Dihydroberberine, a hydrogenated derivative of berberine firstly identified in Phellodendri Chinese Cortex, exerts anti-inflammatory effect via dual modulation of NF-κB and MAPK signaling pathways

Article abstract of DOI:10.1016/j.intimp.2019.105802

Dihydroberberine (DHB), a hydrogenated derivative of berberine (BBR), has been firstly identified in Phellodendri Chinese Cortex (PC) by HPLC-ESI-MS/MS. Nowadays most researches on PC focus on its main components like BBR, however, the role of its naturally-occurring derivatives remains poorly defined heretofore. The present work aimed to comparatively evaluate the in vivo anti-inflammatory properties and mechanisms of DHB and BBR in three typical inflammatory murine models. The results showed that DHB effectively mitigated acetic acid-induced vascular permeability, xylene-elicited ear edema and carrageenan-caused paw edema. Meanwhile, DHB markedly attenuated the inflammatory cell infiltration in pathological sections of ears and paws. DHB was also observed to significantly decrease the production and mRNA expression levels of IL-6, IL-1β, TNF-α, NO (iNOS) and PGE2 (COX-2), increase the release of IL-10, and inhibit the activation of NF-κB and MAPK signaling pathways. The anti-inflammatory effect of DHB was weaker than that of BBR. The results might further contribute to unraveling the pharmacodynamic basis of PC and support its ethnomedical use in the treatment of inflammatory diseases. DHB possesses good potential to be further developed into a promising anti-inflammatory alternative, and can serve as a lead template for novel anti-inflammatory candidate.

Full text of DOI:10.1016/j.intimp.2019.105802

InternationalImmunopharmacology75(2019)105802
Contents lists available at ScienceDirect
International Immunopharmacology
journal homepage: www.elsevier.com/locate/intimp
Dihydroberberine, a hydrogenated derivative of berberine firstly identified
in Phellodendri Chinese Cortex, exerts anti-inflammatory effect via dual
modulation of NF-κB and MAPK signaling pathways
Lihua Tana,1, Yongfu Wanga,1, Gaoxiang Aia, Chaodan Luoa, Hanbin Chenb,c, Cailan Lia,f,
⁎⁎
Huifang Zenga,f, Jianhui Xied, Jiannan Chena,⁎, Ziren Sua,e,
a Guangdong Provincial Key Laboratory of New Drug Development and Research of Chinese Medicine, Mathematical Engineering Academy of Chinese Medicine, Guangzhou
University of Chinese Medicine, Guangzhou 510006, PR China
b The First Affiliated Hospital of Chinese Medicine, Guangzhou University of Chinese Medicine, 12 Airport Road, Bai Yun District, Guangzhou 510405, PR China
c State Key Laboratory of Quality Research in Chinese Medicine, Institute of Chinese Medical Sciences, University of Macau, Macau 999078, PR China
d Guangdong Provincial Key Laboratory of Clinical Research on Traditional Chinese Medicine Syndrome, The Second Affiliated Hospital, Guangzhou University of Chinese
Medicine, Guangzhou 510120, PR China
e Dongguan Mathematical Engineering Academy of Chinese Medicine, Guangzhou University of Chinese Medicine, Dongguan 523808, PR China
f Department of Pharmacology, Zhuhai Campus of Zunyi Medical University, Zhuhai 519041, PR China
A R T I C L E I N F O
A B S T R A C T
Keywords:
Dihydroberberine (DHB), a hydrogenated derivative of berberine (BBR), has been firstly identified in
Phellodendri Chinese Cortex
Dihydroberberine
Anti-inflammatory
Inflammatory mediators
NF-κB
Phellodendri Chinese Cortex (PC) by HPLC-ESI-MS/MS. Nowadays most researches on PC focus on its main
components like BBR, however, the role of its naturally-occurring derivatives remains poorly defined heretofore.
The present work aimed to comparatively evaluate the in vivo anti-inflammatory properties and mechanisms of
DHB and BBR in three typical inflammatory murine models. The results showed that DHB effectively mitigated
acetic acid-induced vascular permeability, xylene-elicited ear edema and carrageenan-caused paw edema.
Meanwhile, DHB markedly attenuated the inflammatory cell infiltration in pathological sections of ears and
paws. DHB was also observed to significantly decrease the production and mRNA expression levels of IL-6, IL-1β,
TNF-α, NO (iNOS) and PGE2 (COX-2), increase the release of IL-10, and inhibit the activation of NF-κB and
MAPK signaling pathways. The anti-inflammatory effect of DHB was weaker than that of BBR. The results might
further contribute to unraveling the pharmacodynamic basis of PC and support its ethnomedical use in the
treatment of inflammatory diseases. DHB possesses good potential to be further developed into a promising anti-
inflammatory alternative, and can serve as a lead template for novel anti-inflammatory candidate.
MAPK
1. Introduction
applications are often restricted due to their side effects [2]. Identifi-
cation of promising anti-inflammatory alternatives derived from med-
Inflammation is a physiological response of immune defense system
to protect the body from noxious stimuli such as infections, allergens
and trauma [1,2]. However, exaggerated inflammatory response not
only leads to the release of inflammation-related mediators and the
activation of NF-κB and MAPK signaling pathways [3], but also results
in diabetes, cardiovascular diseases, rheumatoid arthritis, cancer and
even death [4,5]. Nowadays, despite nonsteroidal anti-inflammatory
drugs are frequently used to treat inflammatory diseases, their clinical
icinal herbal plants is becoming a vital area of research for the devel-
opment of novel anti-inflammatory agents.
Phellodendri Chinese Cortex (PC), the dried bark of Phellodendron
chinense Schneid., is a famous traditional Chinese materia medica ex-
tensively used for the treatment of varied inflammatory diseases such as
gastroenteritis, gastric ulcer, and rheumatoid arthritis, etc. [6]. Modern
study has suggested that PC possesses appreciable anti-inflammatory
effect [6], and the protoberberine alkaloids contained therein are
⁎ Corresponding author.
⁎⁎ Correspondence to: Z. Su, Guangdong Provincial Key Laboratory of New Drug Development and Research of Chinese Medicine, Mathematical Engineering
Academy of Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou 510006, PR China.
E-mail addresses: chenjiannan@gzucm.edu.cn (J. Chen), suziren@gzucm.edu.cn (Z. Su).
1 Lihua Tan and Yongfu Wang contributed equally to this work.
https://doi.org/10.1016/j.intimp.2019.105802
Received 28 March 2019; Received in revised form 11 July 2019; Accepted 31 July 2019
1567-5769/©2019ElsevierB.V.Allrightsreserved.

L. Tan, et al.
InternationalImmunopharmacology75(2019)105802
regarded as its major active components and are of vast medical in-
terest. Berberine (BBR), the most common protoberberine alkaloid and
major active constituent of PC, has been found to display multiple
biological activities including anti-inflammatory [7], anti-diabetic [8],
and anti-cancer effects [9]. However, current biological studies on
protoberberine alkaloids have predominantly concentrated on its major
constituent BBR, while limited attempt has been initiated to explore the
biological activities of its natural derivatives like dihydroberberine
(DHB). Indeed, pharmacokinetic analyses have indicated that nitror-
eductases of the gut microbiota reduces BBR to its absorbable form
DHB, which displays improved absorption and enhanced oral bioa-
vailability [10]. In addition, the in vivo bioactivities of DHB have been
reported to be stronger than those of BBR, such as anti-atherosclerosis
[11], anti-adiposity, and anti-diabetes [12], etc.
