An innovative biotransformation to produce resveratrol by: Bacillus safensis

Article abstract of DOI:10.1039/c9ra01338e

Resveratrol is considered as a potential food supplement, cosmetic ingredient and nutraceutical. In this study, resveratrol was produced by biotransformation successfully. In detail, a β-glucosidase producing strain was isolated and identified as Bacillus safensis, and it could convert polydatin to resveratrol efficiently and rapidly. Further research showed that the conversion rate to resveratrol reached 93.1% in 8 h at 37 °C. The production of resveratrol was confirmed by HPLC, LC-MS and ¹H-NMR to identify its structure and it was verified to possess antibacterial properties especially against Escherchia coli. To illustrate the resveratrol transformation mechanism, several glucosidases from B. safensis CGMCC 13129 were expressed and analyzed. The results showed that BGL4 and BGL5 had higher transformation activity compared with other tested glucosidases. This research provides a novel approach to produce resveratrol, and would promote the application of resveratrol in health-promoting pharmaceutical and food products.

Full text of DOI:10.1039/c9ra01338e

RSC Advances
View Article Online
View Journal | View Issue
PAPER
An innovative biotransformation to produce
resveratrol by Bacillus safensis†
Cite this: RSC Adv., 2019, 9, 15448
ab
Xiaoyan Hu,
Yexue Liu,ab Dengke Li,ab Wei Feng,ab Hanmeng Ni,ab Shan Cao,c
abd
abd
*
*
Fuping Lu
and Yu Li
Resveratrol is considered as a potential food supplement, cosmetic ingredient and nutraceutical. In this
study, resveratrol was produced by biotransformation successfully. In detail, a b-glucosidase producing
strain was isolated and identified as Bacillus safensis, and it could convert polydatin to resveratrol
efficiently and rapidly. Further research showed that the conversion rate to resveratrol reached 93.1% in
8 h at 37 ꢀC. The production of resveratrol was confirmed by HPLC, LC-MS and 1H-NMR to identify its
structure and it was verified to possess antibacterial properties especially against Escherchia coli. To
illustrate the resveratrol transformation mechanism, several glucosidases from B. safensis CGMCC 13129
were expressed and analyzed. The results showed that BGL4 and BGL5 had higher transformation
activity compared with other tested glucosidases. This research provides a novel approach to produce
resveratrol, and would promote the application of resveratrol in health-promoting pharmaceutical and
food products.
Received 22nd February 2019
Accepted 8th May 2019
DOI: 10.1039/c9ra01338e
rsc.li/rsc-advances
resveratrol-producing plants is usually unideal and conned by
1. Introduction
Resveratrol (trans-3,5,40-trihydroxystilbene),
the long growth cycle of plants.10 Keylor reported a chemical
synthesis to produce resveratrol. The yield was 5.1% and there
were 13 linear synthetic steps in the total syntheses.11 However,
the chemical synthesis is usually limited by the use of large
amount of organic solvents, which not only increase the cost but
also be considered as a potential threat to the environment.
Besides, chemical synthesis is also hindered by poor water
solubility and limited chemical stability of resveratrol.12
a polyphenolic
compound of the stilbene family, has been found in many
plants including grapes, peanuts, blueberries, cassia seed and
knotweed.1,2 It has attracted a lot of attention owing to its
benecial properties,3 such as defense against pathogen infec-
tion, antitumor, anti-inammatory, antidiabetic, antith-
rombotic, and antiaging.4,5 In recent years, resveratrol has been
applied as an over-the-counter nutritional supplement in health
products, energy drinks and cosmetics products.6 With
increasing emphasis on resveratrol, the demand is expected to
constantly increase in the future.
Owing to cost-effectiveness and environmental friendly, the
most widely research on resveratrol producing is biotransforma-
tion.13 Che developed an enzymatic system for producing resver-
atrol from glucose and the yield was 224.4 mg Lꢁ1 14 Zhou proved
.
polydatin in P. cuspidatum was able to be converted to resveratrol
by polydatin-b-D-glucosidase.15 While b-glucosidase has the ability
to hydrolyze glycosidic bonds to release glucose and glucosyl
residues.16 This peculiarity allows b-glucosidase to specically
transform polydatin to resveratrol. Furtherly, microbial production
possesses more advantages including rapid growth, easy of culti-
vation and high-level production.17 Until now, researches of
microbial transformation mainly focus on grey mold for producing
resveratrol.18,19 However, compared to mold, using bacterial for
biotransformation may provide more excellent properties such as
shorter production cycles, low cost, high conversion efficiency and
easy control of reaction conditions.20 Therefore, bacteria should be
considered as a potential candidate for resveratrol production.
