Studies on the anti-hepatitis C virus activity of newly synthesized tropolone derivatives: Identification of NS3 helicase inhibitors that specifically inhibit subgenomic HCV replication

Article abstract of DOI:10.1016/j.bmc.2010.05.066

We synthesized new tropolone derivatives substituted with cyclic amines: piperidine, piperazine or pyrrolidine. The most active anti-helicase compound (IC₅₀= 3.4 μM), 3,5,7-tri[(4′-methylpiperazin-1′-yl) methyl]tropolone (2), inhibited RNA replication by 50% at 46.9 μM (EC ₅₀) and exhibited the lowest cytotoxicity (CC₅₀) >1 mM resulting in a selectivity index (SI = CC₅₀/EC₅₀) >21. The most efficient replication inhibitor, 3,5,7-tri[(4′-methylpiperidin- 1′-yl)methyl]tropolone (6), inhibited RNA replication with an EC ₅₀ of 32.0 μM and a SI value of 17.4, whereas 3,5,7-tri[(3′- methylpiperidin-1′-yl)methyl]tropolone (7) exhibited a slightly lower activity with an EC₅₀ of 35.6 μM and a SI of 9.8.

Full text of DOI:10.1016/j.bmc.2010.05.066

Bioorganic & Medicinal Chemistry 18 (2010) 5129–5136
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Studies on the anti-hepatitis C virus activity of newly synthesized tropolone
derivatives: Identification of NS3 helicase inhibitors that specifically inhibit
subgenomic HCV replication
a,
a
a,c,
Andzelika Najda-Bernatowicz , Mariusz Krawczyk a,b, , Anna Stankiewicz-Drogon , Maria Bretner
,
*
_
´
Anna M. Boguszewska-Chachulska b,c,
a Institute of Biochemistry and Biophysics PAS, Pawinskiego 5a, 02-106 Warsaw, Poland
*
b Genomed, Ponczowa 12, 02-971 Warsaw, Poland
c Warsaw University of Technology, Faculty of Chemistry, Noakowskiego 3, 00-664 Warsaw, Poland
a r t i c l e i n f o
a b s t r a c t
Article history:
We synthesized new tropolone derivatives substituted with cyclic amines: piperidine, piperazine or pyr-
rolidine. The most active anti-helicase compound (IC50 = 3.4
M), 3,5,7-tri[(40-methylpiperazin-10-
yl)methyl]tropolone (2), inhibited RNA replication by 50% at 46.9 M (EC50) and exhibited the lowest
Received 30 December 2009
Revised 21 May 2010
Accepted 25 May 2010
Available online 2 June 2010
l
l
cytotoxicity (CC50) >1 mM resulting in a selectivity index (SI = CC50/EC50) >21. The most efficient replica-
tion inhibitor, 3,5,7-tri[(40-methylpiperidin-10-yl)methyl]tropolone (6), inhibited RNA replication with an
EC50 of 32.0
exhibited a slightly lower activity with an EC50 of 35.6
l
M and a SI value of 17.4, whereas 3,5,7-tri[(30-methylpiperidin-10-yl)methyl]tropolone (7)
Keywords:
Hepatitis C virus
NS3 Helicase
l
M and a SI of 9.8.
Ó 2010 Elsevier Ltd. All rights reserved.
Tropolone derivatives
Subgenomic HCV replicon
Antiviral activity
1. Introduction
the wood of members of the Cupressaceae family and have already
been demonstrated to possess antimicrobial,3,4 antifungal and
insecticidal properties.5,6 The tropolone derivative b-thujaplicinol
is a selective inhibitor of the ribonuclease H activity of the HIV
Hepatitis C virus (HCV) remains one of the most important viral
threats to human health in spite of advanced studies on the develop-
ment of new drugs.1 The present treatment for HCV infection is still
reverse transcriptase.7 Furthermore, copper chelates of
a
-, b- and
-thujaplicins inhibited apoptosis induced by Human influenza
virus and prevented viral release and spread of the infection, and
-thujaplicin showed a strong cytotoxic effect in vitro in the cell
limited to the pegylated interferon-
a
(IFN-a) in combination with
c
ribavirin, with response rates (sustained virological response)
between 40% and 50% for genotype 1, the most prevalent genotype
in Europe and the United States and up to 80% for genotypes 2
and 3.2 Even the introduction of new directly acting antivirals tar-
geted against the viral protease and polymerase will not solve one
of the major problems encountered when treating HCV infec-
tions—that of viral breakthroughs due to the emergence of HCV mu-
tants resistant to the treatment applied, observed also during the
clinical trials with telaprevir, a protease inhibitor.1
Searching for an alternative, effective and well tolerated ther-
apy against HCV we continued our studies on derivatives of tropo-
lone. Tropolone is an aromatic but non-benzenoid compound
consisting of a seven carbon ring. Tropolones naturally occur in
a
line of murine lymphocytic leukaemia, while its 50%-lethal dose
value in mice was quite low (256 mg/kg).8–10 Hinokitiol (b-thuja-
plicin) and tropolone exhibit strong cytotoxic effects on selected
murine and human tumour cell lines.11
Our previous screening for potential HCV NS3 helicase inhibi-
tors revealed the inhibitory activity of tropolone derivatives, espe-
cially 3,7-dibromo-5-(morpholin-40-ylmethyl)tropolone (11).12 On
the basis of these initial results, we synthesized new tropolone
derivatives substituted with cyclic amines: piperidine, piperazine
or pyrrolidine and tested their activity against the HCV NS3 heli-
case. To examine the anti-HCV activity of tropolone derivatives se-
lected using the helicase assay, studies on inhibition of RNA
replication in the HCV subgenomic replicon system developed by
Bartenschlager and co-workers were carried out.13,14 Our results
confirm that the helicase assay allows the selection of compounds
with significant antiviral activity that may be considered as lead
compounds for the development of anti-HCV agents.
* Corresponding authors. Tel.: +48 22 234 7570; fax: +48 22 6282741 (M.B.); tel.:
+48 22 498 2948; fax: +48 22 644 60 25 (A.M.B.-C.).
E-mail addresses: mbretner@ch.pw.edu.pl (M. Bretner), annab-ch@genomed.pl
(A.M. Boguszewska-Chachulska).
These authors contributed equally to this work.
0968-0896/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2010.05.066

5130
A. Najda-Bernatowicz et al. / Bioorg. Med. Chem. 18 (2010) 5129–5136
O
2. Results and discussion
H
R3
OH
N
C
H
2.1. Synthesis and characterization of tropolone derivatives
1
1
C
N
C
H2C
CH2
7
1
2
6
2
H2C
CH2
5
The tropolone derivatives employed in this study and their
abbreviations are presented in Scheme 1. 3,5,7-Tri(piperidin-10-
ylmethyl)tropolone (1) was synthesized by a modification of the
published method.15 The mixture of tropolone and 37% aqueous
formaldehyde was treated with 1-methylpiperazine. After adding
the amine the temperature rose, the suspension dissolved and
the resulting dark-orange solution was stirred at 70 °C for 7 min.
