduced into a protein
structure prediction web server ESyPred3D (http://www.fundp.
ac.be/sciences/biologie/urbm/bioinfo/esypred/) [18], using the
crystallized Medicago sativa MsCHI-1 (1EYP) as a template. Struc-
tural simulations were conducted using ICM‑pro v3.4 with a
MMFF local and global Mol-Mechanics calculation module (Mol-
Soft LLC).
Southern blot
For Southern blot analysis, genomic DNA was isolated from 10-
day seedlings by the CTAB method [19], digested with EcoRI, Hin-
dIII, and BamHI restriction enzymes and resolved on 1.2% agar-
ose gels. Southern blot analysis was performed on nylon mem-
branes according to Southern (1975) [20]. The TFGCHI‑1 coding
region was radiolabeled with α-32P dCTP using Ready-to-Go
DNA labeling beads (Amersham Pharmacia Biotech) and used as
a probe. Hybridization was carried out at 55°C for 2 h with 0.6 M
NaCl, and blots were washed at high stringency (0.2 × SSC, 0.1%
SDS).
Cloning of a full-length cDNA sequence
from Trigonella foenum-graecum L.
A highly conserved region was identified by the comparisons of
the CHI cDNA sequences from Medicago sativa (Accession
No. M91079.1), Pisum sativum (U03433.2), and Lotus japonicus
(AB054801.1). Based on this region, degenerated primers,
5′‑CTCGGCGG(G/C/T)GC(A/T)GG(T/G)GAGAG‑3′ (P1) and 5′-
TGTGCCACACA(A/G)TTCTCCAT‑3′ (P2), were designed to amplify
an about 260 bp DNA fragment through RT‑PCR using the cDNA
from 22 d-fenugreek seedlings as the template. Based on the par-
tial sequences obtained, the 5′ and 3′ rapid amplification of cDNA
ends were performed to amplify the remaining cDNA regions of
TFGCHI‑1 according to the manufacturerʼs instruction (TAKARA).
The open reading frame (ORF) of TFGCHI‑1 was amplified using
gene-specific primers 5′-CGCGGATCCATGGCAGCATCCATCACC‑3′
and 5′-CGCGAGCTCTCAGTTTCCAATCTTGAAAGC-3′ and Taq DNA
polymerase (Invitrogen). The PCR product was cloned into
pGEM‑T Easy Vector resulting in the plasmid pGEM-TFGCHI‑1.
The DNA sequence of the insert of pGEM-TFGCHI‑1 was deter-
mined with an ABI3700 DNA sequencer using a BigDye Termina-
tor Cycle Sequencing Kit (Applied Biosystems).
Real-time QPCR
RNAs extracted from different growth stages, using a commercial
RNAEasy mini kit (Qiagen), were used in quantitative real-time
PCR reactions (Q‑PCR) with gene-specific primers (TFGCHI‑F: 5′-
CCACCTGGTGCTTCTGTTTT‑3′ and TFGCHI‑R: 5′-CGTGCTCACC-
GATCATAGTC‑3′). Q‑PCR reactions were conducted using Super-
Script III First-Strand Synthesis SuperMix, a Platinum SYBR Green
qPCR SuperMix-UDG kit (Invitrogen), and the StepOnePlus Real-
Time PCR System (Applied Biosystems) following the manufac-
turersʼ instructions and as described previously [21]. For gene-
specific primers, gel electrophoresis and melting curve analyses
were conducted to ensure a single PCR amplicon of the expected
length and melting temperature. The level of each mRNA was cal-
culated using the mean cycle threshold (Ct) value, and the dry
seed mRNA level was designated as one. Data were analyzed us-
Qin J-c et al. Cloning and Functional… Planta Med 2011; 77: 765–770

Original Papers 767
ing StepOne Software v2.0 (Applied Biosystems), and all results
were shown as means of at least three independent RNA extrac-
tions with corresponding standard errors (SE).
