Dual-Acting Small-Molecule Inhibitors Targeting Mycobacterial DNA Replication

Article abstract of DOI:10.1002/chem.202001725

Mycobacterium tuberculosis (Mtb) is a pathogenic bacterium and a causative agent of tuberculosis (TB), a disease that kills more than 1.5 million people worldwide annually. One of the main reasons for this high mortality rate is the evolution of new Mtb strains that are resistant to available antibiotics. Therefore, new therapeutics for TB are in constant demand. Here, we report the development of small-molecule inhibitors that target two DNA replication enzymes of Mtb, namely DnaG primase and DNA gyrase (Gyr), which share a conserved TOPRIM fold near the inhibitors’ binding site. The molecules were developed on the basis of previously reported inhibitors for T7 DNA primase that bind near the TOPRIM fold. To improve the physicochemical properties of the molecules as well as their inhibitory effect on primase and gyrase, 49 novel compounds have been synthesized as potential drug candidates in three stages of optimization. The last stage of chemical optimization yielded two novel inhibitors for both Mtb DnaG and Gyr that also showed inhibitory activity toward the fast-growing non-pathogenic model Mycobacterium smegmatis (Msmg).

Full text of DOI:10.1002/chem.202001725

Accepted Article
Accepted Article
Title: Dual Acting Small-Molecule Inhibitors Targeting Mycobacterial
DNA Replication
Authors: Meenakshi Singh, Stefan Ilic, Benjamin Tam, Yasmin Ben-
Ishay, Doron Pappo, and Barak Akabayov
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: Chem. Eur. J. 10.1002/chem.202001725
Link to VoR: https://doi.org/10.1002/chem.202001725
0
1/2020

Chemistry - A European Journal
10.1002/chem.202001725
FULL PAPER
Dual Acting Small-Molecule Inhibitors Targeting Mycobacterial
DNA Replication
[
a]
[a]
[a]
[a]
[a]
[a]
Meenakshi Singh, Stefan Ilic, Benjamin Tam, Yasmin Ben-Ishay, Dror Sherf, Doron Pappo,
[
a]
Barak Akabayov*
[
a]
Dr. M. Singh, S. Ilic, S. Tam, Y. Ben-Ishay, Dr. B. Akabayov, M.S., S.I., and B.T. contributed equally.
Department of Chemistry
Ben-Gurion University of the Negev
1
Ben-Gurion Blvd., Be’er-Sheva, Israel 8410501
E-mail: akabayov@bgu.ac.il
Supporting information for this article is given via a link at the end of the document. Supporting Information Figure S1-S83 (PDF).
Abstract: Mycobacterium tuberculosis (Mtb) is
a pathogenic
A
Primase
Topoisomerase II
GyrB
bacterium and a causative agent of tuberculosis (TB), a disease that
kills more than 1.5 million people worldwide annually. One of the main
reasons for this high mortality rate is the evolution of new Mtb strains
that are resistant to available antibiotics. Therefore, new therapeutics
for TB are in constant demand. Here we report the development of
such inhibitors that target two DNA replication enzymes of Mtb,
namely DnaG primase and DNA gyrase, which share a conserved
TOPRIM fold near the inhibitors’ binding site. The molecules were
developed on the basis of previously reported inhibitors for T7 DNA
primase that bind near the TOPRIM fold. In order to improve the
physicochemical properties of the molecules as well as their inhibitory
effect on primase and gyrase, 49 novel compounds were synthesized
as potential drug candidates in three stages of optimization. The last
stage of chemical optimization yielded two novel inhibitors for the fast-
growing nonpathogenic model Mycobacterium smegmatis (Msmg).
CTD
GyrA
Bacterial
Human
Bacterial Human
B
T7 primase
Mtb DnaG primase
Mtb GyrB
Figure 1. Bacterial targets in this study: DNA primase and gyrase. (A)
Introduction
Schematic representation of DNA priming system and DNA topoisomerase II in
bacteria compared to their analogues in humans. (B) Structural homology of the
Replication of the chromosome is performed by coordinated
activity of different enzymes comprising the replisome. Extensive
characterization of the components of the E. coli replisome has
revealed the molecular mechanisms within the replisome [1].
Based on the structural and functional differences between
bacterial and human replication apparatus, it was suggested that
the bacterial replisome could serve as a novel drug target [2].
During DNA replication, DnaB helicase unwinds double-stranded
DNA and exposes two individual strands [3]. One DNA strand is
copied continuously (the leading strand) and the other
discontinuously (the lagging strand). On the lagging strand, DnaG
primase synthesizes short RNA primers that mark the starting
points of “Okazaki fragments” synthesis by DNA polymerase III
holoenzyme. The process of DNA unwinding by DnaB helicase
causes an increase in twisting tension at the coiled portion of DNA
as the replication fork advances. This tension interferes with a
further unwinding of the double-stranded DNA. Therefore, Gyr, a
type II topoisomerase, acts by creating a transient double-
stranded DNA breaks to release the tension and ensures that the
chromosome is always negatively supercoiled [4]. Both DnaG
primase and Gyr are essential for viability of bacterial cells, and
have different structural and functional settings in human
replisomes (Figure 1A), thereby providing attractive candidates
TOPRIM fold in Gyr and DnaG. T7 DNA primase (red, PDBID 1NUI [6]), part of
the fused helicase-primase gp4 of bacteriophage T7, shares a similar structure
with DnaG from Mtb (green, PDBID 5W33 [7]) and S. aureus (grey PDBID 4E2K
[8])
. Mtb Gyr (PDBID 3M4I [9]) is presented in blue.
Bacterial DnaG-type primases, as well as type IA and type II
topoisomerases (including Gyr), belong to the same enzyme
superfamily based on the presence of a conserved TOPRIM fold
[10]
(
Figure 1B). This fold consists of approximately 100 amino
acids and includes two motifs, one containing a very conserved
glutamate residue in its center, whereas the other involves two
conserved aspartates (DxD motif, Supporting Information Figure
S1) [10]. The two conserved motifs have an essential role in both
[11]
primases
(e.g.,
nucleotide
polymerization)
and
topoisomerases (e.g. strand cleavage and rejoining, DNA binding,
metal coordination) [12]. It is therefore expected that inhibitors that
target the TOPRIM fold can cross-interact with different TOPRIM-
containing enzymes as in the case of coumarin. Coumarin is an
inhibitor that binds to the TOPRIM fold of GyrB [13], and also
inhibits DnaG from Mtb [14]
.
Mtb, whose replication proteins are discussed herein, is a Gram-
positive pathogenic bacterium that is the causative agent of
tuberculosis (TB) which infects a third of the world’s population.
New strains of Mtb, that are resistant to all known classes of
antibiotics, pose a global healthcare threat [15]. DNA replication is
an underexploited target for antibiotics but has the potential to
for antibiotic targeting [5]
.
1
This article is protected by copyright. All rights reserved.

Chemistry - A European Journal
10.1002/chem.202001725
FULL PAPER
Figure 2. Effect of selected small molecules on the activities of DnaG primase and gyrase from Mtb. Screening for best precursor molecule among 18 commercially
available compounds by examining their inhibitory effect on specific Mtb DnaG primase (template-directed ribonucleotide synthesis) and gyrase activity (ATPase
activity and DNA-supercoiling). (A) General scheme of the template-directed ribonucleotide synthesis catalyzed by the primase. Mtb DnaG (500 nM) was incubated
in the presence of 50 μM ssDNA template, 250 μM GTP, CTP, UTP, α-32P-ATP and 4 mM of the selected inhibitor. Radioactive RNA-products at the end of the
reaction were separated by gel-electrophoresis and visualized by autoradiography. Gel bands represent RNA primers formed by Mtb DnaG. Lower intensity of the
bands indicates Mtb DnaG inhibition. (B) General scheme showing the enzymatic activity of the Gyrase – catalysis of negative supercoiling of a plasmid by using
the energy obtained by hydrolyzing two ATP molecules. Top: Inhibition of ATP hydrolysis by small molecule inhibitors. The reaction contained 36nM DNA GyrA,
1
8nM GyrB, 13.3 ng/µl pBR322 DNA and 10 µM γ-32P-ATP in the presence of 500 µM each small molecule. The reaction was stopped by adding Norit solution (see
Online Materials and Methods) and the radioactivity of the supernatant was measured. Bottom: Inhibition of DNA supercoiling by small molecule inhibitors. DNA
supercoiling assay was carried out under the same reaction conditions as the ATPase assay except that 1mM non-radioactive ATP was used instead of 10 µM [γ-
3
2P]-ATP 100 nCi. The Reactions stopped, treated by chloroform/isoamyl alcohol (v:v, 24:1) and loaded onto 1% TBE X1 agarose gel. (C) Distribution map
illustrating the effect of each inhibitor on primase/Gyr activities. Each axis represents the specific activity (in percent) of the enzymes in the presence of a given
inhibitor, relative to the control (enzymatic activity without any inhibitor); X-axis: primase activity, y-axis: Gyr ATPase activity, z-axis: Gyr supercoiling activity (circle
size is proportional to magnitude of inhibition). Values used to create this panel can be found in Additional Materials.
yield novel inhibitors for Mtb [2]. Proteins of high potential to
become effective drug targets are those that present marked
structural difference compared to the human analogs, such as
DnaG primase and DNA gyrase.
Herein, we describe the development of novel small molecule
inhibitors, which target Mtb DnaG, based on the molecules that
were found to inhibit T7 DNA primase. Some of these molecules
also inhibit Gyr, presumably through binding near the TOPRIM
fold. Two of the molecules that inhibit both Mtb DnaG and Gyr
were found to inhibit growth of Msmg, thus offering hope for
obtaining novel drugs against TB.
Unlike DnaG, which serves as a novel drug target, Gyr has
already been exploited as a clinical antitubercular target. For
example, fluoroquinolones that stabilize the DNA-gyrase complex
and promote genomic DNA cleavage [16], along with Gyr inhibitors,
such as novobiocin, represent antibacterial agents with proven Results and Discussion
therapeutic efficiency [17]. Also, it is important to note that the
resistance to fluoroquinolones (e.g., moxifloxacin and
gatifloxacin) remains uncommon in clinical isolates of Mtb [18]
Small molecules that inhibit T7 DNA primase also inhibit Mtb
DnaG
.
We have previously reported a method that combines fragment-
based screening by NMR with in-silico optimization steps to
identify inhibitors for DnaG-type DNA primase [19]. Fragment-
based screening is advantageous over commonly used high-
throughput screening for slow enzymes such as DNA primase,
The primase domain of gene 4 protein of bacteriophage T7 (T7
DNA primase) was used as a model target for the development of
anti-DnaG inhibitors [5]. By using NMR-fragment based screening
combined with computational optimization, we found five small-
molecules that inhibit T7 DNA primase [19b]. The binding
where the readout of biochemical activity is extremely low [5, 20]
.
mechanism of three inhibitors (one containing 2H-chromene and
Subset of drug-sized molecules, that contained same scaffold as
the initial fragment molecules, were selected from the Zinc
database [21] and docked into the crystal structure of T7 primase.
The molecules with the lowest predicted binding energy were
used for further biochemical and structural studies. This method,
designated as fragment-based virtual screening [19b], yielded five
small molecule inhibitors that target T7 DNA primase through
common binding mechanism verified by high resolution NMR
two containing indole) was revealed by high field NMR
spectroscopy [19b], whereas three amino acids (Val101, Met105,
Tyr106) were found to mediate the binding of all three molecules.
Therefore, we tested the ability of these molecules, designed
initially to inhibit T7 DNA primase, to impair RNA primers
synthesis by Mtb DnaG due to the high structural similarity of
these proteins (details on the initial small-molecules are
presented in Supporting Information Table 1). Structural and
sequence similarity within the TOPRIM superfamily of enzymes
as well as the close proximity of the initial molecules’ binding site
analysis [19b]
.
2
This article is protected by copyright. All rights reserved.