After cooling, the product precipitated and was purified by crystal-
lization. The method mentioned above was slightly modified to ob-
tain the other analogs of tropolone, 3,5,7-tri(pyrrolidin-10-
ylmethyl)tropolone (3), 3,5,7-tri[(40-pyrrolidin-100-ylpiperidin-10-
yl)methyl]tropolone (4) and 3,5,7-tri [(40-hydroxypiperidin-10-
yl)methyl]tropolone (8) (Scheme 2).
2
HC
C
H2C
CH
6
R1
3
5
3
X
CH2
R4
CH2
C
CH
4
4
3
5
4
R5
R2
Cyclic amine (A1)
Cyclic amine (A2)
When the mixture of tropolone and 1-methylpiperazine was
treated with formaldehyde and stirred at 65 °C for 5 min, 3,5,7-
tri[(40-methylpiperazin-10-yl)methyl]tropolone (2, Scheme 2) was
obtained and purified by crystallization. This method was also used
for
the
synthesis
of
3,5,7-tri
[(40-methylpiperidin-10-
yl)methyl]tropolone (6) and 3,5,7-tri [(30-methylpiperidin-10-
yl)methyl]tropolone (7) (Scheme 2).
The halogeno derivatives of tropolone were synthesized using
the procedure reported by Barhate et al. for the halogenation of
aliphatic or aromatic hydrocarbons, aromatic amines and naph-
thalenes.16–18 This method relies on the oxidation of hydrochloric
or hydrobromic acid by hydrogen peroxide to generate positive
halogen species in situ, leading to chloro or bromo derivatives
of aromatic compounds. For the synthesis of 3,7-dichlorotropo-
lone (5, Scheme 3) about 6 equiv of 36% aqueous HCl with 30%
aqueous H2O2 were used. The 3,7-dibromotropolone (9) was ob-
tained together with 3-bromotropolone (10) (Scheme 3) using
2 equiv of 48% aqueous HBr and 30% aqueous H2O2 in a metha-
nolic solution at a low temperature (4 °C). The compounds were
separated by crystallization from methanol.
Scheme 1. Structures of tropolone derivatives.
OH
O
N
N
a
N
O
OH
3
b
R5
X
R4
O
OH
N
1; X = CH, R4 = R5 = H
N
2; X = N, R4 = H, R5 = CH3
R4
N
4; X = CH, R4 = H, R5 =
X
R5
N
6; X = CH, R4 = H, R5 = CH3
7; X = CH, R4 = CH3, R5 = H
8; X = CH, R4 = H, R5 = OH
X
R5
R4
Scheme 2. Synthesis of compounds 1, 2, 3, 4, 6, 7 and 8. (a) CH2O, pyrrolidine; (b) 1: CH2O, piperidine; 2: CH2O, 1-methylpiperazine; 4: CH2O, 4-pyrrolidin-1-yl-piperidine,
EtOH; 6: CH2O, 4-methylpiperidine; 7: CH2O, 3-methylpiperidine; 8: CH2O, 4-hydroxypiperidine.

A. Najda-Bernatowicz et al. / Bioorg. Med. Chem. 18 (2010) 5129–5136
5131
10 nM dsDNA substrate, 20 nM enzyme, 125 nM capture strand
and 1.5 mM ATP. The proteins appeared to have different initial
reaction velocities (data not shown), helicase 3a being the most po-
tent enzyme that at 20 nM could unwind dsDNA with an initial
velocity fourfold higher than that of helicase 1b. This phenomenon
has already been reported for the enzymes derived from HCV geno-
types 1a, 1b and 2a, and various mechanisms underlying differ-
ences in the enzyme activities were proposed, such as differences
in the rate of ATP hydrolysis, nucleoside triphosphate (NTP) prefer-
ence and strength of DNA binding.20
O
O
OH
R1
OH
30% aq H2O2
MeOH, a
R3
R2
5; R1 = R3 = Cl, R2 = H; a = 36% HCl
9
; R1 = R3 = Br, R2 = H; a = 48% HBr
10
; R1 = Br, R2 = R3 = H; a = 48% HBr
The helicase assay was applied to test new tropolone deriva-
tives in the optimal buffer and ATP conditions selected on the basis
of results obtained previously.21 The tropolone derivatives were
Scheme 3. Synthesis of compounds 5, 9 and 10.
All the tropolone analogues were purified to homogeneity and
characterized by NMR spectroscopy and mass spectrometry. In
the 1H NMR spectrum of 5 the signal of 3-H and 7-H is absent,
while the signals of 4-H and 6-H form a doublet coupled to the
5-H triplet with 3J = 10.7 Hz. These spectral features indicate sub-
stitution with chlorine at positions 3 and 7. In compound 9 the
same positions are substituted by bromine. This results in minor
changes in resonance positions, but does not affect the coupling
pattern in comparison to 5. In compound 10 the symmetry of the
1H spin system is broken by bromine substitution at position 3.
This is manifested by the appearance of four well resolved and
mutually coupled resonances assigned to 4-H, 5-H, 6-H and 7-H.
In the remaining compounds the 4-H and 6-H nuclei are magneti-
cally equivalent and their resonance appears as a singlet. This indi-
cates 3,5,7 substitutions. An additional singlet at d = 3.43–3.62
(two protons) is assigned to the 5-CH2 linkage, while a singlet at
d = 3.67–3.85 (four protons) comes from 3- and 7-CH2 chemically
equivalent linkages. The resonances coming from protons of cyclic
amines which are connected to the CH2 linkages mentioned are ob-
served as unresolved multiplets. Due to extensive overlap of these
signals, 2D NMR techniques were exploited to assign the multi-
plets and to confirm the structures of the newly synthesized trop-
olone derivatives.
tested at 1–300 lM concentrations, depending on their solubility
and the inhibition effect obtained. Compounds 5, 9, 10 and 11 were
dissolved in DMSO, 3 in methanol, while 1, 2, 4, 6, 7 and 8 were
dissolved in 70% EtOH. All the compounds tested were preincu-
bated for 15 min at room temperature with the dsDNA substrate
and the enzyme to facilitate formation of active complexes and
interaction of inhibitors with their targets. The unwinding reaction
was initiated by addition of ATP. All the 50% inhibitory concentra-
tions (IC50) values obtained as well as the IC50 value previously
determined for 3,7-dibromo-5-(morpholin-40-ylmethyl)tropolone
(11) are presented in Table 1.12 In several cases no IC50 values
could be determined due to the low solubility of the compounds
and/or lack of anti-helicase activity.
Compound 2, the most efficient helicase inhibitor, was tested
against three different variants of the NS3 helicase belonging to
two main genotypes, 1 and 3, to determine its specificity (Table
2). No significant differences in the IC50 values were observed, indi-
cating not only that there are no significant structural differences
between various HCV isolates but also that this new inhibitor is
not genotype-specific, which is an advantage in the design of
anti-HCV drugs.22
2.3. Inhibition of replication of HCV subgenomic replicon
Various solvents can be used to dissolve tropolone derivatives
due to the different solubility of these compounds. Halogeno deriv-
atives of tropolone are soluble in dimethyl sulfoxide (DMSO), but
poorly soluble in chloroform and in methanol or EtOH; in turn
cyclic amine-substituted tropolones are insoluble in DMSO, but
soluble in chloroform (except 8), EtOH and in water (with concen-
tration limitations).
