A newly designed curcumin analog Y20 mitigates cardiac injury via anti-inflammatory and anti-oxidant actions in obese rats

Article abstract of DOI:10.1371/journal.pone.0120215

Obesity is strongly associated with the cause of structural and functional changes of the heart in both human and animal models. Oxidative stress and inflammation play a critical role in the development of obesity-induced cardiac disorders. Curcumin is a natural product from Curcuma Longa with multiple bioactivities. In our previous study, in order to reach better anti-inflammatory and anti-oxidant dual activities, we designed a new mono-carbonyl curcumin analog, Y20, via the structural modification with both trifluoromethyl and bromine. This study was designed to investigate the protective effects of Y20 on obesity-induced cardiac injury and its underlying mechanisms. In high fat diet-fed rats, oral administration of Y20 at 20 mg/kg or curcumin at 50 mg/kg significantly decreased the cardiac inflammation and oxidative stress and eventually improved the cardiac remodeling by mitigating cardiac disorganization, hypertrophy, fibrosis and apoptosis. Y20 at 20 mg/kg showed comparable and even stronger bioactivities than curcumin at 50 mg/kg. The beneficial actions of Y20 are closely associated with its ability to increase Nrf2 expression and inhibit NF-κB activation. Taken together, these results suggest that Y20 may have a great therapeutic potential in the treatment of obesity-induced cardiac injury using Nrf2 and NF-κB as the therapeutic targets for treating obesity-related disorders.

Full text of DOI:10.1371/journal.pone.0120215

RESEARCH ARTICLE
A Newly Designed Curcumin Analog Y20
Mitigates Cardiac Injury via Anti-
Inflammatory and Anti-Oxidant Actions in
Obese Rats
1
☯
1,2☯
1
1
1
Yuanyuan Qian , Peng Zhong
, Dandan Liang , Zheng Xu , Melissa Skibba ,
2
1
2
3
1
Chunlai Zeng , Xiaokun Li , Tiemin Wei , Lianpin Wu *, Guang Liang *
1
Chemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University,
Wenzhou, Zhejiang, China, 2 Department of Cardiology, the 5th Affiliated Hospital of Wenzhou Medical
University, Lishui, Zhejiang, China, 3 Department of Cardiology, the 2nd Affiliated Hospital of Wenzhou
Medical University, Wenzhou, Zhejiang, China
a11111
☯
These authors contributed equally to this work.
*
wzwlp@sina.com (LW); wzmcliangguang@163.com (GL)
OPEN ACCESS
Abstract
Citation: Qian Y, Zhong P, Liang D, Xu Z, Skibba M,
Zeng C, et al. (2015) A Newly Designed Curcumin
Analog Y20 Mitigates Cardiac Injury via Anti-
Inflammatory and Anti-Oxidant Actions in Obese
Rats. PLoS ONE 10(3): e0120215. doi:10.1371/
journal.pone.0120215
Obesity is strongly associated with the cause of structural and functional changes of the
heart in both human and animal models. Oxidative stress and inflammation play a critical
role in the development of obesity-induced cardiac disorders. Curcumin is a natural product
from Curcuma Longa with multiple bioactivities. In our previous study, in order to reach bet-
ter anti-inflammatory and anti-oxidant dual activities, we designed a new mono-carbonyl
curcumin analog, Y20, via the structural modification with both trifluoromethyl and bromine.
This study was designed to investigate the protective effects of Y20 on obesity-induced car-
diac injury and its underlying mechanisms. In high fat diet–fed rats, oral administration of
Y20 at 20 mg/kg or curcumin at 50 mg/kg significantly decreased the cardiac inflammation
and oxidative stress and eventually improved the cardiac remodeling by mitigating cardiac
disorganization, hypertrophy, fibrosis and apoptosis. Y20 at 20 mg/kg showed comparable
and even stronger bioactivities than curcumin at 50 mg/kg. The beneficial actions of Y20
are closely associated with its ability to increase Nrf2 expression and inhibit NF-κB activa-
tion. Taken together, these results suggest that Y20 may have a great therapeutic potential
in the treatment of obesity-induced cardiac injury using Nrf2 and NF-κB as the therapeutic
targets for treating obesity-related disorders.
Academic Editor: Partha Mukhopadhyay, National
Institutes of Health, UNITED STATES
Received: November 16, 2014
Accepted: January 20, 2015
Published: March 18, 2015
Copyright: © 2015 Qian et al. This is an open
access article distributed under the terms of the
Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are
credited.
Data Availability Statement: All relevant data are
within the paper.
Funding: This study was supported by the Natural
Science Funding of China (21272179 to G.L.),
Natural Science Funding of Zhejiang Province
(
LY13H160022), CIHR China-Canada Joint Health
Introduction
Research Initiative (81261120560), High-level
Innovative Talent Funding of Zhejiang Department of
Health (to G.L. and C.Z.), and Zhejiang Key Group in
Scientific Innovation (2010R50042 to X.L.). The
funders had no role in study design, data collection
An increased prevalence of obesity worldwide requires profound public health implications.
Obesity is an emerging pandemic linked to type-2 diabetes mellitus, hypertension, and cardio-
vascular disease [1]. Evidence shows that obesity is strongly associated with structural and
functional changes in the heart in both humans and animal models [2]. Presently, myocardial
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
1 / 16

