In vitro and in vivo comparative and competitive activity-based protein profiling of GH29 α-L-fucosidases

Article abstract of DOI:10.1039/c4sc03739a

GH29 α-L-fucosidases catalyze the hydrolysis of α-L-fucosidic linkages. Deficiency in human lysosomal α-L-fucosidase (FUCA1) leads to the recessively inherited disorder, fucosidosis. Herein we describe the development of fucopyranose-configured cyclophellitol aziridines as activity-based probes (ABPs) for selective in vitro and in vivo labeling of GH29 α-L-fucosidases from bacteria, mice and man. Crystallographic analysis on bacterial α-L-fucosidase confirms that the ABPs act by covalent modification of the active site nucleophile. Competitive activity-based protein profiling identified l-fuconojirimycin as the single GH29 α-L-fucosidase inhibitor from eight configurational isomers.

Full text of DOI:10.1039/c4sc03739a

Chemical
Science
View Article Online
View Journal
EDGE ARTICLE
In vitro and in vivo comparative and competitive
activity-based protein profiling of GH29 a-L-
fucosidases†
Cite this: DOI: 10.1039/c4sc03739a
Jianbing Jiang,‡a Wouter W. Kallemeijn,‡b Daniel W. Wright,c Adrianus M. C. H. van
den Nieuwendijk,a Veronica Coco Rohde,a Elisa Colomina Folch,a Hans van den Elst,a
Bogdan I. Florea,a Saskia Scheij,b Wilma E. Donker-Koopman,b Marri Verhoek,b
Nan Li,a Martin Schurmann,d Daniel Mink,d Rolf G. Boot,b Jeroen D. C. Codee,a
¨
´
a
c
ab
*
Gijsbert A. van der Marel, Gideon J. Davies, Johannes M. F. G. Aerts
a
*
and Herman S. Overkleeft
GH29 a-L-fucosidases catalyze the hydrolysis of a-L-fucosidic linkages. Deficiency in human lysosomal a-L-
fucosidase (FUCA1) leads to the recessively inherited disorder, fucosidosis. Herein we describe the
development of fucopyranose-configured cyclophellitol aziridines as activity-based probes (ABPs) for
selective in vitro and in vivo labeling of GH29 a-L-fucosidases from bacteria, mice and man.
Crystallographic analysis on bacterial a-L-fucosidase confirms that the ABPs act by covalent modification
of the active site nucleophile. Competitive activity-based protein profiling identified L-fuconojirimycin as
the single GH29 a-L-fucosidase inhibitor from eight configurational isomers.
Received 3rd December 2014
Accepted 9th February 2015
DOI: 10.1039/c4sc03739a
www.rsc.org/chemicalscience
Two GH29 a-L-fucosidases are expressed in man. Of these,
FUCA1 is found in lysosomes whereas FUCA2 is secreted into
the plasma.8 Deciency of FUCA1 a-L-fucosidase activity causes
Introduction
GH29 a-L-fucosidases catalyze the hydrolysis of terminal a-L-
fucosidic linkages.1 The GH29 (ref. 2) glycoside hydrolase family
of retaining a-L-fucosidases contains members from various
kingdoms of life including the eukaryota3 and bacteria (for
example, Bacteroides thetaiotaomicron,4 Sulfolobus solfataricus,5
and Thermotoga maritima6). GH29 a-L-fucosidases process their
substrate with overall retention of conguration at the anome-
ric center of the cleaved fucopyranose and do so through a
double-displacement mechanism. In this mechanism, rst
proposed by Koshland,7 (Fig. 1A), SN2 displacement of the
aglycon (activated through protonation by the general acid/base
residue) by nucleophilic attack of the catalytic nucleophile
yields a fucosyl-enzyme intermediate, which is subsequently
hydrolyzed to yield a-L-fucopyranose together with the released
aglycon.
fucosidosis,9 a rare autosomal recessive lysosomal storage
disorder. Next to its role in lysosomal turnover of fucosylated
substrates, FUCA1 is also involved in sperm transport and
sperm–egg interactions.10 FUCA1 activity levels are considered
to be a biomarker for cellular senescence11 as well as for the
diagnosis of hepatocellular cancers.12 Deciency of human
FUCA2 has been shown to protect against Helicobacter pylori
adhesion to gastric cancer cells.8
aLeiden Institute of Chemistry, Leiden University, P. O. Box 9502, 2300 RA Leiden, The
Netherlands. E-mail: h.s.overklee@chem.leidenuniv.nl; j.m.aerts@amc.uva.nl
bDepartment of Medical Biochemistry, Academic Medical Center, Meibergdreef 15,
1105 AZ Amsterdam, The Netherlands
cDepartment of Chemistry, University of York, Heslington, York, YO10 5DD, UK
dDSM Innovative Synthesis, Urmonderbaan 22, NL-6167 RD Geleen, The Netherlands
† Electronic supplementary information (ESI) available: Experimental part
including synthesis procedures, characterization data, copies of NMR spectra of
new compounds, supporting biological gures and crystallographic
information. See DOI: 10.1039/c4sc03739a
Fig. 1 (A) Double-displacement mechanism of retaining a-L-fucosi-
dases. (B) Comparative and competitive activity-based profiling of
GH29 a-L-fucosidases presented here.
‡ These authors contributed equally.
This journal is © The Royal Society of Chemistry 2015
Chem. Sci.