The aim of this study was to produce resveratrol by bacteria
transformation successfully. In this study, a bacteria strain
which produced b-glucosidases was screened, characterized
and named as B. safensis CGMCC 13129. Polydatin could be
Due to its low yield in plants and high production cost, the
amount of resveratrol available is clearly limited.7 At present,
resveratrol is mainly produced by plant extraction, chemical
synthesis and biotransformation.8 In skin and esh of grape,
the resveratrol contents were only 0.5 mg kgꢁ1 and 0.25 mg
kgꢁ1
,
respectively.9 The resveratrol yield extracted from
aKey Laboratory of Industrial Fermentation Microbiology, Ministry of Education,
Tianjin University of Science & Technology, Tianjin 300457, China. E-mail: liyu@
tust.edu.cn; lfp@tust.edu.cn
bCollege of Biotechnology, Tianjin University of Science & Technology, Tianjin 300457,
China
cCollege of Leather Chemistry and Engineering, Qilu University of Technology,
Shandong, China
dTianjin Engineering Research Center of Microbial Metabolism and Fermentation
Process Control, China
† Electronic supplementary information (ESI) available. See DOI:
10.1039/c9ra01338e
15448 | RSC Adv., 2019, 9, 15448–15456
This journal is © The Royal Society of Chemistry 2019

View Article Online
Paper
RSC Advances
directly converted to resveratrol through enzyme produced from
CGMCC 13129. The conversion activity was also analyzed in this
study, and aer optimized the biotransformation conditions,
the conversion rate reached 93.1%. To explore the mechanism
why this strain has high biotransformation activity, different
glucosidases from this strain were cloned and analyzed, and two
glucosidases encoded by bgl4 and bgl5 were found the more
important enzymes involved in this biotransformation. This
was the rst report of resveratrol biotransformation by bacteria.
And this research would provide signicant support in devel-
oping resveratrol application though improving resveratrol
yield by bacteria transformation.
2.3 Classication of strain
2.3.1 Morphological identication. The b-glucosidase
producing strain, which having the ability to convert polydatin
to resveratrol was identied through its colony morphology
property. The puried strain was spread onto the nutrient agar
medium. Aer cultivation for 12 h, the colony morphologies
were observed through Gram straining method23 by optical
microscope (MODEL ECLIPSE Ci-S, Nikon, Japan) and scanning
electron microscope (X-MaxN, OXFORD Instruments, UK).24
2.3.2 16S rDNA identication and phylogenetic analysis.
The strain was identied with the 16S rDNA sequencing.
Extracted DNA was used as template for polymerase chain
reaction (PCR). The standard method presented by Sam-
brook25 was used for the extraction of bacterial DNA and
designed PCR primers 27F (50AGAGTTTGATCCTGGCTCAG 30)
and 1492R (50TACGGTTACCTTGTTACGACTT 30) for ampli-
cation of 16S rDNA gene. PCR amplication was performed
according to the PrimeSTAR HS DNA polymerase protocol
(TaKaRa, Dalian, China). PCR prole comprised initial dena-
turation at 95 ꢀC for 5 min, followed by 30 amplication cycles
2. Materials and methods
2.1 Materials, reagents and culture medium
B. safensis CGMCC 13129 was screened from planting polyg-
onum cuspidatum soil collected from Suizhou City, Hubei
Province, and isolated by dilution plate technology. E. coli
JM109, E. coli BL21 (DE3) and the plasmid pET28a were all
preserved in our laboratory. The screening medium contained
1% (w/v) tryptone, 0.5% (w/v) yeast extract, 1% NaCl (w/v), 0.3%
geniposide (w/v, 50% purity) and 2% agar (w/v). The seed
medium consisted of 1% tryptone (w/v), 0.5% yeast extract (w/v)
and 1% NaCl (w/v). The transformation medium was composed
of 0.5% beef extract (w/v), 1% tryptone (w/v), 0.5% NaCl (w/v)
and polygonum cuspidatum (50% purity). Methanol (chro-
matographically purity), acetonitrile (chromatographically
purity), geniposide (50%), semi-nished herbs of polygonum
cuspidatum (50%), the reference substance of resveratrol (98%)
were purchased from Nanjing Dilger Medical Technology Co.
Ltd (Nanjing, China). All other chemicals and reagents were
analytical grade and purchased from commercial sources
(Sinopharm Chemical Reagent Co. Ltd.).
ꢀ
ꢀ
of denaturation at 9ꢀ5 C for 10 s, annealing at 54 C for 45 s
ꢀ
and extension at 72 C for 90 s, and a nal extension at 72 C
for 10 min. The puried PCR products were sequenced by
Genewiz Inc. (South Plaineld, NJ, USA). Compared with
sequences data from the National Center of Biotechnology
information (NCBI),26 the nucleotide sequences of the isolate
were checked by BLAST analysis using the NCBI.27 Its
phylogeny was constructed using the neighbour-joining
method28 in MEGA7.29
2.4 Biotransformation process analysis
2.4.1 Preliminary analysis. A single colony was further
cultured in seed medium to logarithmic growth phase, and then
transferred 2% seed liquid into biotransformation medium,
cultured at 37 ꢀC, 220 rpm. The viable cells were counted every 2
hours as well as the growth curves were plotted, and then
2.2 Strain screening
2.2.1 Screening of b-glucosidases-producing strains. conversion rate with time was calculated. The fermentation
ꢀ
Approximately 1 g of soil sample was dissolved in saline at broth was centrifuged at 4 C with 5000 rpm. The supernatant
different dilutions (10ꢁ1 to 10ꢁ7) by using ten-fold dilution was removed and methanol was added for purication.30 Aer
method. Diluted solution (100 mL) was taken from three suitable centrifugation, the supernatant were separated. Then methanol
dilutions (10ꢁ5, 10ꢁ6, 10ꢁ7) and applied onto the screening was distilled off using a rotary evaporator (R-300, Buchi, Swit-
plate. We screened the bacteria using the property that blue zerland), and resveratrol was obtained.