To test the effect of the compounds studied on RNA amplifica-
tion as well as their cytotoxicity, Huh-7 cells harbouring the repli-
cating subgenomic HCV were grown in the presence of the
tropolone derivatives at concentrations ranging from 1 lM to
1 mM. In each experiment a constant volume of inhibitor was
added, resulting in a final constant 1% concentration of solvent.
As positive control, Huh-7 cells were grown with 1% solvent. The
remaining level of HCV RNA replication in the cells was determined
by measuring the luminescence signal.
2.2. New helicase variants and helicase inhibition assay
New variants of the NS3 helicase (genotypes 1b and 3a) were
isolated and cloned from infected blood samples from Polish
HCV-infected patients. The nucleotide sequences of the NS3 heli-
case of the new variants were established and deposited in the
GeneBank database under the following accession numbers:
GU056838 and GU056839. Sequence comparisons with the heli-
case of genotype 1a used in our previous studies19 revealed a sig-
nificant divergence of nucleotide and amino acid sequences,
typical of HCV isolates (79% and 91% identity for the isolates of
genotype 1, 70% and 81–83% identity for both isolates of genotypes
1 and 3, respectively). None of the highly conserved NTPase and
helicase motifs was changed.
The helicases of genotypes 1a, 1b and 3a were expressed in the
baculovirus system and purified from insect cells following the
protocol developed by Boguszewska-Chachulska et al.19 About
15 mg/mL were obtained for each of the new helicase variants.
The purity of the proteins reached 95% as estimated by SDS–PAGE
and Coomassie staining.
The 50% effective concentration defined as the inhibitor concen-
tration that reduced luminescence by 50% (EC50), the 50% cytotoxic
concentration defined as the compound concentration that inhib-
Table 1
IC50 values obtained for tropolone derivatives in the helicase assay
a
Compound
IC50
(
lM)
1
2
3
4
26.5 6.8
3.4 2.1
183.6 25.5
7.0 2.6
>150
5
6
7
8
9
10.5 1.1
17.8 2.1
22.7 4.3
>150
10
11
>150
17.6 6.8
a
To test the helicase activity of the new helicase variants, a fluo-
All the data represent mean values for at least three independent experi-
ments standard deviation.
rometric helicase activity assay was applied,19 with 6 mM MnCl2,

5132
A. Najda-Bernatowicz et al. / Bioorg. Med. Chem. 18 (2010) 5129–5136
Table 2
sibly plays an important role in the antiviral activity of the six-
membered cyclic amine derivatives of tropolone evaluated in this
study, especially considering the lack of antiviral activity of two
differently substituted piperidine derivatives of tropolone: the pyr-
rolidine-substituted (4) and hydroxyl-substituted derivatives (8).
However, this is the methylpiperazine substitution at positions 3,
5 and 7 of the tropolone ring that is the key pharmacophore ele-
ment identified by these studies, as it seems responsible for the
highest anti-helicase activity of compound 2 as well as its high
antiviral activity, only slightly lower than that of compounds 6
and 7.
IC50 values for compound 2 obtained with helicases of various genotypes
a
Genotype
IC50 (lM)
hel1a
hel1b
hel3a
3.4 2.1
3.5 1.9
4.5 2.9
a
The data represent mean values for three independent experiments standard
deviation.
ited cell growth by 50% (CC50) and the selectivity index (SI = CC50
/
In comparison with ribavirin, whose SI value in this assay was
1.5, compounds 2, 6 and 7 had good SI values (>21.3, 17.4 and
9.8, respectively), indicating that there is a reasonable cytotoxic-
ity/activity window. When compared to 40-azidocytidine (kindly
provided by Dr. Johan Neyts, Katolik Universität, Leuven, Belgium),
compounds 2, 6 and 7 showed higher EC50 values with similar or
lower cytotoxicity. It should be emphasized that the most cyto-
toxic compounds are halogeno derivatives of tropolone.
EC50) values obtained for the compounds tested, are presented in
Table 3.
The tropolone derivatives tested proved to be weaker HCV rep-
lication inhibitors than amidinoanthracyclines or even acridone
derivatives,21,23 with EC50 values in the micromolar range. Unex-
pectedly, in the context of the results obtained in the helicase as-
say, two strong inhibitors of helicase activity (compounds 4 and
11) as well as most of the remaining compounds were unable to in-
hibit replication of the HCV subgenomic replicon. They either
showed no effect (3, 4, 8) or their CC50 values were similar to the
EC50 values, resulting in SI values close to 1 (5, 9, 10, 11). Two iso-
mers of methyl-substituted piperidine derivatives of tropolone, 6
and 7, were the strongest inhibitors of replication among the trop-
2.4. Derivative 2 and 7-resistant mutants
To select resistant mutants, Huh-7 cells harbouring the subge-
nomic HCV replicon were grown in the presence of 100 lM deriv-
atives 2 or 7 under the selective pressure provided by Geneticin
(G418). In these conditions cells either lacking the replicon or con-
taining a susceptible replicon are killed and the remaining cells
form colonies within 3–4 weeks. After the selection the suscepti-
bility of resistant colonies was tested. The results showed that
the EC50 value for compound 2 tested in compound 2-resistant col-
onies was threefold higher than the EC50 tested in naïve cells
olone derivatives tested, with EC50 values of 32 and 35.6
respectively, while the methylpiperazine derivative of tropolone,
compound 2, with an EC50 value of 46.9 M was the least cytotoxic
compound tested (CC50 >1 mM) resulting in the highest SI value
(>21) (Fig. 1). Surprisingly, another derivative of tropolone with
unsubstituted piperidine (compound 1) was a weak inhibitor with
lM,
l
an EC50 value of 137 lM and an SI value of 3.6. The CH3 group pos-
(131.35 15.34
of compound 7-resistant mutants that was almost threefold higher
than that of naïve cells (90.06 3.90 M vs 35.6 2.5 M). More-
lM vs 46.9 11.6 lM). It was similar to the EC50
l
l
Table 3
EC50, CC50 and SI values of the tropolone derivatives
over, the mutants selected against compound 2 were also resistant
to 7 and vice versa, as shown in Figure 2. RNA of the selected
mutant cells was harvested, reverse-transcribed to cDNA and the
NS3-coding region was amplified by PCR. The PCR products were
sequenced and only one mutation in the NS3 helicase sequence
was detected (A to G), the same mutation for both types of mu-
tants, which was not present in the HCV RNA of naïve cells. The
mutation leads to one amino acid substitution in the NS3 helicase
protein, threonine at position 477 is changed to alanine (Fig. 3).
This mutation (T477A) is localised in the region of the NS3 helicase
domain 2 that is not part of any conserved structure. Therefore
inhibition is probably not competitive, but rather allosteric and
this is consistent with the results of dependency experiments per-
formed for the first tropolone inhibitor of helicase identified.12
However, the exact mechanism of action remains unknown. Inter-
estingly, this mutation is located on the NS3 protease-facing
a
a
Compound
EC50
(l
M)
CC50
(lM)
SI
1
2
3
4
137.4 48.9
46.9 11.7
>500
>500
>3.6
>21.3
>1000
>500
>200
>200
5
6
7
8
334.3 6.0
32.0 1.1
35.6 2.5
>250
253.8 17.9
556.0 77.7
348.0 53.9
>250
0.8
17.4
9.8
9
10
11
89.8 4.9
121.3 16.4
176.5 50.5
10.54 2.50
120.00 37.11
92.7 9.0
85.2 3.0
227.3 37.5
>100
1.0
0.7
1.3
n.a.