Chemistry - A European Journal
10.1002/chem.202001725
FULL PAPER
to the TOPRIM fold of T7 primase, led us to hypothesize that other
TOPRIM containing enzymes, such as Mtb DnaG primase and
Gyr could also be targets for these inhibitors (Supporting
Information Figure S2-S3, the active site residues and the
conserved active site motifs are indicated). We also performed a
docking analysis (Supporting Information Figure S4) and
confirmed, based on the negative ΔG values, that the molecules
may indeed bind to this region.
Gyr, ATP hydrolysis rate and DNA supercoiling assay were
carried out (Figure 2B). Upon incubation of Mtb Gyr with DNA and
32
[γ- P]-ATP a radioactive P
after treatment with active charcoal. In the presence of a small-
molecule inhibitor, the decrease in the amount of 32P
, indicates a
i
is formed and remains free in solution
i
decrease in ATP hydrolysis by Mtb Gyr (Figure 2B, top panel).
The results are presented as percent of activity, relative to the
control sample that didn’t contain any inhibitor.
The reaction involved incubating the Mtb DnaG with an
The effect of small molecule inhibitors on the formation of
cleavable-complex species by Mtb Gyr was also measured. In the
presence of ATP and absence of inhibitor the enzyme shows
marked negative supercoiling on pBR322 DNA. The inhibition of
supercoiling activity is characterized by the appearance of a
ladder of gel bands (Figure 2B, bottom panel).
oligonucleotide
template
(5’-
3’),
CCGACCCGTCCGTAATACAGAGGTAATTGTCACGGT
-
32
each one of the four rNTPs, and [α- P]-ATP. The radioactively
labeled RNA products were separated by denaturing gel analysis
and visualized on an autoradiogram (Figure 2A). The decrease in
the radioactive signal strength, which is directly proportional to the
number of synthesized RNA primers, indicates the inhibition of
primase activity. Remarkably, two of the five molecules that inhibit
T7 DNA primase, 3-(2-(ethoxycarbonyl)-5-nitro-1H-indol-3-
yl)propanoic acid (Compound A13) and 7-nitro-1H-indole-2-
carboxylic acid (Compound A17), were also found to inhibit the
RNA primer synthesis of Mtb DnaG (Figure 2A, lanes 13 and 17).
Comparison of all three measured activities of Gyr and primase
places the best inhibitor in the bottom left corner of the distribution
map (Figure 2C). Some of the molecules (A13, A15 and A17) that
32
i
were found to reduce [ P] release (ATP hydrolysis) also inhibit
the supercoiling of pBR322 DNA by Mtb Gyr (Figure 2C, top-left).
Two of the molecules (A13 and A17) that were found as best
inhibitors for Mtb DnaG and Gyr contained the indole scaffold
substituted with carboxylic acid/ester in position two/three and
electron-withdrawing nitro group in position five/seven. We
reasoned that the bulkier structure of molecule A13 may enable
broader network of interactions with the target macromolecule,
thus promoting tighter binding and better inhibition.
Preparation of library of derivatives for the inhibition of Mtb
DnaG
A library of 49 novel derivatives was synthesized on the basis of
molecule A13 in order to improve inhibition efficacy. The
synthesis
carboxylate derivatives (3a-g, 3c’, 4a, 5a, 6a-g, 6c’, 7a, 8a-f, 8c’,
a-f, 9c’) and the N-benzylated derivatives of ethyl 3-(3-ethoxy-3-
of
ethyl
3-(3-ethoxy-3-oxopropyl)-1H-indole-2-
9
oxopropyl)-1H-indole-2-carboxylate (10a-f, 10c’, 11a-f, 11c’, 12a-
f, 12c’, 13a-f and 13c’) is depicted in Scheme 1 and Supporting
Information Figure S5.
The synthesis commenced by Japp-Klingemann condensations
of the commercially available aniline derivatives 1a-g and
afforded
the
corresponding
diethyl
derivatives
of
phenylhydrazones (2a-g) in 60-80% yields. Subsequent Fischer
indole cyclization of the latter phenylhydrazones (p-
toluenesulfonic acid, benzene, reflux) [22], produced the key indole
derivatives (3a-g, 3c’) in 15–80% yields. Compound 3c and 3c’
are the two regioisomers that are produced after Fischer
cyclization in the ratio of 1:1.25 (3c’:3c). These regioisomers were
isolated through column chromatography using ethyl
acetate/hexane (1:8) as mixture for elution. Hydrolysis of the latter
diesters under mild basic conditions (0.01M NaOH) gave a
mixture of the corresponding dicarboxylic acid derivatives 6a-g,
Scheme 1. Synthetic scheme of small-molecule inhibitors. Reagents and
conditions: a. i. HCl, NaNO
carboxylate, KOH (4 M), 0°C; 1 h; iii. H
sulfonic acid (PTSA), benzene, 110°C, 24 h; c. LiAlH
pyridinium chlorochromate (PCC), DCM, rt, 2-3 h; e. NaOH (0.01 M)/THF, rt,
8-24 h; f. DCC, HOBt, dry DMF, aniline, rt, 24h; g. benzyl bromide, Cs CO , KI,
DMF, 60°C, 2 h.
2
,
H
2
O, 0°C, 1h; ii. ethyl 2-oxocyclopentane
SO , ethanol, 100°C, 3 h; b. p-toluene
, THF, H SO , rt, 2 h; d.
2
4
6
c’ and mono-carboxylic acid derivatives 8a-f, 8c’, 9a-f, 9c’.
4
2
4
o
Reduction of indole diester 3a using LiAlH
4
(THF, 4 C) produced
-(5-chloro-2-(hydroxymethyl)-1H-indol-3-yl) propan-1-ol (4a) in
0% yield, while selective oxidation of the latter di-alcohol 4a
3
5
1
2
3
using PCC afforded dicarboxaldehyde 5a in 40% yield. Diamide
a was prepared from acid 6a (DCC and HoBt, dry DMF) in 60%
yield. Benzylation of compounds 3a-f, 3c’ (BnBr, Cs CO , DMF)
afforded obtaining N-benzylindoles 10a-f, 10c’ in 85-95% yields
[23].
Partial hydrolysis of the latter diesters (10a-f, 10c’) under mild
7
Few inhibitors for Mtb DnaG cross-interact with Gyr of Mtb
Mtb Gyr)
2
3
(
The compounds found to inhibit DnaG primase were also tested
against Mtb Gyr, since both enzymes share a conserved TOPRIM
fold. The original inhibitors, from which the current molecules
were developed, were bound near the conserved TOPRIM fold of
the T7 primase. To evaluate the inhibition of two activities of Mtb
basic conditions (0.01M NaOH) led to the formation of the
corresponding dicarboxylic and mono-carboxylic acids 11a-f, 11c’,
1
2a-f, 12c’, 13a-f, and 13c’ in 10-75% yields.
3
This article is protected by copyright. All rights reserved.

Chemistry - A European Journal
10.1002/chem.202001725
FULL PAPER
A
B
C
Y
00
Rounds of optimization: Group I
Group II
Group III
COOH
1
b
8
6
4
0
e
COOC
2
H
5
Z
COOH
100
0
0
a
No substitution
allowed
13d
EWG
2 5
COOC H
11c’
N
13a
8
f
EWG
2 5
COOC H
EWG
COOC H
2 5
20
0
N
H
Benzylic
carbon
N
H
12c
7a
13c
No substitution
allowed
Benzylic
group
d
X
20
40 60 80 100
c
f
0
Primase activity (%)
Figure 3. SAR- guided optimization of small molecule inhibitors for DnaG/GyrB of Mtb. (A) Optimization of small molecule inhibitors was performed in three rounds
of synthesis. Round I included development of indole derivatives (3a – 7a) viz. indole diesters, indole diacids, indole dialcohols, indole dicarboxaldehyde and indole
diamides. Round II included development of indole derivatives (8b – 9f) viz. indole monoesters and indole monoacids. Round III included development of indole
derivatives (10a – 13d) viz. N-benzylated indole diesters, N-benzylated indole diacids, N-benzylated indole monoester and N-benzylated indole monoacid. (B)
Scheme of synthesis of derivative molecules based on SAR conclusions. Group 1) a. Electron withdrawing group (e.g., NO
2 3
, CF , Cl) render phenyl ring less
nucleophilic and support activity. Incorporation of electron donating group (e.g., CH , OH) hinders activity. b. Bulky groups introduce steric hindrance and decrease
3
activity. Five membered nitrogen heterocyclic ring system is essential for activity. c. Free nitrogen is essential for activity. Lone pair located on the nitrogen atom is
in resonance, and therefore, it stabilizes the structure. d. Carboxylate ester is essential for activity. Activity is reduced when modified to alcohols, amides, aldehydes
but increased upon conversion to acid. Group 2) e. Carboxyl group is essential. Activity is reduced when modified to ester, alcohols, amides, aldehydes. Group 3)
f. Utilization of free –NH linkage of Indole. Substituting the –H of –NH of Indole with benzyl group increases the inhibition. (C) Correlation of enzymatic activities in
the presence of derivative molecules (results of all three activities as well as the reaction conditions are summarized in Supporting Information Figure S6). X-axis:
inhibition of primase activity, y-axis: inhibition of ATPase activity of Gyr, z-axis: inhibition of Gyr supercoiling activity (circle size is proportional to magnitude of
inhibition). Molecules that weren’t successfully synthesized or weren’t fully characterized are not included in the functional analysis. Values used to create this panel
can be found in Additional Materials.
SAR studies of newly synthesized indole derivatives
increased dramatically in comparison with compounds (3a-g, 3c’,
6a-g, 6c’, 8a-f, 8c’, 9a-f, 9c’). Most notably, the N-benzylation of
compounds (3a-g, 3c’) gave rise to compounds (13a-f and 13c’),
which presented maximum inhibitory activity thus far.
The newly synthesized molecules (Figure 3A) were tested for their
ability to inhibit the activities of Mtb DnaG and Gyr (Supporting
Information Figure S6). Dose response experiments revealed
micromolar range for inhibition of all three activities (Supporting
Information Figure S7). We have observed that the presence of
electron donating groups, especially methyl group (3g), resulted
in decreased potency of inhibition compared to compound 3c’.
The reduction of ester function (3a) to alcohol group (4a) and then
oxidation to aldehyde group (5a) led to loss of activity. The amide
coupling to carboxylic acid derivative (6a) gave rise to compound
Importantly, when the ester group was replaced with a carboxylic
acid moiety in position 3, the molecules (13c and 13d) were more
active both in enzymatic and bacterial assays (Figures 3-4),
indicating that the presence of carboxyethyl and propanoic acid
group at position 2 and 3, respectively, is essential for an
extended interaction with the primase/Gyr.
As we have seen so far, some structural variations in the
molecules allowed SAR continuity that resulted in increased
potency. On the other hand, discontinuity in SAR that markedly
reduced the potency of an inhibitor after a small chemical
modification, termed “the functional cliff”, also occurred. For
example, we have revealed that the substituent on phenyl ring of
(
7a), which presented some inhibitory activity on Gyr but not on
primase. In order to explore the effect of N-benzylation of indole
on inhibitory activity, compounds (10a-f, 10c’, 11a-f, 11c’, 12a-f,
1
2c’, 13a-f and 13c’) were synthesized and their efficacies were
tested. When the benzyl group was introduced at the NH-position
of the indole ring, the inhibitory effects of the resulting compounds
4
This article is protected by copyright. All rights reserved.