View Article Online
Chemical Science
Edge Article
The biological and biomedical relevance of GH29 retaining template in 16 followed by ring-closing metathesis yielded
a-L-fucosidases warrant the development of efficient methods to according to the Llebaria procedure17 partially protected L-gal-
monitor their functional state and activity in vitro, in situ and actopyranose-congured cyclohexene 17 in good yield. Tosyla-
in vivo. In this respect, activity-based probes (ABPs) have shown tion of the primary alcohol in 17 was followed by hydride
their merit as tools to detect active enzyme molecules in their displacement of the tosylate to afford L-fucopyranose-cong-
native environment (Fig. 1B).13 We have previously reported the ured cyclohexene 19. The benzyl groups in 19 were reduced
use of cyclophellitol aziridines as scaffolds for the design of under Birch conditions, aer which the cis-diol was protected as
in situ and in vivo active ABPs directed at GH1 retaining b- the isopropylidene acetal to give 20. The secondary alcohol in 20
glucosidases14 and GH27 retaining a-galactosidases.15 The was transformed into the corresponding trichloroacetimidate
specicity of these probes appeared due to their conguration, aer which iodocyclisation yielded in a stereospecic fashion
with the b-glucopyranose congured cyclitol aziridine being intermediate 21 analogous to the procedure we reported for the
highly selective towards retaining b-glucosidases and their synthesis of retaining b-glucosidase ABPs.18 Acidic hydrolysis of
a-galacto-congured counterparts selective towards a-galacto- both acetal and iminal in 21 was followed by base-induced
sidases. Here we describe the development of retaining GH29 intramolecular nucleophilic substitution of the iodine to yield
a-L-fucosidase ABPs. The ABPs are based on the cyclophellitol aziridine 22. Acetylation or benzoylation of the aziridine in 22
aziridine structure having a-L-fucoside conguration and are under the agency of 2-ethoxy-1-ethoxycarbonyl-1,2-dihy-
equipped with a green (1, JJB256) or red (2, JJB244) BODIPY droquinoline (EEDQ) following conditions we had developed
uorophore and biotin tag (3, JJB243) (Fig. 2). We reveal that previously18 yielded compounds 4 and 5, respectively. EEDQ-
these probes are highly sensitive and selective and can be used induced acylation of 22 with 8-azidooctanoic acid19 24 provided
for in situ and in vivo monitoring of mammalian and bacterial azide 23, which was transformed into target ABPs 1, 2 and 3 by
GH29 retaining a-L-fucosidases.
conjugation to BODIPY-alkynes 25, 26 and biotin-alkyne 27,
We also demonstrate that ABPs 1 and 2 can be used in a respectively, via copper(I)-catalyzed Huisgen [2 + 3] cycloaddi-
competitive activity-based protein proling (ABPP) assay16 to tion. The nal compounds were puried by reverse phase
identify rapidly retaining a-L-fucosidase inhibitors from a HPLC.
library of eight congurational isomers of deoxy-L-fuconojir-
imycin (6–13); a library we prepared specically for this
purpose. Finally we unambiguously establish the validity of the
cyclophellitol aziridine design platform for ABP development of
retaining glycosidases by solving the crystal structure of
retaining a-L-fucosidase from Bacteroides thetaiotaomicron 2970,
covalently bound to N-acyl cyclophellitol aziridines 4 and 5.
Results and discussion
The synthesis of a-L-fucopyranose-congured cyclophellitol
aziridine-based target compounds started with aldol conden-
sation of aldehyde 15 and chiral acrylamide 14, following the
procedure reported17 by Llebaria and co-workers for the enan-
tiomer of 16 (Scheme 1). Reductive removal of the Evans
Scheme 1 Synthesis of aziridine ABPs 1, 2, 3 and inhibitors 4, 5.
Reagents and conditions: (a) DBBT, Et3N, CH2Cl2, ꢀ78 ꢁC, 71%;
(b) (i) LiBH4, THF, 83%; (ii) Grubbs 2nd generation, CH2Cl2, 95%; (c) p-
TsCl, Et3N, CH2Cl2, 87%; (d) LiAlH4, THF, 0 ꢁC to rt, 87%; (e) (i) Li, NH3 (l),
THF, ꢀ60 ꢁC, 73%, (ii) 2,2-dimethoxypropane, CSA, rt, 60%; (f) (i) CCl3CN,
DBU, CH2Cl2, rt; (ii) NaHCO3, I2, H2O, rt, 46%; (g) (i) 37% HCl (aq.), MeOH,
60 ꢁC; (ii) NaHCO3, MeOH, rt, 65%; (h) EEDQ, benzoic acid or acetic acid,
DMF, 0 ꢁC, 7% 4, 28% 5; (i) EEDQ, 24, DMF, 0 ꢁC 25%; (j) CuSO4, sodium
Fig. 2 Structures of inhibitors and ABPs presented in this study.
ascorbate, 25, 26 or 27, rt, 19% 1, 12% 2, 13% 3.
Chem. Sci.
This journal is © The Royal Society of Chemistry 2015

View Article Online
Edge Article
The congurational fuconojirimycin isomers 6–13 (Fig. 3)
Chemical Science
were synthesized following the strategy exemplied for 1-deoxy-
L-fuconojirimycin 6 (Scheme 2). Key steps in the synthetic
scheme include a DIBAL-H reduction-transimination-sodium
borohydride reduction cascade of reactions involving enantio-
merically pure cyanohydrin 28, prepared employing
(S)-hydroxynitrile lyase (S-HbHNL), from Hevea brasiliensis
rubber tree,20 and the allylic amine 29 prepared by reported
strategy,21 to give secondary amine 30. N-Boc protection (30 to
31), ring-closing metathesis (31 to 32) and Upjohn dihydroxy-
lation afforded a mixture of syn-diols, which were acetylated and
separated by silica gel purication to yield diastereomers 33 and
34 in a 1 : 3 ratio.
