Curcumin and a hemi-analogue with improved blood–brain barrier permeability protect against amyloid-beta toxicity in Caenorhabditis elegans via SKN-1/Nrf activation

Article abstract of DOI:10.1111/jphp.13052

Objectives: This study aims to investigate the blood–brain barrier (BBB) permeability of curcumin analogues with shortened linkers and their ability to protect against amyloid-beta toxicity in a whole organism model. Method: Four curcumin analogues were synthesized. These analogues and curcumin were evaluated for their BBB permeability in the parallel artificial membrane permeability assay. The transgenic Caenorhabditis elegansGMC101 that expresses human Aβ_1–42 was treated with the compounds to evaluate their ability to delay Aβ-induced paralysis. Expression of skn-1mRNA was examined on nematodes treated with selected efficacious compounds. In vitro Aβ aggregation in the presence of the compounds was performed. Key findings: The four analogues showed improved BBB permeability vs curcumin in the PAMPA with the hemi-analogue C4 having the highest permeability coefficient. At 100 μm, analogues C1 and C4 as well as curcumin significantly prolonged the survival of the nematodes protecting against Aβ toxicity. However, only curcumin and C4 showed protection at lower concentrations. skn-1mRNA was significantly elevated in nematodes treated with curcumin and C4 indicating SKN-1/Nrf activation as a possible mode of action. Conclusions: Analogue C4 provides a new lead for the development of a curcumin-based compound for protection against Aβ toxicity with an improved BBB permeability.

Full text of DOI:10.1111/jphp.13052

Research Paper
Curcumin and a hemi-analogue with improved blood–brain
barrier permeability protect against amyloid-beta toxicity
in Caenorhabditis elegans via SKN-1/Nrf activation
Elaine Hui-Chien Lee, Sherlyn Sheau-Chin Lim, Kah-Hay Yuen and Chong-Yew Lee
School of Pharmaceutical Sciences, Universiti Sains Malaysia, Penang, Malaysia
Keywords
Abstract
amyloid-beta; blood–brain barrier
permeability; Caenorhabditis elegans;
Objectives This study aims to investigate the blood–brain barrier (BBB) perme-
ability of curcumin analogues with shortened linkers and their ability to protect
against amyloid-beta toxicity in a whole organism model.
curcumin analogues; SKN-1/Nrf
Correspondence
Method Four curcumin analogues were synthesized. These analogues and cur-
cumin were evaluated for their BBB permeability in the parallel artificial mem-
brane permeability assay. The transgenic Caenorhabditis elegans GMC101 that
expresses human Ab1–42 was treated with the compounds to evaluate their ability
to delay Ab-induced paralysis. Expression of skn-1 mRNA was examined on
nematodes treated with selected efficacious compounds. In vitro Ab aggregation
in the presence of the compounds was performed.
Chong-Yew Lee, School of Pharmaceutical
Sciences, Universiti Sains Malaysia, 11800
Penang, Malaysia.
E-mail: chongyew@usm.my
Received June 26, 2018
Accepted September 17, 2018
Key findings The four analogues showed improved BBB permeability vs cur-
cumin in the PAMPA with the hemi-analogue C4 having the highest permeability
coefficient. At 100 lM, analogues C1 and C4 as well as curcumin significantly
prolonged the survival of the nematodes protecting against Ab toxicity. However,
only curcumin and C4 showed protection at lower concentrations. skn-1 mRNA
was significantly elevated in nematodes treated with curcumin and C4 indicating
SKN-1/Nrf activation as a possible mode of action.
doi: 10.1111/jphp.13052
Conclusions Analogue C4 provides a new lead for the development of a cur-
cumin-based compound for protection against Ab toxicity with an improved
BBB permeability.
control are being intensively studied and sought after. A
notable example is curcumin, a naturally occurring pheno-
Introduction
Alzheimer’s disease is a common cause of dementia in the
ageing population. It is a neurodegenerative condition
marked by progressive cognitive impairment leading to
overt disability, morbidity and death. At the cellular level,
the hallmarks of the disorder are the deposition of toxic
amyloid beta (Ab) oligomers, increased oxidative stress, the
development of neurofibrillary tangles and glial activation,
multiple events that interact to cause neuronal cell dysfunc-
lic diarylheptanoid constituent of the spice turmeric (Cur-
cuma longa). Curcumin has demonstrated remarkable
properties in vitro such as the ability to inhibit Ab aggrega-
[
5,6]
tion or cause its disaggregation
and to reduce Ab-
induced toxicity in various cell culture preparations.
[7–9]
Despite these promising attributes, little has been done to
address its ability to penetrate the blood–brain barrier
(BBB) and be available in efficacious concentrations in the
brain. Sensitive multiphoton microscopy has shown evi-
dence of curcumin BBB penetration but its presence in the
mouse brain was weak and required the accumulation of
[
1]
tion and death. Due to the complex interplay between
these multiple causative processes, the pathogenesis of Alz-
heimer’s disease is not precisely understood. However, the
negative or toxic effects of Ab in the intra- and intercellular
environments of neurons and glial cells are evident in
[
10]
curcumin via repeated intravenous administrations.
11]
[
Cheng et al.
using the Mardin-Darby canine kidney cell
[
2–4]
numerous studies.
Disease-modifying agents that address these multiple fac-
tors of Alzheimer’s disease and extend beyond symptomatic
monolayer expressing human multidrug resistance 1
(MDR1) as their BBB model reported low curcumin perme-
ꢀ
6
ability rate (1.8 9 10 cm/s) even when the compound
©
2018 Royal Pharmaceutical Society, Journal of Pharmacy and Pharmacology, ** (2018), pp. **–**
1

BBB-permeable curcumin analog Ab protection
Elaine Hui-Chien Lee et al.