pigment was formed by amino acids reaction with genipin,
2.4.2 Cloning, expression and enzyme activity assay. The
which was produced from hydrolysis of geniposide by b-gluco- gene encoding glucosidases was amplied by standard poly-
sidases.21 Aer incubation for 12 h at 37 ꢀC, the growing merase chain reaction methods using B. safensis CGMCC 13129
bacterial colonies were observed and single colonies were genomic DNA as template. The cloning primer sequences were
further puried by streak plate method.
designed according to glucosidase gene from Bacillus safensis
2.2.2 Screening of b-glucosidases-producing strains with strain JPL_MERTA8-2 (NZ_LATH01000001.1), and were showed
high conversion activities. Due to polydatin can be converted to in Table S1.† The amplication was carried out under the
resveratrol with b-glucosidase,22 we further screened to obtain following conditions: the rst step was at 95 C for 4 min; fol-
ꢀ
the strains with high conversion activities. The bacterial were lowed by 30 cycles of 95 ꢀC for 10 s, 56 ꢀC for 45 s, and 72 ꢀC for
inoculated in biotransformation culture medium and then 30 s; and the nal extension was carried out at 72 ꢀC for 10 min.
incubated at 37 ꢀC for 12 h. The conversion rate was dened as The PCR product was gel puried and then ligated into pET28a.
the ratio of amount of substance of product to substrate. The recombinant plasmid pET28a-bgl was transformed into E.
According to evaluate the conversion rate, strains with high coli JM109 and was identied by restriction analysis and
conversion activity were screened out.
sequencing. Then the resulting vector was transformed into E.
This journal is © The Royal Society of Chemistry 2019
RSC Adv., 2019, 9, 15448–15456 | 15449

View Article Online
RSC Advances
Paper
coli BL21 (DE3) for expression. Through enzyme activity assay
and conversion activity assay, the key enzymes in the biotrans-
formation process have been screened. The b-glucosidase
activity was assayed using p-nitrophenyl-b-D-glucopyranoside
(pNPG) as the substrate. The reaction mixture, which consisted
of 1.9 mL of citric acid/phosphate buffer (200 mM Na2HPO4 and
100 mM citric acid pH 5.0, the preparation of buffer was indi-
cated in Table S2†), 0.1 mL of enzyme sample and 1 mL of 3 mM
pNPG, was incubated at 50 ꢀC for 4 min. The reaction was
terminated by adding 1 mL of 1 M Na2CO3. The absorbance of
the released p-nitrophenol (pNP) was measured at 400 nm. One
unit of enzyme activity was dened as the amount of enzyme
that catalyzes the generation of 1 mmol of pNP per minute under
the described assay conditions. Protein concentrations were
determined using a BCA Protein Assay Kit with BSA as the
standard. The specic activity was expressed as U mgꢁ1. The
conversion activity was assayed using polydatin as the substrate.
The 3 mL reaction mixture which consisted of 5g Lꢁ1 polydatin
3. Results and discussion
3.1 Strains screening and identication
From the soil samples, 32 bacteria strains which produced b-
glucosidase were isolated. According to the ratio of hydrolytic
zone diameter to colony diameter (H/C), 12 strains with
higher b-glucosidases activity were further screened out for
the conversion experiment. A strain which had the highest b-
glucosidase production ability was isolated, identied and
analyzed. As shown in Fig. 1(A), due to genipin generated
from geniposide hydrolysis by b-glucosidase could form blue
color,33 the blue color around the colony represented the
ability of producing b-glucosidase. The strain exhibited the
morphological characteristics such as Gram-positive, rod-
shaped, spore-forming (Fig. 1(B–D)). Based on the typical
features, it was suggested that this strain could be described
as Bacillus. In order to identify bacterial species of the
screened strains, the partial 16S rDNA gene was amplied
using 27F and 1492R primer. The sequences produced were
compared with sequences from NCBI using BLAST method,
and showed the similarity as Bacillus safensis. The phyloge-
netic tree showed the closest sequences in Fig. 2. Based on
ꢀ
and 10 U glucosidases was incubated at 50 C for 30 min. The
amount of resveratrol was detected by HPLC.