Global deprotection of 34 afforded 1-deoxy-L-fuconoijir-
imycin 6, the analytical and spectroscopical data of which were
in full agreement with those reported in the literature.22 The
seven congurational isomers 7–13 were prepared by alteration
of the building blocks and/or the chemical transformations. It
should be noted that four out of the eight isomers of fucono-
jirimycin are derived from 28. To enable the synthesis of the
four enantiomers we needed access to the enantiomer of
cyanohydrin 28, which we prepared using almond (R)-hydroxy-
nitrile lyase (R-PaHNL).23
Scheme 2 Synthesis of 1-deoxy-L-fuconojirimycin 6. Reagents and
conditions: (a) (i) Et2O, DIBAL-H, ꢀ80 ꢁC, (ii) MeOH, ꢀ90 ꢁC, (iii) amine
29, NaOMe, (iv) NaBH4, ꢀ15 ꢁC to rt, 88%; (b) Boc2O, 50 ꢁC, 100%;
(c) Grubbs 1st generation, CH2Cl2, 88%; (d) (i) K2OSO4$2H2O, NMO,
acetone–H2O (1 : 1), ꢀ10 ꢁC, (ii) Ac2O, pyridine, DMAP, 0 ꢁC, 88%
(33 : 34 ¼ 1 : 3); (e) (i) K2CO3, MeOH, (ii) TBAF, THF, (iii) 6M HCl, MeOH,
71%.
In vitro GH29 a-L-fucosidase activity assays
Having the cyclophellitol aziridine inhibitors and probes in
hand, we determined their inhibitory potency towards the
human lysosomal a-L-fucosidase, FUCA1. Inhibition potency
was determined by measuring the residual enzyme activity
using the uorogenic substrate 4-methylumbelliferyl-a-L-fuco-
pyranoside aer pre-incubation of lysates of COS-7 cells over-
expressing recombinant human FUCA1, with varying concen-
trations of the non-uorescent, irreversible cyclophellitol azir-
idine inhibitors 4, 5 and 23; the ABPs 1 (JJB256), 2 (JJB244), 3
(JJB243), 1-deoxy-L-fuconojirimycin 6, and the seven fuconojir-
imycin isomers 7–13. All N-acyl aziridines inhibited human
FUCA1 activity with nanomolar IC50 activities (Table 1).
N-acyl substituent is in fact favored for enzyme inhibition
(5-fold increase, Table 1). ABPs 1 and 2, bearing a BODIPY u-
orophore attached to the alkyl chain, inhibit FUCA1 in the same
order as their azide precursor 23. In situ inhibition of FUCA1 in
living broblasts by ABP 1 and 2 occurs with similar efficacy as
23 and ABP 3, the latter carrying a biotin attached to the alkyl
chain. Exposure of cells to ABP 3 revealed in a 25-fold decreased
inhibitory potency, suggesting a reduced ability to penetrate
into cells to reach the lysosomal FUCA1. The known competitive
Perusal of the inhibitory data does reveal some trends that
allow us to draw some tentative conclusions. N-Benzoyl azir-
idine 4, bearing a bulky aromatic N-benzoate group, is about
eight-fold less active compared to its N-acetylated counterpart,
5. In contrast, comparing 5 with 23 reveals that a bulky aliphatic
Table 1 In vitro and in situ inhibition of recombinant human GH29 a-
a
L-fucosidase, given as half-maximal inhibitory concentration (IC50
)
In vitro IC50
In situ IC50
Aziridine
1 (JJB256)
2 (JJB244)
3 (JJB243)
4
6.9 ꢂ 0.8
8.7 ꢂ 1.2
7.2 ꢂ 1.1
371.6 ꢂ 21.2
46.8 ꢂ 3.4
8.7 ꢂ 1.1
28.9 ꢂ 4.4
157.8 ꢂ 22
25 512 ꢂ 2278
515.4 ꢂ 72.9
77.9 ꢂ 9.1
5
23
65.4 ꢂ 7.5
Iminosugars
6
7–13
3979 ꢂ 257
ND
ND
>100 000
a
Values are given in nanomolar. ND: not determined. It should be
noted that IC50 values on competitive inhibitors do not compare well
to those obtained for mechanism-based inhibitors. The values given
above allow for a comparison of inhibitory potency within the two
classes of compounds studied.
Fig. 3 Structures of 1-deoxy-L-fuconojirimycin 6 and configurational
isomers 7–13.
This journal is © The Royal Society of Chemistry 2015
Chem. Sci.

View Article Online
Chemical Science
Edge Article
fucosidase inhibitor, 1-deoxy-L-fuconojirimycin
6
inhibits fucosidases from various bacterial sources in a similar fashion
FUCA1 with an IC50 of 3.9 mM, in accordance with the literature (Fig. 4B).
values.24 The seven congurational isomers 7–13 do not
Subsequently, we exposed lysates of spleens from a healthy
signicantly inhibit FUCA1 activity up to 100 mM, a result that human individual and a patient suffering from Gaucher disease
corroborates previous ndings on some of the congurational to ABP 1. As can be seen in Fig. 4C, a single uorescent protein
analogues, which were reported as poor fucosidase inhibitors.25 migrating slightly below 50 kDa was uorescently labeled. The
As the next research objective, we examined activity-based labeled band from human Gaucher spleen lysate is considerably
proling of GH29 a-L-fucosidases from varying sources with more intense than the corresponding band in healthy human
green-uorescent aziridine ABP 1, in the presence or absence spleen, reecting elevated a-L-fucosidase activity in the former.
of excess concentrations of, either the mechanism-based This result corroborates earlier observations that mRNA
inhibitor 4 or the competitive inhibitor 6. As is shown in encoding lysosomal glycosidases are upregulated in Gaucher
Fig. 4A, ABP 1 efficiently labels puried a-L-fucosidase from tissue.26 As before, labeling with ABP 1 was suppressed aer pre-
Bacteroides thetaiotaomicron. In lysates from an E. coli culture treatment with either N-benzoyl aziridine 4 or L-fuconojirimycin
overexpressing recombinant a-L-fucosidase from Bacteroides 6. To further ascertain that ABP 2 labels mammalian GH29
thetaiotaomicron gene 2970, several uorescent protein bands retaining a-L-fucosidases we performed a number of control
are visible upon labeling with 1 (ESI Fig. S1†), with the most experiments (ESI Fig. S2a†). Compound 1 labeled both FUCA1
prominent band at around 50 kDa, corresponding to the and FUCA2 that were overexpressed in COS cells. Treatment of
predicted molecular weight of the enzyme. Labeling of the murine spleen lysates with 1 yielded a result essentially as
major band at 50 kD could moreover be blocked following pre- observed for healthy human tissue (ESI Fig. S2b†).
incubation with either 100 mM 4 or with 5 mM 6 (ESI Fig. S1†).