80% for 5 min, and finally a linear gradient of 80–100% for
10 min, followed by a 10-min washing with 100% methanol, a
−1
flow rate of 1.0 mL·min , and an injection volume of 20 µL. Iden-
tical chromatography conditions were also used for LC‑MS/MS
using an 1100 HPLC and an “API QStar XL” pulsar hybrid system
(Applied Biosystems).
Functional analysis of TFGCHI-1 in vitro
The ORF of TFGCHI-1 from the vector pGEM‑TFGCHI-1 was di-
gested with BamHI and SacI and ligated into an E. coli expression
vector pET28a, which led to the construct pET28a-TFGCHI-1. The
empty vector pET28a and the construct pET28a-TFGCHI-1 were
separately introduced into E. coli strain BL21 (DE3) (Novagen) us-
ing heat shock at 42°C. Overnight cultures harboring pET28a or
pET28a-TFGCHI-1 were used to inoculate 250 mL of LB liquid me-
dium containing 50 µg/mL kanamycin and grown at 37°C with
shaking to OD600 of 0.6 followed by induction with 0.5 mM IPTG
at 28°C for 6 h. His-tagged TFGCHI-1 protein was purified at 4°C
using a His-Bind purification kit (Novagen) following the manu-
facturerʼs protocol. The concentration of purified protein was
Results and Discussion
!
Based on the known conserved features of Medicago sativa
(M91079.1), Pisum sativum (U03433.2), and Lotus japonicus
(AB054801.1) CHI genes, we used cDNA as a template for PCR,
with degenerate primers (P1 + P2) to isolate a partial DNA frag-
ment of the CHI gene from Trigonella foenum-graecum L. A 260-
bp DNA fragment was obtained; then the complete sequence of
this gene was determined by 5′- and 3′-RACE PCR based on the
sequence of this partial DNA; it was named TFGCHI-1. The
TFGCHI-1 cDNA contains an open reading frame encoding a pro-
tein of 222 amino acids with a predicted molecular mass of
21 kDa. We performed multiple sequence alignment of TFGCHI-
®
measured by NanoDrop ND-1000 (NanoDrop Technologies,
Inc.). The recombinant enzyme was visualized on 12.5% acryl-
amide gel stained with 0.25% Coomassie Blue. In vitro enzyme as-
say conditions were altered to include incubation at 30°C for
"
5
min in 100 µL total volume containing 80 µL Tris-HCl buffer
1 with other previously reported CHIs. As shown in l Fig. 2A,
(
(
100 mM, pH 7.6), 15 µL purified recombinant TFGCHI-1 protein
0.4 µg µL ), and 5 µL chalcones (100 µM) dissolved in methanol.
phylogenetic analysis demonstrated that TFGCHI-1 can be
grouped with type-II leguminous plants CHIs [25]. Motif scan re-
sults showed that the C-terminal portion of the protein includes a
highly conserved chalcone-flavanone isomerase domain and
shares more than 95% similarity in this region with MsCHI-1
−
1
Determinations of the Km and the Vmax for both naringenin chal-
cone and isoliquiritigenin were performed with varied substrate
concentration ranges between 0.5 and 100 µM and calculated us-
ing a Lineweaver-Burk plot. The decrease of substrate A380 was
monitored using a UV spectrophotometer (Thermo Scientific In-
struments). The optimal pH was determined in 50 mM potassium
phosphate at pH range 6.0 to 8.0 and 50 mM Tris-HCl at pH range
"
from Medicago sativa (l Fig. 2C) [26]. Three-dimensional struc-
"
ture was predicted based on the crystallized MsCHI-1 (l Fig. 2B).
The residues forming the active site were found conserved in
TFGCHI-1, e.g., Thr-48, Tyr-106, Asn-113, and Thr-190. Thr-48 po-
larizes the ketone of the flavanone substrate, and Tyr-106 stabil-
izes a key catalytic water molecule. Asn-113 and Thr-190 orient
the substrate at the active site and position the reactive 2′-oxyan-
ion of the substrate in proximity to the α,β-unsaturated double
bond for the intermolecular cyclization reaction [14].