2.5 Product identication and analysis
2.5.1 Structure analysis. HPLC analysis was performed with
an Agilent Venusil XBP column (5 mm, 4.6 ꢂ 250 nm). The
column temperature was maintained at 35 ꢀC and detection
wavelength was 306 nm. The mobile phase consisted of
a
mixture of acetonitrile, water and phosphoric acid
(40 : 59.82 : 0.18, v/v/v). The HPLC-MS was also carried on using
Agilent Venusil XBP column with the same column temperature
and detection wavelength as HPLC analysis. The mobile phase
was composed by acetonitrile, water and formic acid
(40 : 59.94 : 0.06, v/v/v). The 1H spectra were recorded in
acetone-d6 (C3D6O) and in acetone-d6 with appropriate amount
of D2O on a Bruker AV-500 spectrometer at working frequencies
400 MHz. Chemical shis were corresponded with ppm (d)
values and coupling constants (J).31
2.5.2 Biological activity analysis. The crude extract of
resveratrol was dissolved in methanol and sterilized by ltration
through 0.22 mm Millipore lters. Antimicrobial tests were then
carried out by the Oxford cup method.32 1 mL bacterial
suspension (106 CFU mLꢁ1) was injected into Petri plate with
culture medium at 50 ꢀC (20 mL per plate), then set aside until
coagulation. Oxford cups (6 mm) were placed on the inoculated
agar, and 100 mL of 5 mg mLꢁ1 resveratrol was added with
a micropipette. The diameter of inhibition zone (DIZ) was
measured aer 12 h at 37 ꢀC, and methanol was used as the
negative control. Tests were repeated three times and calculated
the average of the inhibition zone diameter.
Fig. 1 Morphological characteristics of CGMCC 13129. (A) Hydrolysis
circle shape (B) colony morphology (C) Gram-staining analysis (D) SEM
analysis.
2.6 Optimization of biotransformation
To enhance the conversion rate of B. safensis CGMCC 13129,
different parameters were selected for optimization, including
temperatures (24 ꢀC, 29 ꢀC, 33 ꢀC, 37 ꢀC, 41 ꢀC), pH levels (pH 5,
6, 7, 8, 9), substrate concentration of 0.10% (w/v), 0.15% (w/v),
0.20% (w/v), 0.25% (w/v), 0.30% (w/v) and conversion time
(6 h, 8 h, 10 h, 12 h and 14 h).
Fig. 2 Phylogenetic tree.
15450 | RSC Adv., 2019, 9, 15448–15456
This journal is © The Royal Society of Chemistry 2019

View Article Online
Paper
RSC Advances
homology research,34 it indicated that the strain was similar
to Bacillus safensis in the evolutionary relationship and
named as Bacillus safensis CGMCC 13129. The similarity of
DNA sequences between B. safensis CGMCC 13129 and B.
safensis NBRC 100820 was 91%. Thus it revealed that the
screened strain was identied as Bacillus safensis. So far, the
strain B. safensis CGMCC 13129 was the rst bacteria with
ability to producing-resveratrol.
3.2 Analysis of resveratrol-producing process
3.2.1 Preliminary evaluation. In order to investigate the
conversion capacity of this strain which hydrolyzed polydatin
to produce resveratrol, the fermentation broth of B. safensis
CGMCC 13129 was observed by using microscope (Fig. 3). It
was found that the turbidity of the medium changed obviously
in 4 h with the number of bacteria increased rapidly. Aer-
wards, the turbidity changed slowly from 4 h to 12 h, while the
number of aggregation compound increased signicantly.
These compounds distributed in ber form initially, and then
gathered into bulks. At 12 h, the large bulk was produced
which should be resveratrol and it would be veried by
analyzing. Besides, conversion rate and viable count was
further calculated in Fig. 4. As known, the conversion capacity
of bacteria is directly impacted by its number and growth
state, and the vital cells count intuitively and accurately re-
ected the number and status of bacteria. As Fig. 4A shown,
the highest conversion rate was 93% at 8 h. The number of
viable bacteria signicantly dropped at 6 h, while the conver-
sion rate decreased at 8 h. The reason for this phenomenon
was that the enzymes still existed in the transformation system
and the conversion could be carried out. The biotransforma-
tion process was shown in Fig. 4B. And the resveratrol-
containing medium was further observed by optical micro-
scope and SEM. Fig. 5A (observed by optical microscope) and
5C (observed by SEM), which were the nal state of resveratrol
biotransformation, showed that some large bulks were
produced and surrounded with B. safensis CGMCC 13129. The
resveratrol standard was observed by microscope (Fig. 5B and
D) and was similar with those producing bulks shown in
Fig. 4 Analysis of resveratrol conversion. (A) The change of conver-
sion rate and viable count with time (B) the conversion process.
Fig. 5A and C. And to explore the key enzymes in this process,
glycosidases from B. safensis CGMCC 13129 were expressed
and analyzed. In order to determine whether the bulk
produced was resveratrol, it should be further analyzed by
1
HPLC, LC-MS and H-NMR analysis.