Red uorescent ABP
Finally, we evaluated the simultaneous labeling of retaining
2
labels a-(1-2,3,4) and a-(1-6)- b-glucosidases and retaining a-L-fucosidase. To this end we
incubated tissue lysates with 1 and our previously18 reported
broad-spectrum activity-based retaining b-glucosidase probe,
JJB75 (see for its structure, ESI Fig. S3†). As can be seen (Fig. 4D)
the applied ABPs label a distinct set of proteins. Since they bear
complementary uorophores they can be used jointly to prole
both retaining glycosidase families in a single experiment.
The FUCA1 enzymatic activity is maximal at around pH 4.5
(see ESI Fig. S4†), consistent with the acidic pH of its natural
lysosomal environment. Labeling efficiency with 1 largely
reects the pH dependence of FUCA1 at pH below 7. Of note,
the pH dependence of labeling of FUCA1 does not follow that of
its enzymatic activity. At alkaline conditions, where enzymatic
activity is low, labeling still proceeds. We made similar obser-
vations in the past for ABPP of retaining b-exoglucosidases
using cyclophellitol b-aziridine ABPs.14 This result reveals the
high reactivity of the aziridine probes in the initial displace-
ment step employed by retaining glycosidases, a feature which,
in conjunction with their selectivity in binding and relative
stability in physiological environment, explains their efficacy as
activity-based glycosidase probes.27
Assessment of uorescent labeling kinetics by employing
10 nM 1 labeling at stoichiometric concentrations of rhFUCA1
at 4 ꢁC and 37 ꢁC revealed that, during time-course experiments,
examined on SDS-PAGE gels, labeling is near complete within
the rst minute at 4 ꢁC (ESI Fig. S5a†), impairing accurate
determination of kinetic constants. This rapid reaction with
both 1 and 2 also precluded a classic determination of kinetic
constants following a time-dependent decrease in detectable
Fig. 4 In vitro activity-based protein profiling of GH29 a-L-fucosi-
dases. (A) Labeling with ABP 1 of recombinant a-L-fucosidase from
Bacteroides thetaiotaomicron 2970. (B) In vitro labeling of lysate of
spleen from a Gaucher disease patient, a-(1-2,3,4)-fucosidase from
Xanthomonas sp. and a-(1-6)-fucosidase from Elizabethkingia mir-
icola with ABP 2. (C) In vitro labeling of human healthy and Gaucher
disease spleen. (D) Direct labeling of GH29 a-L-fucosidases with
green-fluorescent ABP 1 and retaining b-glucosidases GBA, GBA2 and
GBA3 with red-fluorescent JJB75.18 The location of albumin auto-
fluorescence is designated on each gel.
4-methylumbelliferone (ESI Fig. S5b†).
In vivo GH29 a-L-fucosidase assays
The ability of 1 to label a-L-fucosidase in living mice was
investigated next. Four wild-type C57Bl/6J male mice were
injected with 100 mL vehicle (PBS) or PBS containing 10, 100 or
1000 pmol 1. Aer two hours, the mice were anesthetized,
Chem. Sci.
This journal is © The Royal Society of Chemistry 2015

View Article Online
Edge Article
Chemical Science
perfused with PBS and then brain, spleen, liver and kidney
tissues were isolated. Tissue homogenates were prepared and
each lysate was labeled prior to gel electrophoresis with red-
uorescent cyclophellitol b-aziridine JJB75, which labels b-exo-
glucosidases as loading control (ESI Fig. S6†). Furthermore,
tissue homogenates of vehicle-treated animals were labeled
with excess 1 to visualize the maximal a-L-fucosidase labeling
achievable in each tissue.
Aer treatment of mice with ABP 1, a dose-dependent
Fig.
6
Competitive ABPP on recombinant FUCA1 with deoxy-
labeling of retaining a-L-fucosidases is observed in spleen, liver fuconojirimycin 6 and configurational analogues 7–13 towards a-L-
fucosidases, with ABP 1 labeling as readout.
and kidney (Fig. 5). Injection of 1000 pmol 1 results in
substantial labeling of a-fucosidase in spleen, liver and kidney.
Detected uorescence levels are comparable to that in matching
peptide analysis by LC-MS/MS and matching against the human
UniProt database, using the Mascot search engine as previously
reported.14 FUCA1 was identied aer ABP 3 pull-down as one
of the top identied proteins (Table S1A) in the ESI data, but
was not found in the competitive (Table S1B) or untreated
control (Table S1C†). Proteins with higher scores were back-
ground proteins such as abundant endogenously biotinylated
PCCA and PC, and keratin contaminations. FUCA1 was selec-
tively found in the ABP 3-pull down experiment only. ESI Table
S2† shows the analysis parameters of the identied peptides
from FUCA1, with accuracy below 5 ppm, and Mascot ion scores
above 40 (indicating reliable MS/MS fragment annotation and
match) and manually curated fragmentation patterns. These
results show FUCA1 can be undisputedly affinity puried and
identied via biotinylated ABP 3. Moreover the binding of ABP 3
can be completely blocked by pre-incubation with ABP 1, which
may indicate that both ABPs bind at the same site of the
enzyme.
samples from vehicle-treated mice incubated in vitro with excess
1. In contrast, no in vivo brain FUCA1 labeling was observed
aer any of the administered doses of ABP 1, and we conclude
that ABP 1, just as its b-glucose and a-galactose congeners,14,15
does not penetrate the brain.
Competitive activity-based GH29 a-L-fucosidase proling
Having established the efficacy of ABP 2 to selectively label
GH29 retaining a-L-fucosidases from various sources in an
activity-based manner, we determined the inhibition potential
of deoxyfuconojirimycin 6 and its 7 stereoisomers 7–13 in a
competitive ABPP format (Fig. 6). In contrast to 6, none of the
seven congurational isomers 7–13 were capable of blocking
ABP 1 labeling of a-L-fucosidase, a result that matches with the
data on inhibition of recombinant FUCA1 in the uorogenic
activity assay (Table 1).