1.5
40-Azidocytidine
Ribavirin
177.94 49.39
a
All the data represent mean values for at least three independent experi-
ments standard deviation.
140
120
100
80
140
120
100
80
140
120
Luminescence
Cytotoxicity
Luminescence
Cytotoxicity
100
80
60
40
20
0
60
60
Luminescence
Cytotoxicity
40
40
20
20
0
0
0
200
400
600
800
1000
0
200
400
600
800
1000
0
200
400
600
800
1000
compound 6 (µM)
compound 2 (µM)
compound 7 (µM)
Figure 1. Inhibition of replication of the HCV subgenomic replicon by compounds 2, 6 and 7. Each point is the mean of three independent assays, with three replicates.

A. Najda-Bernatowicz et al. / Bioorg. Med. Chem. 18 (2010) 5129–5136
5133
surface and tropolone binding may influence helicase-protease
interactions (Fig. 3). Computer modelling of ligand-NS3 helicase
interactions based on this experimental result is currently in pro-
gress but it must be supported by new interaction studies.
Huh-7
Huh-7 cmpd 2 MUT
Huh-7 cmpd 7 MUT
140
120
100
80
2.5. Synergy studies
It is important to test drug candidates in combination with
other drugs or compounds that might be used in combinatorial
therapies commonly employed in the treatment of viral infections.
These experiments may prevent the use of combinations of drugs
that antagonize each other, rendering the therapy ineffective. The
60
40
effects of the compound 2/IFN-c and 2/ribavirin combinations in
20
cell culture were therefore evaluated. The results were analysed
as described previously24 and are presented in Figure 4A and B,
respectively. When the effect of drug combination is additive, the
data points form a horizontal surface that equals the zero plane.
A surface that lies above the zero plane indicates a synergistic ef-
fect of the combination, and a surface below the zero plane indi-
cates antagonism. In our study both combinations result in an
additive effect with a very slight tendency to synergy, which might
be expected of two drugs that have different modes of action and
that do not interfere with their respective metabolism.
0
compound 7
compound 2
Figure 2. EC50 values of the Huh-7 cells resistant to compounds 2 and 7 as well as
of naïve Huh-7 cells tested against either compound.
While cases of compounds that antagonize IFN are rare, there
are examples of antagonism between ribavirin and a number of
nucleoside analogs. In 1987 Vogt et al. discovered that ribavirin
antagonizes the anti-Human immunodeficiency virus (anti-HIV)
activity of the 30-azido-30-deoxythymidine (AZT) and more re-
cently it was similarly demonstrated that ribavirin antagonizes
the inhibitory activity of 20-C-methylcytidine, an active component
of the experimental anti-HCV drug valopicitabine.25,26
3. Conclusions
Three tropolone derivatives (2, 6 and 7) inhibit replication of the
HCV subgenomic replicon in cell cultures, a property that has been
shown only for a handful of HCV helicase inhibitors: a peptide
inhibitor,27 TBBT, DRBT28 as well as acridone, anthracycline21,23
and triphenylmethane derivatives.29 Two of these tropolone deriv-
atives, 2 and 7, are the first anti-helicase compounds that inhibit
HCV replication with the ability to cause the appearance of resis-
tant mutants, which further proves that inhibition of replication
is the result of inhibition of the helicase activity. The mutation con-
ferring resistance to compound 2 was the same as for compound 7,
Figure 3. Structure of the NS3 protein (1CU1) with the mutation conferring
resistance to compounds
2 and 7 marked in white. The helicase domain is
highlighted in black and the protease domain in grey. The mutation is located on
the NS3 protease-facing surface.
Figure 4. Combined anti-HCV activity of IFN-c and compound 2 (A) and of ribavirin and compound 2 (B). Values under the zero plane indicate antagonistic activity, values in
the zero plane indicate additive activity and the values above the zero plane indicate synergistic activity.

5134
A. Najda-Bernatowicz et al. / Bioorg. Med. Chem. 18 (2010) 5129–5136
suggesting the same mechanism of action, possibly an allosteric
inhibition. Localisation of this mutation on the NS3 protease-facing
surface (Fig. 3) suggests that tropolone binding may influence heli-
case-protease interactions.
(MH+) m/z 459.3447, found 459.2846. 1H NMR (CDCl3, 298 K) d:
2.23–2.69 [m, 33H; resolved in 2D spectra: 2.31 (3 ꢀ CH3), 2.49
(3,5,7-tri-30-CH2 and 3,5,7-tri-50-CH2), 2.51 (5-20-CH2 and 5-60-
CH2), 2.58 (3,7-di-20-CH2 and 3,7-di-60-CH2)], 3.49 (s, 2H, 5-CH2),
3.72 (s, 4H, 3-CH2 and 7-CH2), 7.81 (s, 2H, 4-H and 6-H); 13C
NMR (CDCl3, 298 K) d: 46.1 (3 ꢀ CH3), 52.8 (5-20-CH2 and 5-60-
CH2), 53.2 (3,7-di-20-CH2 and 3,7-di-60-CH2), 55.3 (3,5,7-tri-30-CH2
and 3,5,7-tri-50-CH2), 59.2 (3-CH2 and 7-CH2), 66.7 (5-CH2), 133.5
(C3 and C7), 136.2 (C5), 138.7 (C4 and C6), 168.5 (C1 and C2).
Despite its relatively high EC50 value of 46.9 l
M, 3,5,7-tri[(40-
methylpiperazin-10-yl)methyl]tropolone (2) is the most promising
tropolone derivative identified here as it is non-cytotoxic at the
highest concentrations studied (1 mM) that precluded the exact
determination of its SI. Consequently, compound 2, containing
the methylpiperazine moiety as the key pharmacophore element,
may be regarded as a lead to develop new compounds that can
be used in future multidrug therapy.
4.1.3. 3,5,7-Tri(pyrrolidin-10-ylmethyl)tropolone (3)
Pyrrolidine (600
of tropolone (244 mg, 2.00 mmol) and 37% aqueous formaldehyde
(774 L, 10.33 mmol). While adding the amine the temperature
lL, 7.20 mmol) was slowly added to a mixture
l
4. Experimental
4.1. Chemistry
rose, the suspension dissolved and the resulting yellow solution
was stirred at 60 °C for 10 min. After cooling to room temperature
and stirring for 12 h, no precipitate was obtained. The solution was
extracted with chloroform (10 mL) and water (3 ꢀ 10 mL), the or-
ganic layer was dried over anhydrous Na2SO4, filtered and evapo-
rated to produce oil. The oil was co-evaporated twice with
methanol producing a light yellow precipitate. The precipitate
was crystallized twice from acetone providing 329 mg (0.89 mmol,
44% yield) of compound 3 as a yellow powder. MS (TOF) calcd for
1H, 1H–1H COSY, 1H–13C GHMBC and 1H–13C GHSQC NMR
experiments were recorded on a Bruker Avance II 300 MHz spec-
trometer. The data of chemical shifts are reported with reference
to Me4Si (internal standard). They are reported in the following
format: chemical shift (multiplicity (s, singlet; d, doublet; t, triplet;
m, multiplet), integration, coupling constants and assignment).