[
12]
was formulated as nanoparticles. A recent study
reported
constants in Hz. Electrospray Ionisation Mass Spectra (ESI-
MS) were obtained using a Waters 2695 Separations Mod-
ule with Micromass Quattro Micro mass spectrometer
(Waters Corporation, Milford, MA, USA) and accurate m/z
for molecular ions were reported. Melting points of the
compounds were obtained using a digital melting point
apparatus Stuart SMP10 (Staffordshire, UK) and were
uncorrected. All synthesized compounds were purified by
flash column chromatography on silica gel 60 (230–400
mesh). All reactions were monitored by thin layer chro-
matography on silica gel 60 F254 plates (Merck, Darmstadt,
Germany). The purities of compounds C1, C2 and C3
(higher than 95%) were confirmed through HPLC on a
Agilent Tech 1120 Compact HPLC system with the use of a
Purospher STAR RP-18e column (4.6 9 100 mm, 5 lm)
at 1 ml/min on two different solvent systems.
that curcumin conjugated to a nanoliposome and a transac-
tivator of transcription (TAT) peptide showed a higher per-
ꢀ
5
meability coefficient (2.2 9 10 cm/s) across the human
cerebral microvascular (hCMEC/D3) cell monolayer but it
remains to be tested whether conjugation with such large
moieties would retain curcumin bioactivity.
We hypothesized that replacing the heptadienedione lin-
ker of curcumin with a single carbonyl cross-conjugated
dienone thus shortening the molecule, reducing its molecu-
lar weight and increasing its lipophilicity would result in
better BBB permeability. Shortening the linker may also
improve its stability as this portion of the molecule has
been known to contribute to its degradation and low
[
13]
bioavailability.
We were also interested to determine
whether such modified curcumin analogues would still
retain or improve the protective properties of curcumin
against Ab. To this end, four analogues were prepared and
evaluated in a transgenic Caenorhabditis elegans that
expresses Ab1–42 and manifests paralysis as a result of Ab
Synthesis of curcumin analogues C1, C2 and
C3
[14]
toxicity to its bodywall muscle cells.
BBB permeability
of the analogues was determined using the parallel artificial
To a solution of 4-hydroxybenzaldehyde (2 mol) in glacial
acetic acid was added a ketone (1 mol) such as acetone (for
C1), cyclopentanone (for C2) and cyclohexanone (for C3).
The resultant mixture was saturated with anhydrous HCl
and stirred at room temperature for 2 h. After standing for
48 h, the mixture was poured into cold water and the sus-
pension was extracted with ethyl acetate (50 ml 9 3). The
collected organic extract was dried with anhydrous Na SO ,
membrane permeability assay for blood–brain barrier
PAMPA-BBB).
The protective effect of curcumin has been attributed to
(
[5,6]
its Ab binding property.
In another perspective,
Michael acceptor motifs (alpha, beta-unsaturated carbonyl)
are embedded within the structures of curcumin and the
analogues in this study. Michael acceptor moiety-bearing
compounds are known to activate the Kelch-like
ECH-associated protein 1-Nuclear Factor (erythroid-
derived 2)-like 2 (Keap1-Nrf2) pathway, a master regulator
of cytoprotective responses to endogenous and exogenous
2
4
evaporated in vacuo to give a solid residue and purified by
column chromatography on silica gel using hexane: ethyl
acetate as eluting solvents. The compounds were recrystal-
lized from ethyl acetate or ethanol.
[15,16]
electrophilic and oxidative stressors.
Accordingly, to
1,5-bis(4-hydroxy-3-methoxyphenyl)-1,4-
elucidate the possible mechanism(s) underlying the protec-
tion against Ab by the compounds, two mechanisms were
explored in this study: their Ab aggregation inhibitory
potential, and their ability to induce the SKN-1 pathway,
the nematode orthologous version of the mammalian Nrf2
pathway.
pentadien-3-one (C1)
Greenish yellow powder. C H O . Yield: 54.6%. Melting
18 5
19
1
point: 134–138 °C. H NMR (DMSO-d , 500 MHz): d 3.85
6
(s, 6H, –OCH 9 2), 6.84 (d, J = 8 Hz, 2H, arom), 7.16
3
(d, J = 15 Hz, 2H, CH=CH–CO 9 2), 7.37 (d, J = 1.5 Hz,
2
9
H, arom), 7.65 (d, J = 15 Hz, 2H, arom-CH = CH 9 2),
13
.71 (s, 2H, –OH 9 2). C NMR (DMSO-d , 125 MHz):
6
Materials and Methods
d 188.5, 149.9, 148.4, 143.2, 126.8, 123.8, 123.4, 116.1,
+.
111.9, 111.8, 56.17; ESI-MS m/z: 327.24 [M + H] HPLC
General experimental details for synthesis
(
MeOH : H O = 55 : 45) t (min): 5.593. Purity: 99.84%.
2
R
Reagents (synthetic grade or better) were obtained from
Sigma-Aldrich Chemical Company Inc. (Singapore, Singa-
pore), Acros Organics (Geel, Belgium) and Biobasic
Canada Inc. (Toronto, Canada) and used without further
HPLC (ACN : H O = 40 : 60) tR (min): 4.697. Purity:
99.36%.