Identication of biotin labeled GH29 a-L-fucosidases
To further determine the specicity of the developed ABPs, we
have analyzed the ABP-labeled proteins in a complex tissue
homogenate. For this purpose, we incubated Gaucher spleen
3-D crystal structure analysis of bacterial FUCA1 complexed to
4 and 5
lysate with biotinylated ABP 3 or with DMSO only (control) or In order to obtain experimental evidence for the formation of a
competitive ABP 3-labeling by rst incubating with uorescent covalent adduct between a-L-fucosidase and ABPs 1, 2 and 3, a
ABP 1. Glycosylated proteins were then enriched via ConA, fol- crystal structure of BtFuc2970 (oen used as a surrogate for the
lowed by affinity purication with streptavidin coated para- mammalian enzyme) with mechanism-based inhibitor 4 was
magnetic beads. The identity of biotinylated and ABP 3-labeled obtained (PDB code 4WSK). While the resulting crystal structure
proteins was determined by on-bead digestion with trypsin, clearly demonstrates the formation of an enzyme–4 complex,
electron density around the aryl group of the inhibitor
“aglycon” moiety was close to the side-chain of the catalytic
acid/base of the enzyme, residue E288 (ESI Fig. S7†) resulting in
disorder. This likely reects steric clashing and considerable
conformational exibility in the 4 aglycon when bound to
BtFuc2970. “Aglycon” here reects the aziridine N-acyl moiety to
which the BODIPY tags are graed in ABPs 1 and 2 and which is
designed to occupy the space normally occupied by the
substrate fucoside.
In our design of aziridine-based retaining exo-glycosidase
ABPs we made the assumption that such aglycon-like moieties
would not interfere with enzyme binding (this also based on the
numerous uorogenic substrates that are in use to study exo-
Fig.
5 In vivo labeling of a-L-fucosidases in mice with various
glycosidases and in which the aglycon moiety can take on made
shapes and sizes). The 3-D fold of BtFuc2970, however, appears
not to provide sufficient space to accommodate an extended aryl
concentrations of ABP 1 during 2 hours. In vivo labeling compared to
maximal labeling with excess ABP 1 of matched homogenates (Ctrl).
The location of albumin autofluorescence is designated on each gel.
This journal is © The Royal Society of Chemistry 2015
Chem. Sci.

View Article Online
Chemical Science
Edge Article
aglycon pendant to the atom, which would equate to the ring that are annulated to cyclohexane rings preferably open in a
oxygen in fucose. In order to minimize steric clashes, BtFuc2970 trans-diaxial fashion through a chair-like transition state, reac-
was subsequently incubated with 5. The crystal structure of the tion with the a-L-fucosidase nucleophile takes place at the
resulting complex (PDB code 4WSJ) revealed unambiguous aziridine carbon corresponding to the anomeric center of a
electron density for the presence of a covalent enzyme–5 substrate a-L-fucoside. This corresponds to ring opening to yield
complex (Fig. 7). The complex has C–O bond lengths between a skew boat, as is observed in the trapped enzyme active site in
˚
the BtFuc2970 catalytic nucleophile and 5 of ca. 1.43 A as would the co-crystal.
be expected for a C–O ester bond. As expected from the reduc-
In conclusion, we offer ABPs 1, 2 and 3 as reagents for the
tion in aglycon size, 5 is better ordered than 4 when bound to discovery and annotation of new members of the GH29 family
the bacterial enzyme and provides a clearer denition of the of a-L-fucosidase in comparative ABPP experiments, for moni-
resulting conformation and interactions. Upon trans-diaxial toring retaining a-L-fucosidase activities in health and disease,
opening of the acylaziridine the covalently bound and and for the discovery of inhibitors able to interfere with specic
3
substituted cyclohexane adopts a slightly distorted H4 confor- a-L-fucosidases in competitive ABPP experiments. ABPs 1, 2 and
mation (between 3H4 and 3S1); consistent with the expected 3 add to our growing series of in situ and in vivo active retaining
catalytic itinerary.28
glycosidase ABPs and moreover their design hold promise
for the design of ABPs targeting retaining glycosidases recog-
nizing and processing differently congured and substituted
carbohydrates.
Conclusions
We have developed the potent and selective aziridine-based
ABPs 1, 2 and 3 for selective proling of active GH29 a-L-fuco-
sidases in cell extracts from bacteria, mice and man as well as
in vivo in mice. Labeling of GH29 retaining a-L-fucosidases with
our L-fucopyranose-congured, cyclophellitol aziridine-based
ABPs proceeds with good efficiency and high selectively both
in vitro and in vivo with the single caveat that the probes do not
penetrate brain tissue in mice. The covalent irreversible azir-
idine inhibitors proved much more potent than their imino-
sugar counterparts, of which L-fuconojirimycin 6 appeared to be
the single compound from this set of congurational isomers
that is able to inhibit FUCA1 in a competitive ABPP setting. The
crystal structures of a-L-fucosidase from Bacteroides thetaiotao-
micron in complex with compound 4 and 5 provide strong
evidence for the covalent binding of cyclophellitol aziridine to
active a-L-fucosidases and by this virtue the validity of the
cyclophellitol aziridine design for activity-based proling of
retaining glycosidases that employ the Koshland double
displacement mechanism. Whereas aziridines and epoxides
Experimental section
Synthesis
The synthesis, analytical and spectroscopical analysis of
L-fuconojirimycin congured cyclophellitol aziridines 1–5 and
L-fuconojirimycin isomers 6–13 is described in the ESI.†
Biological assays
Materials. Cyclophellitol b-aziridine ABP JJB75 was synthe-
sized as described earlier.18 Gaucher patients were diagnosed on
the basis of reduced GBA activity and demonstration of an
abnormal genotype.30 Cell lines were cultured in HAMF12-
DMEM medium (Invitrogen) supplied with 10% (v/v). Spleens
from a normal subject and a patient suffering from type 1
Gaucher were collected aer splenectomy and immediately
stored frozen.