In a continuing effort to more fully characterize the anti-in-
flammatory potential of natural candidates, in the present work, we
identified DHB, a natural reduced derivative and gut-bacteria metabo-
lite of BBR, in ethyl acetate extract of PC by HPLC-ESI-MS/MS, com-
paratively scrutinized their anti-inflammatory effects and delineated
the molecular mechanisms of action. To the best of our knowledge, this
is the first identification of dihydroprotoberberine in PC and the pio-
neering endeavor comparatively exploring the anti-inflammatory
properties of protoberberine alkaloid and its hydrogenated derivative in
typical acute inflammation murine models.
Table 1
Sequences of primers used in RT-PCR assay.
Target gene
iNOS
Primer sequences (5′-3′)
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
ATCTTGGAGCGAGTTGTGGATTGTC
GGTTGTTGCTGAACTTCCAGTCATTG
CTGGTGCCTGGTCTGATGATGTATG
AGCTGTACTCCTGGTCTTCAATGTTG
CACCACGCTCTTCTGTCTACTGAAC
CATCGGCTGGCACCACTAGTTG
TTCAGGCAGGCAGTATCACTCATTG
TGTCGTTGCTTGGTTCTCCTTGTAC
AGACTTCCATCCAGTTGCCTTCTTG
AGTTGTTCTTCATGTACTCCAGGTAGC
ACATACTGCTAACCGACTCCTTAATGC
CTTCACCTGCTCCACTGCCTTG
COX-2
TNF-α
IL-1β
IL-6
IL-10
β-Actin
ATCTGGCACCACACCTTCTACAATG
CACGCTCGGTCAGGATCTTCATG
from 5 to 15 min, 40–60% A from 15 to 20 min, and 60–90% A from 20
to 25 min. The mobile phase flow rate was 0.4 mL/min and the injection
volume was 2 μL [13]. The ESI-MS spectrometry was conducted with a
Multiquant™ Software system and a Triple TOF5600 system (AB SCIEX,
Framingham, MA, USA) equipped with an electrospray ionization
source. The conditions of mass spectrometry were as follows: positive
ion mode ([M + H]+ = 338.1); spray voltage, −4500 kV; ion source
temperature, 500 °C; curtain gas, 35 psi; ion source gas, 55 psi; scanned
range, 40 to 1000 mz; collision energy, −40 eV, collision cell exit
voltage, −100 eV. The mass spectra plot was recorded in automatic
mode.
2. Materials and methods
2.1. Plant material
Phellodendri Chinese Cortex samples, obtained from Lingnan
Chinese Herbal Medicine Co., Ltd. (Guangzhou, China), were authen-
ticated by Prof. Zi-Ren Su of Guangzhou University of Chinese Medicine
(Guangzhou, China). A voucher specimen (No. 20170901) was de-
posited in the herbarium of Mathematical Engineering Academy of
Chinese Medicine, Guangzhou University of Chinese Medicine
(Guangzhou, China).
2.4. Extraction and isolation of dihydroberberine
In the present work, DHB was isolated from Phellodendri Chinese
Cortex based on previous investigation and our prior trial [14,15].
Briefly, the dried powder of Phellodendri Chinese Cortex (2 kg) was
macerated in ethyl acetate (4 L) and extracted with the ultrasonic
technique. After filtration and evaporation, the residue was chromato-
graphed on the silica gel column using methanol-chloroform mixed li-
quor with increasing polarity, and the methanol fraction was purified
on Sephadex LH-20 column with methanol-chloroform-water mixed
liquor. Identical fraction was further purified with preparative thin
layer chromatography to collect yellow DHB crystals. The chemical
structure of DHB was elucidated by comparing its spectral data (MS and
NMR) with previous reports [13,16].
2.2. Chemicals and reagents
Standards of berberine (BBR, C20H18NO4) and dihydroberberine
(DHB, C20H19NO4) were provided by Chengdu Purechem-Standard Co.,
Ltd. (Sichuan, China). Indomethacin, Evans blue and carrageenan were
obtained from Sigma Aldrich (Saint Louis, USA). Antibodies against
beta-actin (β-actin), Histone H3 (H3), IkappaB-alpha (IκBα), phospho-
IkappaB alpha (p-IκBα), p65 (p65), p38 mitogen-activated protein ki-
nases (p38), phospho-p38 mitogen-activated protein kinases (p-p38),
extracellular signal-regulated kinase (ERK), phospho-extracellular
signal-regulated kinase (p-ERK), c-jun N-terminal kinase (JNK),
phospho-c-jun N-terminal kinase (p-JNK), and horseradish peroxidase
(HRP)-conjugated secondary antibodies (anti-mouse IgG and anti-rabbit
IgG) were purchased from Affinity Biosciences (Cincinnati, USA). Test
kits for IL-1β, IL-6, IL-10, TNF-α, and prostaglandin E2 (PGE2) levels
were provided by Cusabio (Wuhan, China). All reagents unless specified
were of analytic grade.
2.5. Synthesis of dihydroberberine
Due to the limited content of dihydroberberine in PC, DHB was
synthesized and identified for further bioactivity evaluation. In the
present work, DHB was synthesized according to previous method with
some modifications [16]. Briefly, 5% sodium hydroxide solution
(27 mL) containing sodium borohydride (2.7 g) was added to a stirred
solution of berberine chloride (11.06 g) and potash (13.1 g) in methanol
(150 mL) dropwise. After the reaction mixture was stirred at ambient
temperature for 3 h, the precipitation was filtered and scrubbed with
30% ethanol (200 mL) followed by 80% ethanol (100 mL). The
green–brown crystals were filtered and dried at 30 °C, and were then
collected to afford 9.4 g (yield: 85%) DHB. The spectral data (MS and
NMR) were in agreement with those of the standard of dihy-
droberberine and previous studies [13,16]. The purity was determined
to be > 98% by HPLC.
2.3. HPLC-ESI-MS/MS analysis of Phellodendri Chinese Cortex
In order to explore the components of PC, the ethyl acetate extract
of PC were prepared with the ultrasonic technique and analyzed by
HPLC-ESI-MS/MS. In this test, chromatographic analyses were im-
plemented on the Agilent UPLC system (Agilent Technologies, Palo
Alto, CA, USA). The Phenomenex Gemini C18 column
(100 mm × 2.0 mm, 3 μm) was used for the chromatographic separa-
tion. The mobile phase consisted of solvent A (acetonitrile) and B (0.1%
formic acid aqueous solution with 10 mM ammonium). The gradient
elution conditions were as follows: 5–10% A from 0 to 5 min, 10–40% A
2.6. Experimental animals and groupings
Kunming (KM) mice of either sex (18–22 g) were obtained from
Animal Experimental Center of Guangzhou University of Chinese
2

L. Tan, et al.
InternationalImmunopharmacology75(2019)105802
Fig. 1. Total ion chromatogram of Phellodendri Chinese Cortex ethyl acetate extract (A) and MS2 mass spectra of dihydroberberine (B) and berberine (C) in the
positive ion mode.