Chemistry - A European Journal
10.1002/chem.202001725
FULL PAPER
A
B
C
indole may have a significant effect on the potency of the inhibitor.
The presence of trifluoromethyl group (13c and 13d) on the
phenyl ring of the round III series of compounds led to a significant
increase in the inhibitory effect compared to the chloro and nitro
substituted compounds (10a and 10b), respectively (Null activity).
A detailed illustration of this functional cliff is presented in
Supporting Information Figure S8, where three sub-structures that
construct compounds 10c and 10d, and their corresponding
analogs 13c and 13d, are defined (Supporting Information Figure
S8, region A-blue, region B-red, and region C- green). The
increase in potency upon modifications of region C and the distal
parts of region B, whereas modifications of region A reduced
potency, indicate that region A is the most important functional
group of the pharmacophore.
No
inhibitor
1
00
1
3d
80
13c
6
0
0
INH
4
20
0
0
.5 1.0 1.5 2.0 2.5
Log Concentration (µM)
13c
#
MIC90 (µM)
1
2
5
13c 86.59
13d 227.3
INH 49.88
13d
Figure 4. Effect of selected small molecule inhibitors on Msmg culture growth.
A) Growth curves of Msmg culture expressing mCherry reporter protein. The
(
culture was grown in 7H9 liquid medium (0.4% glycerol, 0.05% Tween-80)
containing different small molecule inhibitors in 250 µM concentration. The
fluorescent signal originating form mCherry reporter protein was measured over
the course of 20 hours and used to estimate viability of bacterial cells. Data
represents the average of three replicates (n=3). The blue area represents the
range observed for bacterial growth in the presence of different molecules
presented in this study. The effect of 15 mg/L isoniazid (INH) is indicated in
black. (B) The effect of molecules 13c and 13d on the viability of Msmg
Taken together, the SAR studies demonstrated that a variety of
hydrophobic substituents introduced on a phenyl ring of indole
were well tolerated, and among them the chloro, trifluoromethyl
and nitro moiety were preferred. The carboxyethyl group at
position 2, free carboxylic acid in position 3, an electron
withdrawing group on phenyl ring of indole-3-carboxylic acid
scaffold, as well as N-benzylation, are all essential for the
biological activity (the summary of SAR conclusions is presented
in Figure 3B).
(
compared to INH, indicated in grey). Table presents the MIC90 values of the
three compounds. (C) Dilution colony assay. Aliquots of samples from the assay
described in A were collected after 2h of incubation, serially diluted in 1:10 ratio.
Each dilution was platted on a 7H10+ agar plate and incubated until bacterial
colonies became visible.
Overall, out of 49 newly synthesized molecules, positional
isomers
trifluoromethyl)-1H-indol-3-yl)propanoic acid (13c) and 3-(1-
benzyl-7-chloro-2-(ethoxycarbonyl)-5-(trifluoromethyl)-1H-indol-
-yl)propanoic acid (13d) present the best inhibitors in all
3-(1-benzyl-5-chloro-2-(ethoxycarbonyl)-4-
(
3
Conclusions
measured activities for DnaG and Gyr of Mtb (Figure 3C). Dose
response of selected molecules on the DnaG/Gyr activities is
presented in Supporting Information Figure S7. Structural
characterization of all molecules is presented in Figures S9-S83.
In view of our results, it is rationally presumed that these two
inhibitors present a viable template to discover more potent
compounds, by variations of substituents on the phenyl ring or -
NH of indole.
In summary, we described the rational design of small-molecules
that inhibit activity of two DNA replication enzymes of M.
tuberculosis. These enzymes were chosen as selective targets for
anti-tuberculous agents, considering their pronounced structural
differences when compared to human analogues.
Molecule A13 that served as a promising inhibitor in the initial
screening was chosen as a precursor for optimization. Three
rounds of optimizations allowed us to draw SAR conclusions
related to the inhibitor scaffold and design new molecules with
improved inhibitory activity. Some molecules were found to inhibit
both the DNA primase and the Gyr of Mtb and therefore were
considered as dual acting inhibitors. Targeting several enzymes
with common TOPRIM fold is a desirable goal for increasing
potency and promoting bacterial cell toxicity. Although the IC50
values determined for each enzyme remained in the micromolar
range (Supporting Information Figure S7), a few molecules were
able to effectively inhibit the growth of bacterial culture (Msmg),
presumably due to a dual mechanism of action (synergistic effect).
The physicochemical and pharmacodynamic properties of the
small-molecule inhibitors need to be optimized further in order to
obtain new potent lead molecules. So far, compound 13c and 13d
presented the best inhibitors, for both DNA replication enzymes
in Mtb: DnaG primase and Gyr. Based on SAR analysis, we have
suggested possible chemical manipulations that are expected to
improve potency and physicochemical properties of these small
molecules.
Some of the inhibitors stop the proliferation of
Mycobacterium smegmatis (Msmg)
For this study we have used Msmg, a nonpathogenic relative of
Mtb often used to test antitubercular agents due to the similar
morphological and biochemical properties (e.g. DnaG primase as
well as GyrB subunit, exhibit more than 80% sequence identity
between Mtb and Msmg).
The primase/Gyr inhibitors were screened for inhibition of growth
2
of Msmg mc 155 over a time course of 20h at 37°C. The
antibacterial activity of molecules 13c and 13d were determined
by assaying their minimal inhibitory concentration (MIC) against
Msmg. The results are summarized in Figure 4. Both molecules
inhibited the growth of Msmg in accordance with their inhibition of
mycobacterial primase/Gyr. Other molecules that showed
inhibition of the two enzymes in vitro had little or no effect against
Msmg (Figure 4, growth curve, colored blue). The MIC90 of
molecules 13c and 13d were 86.6 and 227 µM, respectively
(
Figure 4A). These values were comparable to the effective dose
measured for isoniazid (50 µM), a first-line anti-TB drug and a
central drug in common treatment regimens (Figure 4A, indicated
in grey).
Our results offer valuable information on the design and synthesis
of novel inhibitors for bacterial DNA replication as well as new
treatment opportunities for M. tuberculosis.
5
This article is protected by copyright. All rights reserved.

Chemistry - A European Journal
10.1002/chem.202001725
FULL PAPER
in buffer A (50 mM Tris-HCl pH 8, 500 mM NaCl, 10 mM imidazole, 10%
v/v glycerol, and 0.5 mM dithiothreitol). Lysis was performed using
pressure homogenizer and sonication. The lysate was clarified by
centrifugation (21000 x g, 60 minutes), filtered through 0.45 µM filter and
loaded onto Ni-NTA column (HisTrap FF, GE Healthcare). The column
was equilibrated with buffer A and the protein was eluted with a linear
gradient of imidazole (10-400 mM) in buffer A. The fractions containing Mtb
Gyr were joined and concentrated by dialysis against buffer B (20 mM Tris-
HCl pH 8, 100 mM NaCl, 50% v/v glycerol, and 2 mM dithiothreitol) and
loaded onto Superdex S200 column (GE Healthcare) The column was
equilibrated and the protein was eluted with buffer C (20 mM Tris-HCl pH
Experimental Section
Materials. All chemicals and solvents used for the synthesis and
characterization of compounds were purchased from Sigma-Aldrich and
Acros, and were of reagent grade without purification or drying before use.
Chemicals used for biochemical assays were molecular-biology grade,
purchased from Sigma-Aldrich. Ribonucleotides (ATP, CTP, GTP, and
UTP) were purchased from New England Biolabs (NEB). [α–32P] ATP
(
3000 Ci/mmol) and [γ–32P] ATP (3000 Ci/mmol) were purchased from
1
Perkin Elmer. H NMR data were recorded on a 400/500 MHz Bruker NMR
instrument, and 13C NMR data were recorded on a 101 MHz Bruker NMR
instrument. Chemical shifts were reported in δ (ppm) downfield from
tetramethylsilane (TMS) and were recorded in appropriate NMR solvents
8
, 500 mM NaCl, 10% v/v glycerol, and 1 mM dithiothreitol). The fractions
containing purified Mtb Gyr were joined and dialyzed against buffer B and
o
stored at -20 C.
(
CDCl3, δ 7.26; CD3OD, δ 3.31; (CD3)2CO, δ 2.05; or other solvents as
mentioned). All coupling constants (J) are given in Hertz. All of the NMR
spectra were processed by MestReNova software (www.mestrelab.com).
The following abbreviations are used: s, singlet; d, doublet; t, triplet; m,
multiplet; br s, broad singlet peak. The synthesized compounds were
assessed for their purity determination using high performance liquid
chromatography (HPLC). Purity of all final compounds was 95% or higher.
Mass spectra were recorded only for the molecules that exhibited best
activity, using an HRMS instrument. Thin-layer chromatography (TLC) was
performed on Merck aluminum backed plates, pre-coated with silica
Oligoribonucleotide synthesis assay by Mtb DnaG primase. Standard
1
0
μL reaction contained 50 μM of DNA template (5’-
CCGACCCGTCCGTAATACAGAGGTAATTGTCACGGT-3, that contain
Mtb DnaG recognition site, found as reported in [24]), 250 μM GTP, CTP,
UTP and [α-32P]-ATP, and 500 nM Mtb DnaG primase in a buffer
containing 40 mM Tris-HCl (pH 7.5), 1 mM MnCl2, 10 mM DTT, and 50 mM
o
KGlu. The reaction was incubated at 37 C for 60 minutes with 4 mM of the
small molecule for experiments reported in Figures 2-3, or 0.5 mM – 4 mM
for experiments reported in Supporting Figure S7. The reaction was
terminated by adding an equal volume of sequencing buffer containing
(
0.2mm, 60F254) and the detection of molecules was performed by UV
fluorescence (254 nm). Column chromatography separations were
performed using silica gel (0.04-0.06 mesh) as a stationary phase.
9
8% formamide, 0.1% bromophenol blue, and 20 mM EDTA. The samples
were loaded onto a 25% polyacrylamide sequencing gel containing 7 M
urea, and visualized by autoradiography. Quantification of the signal was
performed by ImageQuant TL 8.1.
N,N-Dimethylformamide (DMF) and dichloromethane (DCM) were
purchased as biotech grade from Avantor J.T. Baker. Analytical HPLC was
performed on a Dionex 1100 using a reverse phase C18 column at a flow
rate of 1.5 mL/min. Preparative HPLC was performed on a Dionex Ultimate
DNA supercoiling assay for Mtb Gyr. DNA supercoiling activity was
tested with purified Mtb GyrA and GyrB subunits mixed in 2:1 ratio. The
reaction mixture contained 50 mM HEPES [pH 7.9], 100 mM potassium
3
000 instrument using a C18 reverse phase preparative column at a flow
rate of 20 mL/min. Mass spectrometry analysis was performed by LC-MS
Thermo Surveyor 355.
glutamate,
6 mM magnesium acetate, 2 mM spermidine, 4 mM
dithiothreitol, 50 µg/ml bovine serum albumin, 1 mM ATP and 13.34 ng/µl
relaxed pBR322 DNA, and 500 µM small molecules (10% V/V DMSO final).
One unit of Gyr proteins was added (one unit of enzyme activity was
defined as the amount of Gyr that converted 400 ng of relaxed pBR322 to
the supercoiled form in 1 h at 37°C in 30 µl reaction), and the reaction
mixtures were incubated at 37°C for 1 h. Reactions were terminated by
adding one reaction volume of Stopping Buffer (40% sucrose, 100 mM
Tris-HCl pH 8, 10 mM EDTA, 0.5 mg/ml Bromophenol Blue) and two
reaction volumes of chloroform/isoamyl alcohol (v:v, 24:1). The samples
were vortexed, centrifuged briefly and loaded onto 1% agarose gel in 1X
Tris-borate- EDTA buffer, pH 8.3 (TBE). Electrophoresis was performed
for 4h at 40 V, and the gel was subsequently stained with ethidium bromide
Expression-purification of DnaG primase from Mtb. The DNA
sequence encoding DnaG primase from Mtb H37Rv was inserted into
pET28 vector. The transformed Escherichia coli BL21 (DE3) cells were
grown in LB medium containing 50 mg/L kanamycin until OD600 = 0.7 and
induced with 0.5 mM IPTG. After induction, the culture was incubated with
shaking for 4h at 37°C. Cells were harvested by centrifugation (4700 x g,
1
5 minutes) and the pellet was resuspended in the lysis buffer (50 mM
Tris-HCl pH 7.5, 500 mM NaCl, 10% v/v glycerol, and 1 mM dithiothreitol).
Lysis was performed using pressure homogenizer. The lysate was clarified
by centrifugation (21000 x g, 30 minutes), filtered through 0.45 µM filter
and loaded onto Ni-NTA column (HisTrap FF, GE Healthcare). The
column was equilibrated with buffer A (50 mM Tris-HCl pH 7.5, 500 mM
NaCl, 10% v/v glycerol, 1 mM dithiothreitol and 10 mM imidazole) and the
protein was eluted with a linear gradient of imidazole (10-500 mM) in buffer
A. The fractions containing Mtb DnaG primase were joined and EDTA was
(
0.5 mg/ml).
ATPase Norit assay for Mtb Gyr. The standard assay for ATPase
measures the formation of Norit-adsorbable 32P-labeled phosphate arising
from the hydrolysis of [γ-32P]-ATP. ATPase assay was carried out
according to the same reaction conditions as for DNA supercoiling except
that 10 µM [γ-32P]-ATP 100 nCi was used instead of non-radioactive 1 mM
ATP. The reaction mixture (10 μl) was incubated at 37 °C for 60 minutes.
The reaction was stopped by the addition of 90 μl of a solution consisting
of 0.6 ml of 1 M HCl, 0.1 M Na4P2O7, 0.02 M KH2PO4, 0.2 ml of a Norit A
suspension (20% packed volume), and 0.1 ml of bovine serum albumin (5
mg/ml). The solutions were mixed and allowed to sit for 5 min at 0 °C. After
centrifugation, 20 μl of the supernatant was spotted in a scintillation tube
and upon the addition of Ultima Gold scintillation liquid (Perkin Elmer) the
signal was measured by scintillation counter.
added to a final concentration of 1 mM. Ammonium-sulfate was added
o
(
0.4 g/mL of sample) with stirring and left for several hours at 4 C to
precipitate the protein. Centrifugation was performed (21000 x g, 30
minutes) and the protein precipitate was dissolved in buffer C (50 mM Tris-
HCl pH 7.5, 500 mM NaCl, 10% v/v glycerol, 1 mM dithiothreitol, 1 mM
EDTA) and loaded onto Superdex S200 column (GE Healthcare). The
protein was eluted in buffer C. Fractions containing purified Mtb DnaG
primase were joined and dialyzed against buffer C containing 50% glycerol.
o
The protein samples were stored at -20 C.
Expression-purification of gyrase from Mtb. Mtb Gyr subunit A and B
were purified separately. The DNA sequences encoding each Gyr subunit
from Mtb H37Rv were inserted into separate pET28 vectors. The
expression vectors were transformed into Escherichia coli BL21 (DE3) that
were grown in LB medium containing 50 mg/L kanamycin until OD600 = 0.6
and induced with 0.5 mM IPTG and 0.2% arabinose. After induction, the
culture was incubated with shaking for 4h at 30 °C. Cells were harvested
by centrifugation (4700 x g, 15 minutes) and the pellet was resuspended
Bacterial growth assays. Bacterial strains and growth media. Msmg
2
cells mc 155 (wild type), containing Hygromycin resistance gene and
transcriptional red fluorescent protein gene (mCherry), were grown in
Middlebrook 7H9 broth (Fluka) liquid medium supplemented with glycerol
(
0.4%, v/v) and Tween-80 (0.05%, v/v) (7H9++ liquid medium). Solid
medium was composed of Middlebrook 7H10 agar (Difco) and 0.4% (v/v)
6
This article is protected by copyright. All rights reserved.