2
2,5-bis (4 hydroxy-3-methoxybenzylidene)
1
13
purification. H and C NMR spectra were recorded on a
Bruker Avance III 500 MHz spectrometer (Bruker Biospin
AG, Fallanden, Switzerland). Chemical shifts (d) were
reported in parts per millions (ppm) and the coupling
cyclopentanone (C2)
1
Yellow powder, Yield: 87.0%, m.p. 196–198 °C;
H
NMR (DMSO-d ): d 3.07 (4H, s, –CH CH –), 3.84 (s,
6
2
2
2
© 2018 Royal Pharmaceutical Society, Journal of Pharmacy and Pharmacology, ** (2018), pp. **–**

Elaine Hui-Chien Lee et al.
BBB-permeable curcumin analog Ab protection
6
H, OCH 9 2), 6.89 (d, J = 9 Hz, 2H, CH=CH–
3
Ab-induced paralysis assay
CO 9 2), 7.17 (d, J = 9 Hz, 2H, arom-CH=CH 9 2),
.25 (s, 2H, arom), 7.36 (s, 2H, arom), 9.72 (br s, 2H,
[14]
7
Paralysis assays were performed as described previously.
1
3
OH 9 2). C NMR (DMSO-d , 125 MHz): d 195.3, 149.0,
In brief, egg-synchronized population of transgenic
GMC101 strain was prepared by allowing gravid adult
nematodes to lay eggs on the NGM plate containing either
a vehicle or test compound at the desired concentrations
for 2 h at 16 °C. Adult nematodes were then removed and
plates with eggs were allowed to develop into L3 larvae
stage at 16 °C. At 68 h post-egg lay, the test plates were
temperature upshifted to 25 °C to induce transgene expres-
sion. Scoring for paralysis was performed at 2 h intervals
beginning from 24 h post-temperature upshift. Nematodes
were scored as paralysed if they failed to respond to a
touch-provoked movement with platinum wire. At least
three independent experiments were performed for each
test compounds. Approximately 55–100 worms were grown
on each assay plate. Survival curves were generated using
Prism 5 (GraphPad Software Inc., La Jolla, CA, US). The
delays in paralysis were assessed by comparing the median
survival time at which 50% nematodes were paralysed, rep-
resented as median ꢁ95% confident interval, between
nematodes fed with vehicle or compounds. Significant dif-
ferences between groups were assessed using the log-rank
6
1
2
48.2, 135.2, 133.3, 127.6, 125.2, 116.3, 115.0, 56.0,
+
6.3; ESI-MS m/z: 353.29 [M + H] . HPLC (MeOH :
H O = 65 : 35) tR (min): 3.973. Purity: 99.73%. HPLC
2
(
ACN : H O = 50 : 50) tR (min): 3.097. Purity: 99.80%.
2
2
,6-bis (4-hydroxy-3-methoxy benzylidene)
cyclohexanone (C3)
1
Yellow powder, Yield: 73.3%, m.p. 174–176 °C; H NMR
DMSO-d ): d 1.71–1.75 (m, 2H), 2.9 (t, 4H), 3.81 (s,
(
6
6H, OCH 9 2), 6.85 (d, J = 9 Hz, 2H, CH=CH–
3
CO 9 2), 7.04 (d, J = 9 Hz, 2H, arom-CH=CH 9 2),
.12 (s, 2H, arom), 7.57 (s, 2H, arom), 9.57 (s, 2H,
7
1
3
OH 9 2). C NMR (DMSO-d , 125 MHz): d 189.0,
6
1
5
48.3, 147.9, 136.6, 134.0, 127.4, 124.7, 116.0, 115.2,
+
6.1, 28.4, 23.03. ESI-MS m/z: 367.27 [M + H] . HPLC
(
MeOH : H O = 65 : 35) tR (min): 4.870. Purity:
2
98.84%. HPLC (ACN : H O = 50 : 50) t (min): 4.177.
2 R
Purity: 98.84%.
(Mantel-Cox) analysis. A P value <0.05 was considered sta-
tistically significant.
Caenorhabditis elegans strain and culture
conditions
The transgenic strain GMC101 (dvIs100 (unc-54p::A-
0
Parallel artificial membrane permeability
assay for blood–brain barrier
beta-1-42::unc-54 3 -UTR + mtl-2p::GFP). mtl-2p::GFP)
and the food source Escherichia coli (E. coli) strain
OP50 were obtained from the Caenorhabditis Genetics
Center (University of Minnesota, Minnesota, MN,
USA). The GMC101 strain constitutively produces a
full-length human Ab1–42 in bodywall muscle cells that
aggregates in vivo and upshifting L4 or young adults
Porcine brain lipid (PBL) was purchased from Avanti
Polar Lipids (Alabaster, AL, USA). Dodecane, caffeine
and donepezil were sourced from Sigma-Aldrich (St.
Louis, MO, USA) while DMSO was from BioBasic
Canada Inc. The 96-well donor plate microplate (PVDF
membrane, pore size 0.45 lM) and the acceptor micro-
plate were both from Merck Millipore Bioscience (Bed-
[14]
worms from 16 to 25 °C induces paralysis.
The
nematodes were routinely propagated at 16 °C on solid
nematode growth medium (NGM) seeded with spots of
OP50 as the food source.
[
17]
ford, MA, USA). The method by Di et al.
was
followed. Stock solutions of each reference and test com-
pound were prepared in DMSO at 1 mM and then
diluted with phosphate buffered saline (PBS) to obtain
the donor solution with the final concentration of 10 lM.
300 ll of the compounds were added to the donor wells.