NMR spectra were obtained in the Laboratory for Solid State
NMR, Institute of Physical Chemistry, Polish Academy of Sciences
(PAS). Mass spectra were recorded on a Micro-mass ESI Q-TOF
spectrometer at the Mass Spectrometry Laboratory, Institute of
Biochemistry and Biophysics (IBB), PAS. Starting materials were
C
22H34N3O2þ (MH+) m/z 372.2651, found 372.2523. 1H NMR (CDCl3,
298 K) d: 1.71–1.93 [m, 12H; resolved in 2D spectra: 1.78 (5-30-
CH2, and 5-40-CH2), 1.82 (3,7-di-30-CH2, and 3,7-di-40-CH2)], 2.44–
2.73 [m, 12H; resolved in 2D spectra: 2.53 (5-20-CH2 and 5-50-
CH2), 2.62 (3,7-di-20-CH2 and 3,7-di-50-CH2)], 3.62 (s, 2H, 5-CH2),
3.85 (s, 4H, 3-CH2 and 7-CH2), 7.79 (s, 2H, 4-H and 6-H); 13C
NMR (CDCl3, 298 K) d: 23.6 (5-30-CH2 and 5-40-CH2), 23.7 (3,7-di-
30-CH2 and 3,7-di-40-CH2), 53.9 (5-20-CH2 and 5-50-CH2), 54.3
(3,7-di-20-CH2 and 3,7-di-50-CH2), 57.6 (3-CH2 and 7-CH2), 64.4
(5-CH2), 134.6 (C3 and C7), 137.3 (C5), 138.7 (C4 and C6), 168.4
(C1 and C2).
´
purchased from Sigma–Aldrich (Poznan, Poland). The derivatives
of tropolone: 3,7-dibromotropolone (9), 3-bromotropolone (10)
and 3,7-dibromo-5-(morpholin-40-ylmethyl)tropolone (11) were
synthesized by adapting the methods developed in our labora-
tory.12 All solvents were of reagent grade. All yields reported are
for dry compounds that require no further purification.
4.1.4. 3,5,7-Tri[(40-pyrrolidin-100-ylpiperidin-10-yl)methyl]
tropolone (4)
4.1.1. 3,5,7-Tri(piperidin-10-ylmethyl)tropolone (1)
Piperidine (690
ture of tropolone (227 mg, 1.86 mmol) and 37% aqueous formalde-
hyde (720 L, 9.61 mmol) cooled in an ice bath. While adding the
lL, 6.97 mmol) was slowly added to the mix-
A solution of 4-pyrrolidin-1-ylpiperidine (1.112 g, 7.21 mmol)
in 20 mL of ethanol was added to
(242 mg, 1.98 mmol) and 37% aqueous formaldehyde (774
a
mixture of tropolone
L,
l
l
amine the suspension dissolved and the resulting dark-orange
solution was stirred at 70 °C for 7 min. After cooling the solution
to room temperature, a precipitate was obtained and crystallized
from acetone to give 400 mg (0.97 mmol, 52% yield) of compound
10.33 mmol). After adding the amine the mixture turned into a
clear yellow solution that was stirred at 65 °C. The course of the
reaction was monitored by MS spectrometry. Additional portions
of 4-pyrrolidin-1-ylpiperidine were added over a period of 3 days
(in total 482 mg, 3.13 mmol) and the reaction mixture was cooled
to room temperature and stirred for 12 h to complete the reaction.
The solvent was evaporated and the residue was co-evaporated
with toluene, dissolved in chloroform (20 mL) and washed with
water (3 ꢀ 20 mL). The organic extract was dried over anhydrous
Na2SO4, filtered and co-evaporated with acetone. The precipitate
was crystallized twice from acetone to produce 736 mg
(1.18 mmol, 60% yield) of 4 as a yellow powder. MS (TOF) calcd
1. MS (TOF) calcd for C25H40N3O2 (MH+) m/z 414.3121, found
þ
414.2466. 1H NMR (CDCl3, 298 K) d: 1.33–1.71 [m, 18H; resolved
in 2D spectra: 1.47 (3,5,7-tri-40-CH2), 1.62 (3,5,7-tri-30-CH2 and
3,5,7-tri-50-CH2)], 2.30–2.59 [m, 12H; resolved in 2D spectra:
2.40 (5-20-CH2 and 5-60-CH2), 2.47 (3,7-di-20-CH2 and 3,7-di-60-
CH2)], 3.45 (s, 2H, 5-CH2), 3.67 (s, 4H, 3-CH2 and 7-CH2), 7.83 (s,
13
2H, 4-H and 6-H); C NMR (CDCl3, 298 K) d: 24.2 (3,5,7-tri-40-
CH2), 26.1 (3,5,7-tri-30-CH2 and 3,5,7-tri-50-CH2), 54.2 (5-20-CH2
and 5-60-CH2), 54.7 (3,7-di-20-CH2 and 3,7-di-60-CH2), 60.1 (3-CH2
and 7-CH2), 67.6 (5-CH2), 133.8 (C3 and C7), 136.8 (C5), 138.6
(C4 and C6), 168.4 (C1 and C2).
for C37H61N6O2 (MH+) m/z 621.4856, found 621.5017. 1H NMR
þ
(CDCl3, 303 K) d: 1.44–2.29 [m, 31H; resolved in 2D spectra: 1.53
(5-30-CH axial and 5-50-CH axial), 1.63 (3,7-di-30-CH axial and
3,7-di-50-CH axial), 1.77–1.79 (3,5,7-tri-300-CH2 and 3,5,7-tri-400-
CH2), 1.84 (5-30-CH equatorial and 5-50-CH equatorial), 1.90 (3,7-
di-30-CH equatorial and 3,7-di-50-CH equatorial), 1.95 (5-40-CH),
2.03 (5-20-CH axial and 5-60-CH axial), 2.17 (3,7-di-20-CH axial
and 3,7-di-60-CH axial)], 2.45–2.68 (m, 12H, 3,5,7-tri-200-CH2 and
3,5,7-tri-500-CH2), 2.74–3.06 [m, 8H; resolved in 2D spectra: 2.83
(5-20-CH equatorial and 5-60-CH equatorial), 2.87 (3,7-di-20-CH
equatorial and 3,7-di-60-CH equatorial), 2.97 (3,7-di-40-CH)], 3.43
(s, 2H, 5-CH2), 3.68 (s, 4H, 3-CH2 and 7-CH2), 7.85 (s, 2H, 4-H and
4.1.2. 3,5,7-Tri[(40-methylpiperazin-10-yl)methyl]tropolone (2)
A mixture of tropolone (227 mg, 1.86 mmol) and 1-methylpi-
perazine (750
aldehyde (720
l
l
L, 6.76 mmol) was treated with 37% aqueous form-
L, 9.61 mmol) added in two steps. After adding the
first portion of aqueous formaldehyde, the mixture turned into a
clear solution and started to boil. It was stirred at 65 °C for
5 min. After cooling the solution to room temperature, a precipi-
tate was obtained and crystallized twice from ethyl acetate and
petroleum ether to give 617 mg (1.34 mmol, 72% yield) of com-
13
6-H); C NMR (CDCl3, 303 K) d: 23.2 (3,5,7-tri-300-CH2 and 3,5,7-
þ
tri-400-CH2), 31.4 (5-30-CH2 and 5-50-CH2), 31.8 (3,7-di-30-CH2 and
pound 2 as yellow needles. MS (TOF) calcd for C25H43N6O2

A. Najda-Bernatowicz et al. / Bioorg. Med. Chem. 18 (2010) 5129–5136
5135
3,7-di-50-CH2), 50.9 (3,5,7-tri-40-CH), 51.5 (3,5,7-tri-200-CH2 and
3,5,7-tri-500-CH2), 52.4 (5-20-CH2 and 5-60-CH2), 52.9 (3,7-di-20-
CH2 and 3,7-di-60-CH2), 59.0 (3-CH2 and 7-CH2), 67.1 (5-CH2),
134.0 (C3 and C7), 137.0 (C5), 138.6 (C4 and C6), 168.0 (C1 and C2).