7
.5 to 8.5 using naringenin chalcone as a substrate. The rate con-
stant Kuncat for the spontaneous conversion of the respective
chalcone to the corresponding flavanone was determined in
5
0 mM potassium phosphate buffer (pH 7.8) according to the
method of Joseph and Joseph [22].
When EcoRI, HindIII, and BamHI-digested DNA samples were
probed with TFGCHI‑1, the number of the hybridization signals
indicated that two copies of CHI existed in the Trigonella foe-
Complementation of Arabidopsis tt5 by TFGCHI-1
The ORF of TFGCHI‑1 from the vector pGEM-TFGCHI‑1 was di-
gested with BamHI and SacI and ligated into a binary vector
pBI121 under the control of the 35S promoter, which led to the
construct pBI121-TFGCHI‑1. Arabidopsis tt5 mutant that lacks
the CHI activity was obtained from ABRC and was transformed
with the A. tumefaciens GV3101 containing the binary construct
pBI121-TFGCHI‑1 by floral dipping [23] followed by selections
with 100 µg/mL kanamycin and used for flavonoids analysis by
HPLC.
"
num-graecum L. genome (l Fig. 3A). Temporal expression of
TFGCHI‑1 in different tissues was detected by real-time PCR.
TFGCHI‑1 transcript accumulated at a low level in the cotyledon,
root, and leaves. The highest expression level was found in the
developing silique and flower. The lowest level of TFGCHI‑1
"
mRNA was at the dry seed stage (l Fig. 3B). This was consistent
with the Arabidopsis chalcone isomerase (TT5) gene expression
pattern during the different developing stages (data was ex-
tracted from www.arabidopsis.org).
HPLC UV/MS analyses of flavonoids
CHI converts chalcones into the corresponding flavanones by se-
lectively binding an ionized chalcone in a conformation condu-
cive to ring closure in a diffusion controlled reaction, thus accel-
erating the stereochemically defined intramolecular cyclization
reaction yielding a biologically active (S)-isomer [14]. To test the
functionality of the TFGCHI-1, E. coli Bl21 was transformed with
vector pET28a-TFGCHI-1. Cells containing TFGCHI-1 protein were
Flavonoids were extracted in triplicate batches from Arabidopsis
seed and analyzed as described by Gao et al. [24] with minor
modifications. Briefly, 100 mg of frozen seeds were ground in liq-
uid nitrogen in a 20-mL Potter (Elvehjem), followed by grinding
in 10 mL acetone/water (70:30; v/v) for 10 min. Following filtra-
tion, the pellet was re-extracted overnight at 4°C in the dark, the
two extracts were combined and evaporated at 35°C under vac-
uum, and the dried extract was dissolved to 1 mg·mL− metha-
nol/water (50:50; v/v). HPLC/UV analysis was conducted using a
Hewlett Packard Agilent 1100 chromatograph, a G-7120 diode
array detector, HP Chemstation ver. 8.01 software, and a Zorbax
C18 column (150 × 4.6 mm, 5 µm ID) with a linear gradient of 20–
"
easily lysed after growth (l Fig. 4A, lane 3), and the recombinant
1
protein was extracted and purified to yield a single distinct
"
28 kDa band after SDS-PAGE (l Fig. 4A, lane 4). We used both
6′-hydroxychalcone and 6′-deoxychalcone as substrates to exam-
ine the enzyme activity. HPLC elution profiles of reaction prod-
ucts showed that TFGCHI-1 yielded naringenin from the incuba-
"
45% for 5 min, constant 45% for 10 min, a linear gradient of 45–
tion with naringenin chalcone as a substrate (l Fig. 4B bottom).