The lipid membrane of the PAMPA-BBB model was pre-
pared by dissolving 20 mg of PBL in 1 ml dodecane. The
filter membrane of the acceptor microplate was coated
with 4 ll of the PBL solution and then filled with 300 ll
of PBS. Thereafter, acceptor plate was gently placed into
the donor plate and incubated at room temperature for
18 h. Upon completion of incubation, the plates were
separated and the concentration of the compounds in
both donor and acceptor wells were quantified by the UV
Media preparation
Curcumin and C4 were purchased from Sigma-Aldrich Inc.
(Singapore, Singapore). The curcumin analogues (C1, C2
and C3) were synthesized as described in the previous sec-
tion. Stock solutions of all compounds were made with
100% DMSO. The final concentration of DMSO did not
exceed 1% in the media. All compounds were added
directly into the molten NGM to a final concentration of
100, 10 and 1 lM; NGM with 1% of DMSO served as vehi-
cle control. All media were spotted with 600 ll of OP50
food source.
©
2018 Royal Pharmaceutical Society, Journal of Pharmacy and Pharmacology, ** (2018), pp. **–**
3

BBB-permeable curcumin analog Ab protection
Elaine Hui-Chien Lee et al.
absorbances of the compounds (curcumin and C2, kmax
Real-time quantitative PCR
4
Permeability rates (P ) and membrane retention (R) were
20 nm; C1 and C3, kmax 395 nm; C4, kmax 340 nm).
For quantitative gene expression analysis, total RNA sam-
ples, derived from three biological replicates of each treat-
ment were pooled. qRT-PCR experiments were performed
e
calculated using the following equation:
ꢀ
ꢁ
ꢂ
ꢃ
2
:303VA
A:t
VA
VA þ VD CAðtÞ
â
using KAPA SYBR FAST quantitative PCR (qPCR) kit
(
Pe ¼ ꢀ
ꢂ log 1 ꢀ
ꢂ
VA þ VD
VDð1 ꢀ RÞ CDð0Þ
TM
Kapa Biosystems, Wilmington, MA, USA) on Eco Real-
Time PCR system (Illumina Inc, San Diego, CA, USA).
Briefly, the reaction consists of 0.2 lM each gene-specific
primer and 100 ng of cDNA as the template. Each pooled
sample was run in reaction mixture with a final volume of
20 ll in triplicate, following the manufacturer’s instruc-
tions. Relative gene expression of skn-1 was determined
CDðtÞ VA CAðtÞ
R ¼ 1 ꢀ
ꢀ
ꢂ
CDð0Þ VD CDð0Þ
where A is the active surface area of the membrane
2
(0.24 cm ), t is the incubation time (in s), V and V are
A D
the volumes (cm ) of the acceptor and donor compart-
3
[
18]
ments, C and CD are the compound concentrations
A
3
mol/cm ) in the acceptor and donor compartments.
using the Pfaffl method and normalized to reference
gene cdc-42. The specific primer sequences were as follows:
(
0
0
Experiments were carried out in replicates (n = 6) in
three independent experiments and Pe values were
reported as means ꢁ standard deviations.
skn-1: forward (5 ? 3 ): AGTGTCGGCGTTCCAGATTT,
0
0
reverse (5 ? 3 ): GTCGACGAATCTTGCGAATC; cdc-42:
forward (5 ? 3 ): CTGCTGGACAGGAAGATTACG,
reverse (5 ? 3 ): CTCGGACATTCTCGAATGAAG. Data
were presented as means ꢁ SD, and differences between
groups were assessed by using one-way ANOVA in Graph-
Pad Prism 5.
0
0
0
0
Inhibition of Ab1–40 peptide aggregation
Synthetic full-length Ab1–40 peptides (Sigma-Aldrich) were
pretreated with HFIP (1,1,1,3,3,3-Hexafluoro-2-propanol)
to ensure it is in a monomer state, subsequently evaporated
under stream of nitrogen gas and redissolved in dimethyl-
sulfoxide (DMSO) to keep as stock. The peptide stock solu-
tions were later diluted in PBS (pH 7.4) to the final
concentration of 10 lM used in experiments. Thioflavin T
Results
Preparation of curcumin analogues C1, C2,
C3 and C4
(
ThT) assay was performed as follows: 10 lM of Ab1–40
Three analogues were prepared by acid-catalysed aldol
condensation of vanillin with various ketones (acetone,
cyclopentanone and cyclohexanone; Figure 1) in moder-
ate yields and high purity. The NMR, mass spectra and
HPLC chromatograms of the compounds are given in
the Appendix S1. They were considered analogues with a
shortened linker connecting the two aromatic rings. The
substituents on the aromatic rings (the 4-hydroxyl and
peptide incubated with 10 lM test compounds or plain PBS
was mixed with 20 lM ThT at 37 °C for 24 h. The ThT flu-
orescence intensity was measured on LS 45 Luminescence
Spectrometer (Perkin-Elmer, Waltham, MA, USA) with
excitation and emission wavelengths at 440 and 484 nm,
respectively. Each assay was run in triplicates in three inde-
pendent experiments.
3-methoxyl) were maintained in these compounds with
the focus being variation to the linker. The linker was
acyclic as in C1 or cyclic (C2 and C3) imparting the
compounds with variation in size and lipophilicity. The
commercially obtained C4 was considered a ‘hemi-analo-
gue’ of curcumin as it constituted a symmetric half of
the curcumin molecule.
Isolation of RNA and cDNA synthesis
Egg synchronized transgenic GMC101 worms were exposed
to media containing vehicle, curcumin or C4 (10 and
1
00 lM) at 16 °C for 68 h and were upshifted to 25 °C for
transgene induction. At 15 h post-temperature upshift,
about 8000 worms were harvested for total RNA extraction.