Y20 Attenuates Obesity-Induced Heart Injury
and analysis, decision to publish, or preparation of
the manuscript.
changes associated with the obese state is referred to as obesity cardiomyopathy which is inde-
pendent of hypertension, obstructive sleep apnea and coronary artery disease [3].Mechanisms
contributing to structural and functional changes in the heart due to obesity could include: al-
tered cardiac metabolism, mitochondrial dysfunction, oxidative stress, impaired insulin signal-
ing, inflammation, pressure/volume overload, sleep apnea, neurohumoral activation, cardiac
fibrosis, and apoptosis [4]. Among these pathophysiological mechanisms, hyperlipidemia-
induced inflammation and oxidative stress are the upstream indicators in the cascade and have
emerged as crucial factors in obesity-induced cardiac remodeling and dysfunction [5], [6].
Therefore, antioxidant and anti-inflammatory therapies appear to be promising approaches in
dealing with obesity cardiomyopathy. Several small-molecule compounds with anti-oxidant or
anti-inflammatory properties have showed limited protection from obesity-induced cardiomy-
opathy [7,8].
Competing Interests: The authors have declared
that no competing interests exist.
Curcumin, a natural and hydrophobic polyphenol, is a constituent of the spice turmeric. It
has been shown to exhibit antioxidant, anti-inflammatory, antiviral, and antibacterial activities
[9]. Previous studies have demonstrated that curcumin at a dosage higher than 50 mg/kg/day
can improve obesity-induced cardiac remodeling via anti-oxidative stress and anti-
inflammatory mechanisms in mice [10]. Despite the favorable biological properties of curcu-
min, low bioavailability and instability have limited its development as a potential therapeutic
drug [11]. Multiple approaches are being sought to overcome these limitations. In the past sev-
eral years, our lab has focused on the chemical modification of curcumin to find novel mole-
cules for drug development [12,13]. We have previously demonstrated that mono-carbonyl
analogs of curcumin lacking the β-diketone moiety show an enhanced stability in vitro and an
improved pharmacokinetic profile in vivo [14]. Of the curcumin analogs, (2E,6E)-2,6-bis
(
2-(trifluoromethyl) benzylidene)cyclohexanone (C66, Fig. 1A) has been shown to have the de-
sired pharmacological effects in diabetes-related complications via its anti-inflammatory action
15,16]. However, C66 showed little anti-oxidant activity both in vitro and in vivo (data not
[
shown), suggesting that it fails to exert the dual activities of both anti-inflammation and anti-
oxidation. Thus, we desired to develop a new C66-based molecule with dual activities.
The structure of C66 has vertical symmetry and contains two trifluoromethy phenyls which
may contribute to its anti-inflammatory activity. Recent studies have showed that the introduc-
tion of bromine, a radical scavenger group with anti-oxidant properties, can enhance the lead-
ing compound’s antioxidant activity [17,18]. Thus, to further modify C66 with anti-oxidant
activity, we substituted one of the trifluoromethyls with a bromine, creating the new compound
(
2E,6E)-2-(2-bromobenzylidene)-6-(2-(trifluoromethyl)benzylidene)cyclohexanone (Y20,
Fig. 1A). We hypothesized that Y20 will have anti-inflammatory properties along with anti-
oxidant properties. Our previous studies demonstrated that Y20 is a safe compound without
unwanted side effects when chronically administered in mice (data not shown). In the present
study, we investigated whether Y20 can prevent inflammation and oxidative stress in the heart,
and ultimately protect the heart from cardiac remodeling in obese rats induced by a high fat
diet (HFD).
Materials and Methods
Chemicals and reagents
As an asymmetric mono-carbonyl curcumin analog, Y20 was prepared according to the previ-
ously reported methods [13]. The chemical synthesis was shown in Fig. 1B. Briefly, a solution
of cyclohexanone (9.8 g, 0.1 mol), morpholine (10.45 g, 0.12 mol), 4-toluenesulfonic acid (0.04
g,0.23mmol) in toluene (30 ml) was under stirring for 6 h at 110°C. After completion of reac-
tion, the solvent was removed by evaporation under reduced pressure to afford the crude
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
2 / 16