67.3 (5-CH2), 133.8 (C3 and C7), 136.3 (C5), 138.6 (C4 and C6),
168.1 (C1 and C2).
4.1.8. 3,5,7-Tri [(40-hydroxypiperidin-10-yl)methyl]tropolone (8)
To a solution of tropolone (248 mg, 2.03 mmol) in ethanol
4.1.5. 3,7-Dichlorotropolone (5)
(1 mL), aqueous (37%) formaldehyde (780 lL, 10.41 mmol) and 4-
To the cold (ice + acetone bath) solution of tropolone (500 mg,
4.09 mmol) in 5 mL of methanol, aqueous HCl (1.66 mL, 36%) was
added, followed by dropwise addition of 30% aqueous H2O2
(1.67 mL). The reaction mixture was stirred at room temperature
for 5 days. Additional aqueous HCl (0.8 mL, 36%) and 30% aqueous
H2O2 (0.8 mL) were added at room temperature and the mixture
was stirred for an additional 48 h. The yellow precipitate formed
was filtered and washed with diethyl ether to give 31 mg
(0.16 mmol, 4% yield) of compound 5 as a white powder. MS
hydroxypiperidine (732 mg, 7.24 mmol) were added and the mix-
ture was stirred and heated to 65 °C for 5 min. It was then cooled to
room temperature, stirred for 12 h and evaporated to produce oil.
After adding acetone (3 mL) a precipitate formed that was filtered,
and crystallized from methanol with acetone giving 799 mg
(1.73 mmol, 85% yield) of compound 8. MS (TOF) calcd for
þ
C
25H40N3O5 (MH+) m/z 462.2968, found 462.1859. 1H NMR
(CD3OD, 298 K) d: 1.43–1.73 [m, 6H; resolved in 2D spectra: 1.57
(5-30-CH and 5-50-CH), 1.68 (3,7-di-30-CH and 3,7-di-50-CH)],
1.73–1.99 [m, 6H; resolved in 2D spectra: 1.86 (5-30-CH and 5-50-
CH), 1.89 (3,7-di-30-CH and 3,7-di-50-CH)], 2.19 (t, 2H, 5-20-CH
and 5-60-CH), 2.52 (t, 4H, 3,7-di-20-CH and 3,7-di-60-CH), 2.72–
2.83 (m, 2H, 5-20-CH and 5-60-CH), 2.91–3.05 (m, 4H, 3,7-di-20-
CH and 3,7-di-60-CH), 3.43 (s, 2H, 5-CH2), 3.54–3.77 [m, 3H; re-
solved in 2D spectra: 3.62 (5-40-CH), 3.72 (3,7-di-40-CH], 3.84 (s,
4H, 3-CH2 and 7-CH2), 7.59 (s, 2H, 4-H and 6-H); 13C NMR (CD3OD,
298 K) d: 34.4 (3,7-di-30-CH2 and 3,7-di-50-CH2), 35.4 (5-30-CH2 and
5-50-CH2), 51.8 (3,7-di-20-CH2 and 3,7-di-60-CH2), 52.2 (5-20-CH2
and 5-60-CH2), 62.4 (3-CH2 and 7-CH2), 67.2 (3,7-di-40-CH), 67.9
(5-CH2), 68.6 (5-40-CH), 130.6 (C3 and C7), 131.9 (C5), 141.5 (C4
and C6), 176.1 (C1 and C2).
(TOF) calcd for C7H5Cl2O2 (MH+) m/z 190.9667, found 190.9651.
þ
1H NMR (DMSO-d6, 303 K) d: 6.86 (t, 1H, 3J = 10.7 Hz, 5-H), 7.90
(d, 2H, 3J = 10.7 Hz, 4-H and 6-H); 13C NMR (DMSO-d6, 303 K) d:
122.4 (C5), 133.4 (C3 and C7), 137.7 (C4 and C6), 164.9 (C1 and C2).
4.1.6. 3,5,7-Tri [(40-methylpiperidin-10-yl)methyl]tropolone (6)
A mixture of tropolone (227 mg, 1.86 mmol) and 4-methylpi-
peridine (800
aldehyde (720
l
L, 6.76 mmol) was treated with 37% aqueous form-
L, 9.61 mmol). After adding formaldehyde the
l
mixture turned into a clear solution and started to boil. It was stir-
red at 60 °C for 5 min and then at room temperature for 12 h. The
precipitate obtained was crystallized four times from ethyl acetate
or acetone and washed with diethyl ether or acetone to give
643 mg (1.41 mmol, 76% yield) of compound 6. MS (TOF) calcd
4.1.9. 3,7-Dibromotropolone (9)
for C28H46N3O2 (MH+) m/z 456.3590, found 456.2868. 1H NMR
The compound was synthesized as described by Boguszewska-
þ
Chachulska et al.12 MS (TOF) calcd for C7H5Br2O2 (MH+) m/z
þ
(CDCl3, 298 K) d: 0.89–0.97 [m, 9H; resolved in 2D spectra: 0.92
(5-CH3), 0.94 (3,7-di-CH3)], 1.11–1.50 [m, 7H; resolved in 2D spec-
tra: 1.28–1.36 (5-30-CH2 and 5-50-CH2), 1.36 (3,5,7-tri-40-CH)],
1.50–1.73 (m, 8H, 3,7-di-30-CH2 and 3,7-di-50-CH2), 1.90–2.21 [m,
6H; resolved in 2D spectra: 2.00 (5-20-CH and 5-60-CH), 2.12 (3,7-
di-20-CH and 3,7-di-60-CH)], 2.76–2.97 [m, 6H; resolved in 2D
spectra: 2.82 (5-20-CH and 5-60-CH), 2.85 (3,7-di-20-CH and 3,7-
di-60-CH)], 3.47 (s, 2H, 5-CH2), 3.68 (s, 4H, 3-CH2 and 7-CH2),
7.82 (s, 2H, 4-H and 6-H); 13C NMR (CDCl3, 298 K) d: 21.8
(3 ꢀ CH3), 30.6 (3,5,7-tri-40-CH), 34.5 (3,5,7-tri-30-CH2 and 3,5,7-
tri-50-CH2), 53.7 (5-20-CH2 and 5-60-CH2), 54.2 (3,7-di-20-CH2 and
3,7-di-60-CH2), 59.8 (3-CH2 and 7-CH2), 67.2 (5-CH2), 133.9 (C3
and C7), 136.8 (C5), 138.4 (C4 and C6), 168.3 (C1 and C2).