R
Total RNA was extracted with Nucleospin RNA Plus kit
In vitro passive BBB permeability of
curcumin and analogues
(
Macherey-Nagel, Duren, Germany) according to manufac-
turer’s instructions. Purity and concentration of total RNA
were determined by using Bioanalyser (UV spectropho-
tometer Q3000, Quawell). RNA samples with the purity
above 1.8 and 2.0 were qualified for further tests. First
strand cDNA was synthesized from 2 lg RNA using HiSen-
We first evaluated the passive permeability of the com-
pounds in the PAMPA-BBB model. PAMPA evaluates the
ability of a compound to permeate the BBB by measuring
the rate (P ) at which a compound transverses a brain
e
TM
script RH(ꢀ) cDNA Synthesis kit (Intron Biotechnology
lipid-coated filter membrane that mimics the BBB from a
donor compartment to an acceptor compartment filled
Inc., Gyeonggi-do, Korea).
4
© 2018 Royal Pharmaceutical Society, Journal of Pharmacy and Pharmacology, ** (2018), pp. **–**

Elaine Hui-Chien Lee et al.
BBB-permeable curcumin analog Ab protection
Figure 1 Synthesis of curcumin analogues. Reagent and condition: (a) Acetone, cyclopentanone, or cyclohexanone (2 eq), HCl, acetic acid, rt, 48 h.
with phosphate buffer (pH 7.4). Donepezil (a high perme-
ability compound, P > 4 cm/s) and caffeine (a low perme-
C. elegans GMC101 that expresses the Ab1–42 peptide in its
bodywall cells. Initially, the nematodes were treated with
each compound at the highest possible concentration (with
solubility and toxicity being the limiting factor) of 100 lM.
The nematodes were exposed to the compounds from the
egg stage and throughout the assay (Figure 2a). The com-
pounds-treated nematodes showed normal development to
adulthood; thus, the compounds were deemed non-toxic.
Upon temperature upshift from 16 to 25 °C, Ab was
expressed in the worms and scoring of nematode survival
was performed post 24 h when worm paralysis became pro-
nounced. Curcumin, C1 and C4 at 100 lM significantly
delayed paralysis of the worms (Figure 2b). The median
survival times of nematodes treated with these compounds
were also increased significantly (P < 0.001, Table 2). In
e
ability compound, P < 2 cm/s) were used to validate the
e
assay by comparing permeability rates obtained in the assay
with literature values (Table 1). Curcumin showed a low Pe
while the four analogues interestingly demonstrated signifi-
cantly higher P values. C4 with the smallest molecular size
e
(
and the lowest lipophilicity) showed the highest Pe.
Protective effect of curcumin analogues in
Ab-induced paralysis in GMC101
Caenorhabditis elegans
We next evaluated the ability of curcumin and the ana-
logues to delay Ab-induced paralysis in the transgenic
Table 1 Blood–brain barrier permeability of curcumin analogues
ꢀ
6
c
Compound
Structure
P
e
(910 cm/s)
Lipophilicity
2.64
O
O
O
C1
8.2 ꢁ 1.3
6.1 ꢁ 2.1
4.9 ꢁ 1.6
18.0 ꢁ 4.7
0.60 ꢁ 0.67
H CO
OCH3
OH
3
HO
C2
3.13
3.69
1.23
2.25
H CO
OCH3
OH
3
HO
C3
H CO
OCH3
OH
3
HO
O
C4
H CO
3
H
HO
O
O
Curcumin
H CO
OCH3
OH
3
HO
ꢀ
6
Controls
Caffeine
Experimental P
e
(910 cm/s)
ꢀ
6
Literature P
e
(910 cm/s)
a
1.90 ꢁ 0.62
1.3
b
Donepezil
a
21.8 ꢁ 4.1
12.0
b
c
Taken from Ref. [17]. Taken from Ref. [19]. Calculated lipophilicity (cLogP) using ChemBioDraw 14.0 (CambridgeSoft Corp., Cambridge, MA, USA).
©
2018 Royal Pharmaceutical Society, Journal of Pharmacy and Pharmacology, ** (2018), pp. **–**
5

BBB-permeable curcumin analog Ab protection
Elaine Hui-Chien Lee et al.
Ab aggregation inhibition by curcumin and
C4
Efficacious compounds curcumin and C4 were evaluated
for their ability to inhibit Ab aggregation when Ab mono-
mers were incubated in the presence of the compounds
in vitro. Ab aggregation was monitored for 24 h using the
fluorescent Thioflavin T as indicator of aggregation levels
of the peptide. At the 24th h post-incubation, curcumin at
10 lM showed a slight inhibition (14.8%) but this reduc-
tion in Ab aggregation was not significant (Figure 4a). C4
also did not inhibit Ab aggregation significantly.
Upregulation of skn-1 by curcumin and C4
Experiments using GMC101 were repeated using the same
protocol (Figure 1b) but without scoring for paralysed
worms. The RNA of the nematodes under curcumin and
C4 treatment (10 and 100 lM) was extracted and probed
for skn-1 mRNA levels at the 15th h post-temperature
upshift when Ab was expressed and the number of nema-
todes experiencing paralysis was pronounced. RT-PCR
analysis showed skn-1 levels were significantly increased in
worms treated with curcumin at 10 lM (P < 0.01) and C4
at 10 lM (P < 0.05) and 100 lM (P < 0.001) compared to
the vehicle control (Figure 4b).
Figure 2 (a) Experimental protocol for the GMC101 paralysis assay.
(
b) Effects of curcumin and analogues at 100 lM in the Ab-induced
paralysis assay. Time refers to hours after temperature up-shift. Ab
expression was induced by upshifting temperature from 16 to 25 °C.