Molecular cloning and recombinant expression. The coding
sequences of H. sapiens FUCA1 (NCBI reference sequence
XM_005245821.1, using forward primer 50-GGGGACAAGTTTG
TACAAAAAAGCAGGCTCCACCACCATGCGGGCTCCGGGGATG-30
and reverse primer 50-GGGGACCACTTTGTACAAGAAAGCTGGG
TCTTACTTCACTCCTGTCAGCTTTAT-30), and of H. sapiens
FUCA2 (NCBI reference sequence NM_032020.4, using forward
primer 50-GGGGACAAGTTTGTACAAAAAAGCAGGCTC CACCAC
CATGCGGCCCCAGGAGCTC-30 and reverse primer 50-GGGGAC
CACTTTGTACAAGAAAGCTGGGTCT TAGATCACATTAGTCAGG
GCTA-30) were amplied via PCR and cloned into pDNOR-221
and thereaer sub-cloned in pcDNA™-DEST40 vector using the
Gateway system (Invitrogen). Correctness of all constructs was
veried by sequencing. Conuent COS-7 cells were transfected
with pcDNA3.1 empty vector (Mock) or the vector with described
insert in conjunction with FuGENE (Roche). Aer 72 hours,
medium isolated and frozen at ꢀ80 ꢁC and cells were harvested
by scraping in 25 mM potassium phosphate buffer (pH 6.5,
supplemented with 0.1% (v/v) Triton X-100 and protease
inhibitor cocktail (Roche)). Aer determination of the protein
Fig. 7 Crystal structure of a-L-fucosidase from Bacteroides thetaio-
taomicron in complex with 5. Catalytic residues are annotated: Asp
229 (nucleophile) and Glu 288 (acid/base). Electron density displayed
is Fo–Fc density from phases calculated prior to the inclusion of 5 in
refinement, contoured at 3s. Figure was prepared using CCP4MG.29
Chem. Sci.
This journal is © The Royal Society of Chemistry 2015

View Article Online
Edge Article
Chemical Science
concentration ꢁ(BCA kit, Pierce), lysates were aliquoted and sonicated three times for 10 seconds at 100% strength and kept
frozen at ꢀ80 C.
on ice. Aer 2 min, procedure repeated twice. Lysate was then
Enzyme activity assays. The enzymatic activity of a-L-fucosi- centrifuged for 10 min at 10 000 g, supernatant collected care-
ꢁ
dase was assayed at 37 C by incubating with 1.5 mM 4-meth- fully, protein concentration determined and 200 mg total protein
ylumbelliferyl-a-L-fucopyranoside as substrate in 150 mM was then incubated with either 0.1% (v/v) DMSO, ABP 1 or ABP 3,
McIlvaine buffer, pH 4.5, supplemented with 0.1% (w/v) BSA. To or rstly with 10 mM ABP 1 followed by 10 mM of ABP 3, each step
determine the apparent IC50 value, COS-7 cell lysate containing taking 30 min at 37 ꢁC, in a total volume of 1 mL McIlvaine
over-expressed human recombinant FUCA1 was pre-incubated buffer, pH 4.5. Glycosylated biomolecules were enriched by using
with a range of inhibitor dilutions for 30 min at 37 ꢁC. The 1 mL ConA-Sepharose per sample, according to manufacturer's
reaction was quenched by adding excess NaOH–glycine instructions (Amersham Pharmacia Biotech AB, Sweden) and
(pH 10.6), aer which uorescence was measured with a uo- subsequently denatured by the presence of 2% (w/v) SDS and
rimeter LS55 (Perkin Elmer) using lEX 366 nm and lEM 445 nm. boiling for 5 min at 100 ꢁC. From here on, samples were prepared
In vitro labeling and SDS-PAGE analysis. All pre-incubations for MS as published earlier.14 Aer desalting on StageTips,
ꢁ
and ABP labeling-reactions occurred for 30 min at 37 C. Total peptides were analyzed with a 2 h gradient of 5–25% ACN on
lysates (50 mg), medium (500 mg) or puried protein preparations nano-LC, hyphenated to an LTQ-Orbitrap and identied via the
(5 mg) were labeled with 1 mM JJB256 1 or JJB244 2, dissolved in Mascot protein search engine.14
150 mM McIlvaine buffer, pH 4.5, incubating for 30 min at 37 ꢁC.
X-ray crystallography. Recombinant Bacteroides thetaiotao-
For ABPP, protein preparations were pre-incubated with micron 2970 a-L-fucosidase (BtFuc2970) was prepared as
compounds 4 (100 mM), 6 (100 mM), 7–13 (1 or 5 mM, specied in described previously.28 Protein crystals were obtained through
the main text) prior to the addition of 100 nM uorescent ABPs. hanging (Crystals soaked with compound 5) or sitting (crystals
Inuence of pH on ABP labeling involved pre-incubation at pH 3– soaked with compound 4) drop vapor diffusion (for further
10 prior to addition of 100 nM ABP 1. Direct labeling of retaining details see PDB le headers). Compounds 4 and 5 were dis-
b-glucosidases occurred at pH 5.0 in conjunction with 100 nM solved in crystallization mother liquor at a concentration of 5 or
ABP JJB75. Samples were then denatured with 5ꢃ Laemmli buffer 20 mM respectively and added to crystallization drops con-
(50% (v/v) 1 M Tris–HCl, pH 6.8, 50% (v/v) 100% glycerol, 10% taining crystals of BtFuc2970 in a 1 : 1 ratio. Aer ca. 1 h soaking
(w/v) DTT, 10% (w/v) SDS, 0.01% (w/v) bromophenol blue), boiled with ligands, crystals were shed into cryo-protectant solutions
for 4 min at 100 ꢁC, and separated by gel electrophoresis on 10% (mother liquor supplemented with 20% v/v glycerol) and cryo-
(w/v) SDS-PAGE gels running continuously at 90 V.13,14 Wet slab- cooled in liquid nitrogen. Diffraction data were collected at
gels were scanned on uorescence using a Typhoon Variable Diamond Light Source. Diffraction images were indexed and
Mode Imager (Amersham Biosciences) using lEX 488 nm and lEM integrated using MOSFLM29 (4) or XDS31 (5) and scaled and
520 nm (band pass lter 40 nm) for green uorescent JJB256 1 merged using AIMLESS.32 Crystals grew in an almost isomor-
and lEX 532 nm and lEM 610 nM (band pass lter 30 nm) for red phous space group to PDB entry 4JFV, and coordinates from this
uorescent JJB244 2 and JJB75.