Fig. 2. Effect of DHB on acetic acid-induced abdominal capillary permeability (A) and xylene-induced ear edema (B) in mice. MC: model control group; Indo: 10 mg/
kg indomethacin; BBR: 20 mg/kg berberine; DHB: 10, 20 and 40 mg/kg dihydroberberine. Values given are mean
MC group.
S.E.M. (n = 10). *p < 0.05 and **p < 0.01 vs.
Medicine (No. 44007200042620). Animals were housed under specific-
pathogen-free conditions of 22 2 °C and 55 2% humidity with a
2.7. Acetic acid-induced vascular permeability in mice
12-h light/dark cycle, and fed with forage and clean water ad libitum.
All animal experimental protocols were approved by the Animal
Experimental Ethics Committee of Guangzhou University of Chinese
Medicine (No. dspf 2017098) and conducted in accordance with the
National Institutes of Health (NIH) guide for the Care and Use of
Laboratory Animals.
After one-week acclimatization, male and female mice were ran-
domly divided into 7 groups: normal control group (NC), model control
group (MC), indomethacin-treated group (Indo, 10 mg/kg), berberine-
treated group (BBR, 20 mg/kg), and dihydroberberine-treated groups
(DHB, 10, 20 and 40 mg/kg), respectively. All drugs were dissolved in
0.5% Tween 80 and administered intragastrically once daily for 7
consecutive days. The dosages of agents used in this experiment were
adopted according to our prior trial and previous research [17].
Acetic acid-caused abdominal capillary permeability model, one of
typical acute inflammatory models, was established according to pre-
vious study [18]. Briefly, 60 min after the last administration, mice (10
mice each group) except those in the NC group were intravenously
injected with 1% Evans blue in physiological saline solution, followed
by an intraperitoneal injection of 0.6% acetic acid at 0.1 mL/10 g body
weight. Twenty minutes later, mice were sacrificed and the Evans blue
infiltrated into the enterocoelia was washed several times with 5 mL
normal saline solution. The leaner of enterocoelia was centrifuged at
3000 r/min for 15 min, and was determined at 590 nm to calculate the
inhibitory rate of the permeability increment.
2.8. Xylene-caused edema in mice ears
The xylene-induced acute inflammatory model was established in
3

L. Tan, et al.
InternationalImmunopharmacology75(2019)105802
Fig. 3. Representative histological sections of xylene-treated ears in mice (magnification ×200). NC: normal control group; MC: model control group; Indo: 10 mg/kg
indomethacin; BBR: 20 mg/kg berberine; DHB: 10, 20 and 40 mg/kg dihydroberberine. The demonstrated sections are typical representatives of three animals each
group.
this study following the method described previously [19]. In brief, 1 h
after the final treatment, the right ears of all mice were treated with
20 μL xylene, while the left ears were devoid of any treatment. One
hour later, animals were sacrificed and 2 ear biopsies were punched by
biopsy punch with a diameter of 8 mm for sample collection and weight
measurement. The weight difference between 2 ears from the same
animal was used to measure the effect of DHB on xylene-caused ear
edema. After measurement of the ear weight, samples were immersed
in 4% paraformaldehyde for tissue fixation. Tissue sections were cut
into 5 μm, embedded in paraffin, and stained with hematoxylin and
eosin following routine procedure to evaluate the severity of in-
flammation.
suppression ratio of paw edema were measured following the routine
manner.
In the following experiment, the rest mice were subjected to the
same experimental protocol abovementioned. Four hours after the
carrageenan injection, mice were euthanized, and the right hind paws
were collected for further mechanism investigation.
2.9.1. Histopathological examination
For standard histopathological inspection, the paw biopsies ob-
tained from the mice were soaked in 4% paraformaldehyde im-
mediately. One week later, hematoxylin and eosin were applied to stain
paw tissues embedded in paraffin. The pathological biopsies were ob-
served under Olympus BX53 microscope (Olympus, Tokyo, Japan).
2.9. Carrageenan-caused edema in mice paws
Another well-established acute inflammatory model induced by
carrageenan in mice paws was adopted following reported regime with
minor modifications [20]. One hour after the last administration, sub-
cutaneous tissue of right hind paw in mice was injected with 1% car-
rageenan solution except mice in the normal control group. To de-
termine the effect of DHB on paw edema induced by carrageenan, the
volume of the mouse right hind paw in each group was determined with
MK101CMP plethysmometer before and after the carrageenan injection
at different time points (0, 1, 2, 3, 4, 5 and 6 h). The edema rate and
2.9.2. Measurement of inflammatory mediators production
To measure the levels of inflammation-related mediators in the paw,
specimens from the right hind paw were homogenized and centrifuged
according to the manufacturer's instructions. The supernatant was
collected and frozen at −80 °C until use. The levels of IL-6, IL-10, IL-1β,
TNF-α and PGE2 were measured according to the protocols of corre-
sponding enzyme linked immunosorbent assay (ELISA) kits. In addition,
the content of nitrite was measured using the Griess reagent to analyze
the nitric oxide (NO) level.
4

L. Tan, et al.
InternationalImmunopharmacology75(2019)105802
2.10. Statistical analysis
The data were shown as mean
standard error of the mean
(S.E.M.) and analyzed with SPSS 23.0 (SPSS Inc., USA). Differences
among groups were analyzed by one-way analysis of variance followed
by LSD test or Duncan test. Differences were considered to be statisti-
cally significant at p < 0.05. Furthermore, Student's t-test was used to
evaluate the difference between two groups.
3. Results
3.1. Composition analysis of Phellodendri Chinese Cortex
The HPLC-ESI-MS/MS chromatograms of PC ethyl acetate extract
were shown in Fig. 1. The total ion chromatogram showed that peaks 1
and 2 were predominantly observed in the ethyl acetate extract of PC
(Fig. 1A). According to previous reports and corresponding standard
compound, peaks 1 and 2 were identified as dihydroberberine (reten-
tion time, 8.12 min; [M]+ ion, m/z 338.1; the characteristic fragment
ions, m/z 322.0996, m/z 306.1049, m/z 294.1050 and m/z 280.0892)
[13] and berberine (retention time, 11.77 min; [M]+ ion, m/z 337.1;
the characteristic fragment ions, m/z 321.0963, m/z 305.1017, m/z
293.1013 and m/z 279.0854) [22], respectively. The content of DHB
and BBR was 22.4 and 43.8 μg/g, respectively (Fig. 1B and C).