Worms began to show paralysis 24 h post-temperature upshift and
were scored at 2 h intervals. An asterisk (*) indicates significant differ-
ences between vehicle and treatment (**P < 0.01; ***P < 0.001,
paired log rank survival test). Data are expressed as percentage of
non-paralysed worms derived from at least three independent experi-
ments of >100 worms in each experiment. The plots shown are repre-
sentatives of three experiments.
Discussion
In vitro, curcumin has consistently shown protection
against Ab-induced toxicity in various cell lines as well as
the ability to rescue long-term potentiation in rat hip-
Table 2 Median survival times of GMC101 nematodes treated with
compounds at 100 lM in the Ab-induced paralysis assay
[
6,8,20,21]
pocampus impaired by Ab. Its in vivo performance
however has been hampered by inherently suboptimal
Survival time in hours
physicochemical properties such as low chemical and meta-
[22]
a
2
Treatment Estimate
95% CI
v
(df)
P value
bolic stability, and inconsistent BBB permeability.
In
d
this study, we explored the possibility of improving cur-
cumin BBB permeability via curcumin analogues with
shortened linkers while retaining curcumin protective
activity. Such dibenzylidene ketone analogues as C1 and C2
have been shown to retain the Ab binding property of cur-
Vehicle
Curcumin
C1
40
48
42
36
36
50
39.4; 40.6
47.2; 48.8
41.5; 42.5
35.6; 36.4
35.5; 36.5
49.1; 50.9
Overall : 2481.26 (7) <0.001
b
c
C2
C3
b
C4
[
23,24]
cumin
but their ability to protect against Ab toxicity
Median survival time is the period at which 50% worms survive. Com-
in a physiological context as in the whole organism C. ele-
gans has hitherto not been tested.
a
parisons were done between vehicle and treatment. Median survival
b
time (50% non-paralysed worms). P < 0.001 compared to vehicle.
c
d
Using the PAMPA model, we demonstrated for the first
time that the curcumin analogues C1, C2, C3 and C4
showed improved passive BBB permeability compared to
curcumin. It would seem that the higher lipophilicities (vs
curcumin) of C1, C2 and C3 may have contributed to their
improved BBB permeability with the exception of the smal-
ler hemi-analogue C4 which possessed the lowest
lipophilicity (cLogP 1.23) showing the highest permeability
coefficient of the four compounds. This indicates that
P < 0.01 compared to vehicle. Overall log-rank test.
contrast, cyclic linker-bearing analogues C2 and C3 failed
to show protective effect at 100 lM. At lower concentra-
tions (1 and 10 lM), curcumin and C4 retained their pro-
tective effect in a concentration-dependent manner while
C1 did not show protection (Figure 3). Thus, curcumin
and C4 were deemed as the more efficacious compounds.
6
© 2018 Royal Pharmaceutical Society, Journal of Pharmacy and Pharmacology, ** (2018), pp. **–**

Elaine Hui-Chien Lee et al.
BBB-permeable curcumin analog Ab protection
Figure 3 Effects of curcumin (a), C1 (b) and C4 (c) at 1–100 lM on the Ab-induced paralysis in GMC101. An asterisk (*) indicates significant dif-
ferences between vehicle and treatment (***P < 0.001, paired log rank survival test). Data are expressed as percentage of non-paralysed worms
from at least three independent assays of >100 worms in each experiment. The plots shown are representative of three experiments.
Figure 4 Mechanistic evaluation of curcumin and C4 protection against Ab toxicity. (a) Ab1–40 aggregation inhibitory effect was evaluated by
ThT fluorescence assay. Ab1–40 (10 lM) was incubated at 37 °C for 24 h in the presence and absence of curcumin or C4 (10 lM). The fluorescence
intensities were corrected by subtracting the background reading. Data are presented as means ꢁ SD from three independent experiments with
three replicates for each experiment (n = 3). (b) RT-qPCR probing of skn-1 mRNA was conducted. GMC101 nematodes were cultured on NGM
containing vehicle or test compounds (10 and 100 lM) at 16 °C for 68 h. Ab expression was then induced by upshifting temperature from 16 to
25 °C. At 15 h post-temperature up-shift, total RNA was extracted from the worms (~8000) and the gene expression was analysed using qPCR.
skn-1 gene expression was normalized with reference gene cdc-42. Data are presented as means ꢁ SD (n = 3) from three independent experi-
ments. Statistical test was performed by one-way ANOVA with post hoc Tukey’s. An asterisk (*) indicates significant differences between vehicle
and treatment (*P < 0.05; **P < 0.01; ***P < 0.001).
molecular size in the present instance played a larger role
towards BBB permeability compared to lipophilicity. A
caveat, however, in the present study is that these curcumin
analogues merely showed better passive permeability which
does not take into account active transport protein-
mediated permeation by which a cell-based BBB model
Having found these analogues to have improved BBB
permeability, we evaluated their ability to confer protection
against Ab in the GMC101 nematode that manifests paraly-
sis as a result of Ab toxicity. At the highest screening con-
centration (100 lM), curcumin showed protective effect in
delaying the onset of Ab-induced paralysis and its effect
was dose-dependent thus confirming on previous tissue/
cell-based studies of curcumin protective activity. The abil-
ity of curcumin to interact with Ab and inhibit its aggrega-
tion has been linked to its ability to attenuate Ab toxicity.
However, analogues C2 and C3 which were reported as
[
25,26]
would offer.
of curcumin derivatives with efflux proteins,
In light of recent findings of interactions
the pos-
[27,28]
sibility that the BBB permeation of these compounds may
also involve active transporters requires further confirma-
tion with a cell-based BBB assay.