Qin J-c et al. Cloning and Functional… Planta Med 2011; 77: 765–770

7
68 Original Papers
Fig. 2 Sequence information of TFGCHI-1. A Phy-
logenetic analysis of TFGCHI-1. Accession numbers
of these proteins are as follows: Glycine max:
Q93XE6; Glycyrrhiza uralensis: ABM66533; Pueraria
montana: Q43056; Phaseolus vulgaris: P14298; Lotus
japonicus: Q8H0F; Pisum sativum: P41089; Medicago
sativa: P28013; Camellia sinensis: Q45QI7; Dianthus
caryophyllus: Q43754; Populus trichocarpa:
XP_002315258; Arabidopsis thaliana: NP_191072;
Elaeagnus umbellate: O6533; Vitis vinifera: P51117;
Pyrus communis: A5HBK6. B Simulated three-di-
mensional structure of TFGCHI-1. Structure was
predicted by ESyPred3D using the crystallized Medi-
cago sativa MsCHI-1 (1EYP) as a template. C Align-
ment of TFGCHI-1 (top) with Medicago sativa MsCHI-
1
(bottom). Amino acid differences were high-
lighted with grey boxes and binding sites were
marked with arrows.
Fig. 3 Molecular analyses of TFGCHI‑1 in Trigonella foenum-graecum L.
Fig. 4 Functional characterization of TFGCHI-1 in vitro. A SDS-PAGE anal-
yses of TFGCHI-1 purified by Ni-NTA conjugation; lane 1, protein molecular
weight marker; lane 2, supernatant of pET28a cell lysate; lane 3, superna-
tant of pET28a-TFGCHI-1 cell lysate; lane 4, purified TFGCHI-1 protein.
B Representative HPLC profile of incubation of naringenin chalcone with
(bottom) or without (top) purified TFGCHI-1 enzyme. Peak a: narigenin
chalcone; peak b: narigenin.
A Southern blot. Genomic DNA was digested with EcoRI, HindIII, and Bam-
HI restriction enzymes, and resolved on 1.2% agarose gels, then probed by
α-32P dCTP labeled TFGCHI‑1. B TFGCHI‑1 expression levels in different de-
veloping stages. Dry seed mRNA level was designated as one and all results
were shown as means of at least three independent RNA extractions with
corresponding standard errors (SE).
The control reaction with naringenin chalcone using the same
buffer without the TFGCHI-1 enzyme gave a peak of naringenin
Table 1 Catalytic properties of chalcone isomerase from T. foenum-graecum
regarding the different chalcone substrates
"
(
l Fig. 4B, top), which should be ascribed to the nonenzymatical
conversion to naringenin. The temperature optimum for the iso-
merization of naringenin chalcone to naringenin as catalyzed by
the purified enzyme was 36°C; the pH optimal of naringenin
chalcone and isoliquiritigenin were in the range of 7.5–8.0. En-
zyme activity followed Michaelis–Menten kinetics. The Km for
naringenin chalcone and isoliquiritigenin were 67 and 26 µM, re-
spectively. The Vmax for naringenin chalcone and isoliquiritigenin
Substrate Vmax
(µmol·
Km
Kuncat
Kcat
Rate
pH
(µM) (min−1) (min−1
)
enhance- optimal
ment
min−1)
Naringenin 1893
chalcone
67
26
0.0554 371200 6.7 × 106
7.5–8.0
Isoliquiriti-
genin
129.1
0.0096
13600 1.4 × 106
7.5–8.0
−
1
were 1893 and 129.1 µmol·min , respectively. The rate en-
hancement of the spontaneous cyclization by the purified chal-
6
cone isomerase (Kcat/Kuncat) were determined as 6.7 × 10 and
of a racemic mixture of flavanones. Many flavonoid biosynthetic
enzymes that are utilized in the production of other downstream
flavonoids, such as flavonols and flavones, can only accept (2S)-
forms. Although the chirality of narigenin produced by this re-
combinant strain was not determined with a chiral column, we
suppose (2S)-narigenin was mainly produced by the action of
TFGCHI-1 based on the previous results [14,27].