3.2. Effect of DHB on acetic acid-caused vascular permeability
Fig. 4. Effect of DHB on carrageenan-induced paw edema in mice. MC: model
control group; Indo: 10 mg/kg indomethacin; BBR: 20 mg/kg berberine; DHB:
10, 20, and 40 mg/kg dihydroberberine. Paw edema degree (A) and inhibition
rate of paw edema (B) were evaluated after carrageenan treatment as compared
As illustrated in Fig. 2A, pretreatment with DHB (20 and 40 mg/kg)
resulted in a remarkable reduction in acetic acid-induced dye leakage as
compared with the MC group (inhibition rate of 33.1% and 42.3%,
respectively, p < 0.01). While 10 mg/kg DHB did not show significant
inhibitory effect (p > 0.05). Pretreatment with Indo and BBR exerted
more potent suppressive effect against the extravasation of Evans blue
with the suppression ratio of 73.9% and 46.5% (p < 0.01), respec-
tively.
with the MC group. Values given are mean
S.E.M. (n = 8). *p < 0.05 and
**p < 0.01 vs. MC group.
2.9.3. Real-time polymerase chain reaction analysis
Real-time polymerase chain reaction (RT-PCR) was carried out to
quantitate the mRNA expression levels of IL-6, IL-10, IL-1β, TNF-α,
cyclooxygenase-2 (COX-2), and inducible type nitric oxide synthase
(iNOS). TRIzol reagent (Invitrogen, USA) was used to harvest the total
RNA from paw samples according to the manufacturer's protocol. The
purified RNA was transformed into cDNA according to the instruction
of the Hiscript II QRT SuperMix for RT-PCR. The RT-PCR was per-
formed using the ChamQ SYBR qPCR Master Mix with a Real-Time PCR
Detection System of Bio-rad CFX96 Touch and the amplification con-
dition was employed as mentioned previously [21]. The specific primer
sequences used in this assay were shown in Table 1. The mRNA ex-
pression level was computed with the 2−△△CT method and normalized
to β-actin.
3.3. Effect of DHB on xylene-caused mouse ear edema
As shown in Fig. 2B, obvious ear edema induced by xylene was
observed in the MC group as anticipated. Nevertheless, as compared
with the MC group, pretreatment with 10, 20 and 40 mg/kg DHB ex-
erted significant suppressive effect on xylene-caused ear edema (32.3%,
33.9% and 40.3%, respectively, all p < 0.01). While Indo (10 mg/kg)
and BBR (20 mg/kg), serving as the positive controls, significantly de-
creased the swelling with the inhibition rate of 54.22% and 56.44%
(both p < 0.01), respectively. The histopathologic analysis was shown
in Fig. 3. Result indicated that the ear biopsy specimens exposed to
xylene showed significant connective tissue loosening, inflammatory
cell infiltration and increment of dermis thickness. However, when
compared with the MC group, pretreatment with 3 tested doses of DHB
exerted distinct improvement in dermis thickness and inflammatory cell
infiltration. Pretreatment with Indo and BBR also significantly ame-
liorated the inflammatory symptoms abovementioned.
2.9.4. Western blot analysis
Western blot analysis was carried out to evaluate the effect of DHB
on NF-κB and MAPK signaling pathways. The total protein was ex-
tracted from the paw specimens with RIPA lysis buffer supplemented
with protease inhibitor cocktail while the nuclear and cytoplasmic
proteins were prepared according to the instruction of Nuclear and
Cytosol Protein Extraction Kit (KeyGEN BioTECH, Nanjing, China). The
protein concentrations were measured with the BCA protein assay kit.
For Western blot, equal amounts of proteins were separated with ap-
propriate concentrations of SDS-PAGE gel and transferred to PVDF
membrane. Subsequently, the membrane was blocked with bovine
serum albumin or skim milk powder, followed by incubation with
primary antibodies at 4 °C overnight. On the next day, horseradish
peroxidase (HRP)-conjugated secondary antibody (anti-mouse IgG or
anti-rabbit IgG) was used to incubate the membrane at room tem-
perature for 2 h. Finally, the protein bands were observed with en-
hanced chemiluminescence detection reagents (Bio-Rad, USA). The
expression level of each protein band was analyzed with the Quantity
One Software of Bio-Rad.
3.4. Effect of DHB on carrageenan-caused mouse paw edema
After subcutaneous carrageenan injection into the right hind paw of
mice, the paw volume increased remarkably (up to 3 h) in a time-de-
pendent manner (Fig. 4A). However, when compared to the MC group,
all phases of paw edema induced by carrageenan were markedly in-
hibited by pretreatment with DHB, BBR and Indo (Fig. 4A and B). The
suppression ratio of the DHB group (10, 20 and 40 mg/kg) increased to
26.2%, 32.8%, and 40.2% at 6 h after carrageenan injection (all
p < 0.01), respectively. While pretreatment with Indo (10 mg/kg) and
BBR (20 mg/kg) resulted in 60.9% and 43.7% inhibitory rate against
carrageenan-induced paw edema (p < 0.01), respectively (Fig. 4B).
5

L. Tan, et al.
InternationalImmunopharmacology75(2019)105802
Fig. 5. Histological sections of carrageenan-treated paws in mice (magnification ×200). NC: normal control group; MC: model control group; Indo: 10 mg/kg
indomethacin; BBR: 20 mg/kg berberine; DHB: 10, 20, and 40 mg/kg dihydroberberine. The demonstrated sections are typical representatives of three animals each
group.
3.4.1. Histopathologic analysis of paw tissue
3.4.3. Effect of DHB on the mRNA expression of inflammatory mediators
As shown in Fig. 7, when compared with the NC group, the gene
expression of iNOS (Fig. 7A), COX-2 (Fig. 7B), TNF-α (Fig. 7C), IL-1β
(Fig. 7D), and IL-6 (Fig. 7E) (all p < 0.01) was significantly up-regu-
lated after injection of carrageenan. When compared with the MC
group, pretreatment with DHB (20 and 40 mg/kg), BBR, and Indo
considerably suppressed (p < 0.05 or p < 0.01) the mRNA expression
of these mediators. While DHB at 10 mg/kg only exerted conspicuous
reduction on the expression of IL-1β (p < 0.05), COX-2, and iNOS
(p < 0.01). There was a remarkable decline of the IL-10 gene expres-
sion (p < 0.01) in carrageenan-treated group in contrast with the NC
group. Whereas DHB (10, 20 and 40 mg/kg) and positive drugs (10 mg/
kg Indo and 20 mg/kg BBR) resulted in prominent augmentation on the
expression of IL-10 when compared with the MC group (all p < 0.01)
(Fig. 7F).
As revealed in Fig. 5, as compared to the NC group, the paw spe-
cimens of the MC group exhibited remarkable inflammatory response,
such as dropsy, tissue destruction, and inflammatory cell infiltration.
However, pretreatment with DHB (10, 20, and 40 mg/kg) significantly
alleviated the swelling degree, tissue damage extent and inflammatory
infiltration in carrageenan-treated mice. BBR (20 mg/kg) and Indo
(10 mg/kg) showed more profound effect in alleviating the in-
flammatory symptoms as compared to DHB.