©
2018 Royal Pharmaceutical Society, Journal of Pharmacy and Pharmacology, ** (2018), pp. **–**
7

BBB-permeable curcumin analog Ab protection
Elaine Hui-Chien Lee et al.
[
23,24]
strong Ab binders comparable to curcumin
failed to
shown to undergo one-electron oxidation to generate sulfu-
ranyl free radical leading to oxidative modification of cellu-
show any protection in delaying paralysis onset of the
worms. Similarly, C1 which showed protection at 100 lM,
was inefficacious at lower concentrations. This draws paral-
[
30]
lar proteins.
Induction of SKN-1 by C4 or curcumin
would thus lead to upregulation of downstream effectors
such as glutathione-S-transferases to remove the oxidative
stressor caused by the presence of Ab. Similar studies but
without the presence of Ab showed the ability of plumba-
[8]
lel to a study by Park et al. which showed that the 7-car-
bon linker of curcumin was necessary for its protection
against Ab-induced death in PC-12 cells and that shorter
linkers (as that of C1, C2 and C3) would result in inactivity.
[
31]
[32]
gin
and allyl isothiocyanate
(both electrophilic Nrf2
[29]
Reinke and Gestwicki
proposed that an Ab-binding
inducers) to prolong the lifespan and increase oxidative
stress resistance of wild type C. elegans via SKN-1 activa-
tion. The notion that curcumin and C4 alleviate Ab toxicity
through oxidative stress modulation in the present finding
requires further investigation into the possible oxidative
modification(s) within the nematode when exposed to Ab
and how these compounds may be able to modify these
changes.
compound requires (i) a linker of optimal length and flexi-
bility and (ii) two aromatic rings attached to both ends of
the linker. In clear contrast, C4 (being half the structure of
curcumin) lacked such structural requirements but showed
significant and dose-responsive paralysis delay and a better
median survival time than curcumin. Taken together, this
suggests that the protective effect shown by the curcumin
and C4 may not be attributed to Ab binding mechanism or
necessitating the full structural motif of curcumin.
In conclusion, a simplified curcumin analogue C4 has
been identified in the present study with improved passive
BBB permeability and the ability to protect against Ab toxi-
city. C4 represents a potential lead for the further optimiza-
tion of similar curcumin-like compounds with therapeutic
potentials and promising BBB targeting property in central
neurodegenerative diseases such as Alzheimer’s disease.
To confirm on this conjecture, curcumin and C4 were
evaluated for their ability to inhibit Ab aggregation in vitro.
Curcumin did not lower Ab aggregation significantly
despite its reputed ability to bind Ab possibly because the
concentration (10 lM) used was insufficient for this prop-
erty to be apparent. The hemi-analogue C4 failed to inhibit
Ab aggregation as expected for its lack of the structural
requirements of an Ab-binding compound. However,
working on the premise of curcumin and C4 having a
Michael acceptor motif within their structures and that
Michael acceptor compounds are potent Nrf2 activators,
the skn-1 (the nematode ortholog of Nrf2) gene was mea-
sured on the compound-treated worms. We showed that
indeed skn-1 mRNA levels of worms treated with curcumin
and C4 were elevated significantly. Thus, this indicates that
the ability of the compounds to modulate oxidative stress
response mechanism via SKN-1 may likely be their mode of
protection against Ab toxicity. A means of Ab toxicity is
the ability of the peptide to induce oxidative stress and
Declarations
Conflict of interest
The Authors declare that they have no conflict of interest to
disclose.
Acknowledgements
The authors gratefully acknowledged support by the
Universiti Sains Malaysia Research University (RU) grant
(1001/PFARMASI/811266) provided by Universiti Sains
Malaysia. EHCL was supported by the MyBrain Scholarship
from the Ministry of Education of Malaysia.
[4]
modify cellular redox state. For example, the Met-35 resi-
due of Ab1–42 peptides located in the lipid bilayer has been
response to amyloid b for Alzheimer’s
disease. J Neuroinflammation 2014; 11:
48.
amyloid in vivo. J Biol Chem 2005;
280: 5892–5901.
References
1
2
3
. Crews L, Masliah E. The molecular
mechanisms of neurodegeneration in
Alzheimer’s disease. Hum Mol Genet
6. Thapa A et al. Curcumin attenuates
amyloid-b aggregate toxicity and
modulates amyloid-b aggregation
pathway. ACS Chem Neurosci 2016; 7:
56–68.
4. Butterfield DA et al. Amyloid b-pep-
tide (1-42)-induced oxidative stress in
Alzheimer disease: importance in dis-
ease pathogenesis and progression.
Antioxid Redox Signal 2013; 19: 823–
835.
2010; 19: R12–R20.
. Benilova I et al. The toxic Ab oligo-
mer and Alzheimer’s disease: an
emperor in need of new clothes. Nat
Neurosci 2012; 15: 349–357.
7. Huang HC et al. Curcumin-mediated
neuroprotection against amyloid-b-
induced mitochondrial dysfunction
involves the inhibition of GSK-3b. J
Alzheimers Dis 2012; 32: 981–996.
5. Fang Y et al. Curcumin inhibits for-
mation of amyloid b oligomers and
fibrils, binds plaques, and reduces
. Doens D, Fernandez PL. Microglia
receptors and their implications in
8
© 2018 Royal Pharmaceutical Society, Journal of Pharmacy and Pharmacology, ** (2018), pp. **–**

Elaine Hui-Chien Lee et al.