Chemistry - A European Journal
10.1002/chem.202001725
FULL PAPER
glycerol (7H10+ agar solid medium). Hygromycin was added to both liquid
and solid media to a final concentration of 50 mg/L. The experiments were
conducted under strictly sterile conditions. All instruments, materials and
media involved were sterilized before use. Experimental procedures were
performed in a biological hood with a laminar flow.
removed under reduced pressure affording a gummy
material (95–100%) that was used without further
purification in the next step.
(
iv)
Diethyl derivatives of phenylhydrazones (2a-g).
Concentrated H2SO4 (2.7 ml, 50.5 mmol, 5.1 equiv.) was
Bacterial growth of Msmg culture. Msmg culture was first inoculated
onto 7H10+ agar plate (medium components are described above)
containing 50 mg/L hygromycin and incubated at 30ºC for approximately
four days. The primary liquid culture was prepared by transferring
numerous colonies from a previously inoculated 7H10+ agar plate into 10
mL of 7H9++ liquid medium containing 50 mg/L hygromycin. Cells were
incubated overnight (~16 hours) at 30 ºC with shaking (200 rpm). The
secondary culture was prepared by transferring 1 mL of Msmg primary
culture into 50 mL 7H9++ liquid medium (1:50 ratio, v/v) supplemented
with 50 mg/L hygromycin. Again, cells were grown overnight at 30 ºC with
shaking (200 rpm) to mid-log phase (OD600 ~0.5). Then the culture was
diluted to OD600 = 0.025, dispensed in wells of Thermo Scientific™ Nunc™
F96 MicroWell™ black polystyrene plate and treated with different small
molecule inhibitors at a concentration of 250 µM. The plate was incubated
at 30°C with continuous orbital shaking (567 cpm) over the course of 20
hours. The cell growth was monitored simultaneously by Synergy H1
microplate reader (Biotek) using mCherry as a reporter protein (mCherry
fluorescent signal directly correlates with the number of live bacterial cells).
Data represent the average of three biological replicates (n=3).
added dropwise to a stirred solution of monoethyl
derivatives (10 mmol) in absolute ethanol (100 ml). The
reaction mixture was then heated to reflux for 3 h at 100°C.
Then the ethanol was removed under reduced pressure
and the residue was treated with 100 ml of ice water. The
aqueous solution was extracted with dichloromethane (3
X 50 ml). The combined organic layer was dried over
magnesium sulfate, filtered and concentrated. The
residue was purified by silica gel column chromatography
(ethyl acetate:hexane, 1:4) led to the desired product in
80–95% yield as a yellow/brown solid.
B. General procedures for the synthesis of ethyl 3-(3-ethoxy-3-
oxopropyl)-1H-indole-2-carboxylate derivatives (3a-g, 3c’).
A mixture of p-toluenesulfonic acid (3.800 g, 20 mmol, 4 equiv.) and 100
ml of benzene was refluxed for 2 h at 110°C under azeotropic condition.
Subsequently, 5 mmol of diethyl derivatives of phenylhydrazone (2a–g)
was added and the mixture refluxed for 24 h before the volatiles were
distilled. The mixture was washed with a saturated solution of NaHCO3 (2
X 30 ml) and water (30 ml). The crude reaction mixture was extracted with
Dilution colony assay (Msmg colonies). The samples from the
previously described procedure (Bacterial growth of Msmg culture) were
also used for dilution colony assay, as explained in the following text. After
two hours of monitoring the bacterial growth in Synergy H1 microplate
reader, 3μL of each sample was collected and serially diluted in 1:10 ratio
dichloromethane (3 X 30 ml) and then washed with water (3 X 20 ml). The
8
organic layer was dried over magnesium sulfate, filtered, and concentrated
under reduced pressure. The residue was purified by silica gel column
chromatography using ethyl acetate/hexane (1:9 to 1:6) as eluent
producing pale white/yellow solid (3a-g, 3c’) in 15–80% yield.
-1
-2
-3
-4
(
x10 , x10 ,x10 , x10 ). Then 3 μL of each dilution was transferred onto
H10+ agar plate and incubated at 30°C for four days or until colonies
7
were observed in the sample that didn’t contain any inhibitor.
C. Synthesis of 3-(5-chloro-2-(hydroxymethyl)-1H-indol-3-yl)propan-1-ol
(
4a).
Synthesis of indole derivatives. The scheme for the synthesis of all
molecules below is presented in Scheme 1 and Supporting Information
Figure S5.
Dry THF (20 ml) was added dropwise under N2 atmosphere to an ice-
cooled RBF containing LiAlH4 (342 mg, 9.0 mmol, 6 equiv.) at 0°C. After
completion of THF addition, conc. H2SO4 (240 µl, 4.5 mmol, 3 equiv.) was
added to the reaction mixture and the resulting mixture was left to stir at
A. General procedures for the synthesis of compounds (2a-g).
0
°C for 30 min. To the stirred reaction mixture, compound 3a (1.5 mmol)
(
(
(
i)
Benzenediazonium salt derivatives (mixture I). To a
well-stirred solution of aniline derivatives 1a-g (10 mmol)
in 5M aq. HCl (16 ml) at 0°C was added dropwise a cold
solution (0–5°C) of sodium nitrite (1.38 g, 20 mmol, 2
equiv.) in 10 ml water. To maintain the reaction
temperature at 0°C the addition rate kept slow. The
resulting mixture was stirred at 0–5°C for an additional 30
min in an ice bath.
in dry THF was slowly added within 30 min at 0°C and the resulting mixture
was left to stir at room temperature for 2 h. After completion of the reaction,
ice was added to the resulting reaction mixture and was filtered. The filter
cake was washed with ethyl acetate (3 X 20 ml) and then with water (3 X
10 ml). The organic phase was collected, dried over magnesium sulfate
and filtered. The solvent was removed under vacuum to produce grey solid.
The residue was purified by silica gel column chromatography using
methanol/dichloromethane (1:19) as eluent led to the final products in 50%
yield as grey-white solid.
ii)
2-(ethoxycarbonyl)cyclopentanone anion (mixture II).
A solution of 2-(ethoxycarbonyl)cyclopentanone (2.512 ml,
D. Synthesis of 5-chloro-3-(3-oxopropyl)-1H-indole-2-carbaldehyde (5a).
1
.344g, 15 mmol) in ethanol (5 ml) was cooled to 0–5°C.
Then, a potassium hydroxide solution (5.040 g, 90 mmol,
equiv.) in water (5 ml) previously cooled to 0–5°C was
To the solution of compound 4a (0.05 mmol) in dry DCM (5 ml) was added
PCC (32 mg, 0.15 mmol, 3 equiv). The reaction mixture was stirred for 3h
at room temperature. After completion of the reaction, powdered MgSO4
was added to the resulting reaction mixture and then anhydrous ether (5
X 5 ml) was added, 5X of reaction solvent. The reaction mixture was then,
filtered and concentrated. The residue was purified by silica gel column
chromatography using ethyl acetate/hexane (1:4) as eluent led to the
desired product in 40% yield as a pale white solid.
6
added dropwise for 30 min in order to keep the reaction
temperature below 8°C. The white-milky appearance
mixture was stirred for further 30 min at 0–5°C.
iii)
Monoethyl derivatives of phenylhydrazones (mixture
I+ mixture II). Ice (50 g) was added to mixture II with
stirring at 0–5°C in an ice bath, followed by the addition of
mixture I, and stirring continued for 1 h at 50°C. The
combined mixtures were brought to room temperature
and the pH was subsequently adjusted to 4–5 with 1 M aq.
HCl. The mixture was extracted with diethyl ether (50
ml×3) and the combined organic layer was dried over
magnesium sulfate and filtered. The volatiles were
E. Synthesis of 5-chloro-3-(3-oxo-3-(phenylamino)propyl)-N-phenyl-1H-
indole-2-carboxamide (7a).
HOBt (25mg, 0.16 mmol, 2 equiv.) was added to a stirred solution of
compound 6a (0.08 mmole) in dry DMF (10 ml) under N2 atmosphere.
7
This article is protected by copyright. All rights reserved.