Y20 Attenuates Obesity-Induced Heart Injury
Fig 1. The design and synthesis of compound Y20. (A) The chemical structure of curcumin, C66 and Y20. (B) The chemical synthesis of Y20. Reagents
and conditions: (i) 4-Methylbenzenesulfonic acid, toluene, 110℃ reflux, 4h; (ii) EtOH, 78℃, reflux, 5h, saturate HCl; (iii) 20% NaOH, EtOH, r.t., 10h.
doi:10.1371/journal.pone.0120215.g001
product, which was used without purification. Then, 4-(cyclohex-1-en-1-yl) morpholine(4.61g,
0
.027mol) and 2-(trifluoromethyl)benzaldehyde (4.0 g, 0.023 mol) in ethanol (20 ml) were
added and the reaction was heated to 90°C for 6 h. After completion of reaction as indicated by
TLC, the mixture was concentrated and diluted with ethyl acetate. The organic layer was sepa-
rated and operated to afford the resulting crude product, which was further subjected to flash
column chromatography to give (E)-2-(2-(trifluoromethyl)benzylidene)cyclohexanone. To ob-
tain the final Y20, aqueous sodium hydroxide solution (20% w/v, 1 mL) was added to a solution
of (E)-2-(2-(trifluoromethyl)benzylidene)cyclohexanone (0.40 mmol) and 2-bromobenzalde-
hyde (0.40 mmol) in ethanol (5 mL). The reaction mixture was stirred at room temperature for
2
4 h and the resulting crude product was purified by column chromatography with a 71.9%
1
yield. The structural characterization was performed by H NMR and ESI-MS. Before Y20 was
used in biological experiments, the Y20 was recrystallized from CHCl /EtOH to reach HPLC
3
purity higher than 98%. Curcumin was purchased from Sigma-Aldrich (St. Louis, MO, USA).
Curcumin and Y20 were dissolved in CMC-Na (1%) for in vivo experiments. Since curcumin is
of extremely high safety and the dosage of curcumin ranged from 0.5g/day to 12g/day in clini-
cal trials [19] [20], it was usually used at a high oral dosage in animals. Here, we chose the dos-
age of 50mg/kg curcumin for oral administration in rats.
Animals and treatment
The animals were obtained from the Wenzhou Medical University Animal Center. All animal
procedures were performed after approval from the Ethics Committee of Wenzhou Medical
University Animal Policy and Welfare Committee (Approved documents: wydw2014–0058).
Twenty-four male Wistar rats (360–370 g) were randomly divided into four weight-matched
groups. Six rats were fed standard animal chow and served as a normal control group (Ctrl)
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
3 / 16