3.4.2. Effect of DHB on the levels of inflammatory mediators
As illustrated in Fig. 6, carrageenan treatment dramatically in-
creased the production of NO (Fig. 6A), PGE2 (Fig. 6B), TNF-α (Fig. 6C),
IL-1β (Fig. 6D) and IL-6 (Fig. 6E) (all p < 0.01) in parallel to the NC
group. By contrast, the levels of these mediators were obviously de-
creased (p < 0.05 or p < 0.01) by pretreatment with DHB (20, 40 mg/
kg), BBR (20 mg/kg) and Indo (10 mg/kg), when compared with those
of the MC group. Albeit 10 mg/kg DHB significantly suppressed the
release of NO (p < 0.01), no obvious effects on the production of IL-6,
IL-1β, TNF-α and PGE2 were observed. The level of IL-10 in the MC
group was significantly decreased (p < 0.01) as compared with that of
the NC group (Fig. 6F). However, pretreatment with DHB (10, 20 and
40 mg/kg), BBR, and Indo all remarkably increased the release of IL-10
(p < 0.05 or p < 0.01) as compared to the MC group.
3.4.4. Effect of DHB on the NF-κB and MAPK signaling pathways
Given that NF-κB and MAPK are the major transcriptional regulators
for inflammatory mediators [23,24], the effects of DHB on activation of
NF-κB and MAPK pathways were detected. As shown in Fig. 8A, car-
rageenan treatment induced a significant increase in nuclear translo-
cation of p65, while pretreatment with Indo (10 mg/kg), BBR (20 mg/
kg) and DHB (10, 20 and 40 mg/kg) significantly suppressed p65
translocation from cytoplasm to nucleus as compared to the MC group.
6

L. Tan, et al.
InternationalImmunopharmacology75(2019)105802
Fig. 6. Effect of DHB on the levels of NO (A), PGE2 (B), TNF-α (C), IL-1β (D), IL-6 (E) and IL-10 (F) in carrageenan-treated mice paws. NC: normal control group; MC:
model control group; Indo: 10 mg/kg indomethacin; BBR: 20 mg/kg berberine; DHB: 10, 20, and 40 mg/kg dihydroberberine. Values given are mean
S.E.M.
(n = 8). ##p < 0.01 vs. NC group. *p < 0.05 and **p < 0.01 vs. MC group.
And carrageenan exposure markedly augmented the phosphorylation
and degradation of IκBα as compared to the NC group. By contrast,
when compared with the MC group, pretreatment with DHB, BBR, and
Indo notably inhibited the degradation and phosphorylation of IκBα.
As shown in Fig. 8B, after exposure to carrageenan for 4 h, the
phosphorylation of p38 and JNK was significantly enhanced as com-
pared to the NC group. However, no effect on the phosphorylation of
ERK was observed. By contrast, compared to the MC group, pretreat-
ment with DHB, BBR, and Indo observably inhibited the phosphoryla-
tion of p38 and JNK.
medicine in comparison to their quaternary salt counterparts, which are
commonly extracted with mineral acid and inorganic base [14]. During
these processes, hydrogenated protoberberine alkaloids are likely to be
converted to their quaternary salt forms. According to the in vivo bio-
synthetic pathway of protoberberine alkaloids, hydrogenated proto-
berberine alkaloids can naturally exist inside plants. In the present
work, based on previous investigation and our prior trial, extraction
with ethyl acetate led to the identification of DHB from PC for the first
time.
In continuation of our work on protoberberine alkaloids [17,25,26],
pioneering effort was motivated to comparatively explore the in vivo
anti-inflammatory effect of DHB and BBR, and elucidate the potential
underlying mechanism. In our study, the anti-inflammatory effects of
DHB and BBR were evaluated with three common acute inflammatory
murine models, which were typically used to investigate the drug
candidates with potential anti-inflammatory effect. The results sug-
gested that pretreatment with DHB exhibited significant suppressive
effect on acetic acid-induced vascular permeability, xylene-elicited ear
4. Discussion
In recent years, interest in the bio-properties of DHB has been kin-
dled, and numerous studies have suggested that it possesses more
profound anti-inflammatory, anti-atherosclerotic [11], and anti-dia-
betes effects [12] than quaternary BBR. Besides as a naturally occurring
hydrogenated derivative of BBR, DHB is also a gut-bacteria metabolite
of BBR in vivo, and displays improved absorption and enhanced oral
bioavailability [10,11]. Therefore, DHB is considered a potential can-
didate agent preferable to BBR for the development of new drug. Hy-
drogenated protoberberine alkaloids are rarely found in natural herbal
edema and carrageenan-caused paw edema in
a dose-dependent
manner. BBR exhibited stronger anti-inflammatory effect than DHB at
the same dose.
To explore the inhibitory mechanism of DHB on acute
7

L. Tan, et al.
InternationalImmunopharmacology75(2019)105802
Fig. 7. Effect of DHB on the mRNA expression of iNOS (A), COX-2 (B), TNF-α (C), IL-1β (D), IL-6 (E), and IL-10 (F) in carrageenan-treated mice paws. NC: normal
control group; MC: model control group; Indo: 10 mg/kg indomethacin; BBR: 20 mg/kg berberine; DHB: 10, 20 and 40 mg/kg dihydroberberine. Values given are
mean
S.E.M. (n = 8). ##p < 0.01 vs. NC group. *p < 0.05 and **p < 0.01 vs. MC group.
inflammation, the carrageenan-induced paw edema mice model was
employed. This is a typical and stable acute inflammation model,
commonly used to probe the possible mechanism of anti-inflammatory
agents. At the early stage of inflammation (0 to 2 h), the progress of
paw edema is facilitated primarily by the liberation of histamine, ser-
otonin and bradykinin. While the aggravation of inflammatory reaction
is promoted by the expression of cyclooxygenase, prostaglandins and
other inflammatory mediators at the late stage (3 to 4 h) [27]. Six hours
after carrageenan injection, the inflammatory response could be ne-
glected due to the depletion of kininogen [28]. Therefore, the efficacy
and mechanism of DHB on acute inflammation were evaluated within
4 h after carrageenan injection. Our result displayed that paw edema of
all phases induced by carrageenan was markedly inhibited by pre-
treatment with DHB in a dose-dependent manner, and the efficacy of
BBR was more pronounced than that of DHB. Consistent with the
foregoing result, histopathological analysis proved that pretreatment
with DHB significantly abated the carrageenan-induced inflammatory
response in mice. The result implied that the anti-inflammatory effect of
DHB was potentially associated with the inhibition on the release of
cyclooxygenase, prostaglandins and other inflammatory mediators.
Nitric oxide is a crucial signaling molecule produced by the catalytic
reaction of inducible type nitric oxide synthase on L-arginine [21]. NO
can trigger the elimination of pathogens via production of reactive ra-
dicals such as peroxynitrite, and exert regulatory effect on multiply
physiological and pathological processes such as inflammation, necrosis
and apoptosis [29]. Moreover, researches have shown that NO and
iNOS are related to the biosynthesis of COX-2 and directly affect its
activity [30]. COX-2 cannot be detected in most tissues in the physio-
logical condition, however, it would be secreted by monocytes, syno-
viocytes, fibroblasts, megakaryocytes and chondrocytes when stimu-
lated by inflammation and damage [31,32]. In addition, COX-2
participates in the synthesis of prostaglandins, especially PGE2 [32,33].