Chemistry - A European Journal
10.1002/chem.202001725
FULL PAPER
Subsequently, the solution of aniline (15mg, 0.16 mmol, 2 equiv.) in dry
DMF was added to the reaction mixture followed by the addition of DCC
MHz, CDCl3) δ 7.68 (d, J = 8.7 Hz, 1H), 7.57 (d, J = 1.7 Hz, 1H), 7.46 (dd,
J = 8.7, 2.0 Hz, 1H), 4.34 (q, J = 7.1 Hz, 2H), 4.13 (q, J = 7.1 Hz, 2H), 2.61
(t, J = 7.3 Hz, 2H), 2.40 (t, J = 7.4 Hz, 2H), 1.99 (p, J = 7.4 Hz, 2H), 1.38
(t, J = 7.1 Hz, 3H), 1.24 (t, J = 7.2 Hz, 3H); 13C NMR (101 MHz, CDCl3) δ
173.6, 163.3, 142.9, 132.7, 126.8, 125.1, 123.6, 118.4, 114.0, 61.5, 60.5,
33.6, 32.4, 22.6, 14.4, 14.3.
(
34mg, 0.16 mmol, 2 equiv.) and DIPEA (5% equiv.). The resulting mixture
was left to stir at room temperature for 48 h. After completion of the
reaction, the reaction mixture was washed with 1M HCl (3 X 15 ml)
followed by 0.1M Na2CO3 aqueous solution (3 X 20 ml) to quench the
reaction. The crude mixture was extracted with ethyl acetate. The organic
layer was then washed with brine (3 X 15 ml), dried over magnesium
sulfate, filtered, and evaporated to dryness. The residue was purified by
silica gel column chromatography (ethyl acetate:hexane, 1:6) as eluent led
to compound 7a in 60% yield as a white solid.
Diethyl (E)-2-(2-(2,5-dichloro-4-nitrophenyl)hydrazono)hexanedioate
(
2e). 1H NMR (400 MHz, CDCl3) δ 8.12 (s, 1H), 7.69 (s, 1H), 4.36 (q, J =
7
7
.1 Hz, 2H), 4.14 (q, J = 7.1 Hz, 2H), 2.64 (t, J = 7.4 Hz, 2H), 2.41 (t, J =
.3 Hz, 2H), 2.04 – 1.95 (m, 2H), 1.39 (t, J = 7.1 Hz, 3H), 1.25 (t, J = 7.1
Hz, 3H); 13C NMR (101 MHz, CDCl3) δ 173.4, 163.2, 144.3, 139.4, 136.1,
128.9, 128.1, 116.2, 115.7, 62.1, 60.6, 33.5, 32.6, 22.4, 14.4, 14.2.
F. General procedures for the synthesis of compounds (6a–g, 6c’), (8a-f,
8
c’), (9a-f, 9c’) and (11a–f, 11c’), (12a-f, 12c’), (13a-f, 13c’).
Diethyl
(E)-2-(2-(3,5-
Compound 3a–g, 3c’ (0.5 mmol) and 10a-f, 10c’ (0.5 mmol) were
dissolved in 50 ml tetrahydrofuran (THF) and the mixture stirred at room
temperature for 1 h. Then a solution of NaOH (0.01M) was added and the
reaction stirred at room temperature for 18-24 h. After completion of the
reaction, the pH was adjusted to 2–3 using 1M aq. HCl, and the product
was extracted with diethyl ether (3 X 20 ml). The combined organic layer
was dried over magnesium sulfate, filtered, and evaporated to dryness.
The residue was purified by silica gel column chromatography (ethyl
acetate/hexane, 1:10 to 1:5) as eluent affording products 6a–g, 6c’, 8a-f,
bis(trifluoromethyl)phenyl)hydrazono)hexanedioate (2f). 1H NMR
(400 MHz, CDCl3) δ 7.42 (d, J = 2.6 Hz, 1H), 7.30 (d, J = 1.7 Hz, 1H), 7.15
(d, J = 2.1Hz, 1H), 4.28 (q, J = 7.4 Hz, 2H), 4.15 (q, J = 7.2 Hz, 2H), 2.65
(t, J = 7.1 Hz, 2H), 2.39 (t, J = 7.4 Hz, 2H), 1.98 (p, J = 7.2 Hz, 2H), 1.37
(t, J = 7.2 Hz, 3H), 1.26 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz, CDCl3) δ
174.2, 161.9, 144.5, 133.4, 132.1, 129.7, 124.3, 123.9, 120.8, 115.2, 114.6,
60.8, 60.5, 33.4, 31.7, 21.4, 14.5, 14.2.
Diethyl (E)-2-(2-(p-tolyl)hydrazono)hexanedioate (2g). 1H NMR (400
MHz, CDCl3) δ 7.15 – 7.01 (m, 4H), 4.24 (q, J =7.2Hz, 2H), 4.15 (q, J =
8
c’, 9a-f, 9c’ as well as 11a–f, 11c’, 12a-f, 12c’ and 13a-f, 13c’ in as white
solids.
7
1
.2 Hz, 2H), 2.58 (s, 3H), 2.53 (t, J = 7.2 Hz, 2H), 2.40 (t, J = 7.3 Hz, 2H),
.98 (p, J = 7.6 Hz, 2H), 1.37 (t, J = 7.1 Hz, 3H), 1.22 (t, J = 7.1 Hz, 3H);
G. General Procedures for the Synthesis of N- benzylated derivatives of
ethyl 3-(3-ethoxy-3-oxopropyl)-1H-indole-2-carboxylate (10a-f, 10c’).
13C NMR (101 MHz, CDCl3) δ 172.9, 164.0, 140.9, 130.3, 129.3, 128.5,
112.7, 61.6, 60.9, 35.4, 33.6, 31.8, 24.3, 22.8, 15.4.
A catalytic amount of KI (8 mg, 0.05 mmol) and benzyl bromide (214 mg,
Ethyl 5-chloro-3-(3-ethoxy-3-oxopropyl)-1H-indole-2-carboxylate (3a).
TLC (EtAc/Hex 15:85) Rf = 0.3; 70% yield;orange-brown solid; 1H NMR
(400 MHz, CDCl3) δ 9.26 (s, 1H), 8.73 (d, J = 2.1 Hz, 1H), 8.20 (dd, J =
9.1, 2.2 Hz, 1H), 7.42 (d, J = 9.1 Hz, 1H), 4.46 (q, J = 7.1 Hz, 2H), 4.11 (q,
J = 7.1 Hz, 2H), 3.44 (t, J = 7.7 Hz, 2H), 2.72 (t, J = 7.6 Hz, 2H), 1.45 (t, J
= 7.1 Hz, 3H), 1.23 (t, J = 7.2 Hz, 3H); 13C NMR (101 MHz, CDCl3) δ
172.8, 161.5, 142.3, 138.3, 127.2, 126.7, 125.0, 120.9, 118.6, 112.2, 61.8,
60.8, 35.4, 20.4, 14.4, 14.3.
1
.25 mmol, 2.5 equiv) were added to stirred solution of compounds 3a-f,
c’ (0.5 mmol) and Cs2CO3 (488 mg, 1.5 mmol, 3 equiv) in DMF (20 ml).
3
The reaction mixture was heated to 60°C for 2 h, and then concentrated
under vacuum. The residue was dissolved in EtOAc (25 ml), washed with
water (3 X10 ml), dried with anhydrous MgSO4 and concentrated under
reduced pressure. The crude product was purified by silica gel column
chromatography (ethyl acetate/hexane, 1:9) as eluent affording
compounds 10a-f and 10c’) in high yields (85-95%) as yellow oils.
Ethyl 3-(3-ethoxy-3-oxopropyl)-5-nitro-1H-indole-2-carboxylate (3b).
TLC (EtAc/Hex 15:85) Rf = 0.2; 53% yield; pale-yellow solid; 1H NMR (400
MHz, CDCl3) δ 9.20 (s, 1H), 8.73 (d, J = 2.1 Hz, 1H), 8.21 (dd, J = 9.1, 2.2
Hz, 1H), 7.42 (d, J = 9.1 Hz, 1H), 4.46 (q, J = 7.1 Hz, 2H), 4.11 (q, J = 7.1
Hz, 2H), 3.44 (t, J = 7.7 Hz, 2H), 2.71 (t, J = 7.7 Hz, 2H), 1.45 (t, J = 7.1
Hz, 3H), 1.23 (t, J = 7.2 Hz, 3H); 13C NMR (101 MHz, CDCl3) δ 173.5,
Characterization of synthesized molecules
Diethyl (E)-2-(2-(4-chlorophenyl)hydrazono)hexanedioate (2a). 1H
NMR (400 MHz, CDCl3) δ 7.14 – 7.02 (m, 4H), 4.27 (q, J = 7.1 Hz, 2H),
4
1
1
1
.12 (q, J = 7.1 Hz, 2H), 2.54 (t, J = 7.3 Hz, 2H), 2.39 (t, J = 7.5 Hz, 2H),
.96 (p, J = 7.5 Hz, 2H), 1.35 (t, J = 7.1 Hz, 3H), 1.24 (t, J = 7.1 Hz, 3H);
3C NMR (101 MHz, CDCl3) δ 173.9, 163.9, 141.4, 131.3, 129.9, 126.9,
13.7, 60.7, 60.4, 33.7, 32.1, 23.0, 20.8, 14.4.
1
3
72.8, 142.3, 138.3, 127.3, 126.7, 125.0, 120.9, 118.6, 112.1, 61.8, 60.8,
5.4, 20.4, 14.5, 14.3.
Ethyl
5-chloro-3-(3-ethoxy-3-oxopropyl)-4-(trifluoromethyl)-1H-
indole-2-carboxylate (3c). TLC (EtAc/Hexane15:85) Rf = 0.2; 25% yield;
off-white solid; 1H NMR (400 MHz, CDCl3) δ 9.39 (s, 1H), 7.47 (d, J = 8.8
Hz, 1H), 7.35 (d, J = 8.8 Hz, 1H), 4.45 (q, J = 7.1 Hz, 2H), 4.17 (q, J = 7.1
Hz, 2H), 3.53 – 3.38 (m, 2H), 2.70 – 2.54 (m, 3H), 1.43 (t, J = 7.1 Hz, 3H),
Diethyl (E)-2-(2-(4-nitrophenyl)hydrazono)hexanedioate (2b). 1H NMR
400 MHz, CDCl3) δ 7.17 – 7.08 (m, 4H), 4.31 (q, J = 7.2 Hz, 2H), 4.21 (q,
J = 7.2 Hz, 2H), 2.62 (t, J = 7.2 Hz, 2H), 2.40 (t, J = 7.5 Hz, 2H), 1.99 (p, J
7.4 Hz, 2H), 1.39 (t, J = 7.2 Hz, 3H), 1.26 (t, J = 7.1 Hz, 3H); 13C NMR
101 MHz, CDCl3) δ 171.6, 165.8, 142.6, 132.2, 129.1, 125.5, 114.2, 61.6,
1.0, 34.8, 33.1, 23.7, 20.8, 15.6.
(
=
1
1
2
.27 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz, CDCl3) δ 173.2, 161.5, 135.2,
28.6, 127.1, 126.4, 126.4, 125.2, 124.6, 122.5, 116.7, 61.8, 60.5, 35.4,
1.3, 21.2, 14.4.
(
6
Diethyl
(E)-2-(2-(4-chloro-3-
Ethyl
5-chloro-3-(3-ethoxy-3-oxopropyl)-6-(trifluoromethyl)-1H-
(
trifluoromethyl)phenyl)hydrazono)hexanedioate (2c). 1H NMR (400
indole-2-carboxylate (3c’). TLC (EtAc/Hex 15:85)Rf = 0.3; 20% yield; off-
MHz, CDCl3) δ 7.44 (d, J = 2.6 Hz, 1H), 7.35 (d, J = 8.7 Hz, 1H), 7.21 (dd,
J = 8.7, 2.7 Hz, 1H), 4.27 (q, J = 7.1 Hz, 2H), 4.10 (q, J = 7.1 Hz, 2H), 2.55
white solid; 1H NMR (400 MHz, CDCl3) δ 9.19 (s, 1H), 7.85 (s, 1H), 7.76
(
s, 1H), 4.45 (q, J = 7.1 Hz, 2H), 4.10 (q, J = 7.2 Hz, 2H), 3.36 (t, J = 7.7
(
(
t, J = 7.4 Hz, 2H), 2.37 (t, J = 7.4 Hz, 2H), 1.94 (p, J = 7.4 Hz, 2H), 1.35
t, J = 7.1 Hz, 3H), 1.22 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz, CDCl3) δ
Hz, 2H), 2.67 (t, J = 7.7 Hz, 2H), 1.44 (t, J = 7.1 Hz, 3H), 1.22 (t, J = 7.2
Hz, 3H); 13C NMR (101 MHz, CDCl3) δ 172.9, 161.5, 132.7, 130.5, 127.2,
1
6
73.6, 163.7, 142.5, 132.3, 130.3, 129.0, 123.5, 121.8, 117.3, 112.5, 61.2,
0.4, 33.6, 32.2, 22.7, 14.3, 14.2.
1
24.8, 123.4, 123.0, 122.0, 112.1, 112.0, 61.7, 60.7, 35.3, 20.3, 14.4, 14.3;
HRMS (ESI) calcd for C17H17ClF3NO4 for [M+ H] 392.0871, found
86.0857; HPLC purity 100% (tR = 8.35).
3
Diethyl
(E)-2-(2-(2-chloro-4-
(
trifluoromethyl)phenyl)hydrazono)hexanedioate (2d). 1H NMR (400
8
This article is protected by copyright. All rights reserved.