Y20 Attenuates Obesity-Induced Heart Injury
while the remaining 18 rats were fed with a HFD (from Medicience Diets Co. LTD, Yangzhou,
China) for 12 weeks. After 8 weeks of feeding, HFD-fed rats were further divided into three
groups, HFD group (n = 6), HFD treated with curcumin (n = 6), HFD treated with Y20 (n = 6).
Curcumin and Y20 were given daily by gavage at a dose of 50 mg/kg or 20 mg/kg, respectively,
for 4 weeks. Rats in the ND and HFD group were gavaged with a vehicle only. All the animals
were provided with free access to food and water. During the experimental process, body
weight and blood glucose were monitored once a week. At the end of experimental period, all
the animals were euthanized by a massive pentobarbital sodium IP injection. The body weight
was recorded and the blood samples were collected and centrifuged at 4°C for 10 min to collect
the serum. The heart was excised aseptically, blotted dry and the weight was recorded followed
by immediate freezing in liquid nitrogen and stored at -80°C for further analysis.
Histological analyses
Excised heart tissue specimens were fixed in 4% formalin, processed in graded alcohol, xylene,
and then embedded in paraffin. Paraffin blocks were sliced into 5 μm sections. After rehydra-
tion, the sections were stained with Hematoxylin and Eosin (H&E), sirius red, and masson’s
trichrome. To evaluate the histopathological damage, each image of the sections was captured
using a light microscope (400×amplification, Nikon, Japan). To detect apoptosis, tissue sec-
tions were used for the terminal deoxynucleotidyl transferase-mediated dUTP nick end label-
ing (TUNEL) apoptosis detection kit (R&D Systems, Minneapolis, MN) according to the
manufacturer’s instruction. TUNEL positive cells were imaged under a fluorescence micro-
scope (400×amplification, Nikon, Japan).
Immunohistochemical analysis
The paraffin samples (5 μm) were removed from the sections with xylene, rehydrated in graded
alcohol series, subjected to antigen retrieval in 0.01 mol/L citrate buffer (pH 6.0) by microwaving,
and then placed in 3% hydrogen peroxide in methanol for 30 min at room temperature. After
blocking with 5% BSA, the sections were incubated with anti-3-NT antibody (1:500, Abcam Inc,
MA), anti-TNF-α antibody (1:500, Abcam Inc, MA) or anti-CD68 (1:200, Santa Cruz, CA,
USA), respectively, overnight at 4°C, followed by the respective secondary HRP-conjugated anti-
body (Santa Cruz, CA, USA). After counterstaining with hematoxylin, the sections were dehy-
drated and viewed under the Nikon microscope (400×amplification, Nikon, Japan).
Immunofluorescence staining of tissues
The paraffin samples (5 μm) were removed from the sections using xylene, rehydrated in graded
alcohol series, subjected to antigen retrieval in 0.01 mol/L citrate buffer (pH 6.0) by microwav-
ing, and then placed in 3% hydrogen peroxide in methanol for 30 min at room temperature.
After blocking with 5% BSA, the sections were incubated with the antibody for nuclear factor
erythroid 2-related factor 2 (Nrf2) (Santa Cruz, CA, USA), or antibody for tumor necrosis factor
(
TNF)-α (Abcam Inc, MA) overnight at 4°C, followed by FITC-conjugated secondary antibody
(
1:200, Santa Cruz, CA, USA). The nucleus was stained with DAPI and sections were then
viewed under a Nikon fluorescence microscope (400×amplification, Nikon, Japan).
Measurements of the level of serum lipid
The components of serum lipid including the total triglyceride (TG), total cholesterol (TCH),
low density lipoprotein (LDL), and high density lipoprotein (HDL) were detected using com-
mercial kits (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China).
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
4 / 16