To verify whether TFGCHI‑1 encodes a functional CHI in plants,
we overexpressed it under the CaMV 35S promoter in an Arabi-
dopsis tt5 mutant. RT‑PCR analysis revealed that the transgene
1
.4 × 106 for naringenin chalcone and isoliquiritigenin, respec-
"
tively (l Table 1). Compared to the rate enhancement of approx-
imately 10 brought about by enzymes from soy beans and alfalfa
6
[22,25], TFGCHI-1 showed similar Kcat/Kuncat values for both nar-
ingenin chalcone and isoliquiritigenin, although the isomeriza-
tion of 6′-deoxychalcone to 5-deoxyflavanone is rather slow in
contrast to a rapid isomerization of 6′-hydroxychalcone into 5-
hydroxyflavanone. Conversion of the flavanones from chalcones
nonenzymatically under alkali conditions resulted in production
Qin J-c et al. Cloning and Functional… Planta Med 2011; 77: 765–770

Original Papers 769
Fig. 5 Complementation of Arabidopsis tt5 by
TFGCHI‑1. Mature seeds of A wild-type Col-0; D tt5
mutant; G complementation of tt5 by TFGCHI‑1.
Four-day seedling of B wild-type Col-0; E tt5 mu-
tant; H complementation of tt5 by TFGCHI‑1. Rep-
resentative HPLC‑UV (λ370 nm) chromatogram pro-
files of C wild-type Col-0; F tt5 mutant; I comple-
mentation of tt5 by TFGCHI‑1 seed methanol ex-
tracts. The peaks for flavonoids are indicated as:
b quercetin-hexoside-rhamnoside; d quercetin-di-
rhamnoside; e kaempferol-3,7-di-O-rhamnoside;
f quercetin-3-O-rhamnoside; g narigenin chalcone.
Peaks a and c are predicted to be sinapic acid deriv-
atives based on MS and UV data.
was highly expressed (data not shown). Arabidopsis seed fla-
vonols are present in both the testa and the embryo, while PAs
accumulate only in the seed coat to protect the embryo and en-
dosperm [12]. Quercetin-3-O-rhamnoside (Q3R), quercetin-di-
rhamnoside (QDR), kaempferol-3,7-di-O-rhamnoside (KDR), and
quercetin-hexoside-rhamnoside (QHR) are major flavonols in
noid biosynthesis gene characterized from Trigonella foenum-
graecum L.
Acknowledgements
!
"
Arabidopsis seeds (l Fig. 5C) [24]. The tt5 mutant has yellow
seeds, and no anthocyanins accumulated in the seedlings
This work was partially supported by the Program for New Cen-
tury Excellent Talents in University (XL, NCE09-0423), Ministry
of Education of the Peopleʼs Republic of China; National Natural
Science Foundation of China (JCQ, NSFC-31000149); and sup-
ported by Key Projects in the National Science & Technology
Pillar Program during the Eleventh Five-Year Plan Period
(2006BAD08A08); Basic Research Program (20060544), Science
and Technology Department of Jilin Province; International
Technology Cooperation Project (06GH07), Changchun, China.