entry were used directly to obtain a starting model for rene-
In vivo labeling. The appropriate ethics committee for ment. Iterative stages of model-building (COOT33) and
animal experiments approved all experimental procedures. maximum-likelihood renement (REFMAC5 (ref. 34)) were
Wild-type C57Bl/6J male mice were obtained from Harlan and conducted to yield nal models. Maximum-likelihood restraints
fed a commercially available lab diet (RMH-B; Hope Farms). for compounds 4 and 5 were created using the PRODRG online
Four C57BL/6J mice were injected intraperitoneally with server35 and link restraints generated using JLIGAND.36 X-ray
100 mL sterile PBS (vehicle) or PBS containing 10, 100, or crystallographic data statistics are available in ESI Table S3.†
1000 pmol of ABP 1 (about 0.2 mg kgꢀ1, 2 mg kgꢀ1, and
20 mg kgꢀ1, respectively). At 2 h post-administration, urine was
collected and the mice were anesthetized with FFM mix (25/25/
Acknowledgements
50 fentanylcitrate/midazalam/H2O), blood was collected and The work in Leiden and Amsterdam was supported by the China
perfused with PBS at 3.0 mL minꢀ1. Then urine and organs Research Council (PhD grant, to JBJ), the Netherlands Organi-
were collected and directly frozen in liquid nitrogen. Homog- zation for Scientic Research (NWO, ChemThem grant to JMA
enates were made in 25 mM potassium phosphate buffer, and HSO) and the European Research Council (ERC AdG
pH 6.5, supplemented with 0.1% (v/v) Triton X-100 and ‘ChemBioSphing’, to HSO and JMA). The work in York was
protease inhibitor cocktail (Roche). Aer determination of supported by the Biotechnology and Biological Sciences
protein concentration (BCA kit, Pierce), 50 mg total protein was Research Council (BBSRC) through a Ph.D. studentship to D. W.
incubated with 100 nM red uorescent JJB75 and analyzed by W. ABPP work in York is further supported through the ERC
SDS-PAGE. As controls, matching tissue homogenates of (ERC-2012-AdG-322942). The authors thank ChemAxon for the
vehicle-treated animals were concomitantly labeled with 1 mM academic licensed soware.
ABP 1 and 100 nM JJB75 prior to SDS-PAGE.
ABP pulldown and LC-MS/MS analysis. Gaucher spleen lysate
(1 g) was cut with a sterile scalpel, mixed with 4 mL 25 mM
Notes and references
potassium phosphate buffer (pH 6.5, supplemented with 0.1%
(v/v) Triton X-100 and protease inhibitor cocktail (Roche)) and
1 J. Intra, M.-E. Perotti, G. Pavesi and D. Horner, Gene, 2007,
392, 34–46.
This journal is © The Royal Society of Chemistry 2015
Chem. Sci.

View Article Online
Chemical Science
Edge Article
¨
2 V. Lombard, H. Golaconda Ramulu, E. Drula, P. M. Coutinho 20 H. Griengl, N. Klempier, P. Pochlauer, M. Schmidt, N. Shi
and B. Henrissat, Nucleic Acids Res., 2014, 42, D490–D495.
3 S. W. Liu, C. S. Chen, S. S. Chang, K. K. T. Mong, C. H. Lin,
and A. A. Zabelinskaja-Mackova, Tetrahedron, 1998, 54,
14477–14486.
C. W. Chang, C. Y. Tang and Y. K. Li, Biochemistry, 2009, 48, 21 A. D. Campbell, T. M. Raynham and R. J. K. Taylor, Synthesis,
110–120. 1998, 1707–1709.
4 L. Guillotin, P. Late and R. Daniellou, Biochemistry, 2014, 22 G. W. J. Fleet, A. N. Shaw, S. V. Evans and L. E. Fellows, J.
53, 1447–1455. Chem. Soc., Chem. Commun., 1985, 841–842.
5 B. Cobucci-Ponzano, M. Mazzone, M. Rossi and M. Moracci, 23 E. G. J. C. Warmerdam, A. M. C. H. van den Nieuwendijk,
Biochemistry, 2005, 44, 6331–6342.
6 F. A. Shaikh, A. L. van Bueren, G. J. Davies and S. G. Withers,
Biochemistry, 2013, 52, 5857–5864.
J. Brussee, A. van der Gen and C. G. Kruse, Recl. Trav.
Chim. Pays-Bas, 1996, 115, 20–24.
24 E. Moreno-Clavijo, A. T. Carmona, A. J. Moreno-Vargas,
L. Molina and I. Robina, Curr. Org. Synth., 2011, 8, 102–133.
7 D. E. Koshland, Biol. Rev., 1953, 28, 416–436.
8 T. W. Liu, C. W. Ho, H. H. Huang, S. M. Chang, S. D. Popat, 25 (a) Y. Bleriot, D. Gretzke, T. M. Krulle, T. D. Butters,
Y. T. Wang, M. S. Wu, Y. J. Chen and C. H. Lin, Proc. Natl.
Acad. Sci. U. S. A., 2009, 106, 14581–14586.
9 J. S. O'Brien, P. J. Willems, H. Fukushima, J. R. de Wet,
J. K. Darby, R. D. Cioccio, M. L. Fowler and T. B. Shows,
Enzyme, 1987, 38, 45–53.