Y20 Attenuates Obesity-Induced Heart Injury
Real-time quantitative PCR
Total RNA was isolated from the tissues (50–100 mg) using TRIZOL (Invitrogen, Carlsbad,
CA) according to the manufacturer’s instructions. Reverse transcription and quantitative PCR
were performed using M-MLV Platinum RT-qPCR Kit (Invitrogen, Carlsbad, CA). Real-time
qPCR was carried out using the Eppendorf Real plex 4 instrument (Eppendorf, Hamburg,
Germany). Primers for genes including TNF-α, interleukin (IL)-6, IL-1β, cyclooxygenase 2
(
COX-2), Nrf2, Heme oxygenase 1 (HO-1), NAD(P)H quinone oxidoreductase 1 (NQO-1),
Transforming growth factor (TGF)-β, collagen 1, matrix metalloproteinase (MMP)-2, MMP-9,
atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), Intercellular Adhesion Mole-
cule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and β-actin were synthesized
by Invitrogen (Invitrogen, Shanghai, China). The primer sequences used were shown in
Table 1. The relative amount of each gene was normalized to the amount of β-actin.
Western blot assay
Primary antibodies for B-cell lymphoma 2 (Bcl-2), Bcl-2-associated X protein (Bax), ANP,
IκBα, VCAM-1, TGF-β, cleavaged PARP, GAPDH and secondary antibodies were purchased
from Santa Cruz Biotechnology (Santa Cruz, CA). Tissue lysate homogenates were prepared in
our lab. Protein samples (30–80 μg) were subjected to a 10% sodium dodecyl sulfate-polyacryl-
amide gel electrophoresis and transferred onto polyvinyldene fluoride membrane (Bio-Rad
Laboratory, Hercules, CA). After blocked in blocking buffer (5% milk in tris-buffered saline
containing 0.05% Tween 20, TBS-T) for 1.5 h at room temperature, the membranes were incu-
bated with different primary antibodies overnight at 4°C. The membranes were then washed in
TBS-T and reacted with secondary horseradish peroxidase-conjugated antibody for 1–2 h at
room temperature. Antigen-antibody complexes were then visualized using enhanced
chemiluminescence reagents.
Statistical analysis
Data was presented as means ± SDs. The statistical significance of differences between groups
was obtained using the student’s t test or ANOVA multiple comparisons in GraphPad Pro 5.0
(
GraphPad, San Diego, CA). Differences were considered to be significant at P < 0.05.
Results
The effects of Y20 on body weight, blood glucose, and the serum lipid
profile
HFD-fed rats became markedly obese with a body weight above 550 g on average at the
1
2-week time point, treatment with curcumin (50 mg/kg) mildly induced weight loss in HFD-
fed rats at the 12-week timet point (P> 0.05 v.s. HFD group), while treatment with Y20 (20
mg/kg) markedly reduced the body weight gain in HFD-fed rats at the 12-week point (P< 0.05
v.s. HFD group, Fig. 2A). HFD-fed rats did not exhibit significant changes in the level of blood
glucose. Also, treatment with curcumin or Y20 had no effect on the blood glucose in HFD-fed
rats (Fig. 2B). In the basal fasting state, HFD-fed rats exhibited a significant increase in the lev-
els of serum lipid including triglycerides (TG) (Fig. 2C), total cholesterol (TCH) (Fig. 2D) and
low density lipoprotein cholesterin (LDL-C) (Fig. 2E), but no significant change in high density
lipoprotein cholesterin (HDL-C) (Fig. 2F). Treatment with curcumin (50 mg/kg) or Y20 (20
mg/kg) significantly decreased the increase in TG level (P<0.05 v.s. HFD group, Fig. 2C), while
neither curcumin nor Y20 had an effect on the TCH, LDL-C, and HDL-C levels in HFD rats
(Fig. 2D-2F).
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
5 / 16

Y20 Attenuates Obesity-Induced Heart Injury
Table 1. Primer sequences for real-time quantitative PCR.
Gene
Species
Forward primer
Reverse primer
ICAM-1
VCAM-1
MMP9
MMP2
TGF-β
Collagen1
ANP
Rat
Rat
Rat
Rat
Rat
Rat
Rat
Rat
Rat
Rat
Rat
Rat
Rat
Rat
Rat
Rat
AGATCATACGGGTTTGGGCTTC
TTTGCAAGAAAAGCCAACATGAAAG
CCCCACTTACTTTGGAAACGC
GACCTTGACCAGAACACCATCG
GGACTACTA CGCCAA AGA AG
GAGCGGAGAG TACTGGATCGA
CTGCTAGACCACCTGGAGGA
GATCCAGGAGAGACTTCGAAA
CACCTCTCAAGCAGAGCACAG
TACTCCCAGGTTCTCTTCAAGG
GAGTTGTGCAATGGCAATTC
TATGACTCGTGAAAGAAATCAGCTC
TCTCCAACAGTTCAGACGTTAGC
ACCCACGACGATACAGATGCTG
GCTGTATTCCCGACCGTTGAAC
TCA AAAGACAGCCACTCAGG
CTGACCTGTCTCCAT- GTTGCA
AAGCTGTTGCAGCCTAGTCC
CGGTCTATCTTCTGCCCAA
BNP
IL-1β
GGGTTCCATGGTGAAGTCAAC
GGAGGCTGACTTTCTCCTGGTA
ACTCCAGAAGACCAGAGCAG
TGGGAGGCACTTGCGTTGATGG
GCTCTTCCATTTCCGAGTCACTG
CAGCTCCTCAAACAGCTCAA
CTTCGGCTCCCCTGTGATGTCGT
CTCTTTAATGTCACGCACGATTTC
TNF-α
IL-6
Cox2
CGGAGGAGAAGTGGGGTTTAGGAT
TTCCTCTGCTGCCATTAGTCAGTC
TCTATCGTGCTCGCATGAAC
Nrf2
HO-1
NQO-1
β-actin
ACTACGATCCGCCCCCAACTTCTG
ATCGTGGGCCGCCCTAGGCACC
doi:10.1371/journal.pone.0120215.t001
Y20 attenuates HFD-induced myocardial inflammation
We then detected the inflammatory markers in cardiac tissues. TNF-α immunohistochemistry
(
IHC) staining and immunofluorescent (IF) staining showed that there was a significant in-
crease in TNF-α protein accumulation (TNF-α were stained in brown for IHC, and in green
for IF) in the hearts of HFD-fed rats (Fig. 3A). There was also an increased expression of
CD68, a specific marker for macrophages, in the hearts of the HFD group, suggesting inflam-
matory cell infiltration in the obese hearts (CD68 positive cells were stained in brown, Fig. 3B).
VCAM-1, a critical cell adhesion molecule for inflammatory cell infiltration, was then found to
be increased in the hearts of the HFD group as evidenced by western blot analysis (Fig. 3C). In
addition, IκB degradation was observed in the hearts of the HFD-fed rats, indicating nuclear
factor κB (NF-κB), a transcript factor controlling the expression of a variety of pro-inflamma-
tory cytokines, was activated via hyperlipidemia (Fig. 3C). We then determined the mRNA ex-
pression of several inflammatory genes by real-time qPCR. The results in Fig. 3D-3I showed
that the expression of pro-inflammatory cytokines such as TNF-α, IL-6, IL-1β and COX-2 and
cell adhesion molecules such as VCAM-1 and ICAM-1 were all up-regulated in myocardial tis-
sues of obese rats. However, all of the above increases in cardiac inflammation were significant-
ly attenuated by 4-week treatment with either curcumin or Y20; and generally, Y20 at 20 mg/
kg exhibited a slightly stronger anti-inflammatory activity than curcumin at 50 mg/kg
(Fig. 3A-3I).
Y20 attenuates HFD-induced myocardial oxidative stress
We investigated whether Y20 administration can prevent oxidative stress induced by HFD
feeding in rat hearts. Immunohistochemistry and immunofluorescent staining analysis showed
that the superoxide anion production (stained in red, Fig. 4A) and 3-NT (stained in brown,
Fig. 4B) in the heart tissues of HFD group were significantly enhanced. However, either curcu-
min (50 mg/kg) or Y20 (20 mg/kg) significantly prevented HFD-induced cardiac accumulation
of these two oxidative stress markers. Evidence has demonstrated that curcumin could up-
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
6 / 16