PGE2 is another important inflammatory mediator associated with nu-
merous inflammatory disorders [34]. In the current work, pretreatment
with DHB significantly down-regulated the mRNA expression of iNOS
and COX-2, and inhibited the release of NO and PGE2 induced by car-
rageenan in a dose-dependent manner. DHB supposedly antagonized
the NO and PGE2 production by suppressing iNOS and COX-2 mRNA
expression, which presumably contributed to the anti-inflammatory
effect of DHB.
IL-6, IL-1β and TNF-α are among the most typical pro-inflammatory
mediators, while IL-10 is a well-known anti-inflammatory mediator
[35]. TNF-α and IL-1β can activate macrophages, T cells and signaling
pathways connected with inflammatory action when the organism is
8

L. Tan, et al.
InternationalImmunopharmacology75(2019)105802
Fig. 8. Effect of DHB on the NF-κB and MAPK signaling pathways in carrageenan-treated mice paws. NC: normal control group; MC: model control group; Indo:
10 mg/kg indomethacin; BBR: 20 mg/kg berberine; DHB: 10, 20 and 40 mg/kg dihydroberberine. (A) The protein expression levels of IκBα, p-IκBα, cytoplasmic p65,
and nuclear p65 in the NF-κB signaling pathway. (B) The protein expression levels of p38, p-p38, JNK, p-JNK, ERK, and p-ERK in the MAPK signaling pathway. Values
given are mean
S.E.M. (n = 3). ##p < 0.01 vs. NC group. *p < 0.05 and **p < 0.01 vs. MC group.
under attack [35]. To be specific, TNF-α and IL-1β can facilitate the
expression of IL-6, iNOS and COX-2 and the generation of PGE2 [36]. IL-
6 is one kind of pro-inflammatory mediators secreted by numerous cell
types, including B cells, T cells, mononuclear phagocytes, keratinocytes,
endothelial cells, fibroblasts, bone marrow cells and hepatocytes [35].
By augmenting the recruitment of neutrophils and leukocytes, IL-6
conduces to the inflammatory response and multiple disorders [37]. In
addition, IL-10, an anti-inflammatory mediator, has been reported to
exert inhibitory effect on the release of pro-inflammatory mediators like
TNF-α and IFN-γ, and mediates the inflammatory and immune re-
sponses [38]. In this study, it was observed that the production and
mRNA expression of IL-6, IL-1β and TNF-α were notably suppressed by
DHB in a dose-dependent manner, while the level and mRNA expression
of IL-10 were remarkably elevated by DHB. Therefore, the anti-in-
flammatory effect of DHB might be intimately associated with the fa-
vorable regulation of anti-inflammatory status.
Previous studies have illustrated that inflammatory mediators in-
cluding IL-6, IL-1β and TNF-α can boost the activation of MAPK and
NF-κB signaling pathways [39]. In turn, the MAPK and NF-κB signaling
pathways can also regulate the expression of inflammatory mediators
[39]. NF-κB signaling pathway is one of the well-recognized pathways
modulating immune and inflammatory responses [23]. Under normal
physiological conditions, NF-κB heterodimer consisting of NF-κB1/p50
and Rel A/p65 is normally localized in the cytoplasm via binding to its
inhibitor IκB [40]. Once NF-κB is activated, phosphorylation and de-
gradation of IκB will induce the separation of IκB and NF-κB, and the
nuclear translocation of NF-κB heterodimer from cytoplasm to nucleus.
The transcription of inflammatory mediators, such as IL-6, IL-1β, TNF-
α, IL-10, COX-2 and iNOS, will be therefore activated [41]. To de-
termine whether the anti-inflammatory effect of DHB involved the NF-
κB signaling pathway, relevant upstream signal molecules of NF-κB
were examined. Results revealed that carrageenan treatment activated
the NF-κB signaling pathway by promoting the phosphorylation and
degradation of IκB and activating the translocation of p65 from cyto-
plasm to nucleus. Nevertheless, pretreatment with DHB significantly
up-regulated the expression of IκBα and p65 (cytoplasmic) and down-
regulated the p-IκBα and p65 (nuclear) expression levels. Therefore,
DHB might suppress carrageenan-induced inflammation, at least in
part, via inhibiting the NF-κB signaling pathway.
Besides the NF-κB signaling pathway, the MAPK pathway consisting
of JNK, p38 MAPK and ERK also critically contributes to the develop-
ment of acute inflammation [42]. ERK, activated by cytokines, phorbol
esters, growth factors and other mitogenic stimuli, is related to the
modulation of cell meiosis, proliferation and differentiation [42]. The
members of JNK family play a key role in inflammation, apoptosis,
neural development and various signal transduction [42]. p38 is a vital
member of MAPK family to control inflammation [43]. Researches have
suggested that p38 can mediate the phosphorylation and activation of
9

L. Tan, et al.
InternationalImmunopharmacology75(2019)105802
Fig. 9. The proposed anti-inflammatory mechanism of dihydroberberine.
several transcription factors related to inflammation, therefore reg-
ulating the production and expression of inflammatory mediators [44].
Our results showed that carrageenan treatment remarkably augmented
the phosphorylation of JNK and p38. By contrast, pretreatment with
DHB significantly antagonized the phosphorylation of JNK and p38,
while exerted no significant effect on ERK. Therefore, the anti-in-
flammatory effect of DHB might be closely associated with the blockage
of NF-κB and MAPK signaling pathways, which was in accord with
preceding observations in vitro to some extent [11,42].
Previous researches have reported that the bioactivities of DHB
were superior to those of BBR due to enhanced bioavailability [10,11].
Our result indicated that the anti-inflammatory effect of DHB was
weaker than that of BBR, which was inconsistent with previous reports
suggestive of superior anti-atherosclerosis [11], anti-adiposity, and
hypolipidemic [12] activities of DHB over BBR [10–12]. Previous study
has revealed that once absorbed, DHB is rapidly converted back to BBR
[10], highlighting that this is likely the active moiety. These findings
indicate that DHB is in essence an effective vehicle for delivering BBR to
the circulation [10], mutually and collectively contributing to the anti-
inflammatory effect of PC. Our finding was analogous to the case of
curcumin and tetrahydrocurcumin. Research has shown that double
bonds play a major role in inactivating NF-κB by curcumin when
compared with tetrahydrocurcumin [45].
deduced from the result. Hence, the enhanced anti-inflammatory effect
was postulated to be attributed to the presence of aromatization of ring
C and quaternary nitrogen (cationic center: the 7-position quaternary
ammonium) in BBR, which was congruent with the acetylcholinesterase
inhibitory activities of palmatine and tetrahydropalmatine [46]. This
observation highlighted the role of quaternary nitrogen contributing to
the bioactivities of protoberberine alkaloids, which was in concert with
other report to some extent [47].