"
(
l Fig. 5D–E), which compared to wild-type brown seed with
"
seedlings containing anthocyanins (l Fig. 5A–B), due to the block
"
in the flavonoid pathway caused by the mutation in CHI (l Fig. 1)
[12]. Seeds from the transgenic plants overexpressing TFGCHI‑1
were brown, and seedlings were found to accumulate anthocya-
"
nins, as in the wild type (l Fig. 5G–H), indicating that TFGCHI‑1
complements the seed color and seedling anthocyanins accumu-
lation phenotype of the tt5 mutant. We analyzed the contents of
the flavonoids in the wild type, tt5 mutant, and tt5 mutant over-
expressing TFGCHI‑1 by HPLC UV/MS. Flavonol glycosides Q3R,
QDR, KDR, and QHR were not detected in the tt5 mutant, but this
References
1 Yoshikawa M, Murakami T, Komatsu H, Murakami N. Medicinal food-
stuffs. IV. Fenugreek seed. (1): structures of trigoneosides Ia, Ib, IIa,
IIb, IIIa, and IIIb, new furostanol saponins from the seeds of Indian Trig-
onella foenum-graecum L. Chem Pharm Bull 1997; 45: 81–87
"
mutant accumulated narigenin chalcone (l Fig. 5F), whereas in
the transgenic line the levels of quercetin glycosides (peak b, d,
2
Liu H, Zhang T, Li M. Clinical study of chronic renal failure patients
treated with xiangcao infusion. Zhongyiyaoxinxi 1990; 7: 20–21
"
and f in l Fig. 5I) were higher than those in the wild type
"
3 Rayyan S, Fossen T, Andersen OM. Flavone C-glycosides from seeds of fe-
nugreek, Trigonella foenum-graecum L. J Agric Food Chem 2010; 58:
(
l Fig. 5C). This could be explained as we used virus 35S rather
than its native promoter, and this maybe caused the transcription
level of TFGCHI‑1 to exceed the regular expression level of Arabi-
dopsis CHI and led to the accumulation of a higher level of querce-
tin glycosides in the transgenic lines. This result was similar with
the overexpression of the petunia CHI‑A gene in the tomato fruit
which resulted in a dramatic increase of flavonols (mainly rutin)
in the peel at the expense of naringenin chalcone [15].
In this study we have provided molecular and biochemical evi-
dence that TFGCHI-1 isolated from Trigonella foenum-graecum L.
is a functional chalcone isomerase that can isomerize chalcone to
produce flavonone. To our best knowledge, this is the first flavo-
7
211–7217
4
Han YM, Nishibe S, Noguchi Y, Jin ZX. Flavonol glycosides from the stems
of Trigonella foenum-graecum. Phytochemistry 2001; 58: 577–580
5 Wang GR, Tang WZ, Yao QQ, Zhong H, Liu YJ. New flavonoids with 2BS
cell proliferation promoting effect from the seeds of Trigonella foe-
num-graecum L. J Nat Med 2010; 64: 358–361
6
Taylor WG, Zulyniak HJ, Richars KW, Acharya SN, Bittma S, Elder JL. Var-
iation in diosgenin levels among 10 accessions of fenugreek seeds pro-
duced in western Canada. J Agric Food Chem 2002; 50: 5994–5997
7 Ghosal S, Srivastava RS, Ciiatterjee DC, Dutta SK. Fenugreekine, a new
steroidal sapogenin-peptide ester of Trigonella foenum-gracecum. Phy-
tochemistry 1974; 13: 2247–2251
Qin J-c et al. Cloning and Functional… Planta Med 2011; 77: 765–770

7
70 Original Papers
8
Taylor WG, Zaman MS, Mir Z, Mir PS, Acharya SN, Mears GJ, Elder JL.