280.8636, found 280.8701. 1H NMR (DMSO-d6, 298 K) d: 6.68 (t,
1H, 3J = 10.7 Hz, 5-H), 8.12 (d, 2H, 3J = 10.7 Hz, 4-H and 6-H); 13C
NMR (DMSO-d6, 298 K) d: 123.1 (C5), 125.3 (C3 and C7), 140.8
(C4 and C6), 164.7 (C1 and C2).
4.1.10. 3-Bromotropolone (10)
The compound was synthesized as previously described.12 MS
(TOF) calcd for C7H6BrO2 (MH+) m/z 200.9551, found 200.9507.
þ
1H NMR (DMSO-d6, 298 K) d: 6.91 (dt, 1H, 3J = 10.2 Hz, 3J =
10.2 Hz, 4J = 0.8 Hz, 5-H), 7.29 (dd, 1H, 3J = 10.4 Hz, 4J = 0.8 Hz,
5J = 0.2 Hz, 7-H), 7.46 (dt, 1H, 3J = 10.2 Hz, 3J = 10.4 Hz, 4J = 1.0 Hz,
6-H), 8.29 (dd, 1H, 3J = 10.2 Hz, 4J = 1.0 Hz, 5J = 0.2 Hz,, 4-H); 13C
NMR (DMSO-d6, 298 K) d: 119.3 (C7), 125.5 (C5), 130.4 (C3),
136.8 (C6), 141.1 (C4), 164.7 (C1), 170.2 (C2).
4.1.7. 3,5,7-Tri [(30-methylpiperidin-10-yl)methyl]tropolone (7)
A mixture of tropolone (244 mg, 2.00 mmol) and 3-methylpi-
peridine (845
aldehyde (774
l
l
L, 7.20 mmol) was treated with 37% aqueous form-
L, 10.33 mmol). After adding formaldehyde the
4.2. Biology
mixture turned into a clear solution and started to boil. It was stir-
red at 65 °C for 5 min, then cooled to room temperature and stirred
for 12 h. The precipitate formed was crystallized three times from
acetone to give 543 mg (1.19 mmol, 60% yield) of compound 7. MS
4.2.1. Protein cloning, expression and purification
The NS3 helicase domain of genotype 1a was expressed in a
baculovirus system and purified from insect cells as described.19
The helicase domains of genotypes 1b and 3a were obtained by re-
verse transcription and PCR amplification using RNA extracted
from the blood of Polish HCV-infected patients as templates; this
was followed by cloning, protein expression and purification per-
formed as previously described19 (see Supplementary data: Exper-
imental protocols on cloning and expression of new HCV helicase
variants).
(TOF) calcd for C28H46N3O2 (MH+) m/z 456.3590, found 456.2708.
þ
1H NMR (CDCl3, 298 K) d: 0.80–0.97 [m, 12H; resolved in 2D spec-
tra: 0.86 (3 ꢀ CH3), 0.89 (3,5,7-tri-40-CH axial)], 1.52–1.81 [m, 15H;
resolved in 2D spectra: 1.63 (5-60-CH axial), 1.64 (3,5,7-tri-30-CH),
1.65 (3,5,7-tri-50-CH axial), 1.70 (3,5,7-tri-40-CH equatorial), 1.75
(3,5,7-tri-50-CH equatorial), 1.77 (3,7-di-60-CH axial)], 1.87–2.10
[m, 3H; resolved in 2D spectra: 1.94 (5-20-CH axial), 2.04 (3,7-di-
20-CH axial)], 2.71–2.85 [m, 6H; resolved in 2D spectra: 2.74 (5-
60-CH equatorial), 2.77 (5-20-CH equatorial and 3,7-di-60-CH equa-
torial), 2.80 (3,7-di-20-CH equatorial)], 3.44 (s, 2H, 5-CH2), 3.67 (s,
4H, 3-CH2 and 7-CH2), 7.81 (s, 2H, 4-H and 6-H); 13C NMR (CDCl3,
298 K) d: 19.5 (3 ꢀ CH3), 25.5 (3,5,7-tri-30-CH2), 31.0 (3,5,7-tri-50-
CH2), 32.7 (3,5,7-tri-40-CH2), 53.5 (5-20-CH2), 54.1 (3,7-di-20-CH2),
59.7 (3-CH2 and 7-CH2), 61.6 (5-60-CH2), 62.0 (3,7-di-60-CH2),
4.2.2. Enzymatic assay
Helicase assays were performed in 60 lL reaction buffer with
10 nM dsDNA substrate and 125 nM capture strand as described.21
The enzyme was preincubated with the inhibitors at various con-
centrations in the reaction mixture without ATP for 15 min at room
temperature. The unwinding reaction was started by addition of
1.5 mM ATP and was carried out at 30 °C for 60 min in a Synergy

5136
A. Najda-Bernatowicz et al. / Bioorg. Med. Chem. 18 (2010) 5129–5136
´
HTi Fluorescence Reader (BioTek Instruments, Inc., Winooski, VT).
The fluorescent signal was registered every 2 min. The enzyme
activity was calculated as the initial reaction velocity as previously
described.21 Inhibition was calculated as the percent activity of the
helicase incubated without inhibitor. The ORIGIN 6.1 program (Orig-
inLab) and EXCEL (Microsoft) were used to calculate the data.
Stanczak and his group for the synthesis of HCV cDNAs, and Dr.
Anne-Lise Haenni for careful reading of the manuscript and helpful
remarks.
Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.bmc.2010.05.066.
4.2.3. HCV replicon and cell toxicity studies
The human hepatoma cell line Huh-7 and the plasmid pFK-luc-
ubi-neo/NS3-30/Con1/5.1 carrying the subgenomic (NS3—30non-
translated region) HCV con1 replicon with the luc-ubi-neo (repor-
ter/selective) fusion gene were kindly provided by Dr. Ralf Bart-
enschlager (Department of Molecular Virology, University of
Heidelberg, Heidelberg, Germany).14 Stable Huh-7 clones carrying
persistently replicating subgenomic HCV replicons were obtained
using the protocol described by Lohmann et al. with minor modi-
fications.30 Huh-7 cells were grown and passaged as previously de-
scribed.14,21,27 The conditions of the assay applied to test antiviral
activities and cell toxicity of tropolone derivatives were as
described.27,28
References and notes
1. Thompson, A.; Patel, K.; Tillman, H.; McHutchison, J. G. J. Hepatol. 2009, 50, 184.
2. Zeuzem, S.; Berg, T.; Moeller, B.; Hinrichsen, H.; Mauss, S.; Wedemeyer, H.;
Sarrazin, C.; Hueppe, D.; Zehnter, E.; Manns, M. P. Viral. Hepat. 2009, 16, 75.
3. Anderson, A. B.; Gripenberg, J. Acta Chem. Scand. 1948, 2, 644.
4. Trust, T. J.; Coombs, R. W. Can. J. Microbiol. 1973, 19, 1341.
5. Rennerfelt, E. Physiol. Plant. 1948, 1, 245.
6. Inamori, Y.; Sakagami, Y.; Morita, Y.; Shibata, M.; Sugiura, M.; Kumeda, Y.;
Okabe, T.; Tsujibo, H.; Ishida, N. Biol. Pharm. Bull. 2000, 23, 995.