Chemistry - A European Journal
10.1002/chem.202001725
FULL PAPER
Ethyl
7-chloro-3-(3-ethoxy-3-oxopropyl)-5-(trifluoromethyl)-1H-
NMR (101 MHz, MeOD) δ 177.1, 164.1, 137.2, 129.3, 128.5, 126.9, 126.4,
125.0, 122.3, 118.7, 35.9, 21.9.
indole-2-carboxylate (3d). TLC (EtAc/Hex 15:85) Rf= 0.3; 30% yield;
white solid; 1H NMR (400 MHz, CDCl3) δ 9.07 (s, 1H), 8.08 – 7.81 (m, 1H),
7
3
.56 (d, J = 1.0 Hz, 1H), 4.47 (q, J = 7.1 Hz, 2H), 4.09 (q, J = 7.1 Hz, 2H),
.53 – 3.27 (m, 2H), 2.68 (t, J = 7.7 Hz, 2H), 1.46 (t, J = 7.1 Hz, 3H), 1.21
3
-(2-carboxyethyl)-5-chloro-6-(trifluoromethyl)-1H-indole-2-
carboxylic acid (6c’). TLC (MeOH/DCM 1:9) Rf = 0.3; 15% yield; white
solid; 1H NMR (400 MHz, Acetone-d6) δ 8.10 (s, 1H), 8.00 (s, 1H), 3.44 (t,
J = 7.6 Hz, 2H), 2.74 (t, J = 7.6 Hz, 2H); 13C NMR (101 MHz, Acetone-d6)
δ 174.1, 162.9, 133.9, 131.4, 126.1, 124.3, 122.3, 122.0, 113.4, 113.3,
(
t, J = 7.2 Hz, 4H); 13C NMR (101 MHz, CDCl3) δ 172.8, 161.3, 134.3,
1
2
28.3, 126.0, 124.6, 124.1, 121.4, 118.0, 117.7, 117.6, 61.7, 60.7, 35.3,
0.5, 14.5, 14.3.
3
5.3, 20.6.
Ethyl
4,7-dichloro-3-(3-ethoxy-3-oxopropyl)-5-nitro-1H-indole-2-
carboxylate (3e). TLC (EtAc/Hex 15:85) Rf = 0.2;20% yield; pale-yellow
solid; 1H NMR (400 MHz, CDCl3) δ 9.26 (s, 1H), 7.87 (s, 1H), 4.48 (q, J =
3
-(2-carboxyethyl)-7-chloro-5-(trifluoromethyl)-1H-indole-2-
carboxylic acid (6d). TLC (MeOH/DCM 1:9) Rf = 0.3; 18% yield; off-white
solid; 1H NMR (400 MHz, Acetone-d6) δ 8.19 (s, 1H), 7.59 (s, 1H), 3.47 (t,
J = 7.5 Hz, 2H), 2.74 (t, J = 7.6 Hz, 2H); 13C NMR (101 MHz, Acetone-d6)
δ 173.3, 162.4, 134.2, 132.7, 128.6, 128.3, 123.6, 122.4, 120.1, 119.9,
7
2
.1 Hz, 2H), 4.15 (q, J = 7.1 Hz, 2H), 3.90 – 3.61 (m, 2H), 2.92 – 2.51 (m,
H), 1.46 (t, J = 7.1 Hz, 3H), 1.25 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz,
CDCl3) δ 172.5, 160.8, 142.5, 134.8, 127.8, 126.5, 125.1, 122.1, 121.4,
16.4, 62.2, 60.7, 36.0, 20.8, 14.4, 14.4.
1
1
17.6, 34.3, 19.7.
Ethyl 3-(3-ethoxy-3-oxopropyl)-4,6-bis(trifluoromethyl)-1H-indole-2-
3
-(2-carboxyethyl)-4,7-dichloro-5-nitro-1H-indole-2-carboxylic acid
carboxylate (3f). TLC (EtAc/Hex 15:85) Rf =0.5; 42% yield; off-white solid;
(
6e). TLC (MeOH/DCM 1:9) Rf = 0.3; 10% yield; pale-yellow solid; 1H NMR
1
–
2
H NMR (400 MHz, CDCl3) δ 10.35 (s, 1H), 7.74 (s, 1H), 7.39 (s, 1H), 4.37
4.31 (m, 2H), 4.31 – 4.25 (m, 2H), 2.71 – 2.59 (m, 2H), 2.55 – 2.45 (m,
H), 1.40 (t, J = 7.1 Hz, 3H), 1.34 (t, J = 7.1 Hz, 3H);13C NMR (101 MHz,
(
400 MHz, MeOD) δ 7.86 (s, 1H), 3.81 – 3.57 (m, 2H), 2.72 – 2.54 (m, 2H);
1
1
3C NMR (101 MHz, MeOD) δ 176.5, 163.7, 143.4, 139.1, 136.4, 131.4,
26.2, 125.9, 121.5, 117.9, 36.8, 21.7.
CDCl3) δ 176.1, 164.9, 145.3, 138.0, 132.7, 132.4, 127.6, 124.9, 122.9,
22.2, 114.3, 113.8, 61.7, 61.6, 32.2, 24.8, 14.4, 14.2.
1
3
-(2-carboxyethyl)-4,6-bis(trifluoromethyl)-1H-indole-2-carboxylic
acid (6f). TLC (MeOH/DCM 1:9) Rf = 0.4; 16%yield; off-white solid; 1H
Ethyl
3-(3-ethoxy-3-oxopropyl)-5-methyl-1H-indole-2-carboxylate
3g). TLC (EtAc/Hex 15:85) Rf = 0.3; 80% yield;pale white solid; 1H NMR
500 MHz, CDCl3) δ 8.97 (s, 1H), 7.58 (s, 1H), 7.37 (d, J = 8.0 Hz, 1H),
NMR (400 MHz, MeOD) δ 8.04 (s, 1H), 7.67 (s, 1H), 3.52 – 3.43 (m, 2H),
(
2
1
.64 – 2.52 (m, 2H); 13C NMR (101 MHz, MeOD) δ 176.8, 163.7, 137.6,
30.9, 126.8, 126.2, 125.9, 125.1, 124.5, 124.2, 121.7, 115.7, 35.8, 21.2.
(
7
3
6
1
3
.25 (d, J = 8.3 Hz, 1H), 4.52 (q, J = 6.7 Hz, 2H), 4.23 (q, J = 6.7 Hz, 2H),
.50 (t, J = 7.7 Hz, 2H), 2.78 (t, J = 7.7 Hz, 2H), 2.56 (s, 3H), 1.53 (t, J =
.8 Hz, 3H), 1.33 (t, J = 6.9 Hz, 3H); 13C NMR (126 MHz, CDCl3) δ 173.1,
62.1, 134.1, 129.4, 127.7, 127.5, 123.4, 122.1, 119.8, 111.3, 60.7, 60.2,
5.3, 21.3, 20.3, 14.2, 14.0.
3
-(2-carboxyethyl)-5-methyl-1H-indole-2-carboxylic acid (6g). TLC
(
MeOH/DCM 1:9) Rf = 0.5; 20% yield; off-whitesolid; 1H NMR (400 MHz,
MeOD) δ 7.45 (s, 1H), 7.29 (d, J = 8.4 Hz, 1H), 7.09 (d, J = 8.5 Hz, 1H),
.40 – 3.33 (m, 2H), 2.62 (t, J = 7.9 Hz, 2H), 2.42 (s, 3H); 13C NMR (101
MHz, MeOD) δ 177.4, 165.4, 136.3, 130.0, 128.8, 128.1, 125.0, 122.9,
3
3
-(5-chloro-2-(hydroxymethyl)-1H-indol-3-yl)propan-1-ol (4a). TLC
1
20.4, 112.9, 36.3, 21.6, 21.3.
(
EtAc/Hex 15:85) Rf = 0.3; 80% yield; pale whitesolid; 1H NMR (500 MHz,
MeOD) δ 7.44 (dd, J = 2.0, 0.4 Hz, 1H), 7.22 (dd, J = 8.6, 0.5 Hz, 1H), 6.98
dd, J = 8.6, 2.0 Hz, 1H), 3.51 (t, J = 6.3 Hz, 2H), 3.27 (dt, J = 3.3, 1.6 Hz,
H), 2.83 – 2.74 (m, 2H), 1.86 – 1.75 (m, 2H); 13C NMR (126 MHz, MeOD)
δ 137.3, 136.0, 130.7, 125.4, 122.6, 119.1, 113.3, 113.0, 62.3, 56.5, 34.8,
5
-chloro-3-(3-oxo-3-(phenylamino)propyl)-N-phenyl-1H-indole-2-
(
carboxamide (7a). TLC (EtAc/Hex 20:80) Rf = 0.3; 60% yield; pale white
2
solid;1H NMR (400 MHz, Acetone-d6) δ 11.38 (s, 1H), 10.76 (s, 1H), 9.56
(
s, 1H), 8.03 – 7.98 (m, 2H), 7.74 (d, J = 1.8 Hz, 1H), 7.62 – 7.58 (m, 2H),
.52 (d, J = 8.8 Hz, 1H), 7.43 – 7.36 (m, 2H), 7.29 – 7.20 (m, 3H), 7.13 (t,
J = 7.4 Hz, 1H), 7.03 (t, J = 7.4 Hz, 1H), 3.51 – 3.39 (m, 2H), 3.27 – 3.18
m, 2H). 13C NMR (126 MHz, Acetone-d6) δ 172.8, 160.1, 139.8, 138.6,
2
1.0.
7
5
-chloro-3-(3-oxopropyl)-1H-indole-2-carbaldehyde
(5a).
TLC
(
(
EtAc/Hex 20:80) Rf = 0.3; 60% yield; pale yellow solid;1H NMR (400 MHz,
1
1
34.7, 131.2, 128.8, 124.7, 124.2, 123.9, 123.6, 119.8, 119.8, 119.6, 119.5,
19.4, 114.3, 113.8, 36.0, 19.5.
Chloroform-d) δ 10.12 (s, 1H), 9.83 (s, 1H), 7.67 (s, 1H), 7.34 (d, J = 1.3
Hz, 2H), 3.38 (t, J = 7.2 Hz, 2H), 2.95 (t, J = 7.2 Hz, 2H); 13C NMR (101
MHz, DMSO) δ 202.7, 182.4, 135.9, 133.1, 127.5, 126.6, 125.4, 124.5,
5
-chloro-3-(3-ethoxy-3-oxopropyl)-4-(trifluoromethyl)-1H-indole-2-
1
20.4, 114.6, 44.6, 15.7.
carboxylic acid (8c). TLC (EtAc/Hex 40:60) Rf =0.5; 53% yield; pale-
brown solid; 1H NMR (400 MHz, MeOD) δ 7.62 (d, J = 8.8 Hz, 1H), 7.35
3
-(2-carboxyethyl)-5-chloro-1H-indole-2-carboxylic acid (6a). TLC
(
d, J = 8.8 Hz, 1H), 4.14 (q, J = 7.0 Hz, 2H), 3.50 – 3.38 (m, 2H), 2.63 –
(
MeOH/DCM 1:9) Rf = 0.5; 20% yield; off-white solid; 1H NMR (400 MHz,
MeOD) δ 7.68 (d, J = 1.5 Hz, 1H), 7.37 (d, J = 8.7 Hz, 1H), 7.20 (dd, J =
.8, 1.9 Hz, 1H), 3.35 (t, J = 7.7 Hz, 2H), 2.63 (t, J = 7.7 Hz, 2H); 13C NMR
101 MHz, MeOD) δ 177.1, 164.7, 136.0, 129.7, 126.6, 126.4, 126.3, 122.7,
2
1
3
3
.53 (m, 2H), 1.26 (t, J = 6.8 Hz, 3H); 13C NMR (101 MHz, MeOD) δ 175.3,
69.0, 139.3, 137.3, 131.4, 128.7, 126.7, 125.1, 122.2, 120.5, 118.9, 61.7,
6.4, 22.1, 14.7. HRMS (ESI) calcd for C15H13ClF3NO4 for [M+ Na]
86.0377, found 386.0367.
8
(
1
20.6, 114.5, 36.2, 21.2.
7
-chloro-3-(3-ethoxy-3-oxopropyl)-5-(trifluoromethyl)-1H-indole-2-
3
-(2-carboxyethyl)-5-nitro-1H-indole-2-carboxylic acid (6b). TLC
carboxylic acid (8d). TLC (EtAc/Hex 40:60) Rf =0.6; 33% yield; off-white
(
MeOH/DCM 1:9) Rf = 0.4; 23% yield; pale-yellow solid; 1H NMR (400
MHz, MeOD) δ 8.74 (d, J = 2.2 Hz, 1H), 8.13 (dd, J = 9.1, 2.2 Hz, 1H), 7.50
d, J = 9.1 Hz, 1H), 3.44 (t, J = 7.6 Hz, 2H), 2.69 (t, J = 7.6 Hz, 2H); 13C
NMR (101 MHz, MeOD) δ 176.9, 169.6, 151.7, 143.0, 140.2, 128.1, 125.4,
solid; 1H NMR (400 MHz, Acetone-d6) δ 8.21 (d, J = 0.7 Hz, 1H), 7.66 –
7
.57 (m, 1H), 4.42 (q, J = 7.1 Hz, 2H), 3.47 – 3.39 (m, 2H), 2.67 (t, J = 7.7
(
Hz, 2H), 1.39 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz, Acetone-d6) δ 174.1,
1
3
3
61.8, 134.0, 131.3, 128.6, 126.0, 124.4, 123.3, 122.5, 122.2, 113.4, 61.8,
5.2, 20.6, 14.5; HRMS (ESI) calcd for C15H13ClF3NO4 for [M+ Na]
86.0377, found 386.0363.
1
20.6, 119.1, 113.4, 36.1, 21.1.
3
-(2-carboxyethyl)-5-chloro-4-(trifluoromethyl)-1H-indole-2-
carboxylic acid (6c). TLC (MeOH/DCM 1:9) Rf = 0.3; 15% yield; white
solid; 1H NMR (400 MHz, MeOD) δ 7.62 (dd, J = 8.8, 0.7 Hz, 1H), 7.36
Ethyl 5-chloro-3-(propanoic acid)-1H-indole-2-carboxylate (9a). TLC
EtAc/Hex 40:60) Rf = 0.6; 62% yield; off-whitesolid; 1H NMR (400 MHz,
Acetone-d6) δ 7.82 (d, J = 2.0 Hz, 1H), 7.50 (d, J = 8.8 Hz, 1H), 7.26 (dd,
(
(
dd, J = 8.8, 0.6 Hz, 1H), 3.48 – 3.38 (m, 2H), 2.62 – 2.53 (m, 2H); 13C
9
This article is protected by copyright. All rights reserved.