3.2.2 The overexpression of key enzymes. Polydatin is the
glycosidic derivative of resveratrol. While enzymes such as b-
glucosidase can be used to hydrolyze glucose from various
aglycone to enhance the pharmacological effects of multiple
chemical compounds, including resveratrol, terpenes, and
volatile phenols.22,35,36 Therefore, we cloned and expressed
glycosidase genes in B. safensis CGMCC 13129 to explore the
key enzymes in this conversion process. The glucosidase gene
was amplied from the genomic DNA of B. safensis CGMCC
13129, the gene was ligated into the expression vector
Fig. 3 Observation of liquid turbidity. (A) The changes of medium turbidity at (A1) 0 h, (A2) 4 h, (A3) 8 h and (A4) 12 h. (B) The changes of
producing substances at (B1) 0 h, (B2) 4 h, (B3) 8 h and (B4) 12 h.
This journal is © The Royal Society of Chemistry 2019
RSC Adv., 2019, 9, 15448–15456 | 15451

View Article Online
RSC Advances
Paper
shown in Fig. 6, the band on the SDS-PAGE gel was observed
with an apparent molecular mass of ꢃ62 kDa (lane 2) and
ꢃ54 kDa (lane 3). The full-length DNA of the bgl4 gene con-
sisted of 1608 base pairs that encoded a polypeptide of 535
amino acids. The theoretical molecular mass and isoelectric
point (pI) were 61.56 kDa and 6.10, respectively. And the bgl5
gene consisted of 1407 base pairs that encoded a polypeptide
of 468 amino acids, the theoretical molecular mass and pI
were 54.43 kDa and 5.86, respectively. Finally, the standard
assay mixture was used for the determination of b-glucosi-
dases activity. The nal specic activity of glucosidase was
8.92 U mgꢁ1 and 6.20 U mgꢁ1, respectively. And the conver-
sion rate was 53% and 42%, respectively.
3.3 Identication of products
3.3.1 HPLC, LC-MS and 1H-NMR analysis of product.
Owing to high selectivity and sensitivity, HPLC and LC-MS were
used for analysis of resveratrol produced by B. safensis CGMCC
13129.37 The puried samples were subjected to analysis and
compared with resveratrol standard. An obvious resveratrol
peak was detected at the same retention time as resveratrol
standard.38 From Fig. 7(A), it was seen that the peak appeared at
5.853 min and the purity reached 99.3%. Thus it represented
that resveratrol generated by bacteria transformation.
Fig. 5 Observation of microscopic structure. (A) Product observed by
optical microscope (B) resveratrol standard observed by optical
microscope (C) product observed by SEM (D) resveratrol standard
observed by SEM.
To further conrm resveratrol structure produced by B.
safensis CGMCC 13129, subsequent analysis was performed
with LC-MS. The compound exhibited ion peaks at m/z 102.1,
143.1 and 229.1 (Fig. 7(B)). The main peak at m/z 229.1 rep-
resented the compound was resveratrol, which was formed by
acquiring a molecule from the deprotonated species [M +
H]+.39 Based on these results, it indicated that resveratrol was
successfully generated by bacterial biotransformation with
CGMCC 13129 strain, and extraction with methanol was
effective for resveratrol production.
As known, cis–trans isomers had signicant differences on
chemical properties, physiological activities and pharmaco-
logical effects. It was found that resveratrol derived from
natural plants was described with a mixture of cis & trans
structures.40 The trans-resveratrol was considered as a bio-
logically active isomer41 and contributed to a variety of health
benets such as the antioxidant, antiaging, anti-
inammatory and anti-tumor biological properties.42 In
order to investigate the structure of resveratrol produced by
B. safensis CGMCC 13129, it was unambiguously conrmed
by 1H-NMR analysis (Fig. 7(C)). The 1H-NMR spectra data for
resveratrol was analyzed as follows: 1H-NMR (400 Hz, C3D6O):
d 6.27 (1H, d, J ¼ 2.1 Hz), 6.54 (2H, d, J ¼ 2.1 Hz), 6.84 (2H, d, J
¼ 8.3 Hz), 6.89 (1H, d, J ¼ 16.3 Hz), 7.02 (1H, d, J ¼ 16.3 Hz)
and 7.42 (2H, d, J ¼ 8.3 Hz). Therefore, the compound was
identied as trans-resveratrol and our results were similar to
other studies.22,43
Fig. 6 SDS-PAGE analysis of glucosidases lane M: protein molecular
mass marker, lane 1: fragmentized liquid supernatant of E. coli BL21/
pET28a, lane 2: fragmentized liquid supernatant of E. coli BL21/
pET28a-bgl4, lane 3: fragmentized liquid supernatant of E. coli BL21/
pET28a-bgl5.
pET28a, and the resulting plasmid was transformed into E.