BBB-permeable curcumin analog Ab protection
8
. Park SY et al. Curcumin protected
potential preventive and therapeutic
porcine brain endothelial cell models. J
Pharm Sci 2017; 106: 502–510.
induced toxicity through the inhibi- 17. Di L et al. High throughput artificial 27. Lopez-Rodrigues V et al. A novel cur-
PC12 cells against beta-amyloid-
agents. Med Res Rev 2013; 32: 687–726.
tion of oxidative damage and tau
hyperphosphorylation. Food Chem
Toxicol 2008; 46: 2881–2887.
membrane permeability assay for
blood-brain barrier. Euro J Med Chem
2003; 38: 223–232.
cumin derivative which inhibits P-gly-
coprotein, arrests cell cycle and
induces apoptosis in multidrug resis-
tance cells. Bioorg Med Chem 2017;
25: 581–596.
9
. Wang J et al. The protective effect of 18. Pfaffl MW et al. Quantification Strate-
curcumin on Ab induced aberrant cell
cycle reentry on primary cultured rat
cortical neurons. Eur Rev Med Phar-
macol Sci 2012; 16: 445–454.
gies in real time PCR. In: Bustin SA,
ed. The Real-Time PCR Encyclopedia 28. Murakami M et al. Synthetic analogs
A-Z of Quantitative PCR. La Jolla:
International University Line, 2004:
87–120.
of curcumin modulate the function
of multidrug resistance-linked ATP-
binding cassette transporter ABCG2.
Drug Metab Dispos 2017; 45: 1166–
1177.
1
0. Garcia-Alloza
M
et al. Curcumin
labels amyloid pathology in vivo, dis- 19. Di L et al. Comparison of blood-brain
rupts existing plaques, and partially
restores distorted neurites in an Alz-
heimer mouse model. J Neurochem
barrier permeability assays: in situ
brain perfusion, MDR1-MDCKII and 29. Reinke AA, Gestwicki JE. Structure-
PAMPA-BBB. J Pharm Sci 2009; 98:
1980–1991.
1. Cheng KK et al. Highly stabilized cur- 20. Qin XY et al. Potential protection of
activity relationships of amyloid beta-
aggregation inhibitors based on cur-
cumin: influence of linker length and
flexibility. Chem Biol Drug Des 2007;
70: 206–215.
2007; 102: 1095–1104.
1
1
cumin nanoparticles tested in an
in vitro blood-brain barrier model
and in Alzheimer’s disease Tg2576
mice. AAPS J 2012; 15: 324–336.
curcumin against intracellular amyloid
beta-induced toxicity in cultured rat
prefrontal cortical neurons. Neurosci 30. Butterfield DA, Boyd-Kimball D. The
Lett 2010; 480: 21–24.
critical role of methionine 35 in
Alzheimer’s amyloid beta-peptide (1-
42)-induced oxidative stress and neu-
rotoxicity. Biochim Biophys Acta 2005;
1703: 149–156.
2. Sancini G et al. Functionalization with 21. Ahmed T et al. Curcuminoids rescue
TAT-peptide enhances blood-brain
barrier crossing in vitro of nanolipo-
somes carrying a curcumin-derivative
long-term potentiation impaired by
amyloid peptide in rat hippocampal
slices. Synapse 2011; 65: 572–582.
to bind amyloid-Β peptide.
Nanomed Nanotech 2013; 4: 3.
J
22. Anand P et al. Bioavailability of cur- 31. Hunt PR et al. Extension of lifespan
cumin: problems and promises. Mol
Pharm 2007; 4: 807–818.
in C. elegans by naphthoquinones that
act through stress hormesis mecha-
nisms. PLoS One 2011; 6: e21922.
1
3. Fang X et al. Design and synthesis of
dimethylaminomethyl-substituted cur- 23. Yanagisawa
D
et al. Curcuminoid
cumin derivatives/analogues: potent
antitumor and antioxidant activity,
binds to amyloid-b1-42 oligomer and 32. Hasegawa K et al. Allyl isothiocyanate
fibril. J Alzheimers Dis 2011; 24: 33–42.
improved stability and aqueous solu- 24. Orlando RA et al. A chemical analog
that induces GST and UGT expression
confers oxidative stress resistance on
Caenorhabditis elegans, as demon-
strated by nematode biosensor. PLoS
One 2007; 5: e9267.
bility compared with curcumin. Bioorg
Med Chem Lett 2013; 23: 1297–1301.
4. McColl G et al. Utility of an improved
of curcumin as an improved inhibitor
of amyloid Abeta oligomerization.
PLoS One 2012; 7: e31869.
1
model of amyloid-beta (Ab1-42) toxic- 25. Helms HC et al. In vitro models of
ity in Caenorhabditis elegans for drug
screening for Alzheimer’s disease. Mol
the blood–brain barrier: an overview Supporting Information
of commonly used brain endothelial
Additional Supporting Information
may be found in the online version of
this article:
Neurodegener 2012; 7: 57–65.
cell culture models and guidelines for
1
1
5. Blackwell TK et al. SKN-1/Nrf, stress
responses, and aging in Caenorhabditis
their use. J Cereb Blood Flow Metab
2016; 36: 862–890.
elegans. Free Radic Biol Med 2015; 88: 26. Liew KF et al. Assessment of the blood-
1
13
Appendix S1. H NMR, C NMR,
and mass spectra and HPLC purities
of C1, C2, and C3.
290–301.
brain barrier permeability of potential
neuroprotective aurones in parallel arti-
ficial membrane permeability assay and
6. Magesh S et al. Small molecule modula-
tors of Keap1-Nrf2-ARE pathway as
©
2018 Royal Pharmaceutical Society, Journal of Pharmacy and Pharmacology, ** (2018), pp. **–**
9