Chemistry - A European Journal
10.1002/chem.202001725
FULL PAPER
J = 8.8, 2.0 Hz, 1H), 4.39 (q, J = 7.1 Hz, 2H), 3.47 – 3.28 (m, 2H), 2.74 –
128.7, 127.2, 125.7, 124.9, 124.1, 123.4, 118.3, 117.4, 117.3, 61.5, 60.7,
49.3, 35.6, 21.0, 14.3, 14.1.
2
1
3
.60 (m, 2H), 1.39 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz, Acetone-d6) δ
73.2, 161.3, 134.7, 128.4, 125.1, 125.0, 124.9, 121.7, 119.7, 113.7, 60.4,
4.4, 19.8, 13.6.
1
-benzyl-3-(2-carboxyethyl)-5-chloro-6-(trifluoromethyl)-1H-indole-2-
carboxylic acid (11c’). TLC (MeOH/DCM 1:9)Rf = 0.3; 15% yield; pale
white solid; 1H NMR (400 MHz, Acetone-d6) δ 8.13 (s, 1H), 8.02 (s, 1H),
7.30 – 7.15 (m, 3H), 7.06 (d, J = 6.9 Hz, 2H), 6.01 (s, 2H), 3.45 (t, J = 7.6
Hz, 2H), 2.74 (t, J = 7.6 Hz, 2H); 13C NMR (101 MHz, Acetone-d6) δ 173.2,
162.2, 138.2, 135.3, 129.5, 129.4, 128.4, 127.1, 126.1, 125.0, 123.5, 122.7,
122.3, 121.6, 111.3, 111.3, 47.8, 34.4, 20.3.
3
-(2-(ethoxycarbonyl)-5-nitro-1H-indol-3-yl)propanoic acid (9b). TLC
(
EtAc/Hex 40:60) Rf = 0.5; 40% yield; pale-yellow solid; 1H NMR (400 MHz,
Acetone-d6) δ 8.83 (d, J = 2.2 Hz, 1H), 8.17 (dd, J = 9.1, 2.2 Hz, 1H), 7.65
(
(
d, J = 9.1 Hz, 1H), 4.43 (q, J = 7.1 Hz, 2H), 3.48 (t, J = 7.6 Hz, 2H), 2.73
t, J = 7.6 Hz, 2H), 1.41 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz, Acetone-
d6) δ 174.0, 161.9, 142.8, 139.7, 131.8, 127.7, 125.6, 120.7, 119.2, 113.6,
1.8, 35.4, 20.7, 14.6.
6
1
-benzyl-5-chloro-3-(3-ethoxy-3-oxopropyl)-4-(trifluoromethyl)-1H-
indole-2-carboxylic acid (12c). TLC (EtAc/Hex40:60) Rf = 0.7; 30% yield;
pale-brown solid; 1H NMR (400 MHz, MeOD) δ 7.64 (d, J = 9.0 Hz, 1H),
7.36 (d, J = 8.9 Hz, 1H), 7.24 (dq, J = 14.3, 7.0 Hz, 3H), 7.03 (d, J = 7.4
Hz, 2H), 5.83 (s, 2H), 4.15 (q, J = 7.1 Hz, 2H), 3.47 – 3.34 (m, 2H), 2.72 –
2.60 (m, 2H), 1.26 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz, MeOD) δ 183.1,
175.5, 147.7, 139.3, 139.0, 139.0, 137.7, 129.6, 128.2, 127.5, 126.6, 126.2,
125.3, 117.0, 116.4, 61.4, 49.6, 36.9, 22.5, 14.5; HRMS (ESI) calcd for
C22H19ClF3NO4 for [M+ H] 454.1028, found 454.1026.
Ethyl
5-chloro-3-(3-ethoxy-3-oxopropyl)-6-(trifluoromethyl)-1H-
indole-2-carboxylate (9c’). TLC (EtAc/Hex 40:60)Rf = 0.6; 41% yield; off-
white solid; 1H NMR (400 MHz, Acetone-d6) δ 8.08 (s, 1H), 7.97 (s, 1H),
4
1
1
2
.43 (q, J = 7.1 Hz, 2H), 3.40 (t, J = 7.6 Hz, 2H), 2.70 (t, J = 7.6 Hz, 2H),
.41 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz, Acetone-d6) δ 174.0, 161.8,
34.0, 131.3, 128.6, 126.0, 124.4, 123.3, 122.5, 122.2, 113.4, 61.8, 35.2,
0.6, 14.5.
Ethyl
1-benzyl-5-chloro-3-(3-ethoxy-3-oxopropyl)-1H-indole-2-
3-(1-benzyl-5-chloro-2-(ethoxycarbonyl)-1H-indol-3-yl)propanoic
acid (13a). TLC (EtAc/Hex 40:60) Rf = 0.7; 75%yield; pale-brown solid; 1H
NMR (400 MHz, MeOD) δ 7.75 (d, J = 1.5 Hz, 1H), 7.37 (d, J = 8.9 Hz, 1H),
7.25 (d, J = 2.0 Hz, 1H), 7.24 – 7.14 (m, 3H), 6.94 (d, J = 6.9 Hz, 2H), 5.78
(s, 2H), 4.33 (q, J = 7.1 Hz, 2H), 3.36 (t, J = 7.7 Hz, 2H), 2.62– 2.58 (m,
2H), 1.33 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz, MeOD) δ 176.9, 163.3,
139.8, 138.3, 129.5, 128.7, 128.1, 127.2, 126.9, 124.5, 124.1, 120.9, 113.4,
111.6, 62.0, 49.6, 36.4, 22.0, 14.4; HRMS (ESI) calcd for C21H20ClNO4
for [M+ Na] 408.0973, found 408.0962.
carboxylate (10a). TLC (EtAc/Hex 15:85) Rf = 0.4;95% yield;pale brown
liquid; 1H NMR (400 MHz, CDCl3) δ 7.74 (s, 1H), 7.30 – 7.27 (m, 2H), 7.26
–
2
1
7.20 (m, 3H), 7.00 (d, J = 6.7 Hz, 2H), 5.78 (s, 2H), 4.37 (q, J = 7.1 Hz,
H), 4.15 (q, J = 7.1 Hz, 2H), 3.49 – 3.28 (m, 2H), 2.78 – 2.62 (m, 2H),
.37 (t, J = 7.1 Hz, 3H), 1.26 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz,
CDCl3) δ 182.0, 173.1, 138.2, 137.0, 128.7, 127.6, 127.3, 126.3, 126.2,
26.1, 125.9, 123.3, 120.1, 112.0, 61.1, 60.6, 48.5, 35.7, 21.3, 14.3, 14.2.
1
Ethyl
1-benzyl-3-(3-ethoxy-3-oxopropyl)-5-nitro-1H-indole-2-
carboxylate (10b). TLC (EtAc/Hex 15:85) Rf = 0.3;90% yield;pale-yellow
liquid; 1H NMR (400 MHz, CDCl3) δ 8.76 (d, J = 2.2 Hz, 1H), 8.19 (dd, J =
3-(1-benzyl-2-(ethoxycarbonyl)-5-nitro-1H-indol-3-yl)propanoic acid
(13b). TLC (EtAc/Hex 40:60) Rf = 0.7; 54%yield; pale-yellow solid; 1H
NMR (400 MHz, MeOD) δ 8.74 (s, 1H), 8.13 (d, J = 9.2 Hz, 1H), 7.52 (d, J
= 9.2 Hz, 1H), 7.21 (dq, J = 14.3, 7.1 Hz, 3H), 6.98 (d, J = 6.9 Hz, 2H),
5.83 (s, 2H), 4.35 (q, J = 7.1 Hz, 2H), 3.41 (t, J = 7.6 Hz, 2H), 2.66 (t, J =
7.6 Hz, 2H), 1.34 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz, MeOD) δ 176.6,
162.8, 143.5, 142.1, 139.2, 129.7, 129.2, 128.4, 127.3, 127.1, 127.1, 121.2,
119.2, 112.5, 62.4, 49.6, 36.3, 21.9, 14.4; HRMS (ESI) calcd for
C21H20N2O6 for [M+ H] 397.1394, found 397.1399.
9
6
3
.2, 2.2 Hz, 1H), 7.38 (d, J = 9.3 Hz, 1H), 7.32 – 7.22 (m, 3H), 7.00 (d, J =
.5 Hz, 2H), 5.83 (s, 2H), 4.39 (q, J = 7.1 Hz, 2H), 4.13 (q, J = 7.1 Hz, 2H),
.52 – 3.40 (m, 2H), 2.77 – 2.67 (m, 2H), 1.37 (t, J = 7.1 Hz, 3H), 1.24 (t,
J = 7.2 Hz, 3H); 13C NMR (101 MHz, CDCl3) δ 172.7, 161.6, 146.8, 142.4,
1
6
40.9, 137.3, 128.9, 127.9, 127.7, 126.2, 126.0, 120.7, 118.5, 111.1, 61.5,
0.7, 48.9, 35.6, 21.2, 14.3, 14.2.
Ethyl-1-benzyl-5-chloro-3-(3-ethoxy-3-oxopropyl)-4-(trifluoromethyl)-
H-indole-2-carboxylate (10c). TLC(EtAc/Hex 15:85) Rf = 0.5; 87% yield;
pale-brown liquid; 1H NMR (400 MHz, CDCl3) δ 7.40 (d, J = 9.0 Hz, 1H),
.32 (d, J = 8.9 Hz, 1H), 7.31 – 7.19 (m, 3H), 6.96 (d, J = 7.3 Hz, 2H), 5.72
s, 2H), 4.38 (q, J = 7.1 Hz, 2H), 4.17 (q, J = 7.0 Hz, 2H), 3.55 – 3.35 (m,
1
3-(1-benzyl-5-chloro-2-(ethoxycarbonyl)-4-(trifluoromethyl)-1H-indol-
3-yl)propanoic acid (13c). TLC (EtAc/Hex40:60) Rf = 0.7; 10% yield;
pale-white solid; 1H NMR (400 MHz, MeOD) δ 7.69 (d, J = 8.9 Hz, 1H),
7.41 (d, J = 9.1 Hz, 1H), 7.29 – 7.16 (m, 3H), 6.95 (d, J = 7.2 Hz, 2H), 5.79
(s, 2H), 4.35 (q, J = 7.0 Hz, 2H), 3.38 (t, 2H), 2.59 (t, 2H), 1.30 (t, J = 7.0
Hz, 3H). 13C NMR (101 MHz, MeOD) δ 176.8, 163.2, 141.9, 139.0, 139.0,
131.4, 129.7, 128.9, 128.5, 127.3, 127.1, 124.5, 124.0, 122.4, 117.5, 62.8,
49.6, 36.5, 22.5, 14.3; HRMS (ESI) calcd for C22H19ClF3NO4 for [M+ H]
7
(
2
1
1
4
H), 2.76 – 2.55 (m, 2H), 1.33 (t, J = 7.1 Hz, 3H), 1.28 (t, J = 7.0 Hz, 3H);
3C NMR (101 MHz, CDCl3) δ 173.2, 162.1, 137.7, 137.3, 133.4, 129.7,
28.9, 128.2, 127.7, 126.6, 126.0, 125.3, 123.8, 121.9, 115.5, 61.8, 60.4,
8.7, 35.8, 21.7, 14.4, 14.1.
4
54.1028, found 454.1036.
Ethyl-1-benzyl-5-chloro-3-(3-ethoxy-3-oxopropyl)-6-(trifluoromethyl)-
H-indole-2-carboxylate (10c’). TLC(EtAc/Hex 15:85) Rf = 0.4; 90%
yield; pale-brown liquid; 1H NMR (400 MHz, CDCl3) δ 7.88 (s, 1H), 7.69
s, 1H), 7.31– 7.20 (m, 3H), 6.97 (d, J = 6.8 Hz, 2H), 5.79 (s, 2H), 4.37 (q,
J = 7.0 Hz, 2H), 4.13 (q, J = 7.2 Hz, 2H), 3.45 – 3.33 (m, 2H), 2.79 – 2.53
m, 2H), 1.36 (t, J = 7.0 Hz, 3H), 1.24 (t, J = 7.2 Hz, 3H); 13C NMR (101
MHz, CDCl3) δ 172.9, 161.7, 137.5, 135.6, 129.3, 128.9, 128.4, 127.7,
1
3-(1-benzyl-5-chloro-2-(ethoxycarbonyl)-6-(trifluoromethyl)-1H-indol-
3-yl)propanoic acid (13c’). TLC (EtAc/Hex40:60) Rf = 0.7; 40% yield; off-
white solid; 1H NMR (400 MHz, Acetone-d6) δ 8.14 (s, 1H), 8.04 (s, 1H),
7.25 (dq, J = 14.3, 7.1 Hz, 3H), 7.05 (d, J = 7.3 Hz, 2H), 4.38 (q, J = 7.1
Hz, 2H), 3.42 (t, J = 7.6 Hz, 2H), 2.70 (t, J = 7.6 Hz, 2H), 1.35 (t, J = 7.1
Hz, 3H); 13C NMR (101 MHz, Acetone-d6) δ 174.0, 162.2, 139.1, 136.3,
130.4, 129.5, 128.1, 127.1, 126.0, 124.6, 123.8, 123.3, 122.8, 112.4, 112.3,
62.1, 49.0, 35.5, 21.3, 14.3.
(
(
1
2
26.1, 124.8, 123.4, 123.1, 122.9, 122.1, 110.9, 61.5, 60.7, 48.7, 35.6,
1.1, 14.3, 14.2.
Ethyl-1-benzyl-7-chloro-3-(3-ethoxy-3-oxopropyl)-5-(trifluoromethyl)-
H-indole-2-carboxylate (10d). TLC(EtAc/Hex 15:85) Rf = 0.5; 85% yield;
pale-brown liquid; 1H NMR (400 MHz, CDCl3) δ 7.95 (d, J = 0.7 Hz, 1H),
.53 (d, J = 1.1 Hz, 1H), 7.31 – 7.17 (m, 3H), 6.89 (d, J = 6.7 Hz, 2H), 6.28
s, 2H), 4.36 (q, J = 7.1 Hz, 2H), 4.13 (q, J = 7.1 Hz, 2H), 3.47 – 3.33 (m,
3-(1-benzyl-7-chloro-2-(ethoxycarbonyl)-5-(trifluoromethyl)-1H-indol-
3-yl)propanoic acid (13d). TLC (EtAc/Hex40:60) Rf = 0.8; 25% yield;
white solid; 1H NMR (400 MHz, MeOD) δ 8.09 (d, J = 0.8 Hz, 1H), 7.53 (d,
J = 1.3 Hz, 1H), 7.27 – 7.13 (m, 3H), 6.82 (d, J = 6.8 Hz, 2H), 6.26 (s, 2H),
4.33 (q, J = 7.1 Hz, 2H), 3.39 (t, J = 7.6 Hz, 2H), 2.63 (t, J = 7.6 Hz, 2H),
1.31 (t, J = 7.1 Hz, 3H); 13C NMR (101 MHz, MeOD) δ 176.5, 162.7, 140.8,
130.6, 130.5, 129.5, 128.0, 126.5, 126.2, 124.6, 124.5, 124.3, 119.3, 118.7,
1
7
(
2
1
H), 2.74 – 2.61 (m, 2H), 1.35 (t, J = 7.1 Hz, 3H), 1.23 (t, J = 7.1 Hz, 3H);
3C NMR (101 MHz, CDCl3) δ 172.8, 161.6, 139.4, 134.9, 129.1, 128.9,
1
0
This article is protected by copyright. All rights reserved.