coli BL21 (DE3). The recombinant glucosidase was isolated
and puried from the cultured cells. Aer preliminary
detection, two glucosidases with higher activity were ob-
tained. The glucosidases were analyzed by SDS-PAGE. As
3.3.2 Biological activity analysis of products. Resveratrol
was usually regarded as a natural antimicrobial agent.44
Therefore, the resveratrol produced by B. safensis CGMCC
13129 was used to detect its inhibitory effects on Escherichia
coli, Staphylococcus aureus and Bacillus subtilis by the Oxford
15452 | RSC Adv., 2019, 9, 15448–15456
This journal is © The Royal Society of Chemistry 2019

View Article Online
Paper
RSC Advances
Fig. 7 HPLC, LC-MS and 1H-NMR analysis of resveratrol (A) HPLC analysis of resveratrol. The elution was monitored at 306 nm at a flow rate of
1
1.0 mL minꢁ1 (B) MS spectrum of resveratrol m/z 229.1 [M + H]+ (calculated for C14H13O3, 229.1) (C) H-NMR of resveratrol.
cup method, while the biological activity of product was eval- bacterial strains were in the range of 13.42–14.12 mm. The DIZ
uated. The results showed that the resveratrol had certain value of E. coli was the maximum, which represented that
antibacterial activity on both Gram-positive and Gram- resveratrol produced by B. safensis CGMCC 13129 had
negative bacteria (Fig. 8). The DIZ values for all tested a remarkable antibacterial effect on E. coli.
Fig. 8 The inhibition zone analysis samples with resveratrol were on the left, and the controls with methanol were on the right. (A) Escherichia coli, the
DIZ values was 14.12 ꢄ 0.61 nm (B) Staphylococcus aureus, the DIZ values was 13.82 ꢄ 0.65 nm (C) Bacillus subtilis, the DIZ values was 13.42 ꢄ 0.59 nm.
This journal is © The Royal Society of Chemistry 2019
RSC Adv., 2019, 9, 15448–15456 | 15453

View Article Online
RSC Advances
Paper
Fig. 9 Conversion rate influenced by different conversion conditions (A) temperature (B) pH (C) substrate concentration (D) time.
more than 90%. While in Chen's report, the polydatin was
transformed to resveratrol by piceid-b-D-glucosidase from
Aspergillus oryzae sp. 100 with the conversion rate of 2 g hꢁ1
Uꢁ1 under 60 ꢀC, pH 5.0, 4 h.48 The biotransformation method
of producing resveratrol with co-immobilized Aspergillus niger
and yeast was investigated in Jin's study and the conversion
3.4 Optimization of conversion conditions
A successful conversion process depended on suitable condi-
tions.45 In order to optimize conversion process, factors such
as temperature, pH, substrate concentration and reaction time
were determined. The results showed that the highest
conversion rate appeared at 37 ꢀC, while lower temperature
resulted in the decreasing of conversion rate due to slower rate
of cell growth (Fig. 8(A)). It was obvious that pH 7 was the
optimum pH and the conversion rate was 89.7%. Both alkaline
and acidic conditions resulted in a lower conversion rate of
resveratrol (Fig. 8(B)). It was explained that enzyme from B.
safensis CGMCC 13129, which hydrolyzed polydatin to form
resveratrol, mainly catalyzed by neutral enzyme and the
optimum temperature of this enzyme should be 37 ꢀC.
Meantime, the highest conversion rate of 93.1% was obtained
with 0.15% substrate concentration (Fig. 8(C)). The conversion
obviously decreased with increasing substrate concentration
aer the substrate concentration was over 0.15%. It was
explained that excessive substrate was negative on the growth
of this bacteria. From Fig. 8(D), the conversion rate reached
the highest level at 92.5% through the rst 8 hours, and then
declined over time. With the transformation time increasing
aer 8 h, the resveratrol was accumulated and adsorption
between bacteria and resveratrol occurred. It was not condu-
cive for resveratrol producing. Besides, resveratrol slightly
degraded over time, which also resulted in the decrease of
conversion rate. This phenomenon was also reported in Trela
and Liazid's presentations.46,47 Based on these results, the
resveratrol was extracted and the conversion rate reached
rate reached about 96.7% under 30 C, pH 6.5, 2 days.49 The
ꢀ
ꢀ
conversion rate reached 85.21% under 31 C pH 6.0 and 60 h
with the method of Aspergillus oryzae negative pressure cavi-
tation bioreactor.50 In this study, the time of conversion to
resveratrol was shortened to 8 h successfully and it provided
a more convenient and simple procedure, so our research
provided a promising and competitive biological material for
the production of resveratrol (Fig. 9).
4. Conclusions
This research presented that bacteria could be applied to
produce resveratrol by biotransformation. In this paper, a strain
which produced b-glucosidase was screened from the soil
planted polygonum cuspidatum yearly. It was identied as
Bacillus safensis and named as B. safensis CGMCC 13129. Based
on its enzyme-specic activities and biotransformation, the
resveratrol was produced efficiently. The biotransformation
conditions, including temperature, pH, substrate concentration
and time, were optimized. The results showed that the optimal
ꢀ
conversion time was 8 h (37 C, pH ¼ 7), and the conversation
rate reached 93.1% with methanol extraction. By 1H-NMR
analysis, it demonstrated that B. safensis CGMCC 13129 had
15454 | RSC Adv., 2019, 9, 15448–15456
This journal is © The Royal Society of Chemistry 2019

View Article Online
Paper
RSC Advances
the ability to produce trans-resveratrol efficiently and rapidly. 17 J. Wu, P. Liu, Y. Fan, H. Bao, G. Du, J. Zhou and J. Chen, J.