17 Tamura K, Dudleym J, Nei M, Kumar S. MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007; 24:
1596–1599
18 Lambert C, Leonard N, De Bolle X, Depiereux E. ESyPred3D: Prediction of
proteins 3D structures. Bioinformatics 2002; 18: 1250–1256
19 Saghai-Maroof MA, Soliman KM, Jorgensen RA, Allard RW. Ribosomal
DNA spacer-length polymorphisms in barley: mendelian inheritance,
chromosomal location, and population dynamics. Proc Natl Acad Sci
USA 1984; 81: 8014–8018
Analysis of steroidal sapogenins from amber fenugreek (Trigonella foe-
num-graecum) by capillary gas chromatography and combined gas
chromatography/mass spectrometry. J Agric Food Chem 1997; 45:
7
53–759
9
Haefeli C, Bonfils C, Sauvaire Y. Characterization of a dioxygenase from
Trigonella foenum-graecum involved in 4-hydroxyisoleucine biosyn-
thesis. Phytochemistry 1997; 44: 563–566
1
1
0 Peraza-Luna F, Rodriguez-Mendiola M, Arias-Castro C, Bessiere JM, Cal-
va-Calva G. Sotolone production by hairy root cultures of Trigonella
foenum-graecum in airlift with mesh bioreactors. J Agric Food Chem
20 Southern EM. Southern, detection of specific sequences among DNA
fragments separated by gel electrophoresis. J Mol Biol 1975; 98: 503–
517
2
001; 49: 6012–6019
1 Tohge T, Yonekura-Sakakibara K, Niida R, Watanabe-Takahashi A, Saito
K. Phytochemical genomics in Arabidopsis thaliana: A case study for
functional identification of flavonoid biosynthesis genes. Pure Appl
Chem 2007; 79: 811–823
2 Lepiniec L, Debeaujon I, Routaboul J, Baudry A, Pourcel L, Nesi N, Caboche
M. Genetics and biochemistry of seed flavonoids. Annu Rev Plant Biol
21 Gao MJ, Lydiate DJ, Li X, Lui H, Gjetvaj B, Hegedus DD, Rozwadowski K.
Repression of seed maturation genes by a trihelix transcriptional re-
pressor in Arabidopsis seedlings. Plant Cell 2009; 21: 54–71
22 Joseph MJ, Joseph PN. Reaction mechanism of chalcone isomerase. J Biol
Chem 2002; 11: 1361–1369
23 Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-
mediated transformation of Arabidopsis thaliana. Plant J 1998; 16:
735–743
24 Gao P, Li X, Cui D, Wu L, Parkin I, Gruber MY. A new dominant Arabi-
dopsis transparent testa mutant, sk21-D, and modulation of seed flavo-
noid biosynthesis by KAN4. Plant Biotechnol J 2010; 8: 979–993
25 Kimura Y, Aoki T, Ayabe S. Chalcone isomerase isozymes with different
substrate specificities toward 6′-hydroxy and 6′-deoxychalcones in
cultured cells of Glycyrrhiza echinata, a leguminous plant producing
5′-deoxyflavonoids. Plant Cell Physiol 2002; 42: 1169–1173
26 Hulo N, Bairoch A, Bulliard V, Cerutti L, Cuche BA, de Castro E, Lachaize C,
Langendijk-Genevaux PS, Sigrist CJ. The 20 years of PROSITE. Nucleic
Acids Res 2008; 36: D245–D249
1
1
1
1
2
006; 57: 405–430
3 Springob K, Nakajima J, Yamazaki M, Saito K. Recent advances in the
biosynthesis and accumulation of anthocyanins. Nat Prod Rep 2003;
2
0: 288–303
4 Jez JM, Bowman ME, Dixon RA, Noel JP. Structure and mechanism of the
evolutionarily unique plant enzyme chalcone isomerase. Nat Struct Bi-
ol 2000; 7: 786–791
5 Muir S, Collins G, Robinson S, Hughes S, Bovy A, De Vos CHR, van Tunen AJ,
Verhoeyen ME. Overexpression of petunia chalcone isomerase in toma-
to results in fruit containing increased levels of flavonols. Nat Biotech-
nol 2001; 19: 470–474
1
6 Lu G, Moriyama EN. Vector NTI, a balanced all-in-one sequence analysis
suite. Brief Bioinform 2004; 5: 378–388
27 Hur S, Bruice TC. Enzymes do what is expected (chalcone isomerase
versus chorismate mutase). J Am Chem Soc 2003; 125: 1472–1473
Qin J-c et al. Cloning and Functional… Planta Med 2011; 77: 765–770