10 K. Phopin, W. Nimlamool, L. J. Lowe-Krentz, E. W. Douglass,
J. N. Taroni and B. S. Bean, Mol. Reprod. Dev., 2013, 80, 273–
285.
R. A. Dwek, R. J. Nash, N. Asano and G. W. Fleet,
Carbohydr. Res., 2005, 340, 2713–2718; (b) A. Bordier,
P. Compain, O. R. Martin, K. Ikeda and N. Asano,
Tetrahedron: Asymmetry, 2003, 14, 47–51; (c) P. Jakobsen,
J. M. Undbeck, M. Kristiansen, J. Breinholt, H. Demuth,
J. Pawlas, M. P. Torres Candela, B. Andersen,
N. Westergaard, K. Lundgren and N. Asano, Bioorg. Med.
Chem., 2001, 9, 733–744; (d) J. Streith, A. Boiron,
J.-L. Paillaud, E.-M. Rodriguez-Perez, C. Strehler,
T. Tschamber and M. Zehnder, Helv. Chim. Acta, 1995, 78,
61–72.
11 D. G. Hildebrand, S. Lehle, A. Borst, S. Haferkamp,
F. Essmann and K. Schulze-Osthoff, Cell Cycle, 2013, 12,
1922–1927.
12 M. G. Giardina, M. Matarazzo, R. Morante, A. Lucariello, 26 M. T. Moran, J. P. Schoeld, A. R. Hayman, G. P. Shi,
A. Varriale, V. Guardasole and G. De Marco, Cancer, 1998,
83, 2468–2474.
E. Young and T. M. Cox, Blood, 2000, 96, 1969–1978.
27 L. I. Willems, J. Jiang, K.-Y. Li, M. D. Witte,
¨
W. W. Kallemeijn, T. J. N. Beenakker, S. P. Schroder,
13 B. F. Cravatt, A. T. Wright and J. W. Kozarich, Annu. Rev.
Biochem., 2008, 77, 383–414.
´
J. M. F. G. Aerts, G. A. van der Marel, J. D. C. Codee and
14 W. W. Kallemeijn, K. Y. Li, M. D. Witte, A. R. Marques,
H. S. Overklee, Chem.–Eur. J., 2014, 20, 10864–10872.
`
J. Aten, S. Scheij, J. Jiang, L. I. Willems, T. M. Voorn- 28 A. Lammerts van Bueren, A. Ardevol, J. Fayers-Kerr, B. Luo,
´
Brouwer, C. P. van Roomen, R. Ottenhoff, R. G. Boot,
Y. Zhang, M. Sollogoub, Y. Bleriot, C. Rovira and
H. van den Elst, M. T. Walvoort, B. I. Florea, J. D. Codee,
G. J. Davies, J. Am. Chem. Soc., 2010, 132, 1804–1806.
G. A. van der Marel, J. M. Aerts and H. S. Overklee, 29 S. Mcnicholas, E. Potterton, K. S. Wilson and M. E. M. Noble,
Angew. Chem., Int. Ed. Engl., 2012, 51, 12529–12533. Acta Crystallogr., Sect. D: Biol. Crystallogr., 2011, 67, 386–394.
15 L. I. Willems, T. J. M. Beenakker, B. Murray, S. Scheij, 30 I. M. Aerts and S. van Weely, Hum. Mutat., 1997, 10, 348–358.
W. W. Kallemeijn, R. G. Boot, M. Verhoek, W. E. Donker- 31 A. G. W. Leslie, Acta Crystallogr., Sect. D: Biol. Crystallogr.,
Koopman, M. J. Ferraz, E. R. van Rijssel, B. I. Florea,
2006, 62, 48–57.
J. D. C. Codee, G. A. van der Marel, J. M. F. G. Aerts and 32 W. Kabsch, Acta Crystallogr., Sect. D: Biol. Crystallogr., 2010,
H. S. Overklee, J. Am. Chem. Soc., 2014, 136, 11622–11625. 66, 125–132.
16 M. J. Niphakis and B. F. Cravatt, Annu. Rev. Biochem., 2014, 33 P. Emsley, B. Lohkamp, W. G. Scott and K. Cowtan, Acta
83, 341–377. Crystallogr., Sect. D: Biol. Crystallogr., 2010, 66, 486–501.
17 Y. Harrak, C. M. Barra, A. Delgado, A. R. Castano and 34 G. N. Murshudov, P. Skubak, A. A. Lebedev, N. S. Pannu,
´
A. Llebaria, J. Am. Chem. Soc., 2011, 133, 12079–12084.
18 K.-Y. Li, J. Jiang, M. D. Witte, W. W. Kallemeijn, H. van den
Elst, C.-S. Wong, S. D. Chander, S. Hoogendoorn,
R. A. Steiner, R. A. Nicholls, M. D. Winn, F. Long and
A. A. Vagin, Acta Crystallogr., Sect. D: Biol. Crystallogr.,
2011, 67, 355–367.
´
T. J. M. Beenakker, J. D. C. Codee, J. M. F. G. Aerts, 35 A. W. Schuttelkopf and D. M. F. van Aalten, Acta Crystallogr.,
G. A. van der Marel and H. S. Overklee, Eur. J. Org. Chem.,
2014, 2014, 6030–6043.
Sect. D: Biol. Crystallogr., 2004, 60, 1355–1363.
36 A. A. Lebedev, P. Young, M. N. Isupov, O. V. Moroz,
A. A. Vagin and G. N. Murshudov, Acta Crystallogr., Sect. D:
Biol. Crystallogr., 2012, 68, 431–440.
¨
19 O. David, W. J. N. Meester, H. Bieraugel, H. E. Schoemaker,
H. Hiemstra and J. H. van Maarseveen, Angew. Chem., Int.
Ed., 2003, 42, 4373–4375.
Chem. Sci.
This journal is © The Royal Society of Chemistry 2015