To the best of our knowledge, this study is the first report that DHB,
the hydrogenated derivative of BBR, naturally exists in PC, and also the
first identification of hydrogenated protoberberine alkaloids in PC. Our
work presents the exception that DHB, the more biologically available
derivative of quaternary BBR, exerts weaker anti-inflammatory effect,
which enriches our knowledge of comparative bioactive profile of DHB
and BBR. However, further in-depth investigation should be merited to
provide precise mechanism. And the comparative study on the bioac-
tivity profile of DHB and BBR is warranted in the future work.
5. Conclusion
Dihydroberberine was proved to be one of the anti-inflammatory
ingredients naturally exited in Phellodendri Chinese Cortex. The anti-
inflammatory mechanism might be associated with dual modulation of
NF-κB and MAPK signaling pathways and regulation of inflammatory
mediators (Fig. 9). The anti-inflammatory effect of dihydroberberine
was weaker than that of BBR. This work provides further empirical
evidence for the use of Phellodendri Chinese Cortex to treat in-
flammation-related diseases in folk medicine. Dihydroberberine pre-
sumably serves as a lead molecule for further chemical modification to
optimize the therapeutic benefit against inflammatory diseases.
Structurally speaking, the structure of tertiary amine DHB is derived
from quaternary ammonium BBR by reduction of the N7-C8 bond (C]
N double bond), and the molecule of DHB lacks classical OeH or NeH
donors owing to lack of double bond in the inner quinolizine ring
system [16]. Saturation of double bond between N-7 and C-8 (CeN
single bond) and the resulting extended conjugated π-electron system of
BBR seem to be essential for its anti-inflammatory activity, as could be
10

L. Tan, et al.
InternationalImmunopharmacology75(2019)105802
Declaration of competing interest
The authors declare no conflict of interest.
Acknowledgments
isolated from patchouli oil in mice, Eur. J. Pharmacol. 781 (2016) 229–238.
[21] J.L. Liang, J.Z. Wu, Y.H. Liu, et al., Patchoulene epoxide isolated from patchouli oil
suppresses acute inflammation through inhibition of NF-kappaB and down-
regulation of COX-2/iNOS, Mediat. Inflamm. 2017 (2017) 1089028.
[22] H. Sun, H. Wang, A. Zhang, et al., Chemical discrimination of cortex Phellodendri
amurensis and cortex Phellodendri chinensis by multivariate analysis approach,
Pharmacogn. Mag. 12 (2016) 41–49.
[23] Q. Shi, J. Cao, L. Fang, et al., Geniposide suppresses LPS-induced nitric oxide, PGE2
and inflammatory cytokine by downregulating NF-kappaB, MAPK and AP-1 sig-
naling pathways in macrophages, Int. Immunopharmacol. 20 (2014) 298–306.
[24] L. Kole, B. Giri, S.K. Manna, et al., Biochanin-A, an isoflavon, showed anti-pro-
liferative and anti-inflammatory activities through the inhibition of iNOS expres-
sion, p38-MAPK and ATF-2 phosphorylation and blocking NFκB nuclear translo-
cation, Eur. J. Pharmacol. 653 (2011) 8.
[25] C. Luo, H. Chen, Y. Wang, et al., Protective effect of coptisine free base on in-
domethacin-induced gastric ulcers in rats: characterization of potential molecular
mechanisms, Life Sci. 193 (2018) 47–56.
[26] L. Tan, C. Li, H. Chen, et al., Epiberberine, a natural protoberberine alkaloid, in-
hibits urease of Helicobacter pylori and jack bean: susceptibility and mechanism,
Eur. J. Pharm. Sci. 110 (2017) 77–86.
[27] N. Sengar, A. Joshi, S.K. Prasad, et al., Anti-inflammatory, analgesic and anti-
pyretic activities of standardized root extract of Jasminum sambac, J.
Ethnopharmacol. 160 (2015) 140–148.
This work was supported by grants from National Science
Foundation of China (No. 81503202), Science and Technology
Development Special Project of Guangdong Province (No.
2017A050506044), Science and Technology Planning Project of
Guangdong Province (2013A022100001), Department of Education of
Guangdong Province Feature Innovation Project (No. 2016KTSCX018),
and Guangzhou Municipal Science and Technology Project (No.
201704030028). Characteristic Cultivation Program for Subject
Research of Guangzhou University of Chinese Medicine (No.
XKP2019007), and Key Program for Subject Research of Guangzhou
University of Chinese Medicine (No. XK2018016).
[28] S.A. Lee, S.M. Moon, Y.H. Choi, et al., Aqueous extract of Codium fragile suppressed
inflammatory responses in lipopolysaccharide-stimulated RAW264.7 cells and
carrageenan-induced rats, Biomed. Pharmacother. 93 (2017) 1055–1064.
[29] D.A. Wink, H.B. Hines, R.Y. Cheng, et al., Nitric oxide and redox mechanisms in the
immune response, J. Leukoc. Biol. 89 (2011) 873.
[30] M.T. Mansouri, A.A. Hemmati, B. Naghizadeh, et al., A study of the mechanisms
underlying the anti-inflammatory effect of ellagic acid in carrageenan-induced paw
edema in rats, Indian J. Pharmacol. 47 (2015) 292–298.
[31] N.H. Goradel, M. Najafi, E. Salehi, et al., Cyclooxygenase-2 in cancer: a review, J.
Cell. Physiol. 234 (2019) 5683–5699.
[32] X. Kang, J.G. Qiu, Q.Q. Li, et al., Cyclooxygenase-2 contributes to oxidopamine-
mediated neuronal inflammation and injury via the prostaglandin E2 receptor EP2
subtype, Sci. Rep. 7 (2017) 9459.
[33] E. Moita, A. Gil-Izquierdo, C. Sousa, et al., Integrated analysis of COX-2 and iNOS
derived inflammatory mediators in LPS-stimulated RAW macrophages pre-exposed
to Echium plantagineum L. bee pollen extract, PLoS One 8 (2013) e59131.
[34] N. Paulino, A.S. Paulino, S.N. Diniz, et al., Evaluation of the anti-inflammatory
action of curcumin analog (DM1): effect on iNOS and COX-2 gene expression and
autophagy pathways, Bioorg. Med. Chem. 24 (2016) 1927–1935.
[35] M.D. Turner, B. Nedjai, T. Hurst, et al., Cytokines and chemokines: at the crossroads
of cell signalling and inflammatory disease, Biochim. Biophys. Acta-Mol. Cell. Res.
1843 (2014) 2563–2582.
[36] B. Orlikova, M. Schumacher, T. Juncker, et al., Styryl-lactone goniothalamin in-
hibits TNF-alpha-induced NF-kappaB activation, Food Chem. Toxicol. 59 (2013)
572–578.
[37] H.R. Kim, D.Y. Shin, K.H. Chung, In vitro inflammatory effects of poly-
hexamethylene biguanide through NF-kappaB activation in A549 cells, Toxicol. in
Vitro 38 (2017) 1–7.
References
[1] L. Helming, Inflammation: cell recruitment versus local proliferation, Curr. Biol. 21
(2011) R548–R550.