7. Budihas, S. R.; Gorshkova, I.; Gaidamakov, S.; Wamiru, A.; Bona, M. K.; Parniak,
M. A.; Crouch, R. J.; McMahon, J. B.; Beutler, J. A.; Le Grice, S. F. Nucleic Acids Res.
2005, 33, 1249.
8. Miyamoto, D.; Kusagaya, Y.; Endo, N.; Sometani, A.; Takeo, S.; Suzuki, T.; Arima,
Y.; Nakajima, K.; Suzuki, Y. Antiviral Res. 1998, 39, 89.
9. Morita, Y.; Matsumura, E.; Okabe, T.; Fukui, T.; Shibata, M.; Sugiura, M.; Ohe, T.;
Tsujibo, H.; Ishida, N.; Inamori, Y. Biol. Pharm. Bull. 2004, 27, 899.
10. Morita, Y.; Matsumura, E.; Tsujibo, H.; Yasuda, M.; Sakagami, Y.; Okabe, T.;
Ishida, N.; Inamori, Y. Biol. Pharm. Bull. 2001, 24, 607.
11. Inamori, Y.; Tsujibo, H.; Ohishi, H.; Ishii, F.; Mizugaki, M.; Aso, H.; Ishida, N. Biol.
Pharm. Bull. 1993, 16, 521.
12. Boguszewska-Chachulska, A. M.; Krawczyk, M.; Najda, A.; Kopanska, K.;
Stankiewicz-Drogon, A.; Zagorski-Ostoja, W.; Bretner, M. Biochem. Biophys.
Res. Commun. 2006, 341, 641.
13. Lohmann, V.; Korner, F.; Koch, J.; Herian, U.; Theilmann, L.; Bartenschlager, R.
Science 1999, 285, 110.
14. Vrolijk, J. M.; Kaul, A.; Hansen, B. E.; Lohmann, V.; Haagmans, B. L.; Schalm, S.
W.; Bartenschlager, R. J. Virol. Methods 2003, 110, 201.
15. Hartwig, E. Angew. Chem. 1954, 66, 605.
16. Barhate, N. B.; Gajare, A. S.; Wakharkar, R. D.; Bedekar, A. V. Tetrahedron 1999,
55, 11127.
17. Barhate, N. B.; Gajare, A. S.; Wakharkar, R. D.; Bedekar, A. V. Tetrahedron Lett.
1998, 39, 6349.
4.2.4. Selection and analysis of mutants resistant to 2 and 7
Huh-7 cells were seeded at a density of 4 ꢀ 105 cells per 10 cm
diameter culture dish in DMEM medium (Invitrogen, Carlsbad, CA)
supplemented with 250 lg/mL G418 and with 100 lM compounds
2 or 7. They were grown at 37 °C and 5% CO2 and were passaged
upon reaching confluency for a total time of 1 month. Finally the
cells were collected by centrifugation and frozen at ꢁ80 °C. Total
RNA was extracted using the RNAspin RNA isolation kit (GE
Healthcare, Little Chalfont, UK) according to the manufacturer’s
instructions. The RNA was eluted in 40 lL of RNase-free water
and the NS3-coding region was reverse-transcribed using the
SuperScript III First-Strand synthesis system (Invitrogen) according
to the manufacturer’s instructions and a mixture of random prim-
ers and the specific primer, NS3rev1 (see Supplementary data). The
NS3 region was amplified using the following primers: AACGTC-
TAGGCCCCCCGAACC and AATACGCGGCCAGAGCTGCTAGG (Labora-
tory of DNA Sequencing and Oligonucleotide Synthesis, IBB PAS)
and sequenced at IBB PAS.
18. Vyas, P. V.; Bhatt, A. K.; Ramachandraiah, G.; Bedekar, A. V. Tetrahedron Lett.
2003, 44, 4085.
19. Boguszewska-Chachulska, A. M.; Krawczyk, M.; Stankiewicz, A.; Gozdek, A.;
Haenni, A. L.; Strokovskaya, L. FEBS Lett. 2004, 567, 253.
20. Lam, A. M.; Keeney, D.; Eckert, P. Q.; Frick, D. N. J. Virol. 2003, 77, 3950.
21. Krawczyk, M.; Wasowska-Lukawska, M.; Oszczapowicz, I.; Boguszewska-
Chachulska, A. M. Biol. Chem. 2009, 390, 351.
22. Heck, J. A.; Lam, A. M.; Narayanan, N.; Frick, D. N. Antimicrob. Agents Chemother.
2008, 52, 1901.
4.2.5. Combined inhibition of replication by tropolone
derivatives, ribavirin and IFN-
To study the effect of the combined inhibition of replication by
tropolone derivatives and IFN- (Institute of Biotechnology and
c
23. Stankiewicz-Drogon, A.; Palchykovska, L. G.; Kostina, V. G.; Alexeeva, I. V.;
Shved, A. D.; Boguszewska-Chachulska, A. M. Bioorg. Med. Chem. 2008, 16, 8846.
24. Prichard, M. N.; Shipman, C., Jr. Antiviral Res. 1990, 14, 181.
25. Vogt, M. W.; Hartshorn, K. L.; Furman, P. A.; Chou, T. C.; Fyfe, J. A.; Coleman, L.
A.; Crumpacker, C.; Schooley, R. T.; Hirsch, M. S. Science 1987, 235, 1376.
26. Coelmont, L.; Paeshuyse, J.; Windisch, M. P.; De Clercq, E.; Bartenschlager, R.;
Neyts, J. Antimicrob. Agents Chemother. 2006, 50, 3444.
27. Gozdek, A.; Zhukov, I.; Polkowska, A.; Poznanski, J.; Stankiewicz-Drogon, A.;
Pawlowicz, J. M.; Zagorski-Ostoja, W.; Borowski, P.; Boguszewska-Chachulska,
A. M. Antimicrob. Agents Chemother. 2008, 52, 393.
c
Antibiotics, Warsaw, Poland) or ribavirin (ICN Biochemicals, Cleve-
land, USA), Huh-7 cells bearing the subgenomic replicon were
seeded in a 96-well microtiter plate and grown with increasing
concentrations of compound 2 (1, 10, 15, 25 and 50
with increasing concentrations of IFN- (0.01, 0.02, 0.04, 0.05,
0.07 and 0.1 /mL), or in another experiment with ribavirin (1, 5,
10, 15, 25 and 50 M).
lM) together
c
l
28. Paeshuyse, J.; Vliegen, I.; Coelmont, L.; Leyssen, P.; Tabarrini, O.; Herdewijn, P.;
Mittendorfer, H.; Easmon, J.; Cecchetti, V.; Bartenschlager, R.; Puerstinger, G.;
Neyts, J. Antimicrob. Agents Chemother. 2008, 52, 3433.
l
29. Chen, C. S.; Chiou, C. T.; Chen, G. S.; Chen, S. C.; Hu, C. Y.; Chi, W. K.; Chu, Y. D.;
Hwang, L. H.; Chen, P. J.; Chen, D. S.; Liaw, S. H.; Chern, J. W. J. Med. Chem. 2009,
52, 2716.
Acknowledgements
30. Lohmann, V.; Korner, F.; Dobierzewska, A.; Bartenschlager, R. J. Virol. 2001, 75,
1437.
This work was supported by the Ministry of Science and Higher
Education Grant 2P05A 03829. We would like to thank Dr. Janusz