Our study provided innovative biological producing process for
potential resveratrol application.
Biotechnol., 2013, 167, 404–411.
´
18 B. Houille, N. Papon, L. Boudesocque, E. Bourdeaud,
S. Besseau, V. Courdavault, C. Enguehardgueiffier,
´
G. Delanoue, L. Guerin and J. P. Bouchara, J. Nat. Prod.,
Conflicts of interest
2014, 77, 1658–1662.
´
19 M. Salgado, S. Rodrıguez-Rojo, F. M. Alves-Santos and
There are no conicts to declare.
M. J. Cocero, J. Food Eng., 2015, 165, 13–21.
20 F. Lai, Y. E. Miao, Y. Huang, Y. Zhang and T. Liu, ACS Appl.
Mater. Interfaces, 2015, 8, 3558–3566.
21 S. Fujikawa, Y. Fukui, K. Koga and J. i. Kumada, J. Ferment.
Technol., 1987, 65, 419–424.
22 A. Todaro, R. Palmeri, R. N. Barbagallo, P. G. Pifferi and
G. Spagna, Food Chem., 2008, 107, 1570–1575.
23 K. Minamida, M. Tanaka, A. Abe, T. Sone, F. Tomita, H. Hara
and K. Asano, J. Biosci. Bioeng., 2006, 102, 247–250.
24 J. Hong, W. Guan, G. Jin, H. Zhao, X. Jiang and J. Dai,
Microbiol. Res., 2015, 170, 69–77.
Acknowledgements
This work was nancially supported by The National Key
Research
and
Development
Program
of
China
(2017YFB0308401), National Natural Science Foundation of
China (Grant No. 31871741) and Public Service Platform for
Selection and Fermentation Technology of Industrial Microor-
ganisms (17PTGCCX00190).
25 J. Sambrook, E. F. Fritsch and T. Maniatis, Molecular Cloning:
A Laboratory Manual, Cold Spring Harbor Laboratory Press,
1989.
26 E. W. Sayers, T. Barrett, D. A. Benson, E. Bolton, S. H. Bryant,
K. Canese, V. Chetvernin, D. M. Church, M. DiCuccio and
S. Federhen, Nucleic Acids Res., 2012, 40, D13–D25.
References
1 Y. Z. Mei, R. X. Liu, D. P. Wang, X. Wang and C. C. Dai,
Biotechnol. Lett., 2015, 37, 9–18.
2 A. Y. Berman, R. A. Motechin, M. Y. Wiesenfeld and
M. K. Holz, NPJ Precis. Oncol., 2017, 1, 35.
¨
3 I. Ahuja, R. Kissen and A. M. Bones, Trends Plant Sci., 2012, 27 S. F. Altschul, T. L. Madden, A. A. Schaffer, J. Zhang,
17, 73–90.
Z. Zhang, W. Miller and D. J. Lipman, Nucleic Acids Res.,
1997, 25, 3389–3402.
28 N. Saitou and M. Nei, Mol. Biol. Evol., 1987, 4, 406.
4 M. Li, K. R. Kildegaard, Y. Chen, A. Rodriguez, I. Borodina
and J. Nielsen, Metab. Eng., 2015, 32, 1.
5 L. Huang, S. Zhang, J. Zhou and X. Li, RSC Adv., 2019, 9, 29 S. Kumar, G. Stecher and K. Tamura, Mol. Biol. Evol., 2016,
2572–2580. 33, 1870–1874.
6 J. Christenson, S. J. Whitby, D. Mellor, J. Thomas, 30 D. G. Wang, W. Y. Liu and G. T. Chen, J. Pharm. Anal., 2013,
A. McKune, P. D. Roach and N. Naumovski, Metab. Syndr.
Relat. Disord., 2016, 14, 323–333.
7 S. Jin, M. Luo, W. Wang, C. J. Zhao, C. B. Gu, C. Y. Li, Y. G. Zu,
3, 241–247.
31 H. E. Gottlieb, V. Kotlyar and A. Nudelman, J. Org. Chem.,
1997, 62, 7512–7515.
Y. J. Fu and Y. Guan, Bioresour. Technol., 2013, 136, 766–770. 32 G. Zhang, M. Hu, L. He, P. Fu, L. Wang and J. Zhou, Food
´
´
´
8 A. Martınez-Marquez, J. A. Morante-Carriel, K. Ramırez-
Bioprod. Process., 2013, 91, 158–168.