[2] T.H. Kim, M.S. Kang, N. Mandakhbayar, et al., Anti-inflammatory actions of folate-
functionalized bioactive ion-releasing nanoparticles imply drug-free nanotherapy of
inflamed tissues, Biomaterials 207 (2019) 23–38.
[3] P.J. Murray, Macrophage activation and polarization, Semin. Immunol. 27 (2015)
235–236.
[4] D. Laveti, M. Kumar, R. Hemalatha, et al., Anti-inflammatory treatments for chronic
diseases: a review, Inflamm. Allergy Drug Targets 12 (2013) 349–361.
[5] L.C. Miao, H.X. Tao, Y. Peng, et al., The anti-inflammatory potential of Portulaca
oleracea L. (purslane) extract by partial suppression on NF-kappa B and MAPK
activation, Food Chem. 290 (2019) 239–245.
[6] Y.Y. Choi, M.H. Kim, J.M. Han, et al., The anti-inflammatory potential of Cortex
Phellodendron in vivo and in vitro: down-regulation of NO and iNOS through
suppression of NF-kappaB and MAPK activation, Int. Immunopharmacol. 19 (2014)
214–220.
[7] Y.A. Bae, H.G. Cheon, Activating transcription factor-3 induction is involved in the
anti-inflammatory action of berberine in RAW264.7 murine macrophages, Korean
J. Physiol. Pharmacol. 20 (2016) 415–424.
[8] X. Wu, Y. Li, Q. Wang, et al., Effects of berberine and pomegranate seed oil on
plasma phospholipid metabolites associated with risks of type 2 diabetes mellitus by
U-HPLC/Q-TOF-MS, J. Chromatogr. B 1007 (2015) 110.
[9] X.N. Li, A.H. Zhang, M.J. Wang, et al., Screening the active compounds of
Phellodendri amurensis cortex for treating prostate cancer by high-throughput
chinmedomics, Sci. Rep. 7 (2017) 46234.
[38] W.J. Ouyang, A. O’Garra, IL-10 family cytokines IL-10 and IL-22: from basic science
[10] R. Feng, J.W. Shou, Z.X. Zhao, et al., Transforming berberine into its intestine-
absorbable form by the gut microbiota, Sci. Rep. 5 (2015) 12155.
[11] J. Chen, J. Cao, L. Fang, et al., Berberine derivatives reduce atherosclerotic plaque
size and vulnerability in apoE(−/−) mice, J. Transl. Med. 12 (2014) 326.
[12] N. Turner, J.Y. Li, A. Gosby, et al., Berberine and its more biologically available
derivative, dihydroberberine, inhibit mitochondrial respiratory complex I: a me-
chanism for the action of berberine to activate AMP-activated protein kinase and
improve insulin action, Diabetes 57 (2008) 1414–1418.
to clinical translation, Immunity 50 (2019) 871–891.
[39] H. Shi, J. Ma, C. Mi, et al., Amorfrutin A inhibits TNF-alpha-induced NF-kappaB
activation and NF-kappaB-regulated target gene products, Int. Immunopharmacol.
21 (2014) 56–62.
[40] M. Schuliga, NF-kappaB signaling in chronic inflammatory airway disease,
Biomolecules 5 (2015) 1266–1283.
[41] K.N. Kim, Y.J. Ko, H.M. Yang, et al., Anti-inflammatory effect of essential oil and its
constituents from fingered citron (Citrus medica L. var. sarcodactylis) through
blocking JNK, ERK and NF-kappaB signaling pathways in LPS-activated RAW 264.7
cells, Food Chem. Toxicol. 57 (2013) 126–131.
[13] K. Wang, L. Chai, X. Feng, et al., Metabolites identification of berberine in rats using
ultra-high performance liquid chromatography/quadrupole time-of-flight mass
spectrometry, J. Pharm. Biomed. Anal. 139 (2017) 73–86.
[42] B. Dai, Y. Ma, W. Wang, et al., Dihydroberberine exhibits synergistic effects with
sunitinib on NSCLC NCI-H460 cells by repressing MAP kinase pathways and in-
flammatory mediators, J. Cell. Mol. Med. 21 (2017) 2573–2585.
[43] A.Q. Khan, R. Khan, W. Qamar, et al., Geraniol attenuates 12-O-tetra-
decanoylphorbol-13-acetate (TPA)-induced oxidative stress and inflammation in
mouse skin: possible role of p38 MAP kinase and NF-kappaB, Exp. Mol. Pathol. 94
(2013) 419–429.
[44] D. Li, Y. Fu, W. Zhang, et al., Salidroside attenuates inflammatory responses by
suppressing nuclear factor-kappaB and mitogen activated protein kinases activation
in lipopolysaccharide-induced mastitis in mice, Inflamm. Res. 62 (2013) 9–15.
[45] S.K. Sandur, M.K. Pandey, B. Sung, et al., Curcumin, demethoxycurcumin, bisde-
methoxycurcumin, tetrahydrocurcumin and turmerones differentially regulate anti-
inflammatory and anti-proliferative responses through a ROS-independent me-
chanism, Carcinogenesis 28 (2007) 1765–1773.
[14] C. Zhou, J. Li, S. Tan, et al., Selective extraction of berberine and palmatine from
Huangbai powder, Pak. J. Pharm. Sci. 26 (2013) 1023–1025.
[15] H.Matsuura Subeki, K. Takahashi, et al., Antibabesial activity of protoberberine
alkaloids and 20-hydroxyecdysone from Arcangelisia flava against Babesia gibsoni
in culture, The J. Vet. Med. Sci. 67 (2005) 223–227.
[16] S. Pingali, J.P. Donahue, F. Payton-Stewart, Weak C-H...X (X = O, N) hydrogen
bonds in the crystal structure of dihydroberberine, Acta Crystallogr. C Struct. Chem.
70 (2014) 388–391.
[17] H.B. Chen, C.D. Luo, J.L. Liang, et al., Anti-inflammatory activity of coptisine free
base in mice through inhibition of NF-kappaB and MAPK signaling pathways, Eur.
J. Pharmacol. 811 (2017) 222–231.
[18] L.B. Rodrigues, A. Oliveira Brito Pereira Bezerra Martins, F.R. Cesario, et al., Anti-
inflammatory and antiedematogenic activity of the Ocimum basilicum essential oil
and its main compound estragole: in vivo mouse models, Chem. Biol. Interac. 257
(2016) 14–25.
[19] Y. Tang, L. Yin, Y. Zhang, et al., Study on anti-inflammatory efficacy and correlative
ingredients with pharmacodynamics detected in acute inflammation rat model
serum from Caulis Lonicerae japonicae, Phytomedicine 23 (2016) 597–610.
[20] Z. Zhang, X. Chen, H. Chen, et al., Anti-inflammatory activity of beta-patchoulene
[46] H.T. Xiao, J. Peng, Y. Liang, et al., Acetylcholinesterase inhibitors from Corydalis
yanhusuo, Nat. Prod. Res. 25 (2011) 1418–1422.
[47] H.L. Li, T. Han, R.H. Liu, et al., Alkaloids from Corydalis saxicola and their anti-
hepatitis B virus activity, Chem. Biodivers. 5 (2008) 777–783.
11