Chemistry - A European Journal
10.1002/chem.202001725
FULL PAPER
1
18.7, 62.6, 50.1, 36.2, 21.7, 14.3; HRMS (ESI) calcd for
[24] T. Biswas, E. Resto-Roldan, S. K. Sawyer, I. Artsimovitch and
C22H19ClF3NO4 for [M+ H] 454.1028, found 454.1034.
O. V. Tsodikov, Nucleic Acids Res 2013, 41, e56.
Acknowledgements
This research was supported by the United States-Israel
Binational Science Foundation (BSF, Grant No. 2016142), the
IMTI (TAMAT)/Israel Ministry of Industry–KAMIN Program, Grant
No. 59081, and by the Israel Science Foundation (ISF, Grant No.
1
023/18).
Keywords: Mycobacterium tuberculosis • DnaG primase •
Gyrase • GyrA • GyrB • Structure-activity relationship
[
1] a) T. A. Baker and S. P. Bell, Cell 1998, 92, 295-305; b) Z.
Kelman and M. O'Donnell, Annu Rev Biochem 1995, 64, 171-200.
2] E. van Eijk, B. Wittekoek, E. J. Kuijper and W. K. Smits, J
Antimicrob Chemother 2017, 72, 1275-1284.
3] R. E. Ashley, A. Dittmore, S. A. McPherson, C. L. Turnbough, Jr.,
K. C. Neuman and N. Osheroff, Nucleic Acids Res 2017, 45, 9611-
624.
4] J. H. Morais Cabral, A. P. Jackson, C. V. Smith, N. Shikotra, A.
Maxwell and R. C. Liddington, Nature 1997, 388, 903-906.
5] S. Ilic, S. Cohen, M. Singh, B. Tam, A. Dayan and B. Akabayov,
Antibiotics (Basel) 2018, 7.
6] M. Kato, T. Ito, G. Wagner, C. C. Richardson and T. Ellenberger,
Mol Cell 2003, 11, 1349-1360.
7] C. Hou, T. Biswas and O. V. Tsodikov, Biochemistry 2018, 57,
084-2093.
8] R. U. Rymer, F. A. Solorio, A. K. Tehranchi, C. Chu, J. E. Corn, J.
L. Keck, J. D. Wang and J. M. Berger, Structure 2012, 20, 1478-
489.
9] J. Piton, S. Petrella, M. Delarue, G. Andre-Leroux, V. Jarlier, A.
Aubry and C. Mayer, PLoS One 2010, 5, e12245.
10] L. Aravind, D. D. Leipe and E. V. Koonin, Nucleic Acids Res
998, 26, 4205-4213.
11] B. Strack, M. Lessl, R. Calendar and E. Lanka, J Biol Chem
992, 267, 13062-13072.
[
[
9
[
[
[
[
2
[
1
[
[
1
[
1
[
[
12] S. J. Chen and J. C. Wang, J Biol Chem 1998, 273, 6050-6056.
13] D. B. Wigley, G. J. Davies, E. J. Dodson, A. Maxwell and G.
Dodson, Nature 1991, 351, 624-629.
[
[
14] A. Maxwell, Mol Microbiol 1993, 9, 681-686.
15] Z. F. Udwadia, R. A. Amale, K. K. Ajbani and C. Rodrigues, Clin
Infect Dis 2012, 54, 579-581.
[
[
16] D. C. Hooper, Drugs 1999, 58 Suppl 2, 6-10.
17] a) K. Mdluli and Z. Ma, Infect Disord Drug Targets 2007, 7, 159-
1
68; b) M. Gellert, M. H. O'Dea, T. Itoh and J. Tomizawa, Proc Natl
Acad Sci U S A 1976, 73, 4474-4478; c) S. Alt, L. A. Mitchenall, A.
Maxwell and L. Heide, J Antimicrob Chemother 2011, 66, 2061-
2
069.
[
18] M. Zignol, A. S. Dean, N. Alikhanova, S. Andres, A. M. Cabibbe,
D. M. Cirillo, A. Dadu, A. Dreyer, M. Driesen, C. Gilpin, R. Hasan, Z.
Hasan, S. Hoffner, A. Husain, A. Hussain, N. Ismail, M. Kamal, M.
Mansjo, L. Mvusi, S. Niemann, S. V. Omar, E. Qadeer, L. Rigouts, S.
Ruesch-Gerdes, M. Schito, M. Seyfaddinova, A. Skrahina, S.
Tahseen, W. A. Wells, Y. D. Mukadi, M. Kimerling, K. Floyd, K.
Weyer and M. C. Raviglione, Lancet Infect Dis 2016, 16, 1185-1192.
[
19] a) M. Singh, B. Tam and B. Akabayov, Molecules 2018, 23; b)
S. Ilic, S. R. Akabayov, H. Arthanari, G. Wagner, C. C. Richardson
and B. Akabayov, Sci Rep 2016, 6, 36322.
[
20] Z. Chilingaryan, S. J. Headey, A. T. Y. Lo, Z. Q. Xu, G. Otting,
N. E. Dixon, M. J. Scanlon and A. J. Oakley, Antibiotics (Basel)
018, 7.
21] J. J. Irwin and B. K. Shoichet, J Chem Inf Model 2005, 45, 177-
82.
22] F. N. Akladios, N. A. Nadvi, J. Park, J. R. Hanrahan, V. Kapoor,
M. D. Gorrell and W. B. Church, Bioorg Med Chem Lett 2012, 22,
579-1581.
23] J. Bie, S. Liu, Z. Li, Y. Mu, B. Xu and Z. Shen, Eur J Med Chem
015, 90, 394-405.
2
[
1
[
1
[
2
1
1
This article is protected by copyright. All rights reserved.

Chemistry - A European Journal
10.1002/chem.202001725
FULL PAPER
Entry for the Table of Contents
Gyrase
CO H
2
R
CO Et
2
N
Bn
DnaG primase
The bacterium Mycobacterium tuberculosis is responsible for TB and is one of the most prevalent killers among single infectious
agents. In this report, we describe the rational design of first-in-class small-molecules that inhibit activity of two DNA replication
enzymes of M. tuberculosis: DnaG primase and gyrase that serve as selective targets for the design of anti-tuberculous agents.
Barak Akabayov Twitter usernames: @Akabayov_Lab
1
2
This article is protected by copyright. All rights reserved.