´
´
´
Estrada, R. M. Cusido, J. Palazon and R. Bru-Martınez, J. 33 A. S. Belle, C. R. Hackenhaar, L. S. Spolidoro, E. Rodrigues,
Plant Biotechnol., 2016, 14, 1813–1825. M. P. Klein and P. F. Hertz, Food Chem., 2018, 246, 266–274.
9 M. T. Barcia, P. B. Pertuzatti, D. Rodrigues, S. Gomez-Alonso, 34 A. Levican, S. Rubio-Arcos, A. Martinez-Murcia, L. Collado
´
´
´
I. Hermosın-Gutierrez and H. T. Godoy, Food Res. Int., 2014,
and M. J. Figueras, Syst. Appl. Microbiol., 2015, 38, 30–35.
35 B. Y. M. S and B. VS, Crit. Rev. Biotechnol., 2002, 22, 375–407.
62, 500–513.
´
˜
10 L. Z. Kang, X. L. Zeng, Z. W. Ye, J. F. Lin and L. Q. Guo, Food 36 P. Gonzalez-Pombo, L. Farina, F. Carrau, F. Batista-Viera and
Chem., 2014, 164, 211–218.
B. M. Brena, Process Biochem., 2011, 46, 385–389.
11 M. H. Keylor, B. S. Matsuura, M. Griesser, J. R. Chauvin, 37 L. Jaitz, K. Siegl, R. Eder, G. Rak, L. Abranko,
R. A. Harding, M. S. Kirillova, X. Zhu, O. J. Fischer,
D. A. Pratt and C. R. Stephenson, Science, 2016, 354, 1260.
G. Koellensperger and S. Hann, Food Chem., 2010, 122,
366–372.
12 L. Hai, D. He, X. He, K. Wang, X. Yang, J. Liu, H. Cheng, 38 S. Y. Shin, N. S. Han, Y. C. Park, M. D. Kim and J. H. Seo,
X. Huang and J. Shangguan, J. Mater. Chem. B, 2017, 5, 29. Enzyme Microb. Technol., 2011, 48, 48–53.
13 S. Jin, B. Yang, Y. Cheng, J. Tan, H. Kuang, Y. Fu, X. Bai, 39 Y. J. Jeong, S. G. Woo, C. H. An, H. J. Jeong, Y. S. Hong,
H. Xie, Y. Gao and C. Lv, Food Bioprod. Process., 2017, 102,
177–185.
Y. M. Kim, Y. B. Ryu, M. C. Rho, W. S. Lee and C. Y. Kim,
Mol. Cells, 2015, 38, 318.
14 J. Che, J. Shi, Z. Gao and Y. Zhang, J. Microbiol. Biotechnol., 40 M. H. Keylor, B. S. Matsuura and C. R. Stephenson, Chem.
2016, 26, 1348.
Rev., 2015, 115, 8976–9027.
15 L. Zhou, S. Li, T. Zhang, W. Mu and B. Jiang, J. Sci. Food 41 S. W. Tsang, H. Zhang, Z. Lin, H. Mu and Z. X. Bian, Biomed.
Agric., 2016, 96, 2588–2595. Pharmacother., 2015, 71, 91–97.
16 J. R. K. Cairns and A. Esen, Cell. Mol. Life Sci., 2010, 67, 3389– 42 A. Ahmad and R. Ahmad, Chem. Biol. Interact., 2014, 221, 1.
3405.
This journal is © The Royal Society of Chemistry 2019
RSC Adv., 2019, 9, 15448–15456 | 15455

View Article Online
RSC Advances
Paper
43 C. Caddeo, M. Manconi, M. C. Cardia, O. Diez-Sales, 47 B. C. Trela and A. L. Waterhouse, J. Agric. Food Chem., 1996,
A. M. Fadda and C. Sinico, Int. J. Pharm., 2015, 484, 138–145. 44, 1253–1257.
44 L. Paulo, S. Ferreira, E. Gallardo, J. A. Queiroz and 48 M. Chen, D. Li, Z. Gao and C. Zhang, Bioproc. Biosyst. Eng.,
F. Domingues, World J. Microbiol. Biotechnol., 2010, 26,
1533–1538.
45 H. P. Kuo, R. Wang, Y. S. Lin, J. T. Lai, Y. C. Lo and
S. T. Huang, Bioresour. Technol., 2017, 243, 986–993.
2014, 37, 1–6.
49 S. Jin, M. Luo, W. Wang, C. J. Zhao, C. B. Gu, C. Y. Li,
Y. G. Zu, Y. J. Fu and Y. Guan, Bioresour. Technol., 2013,
136, 766–770.
46 A. Liazid, M. Palma, J. Brigui and C. G. Barroso, J. 50 J. Shuang, B. Yang, Y. Cheng, J. Tan, H. Kuang, Y. Fu, X. Bai,
Chromatogr. A, 2007, 1140, 29–34.
H. Xie, G. Yuan and L. Chen, Food Bioprod. Process., 2016,
102, 177–185.
15456 | RSC Adv., 2019, 9, 15448–15456
This journal is © The Royal Society of Chemistry 2019