Y20 Attenuates Obesity-Induced Heart Injury
Fig 2. The effects of Y20 and curcumin treatment on the profiles of body weight, blood glucose and serum lipids in HFD-fed rats. Male Rats
weighted at 360 g-370 g were firstly fed either a normal diet (Ctrl) or high fat diet (HFD) for 8 weeks and then the HFD-fed rats were orally treated with
curcumin (Cur, 50 mg/kg), Y20 (20 mg/kg) or vehicle (1% CMC-Na) every day for 4 weeks (n = 6 in each group). In this process, the body weight and blood
glucose were monitored once every week. At the end of experiment, the rats were sacrificed and the blood samples were collected and centrifuged for
collecting serum for serum lipids analysis. (A) The body weight; (B) The blood glucose; (C) The level of serum triglycerides (TC); (D) The level of serum total
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
7 / 16

Y20 Attenuates Obesity-Induced Heart Injury
cholesterol (TCH); (E) The serum level of low density lipoprotein cholesterol (LDL-C); (F) The level of serum high density lipoprotein cholesterol (HDL-C);
data are presented as mean±SDs, n = 6; # P<0.05 v.s. vehicle control (Ctrl); *P<0.05; **P<0.01 v.s. HFD group.
doi:10.1371/journal.pone.0120215.g002
regulate and activate Nrf2, a key transcription factor in the regulation of multiple antioxidants.
[21] Thus, we investigated whether Y20 had the same effects on Nrf2 expression in myocardial
tissues. Fig. 4C and 4D showed that HFD feeding down-regulated the expression of Nrf2 at
both the protein and mRNA levels, while Nrf2 expression was significantly increased with
treatment of either curcumin or Y20. Similar results were observed in the profile of Nrf2 down-
stream genes such as HO-1 (Fig. 4E) and NQO-1 (Fig. 4F). Interestingly, Y20 at 20 mg/kg was
more efficient than curcumin at 50 mg/kg in both reducing reactive oxygen species (ROS) and
up-regulating Nrf2 expression.
Y20 treatment attenuates HFD-induced cardiac histopathology and
hypertrophy
The myocardial structural was examined by H&E staining. As shown in Fig. 5A, the cardiac
longitudinal section in the H&E staining exhibited well organized myofibrils and disorganized
fibres in the control rats and in HFD-fed hearts, respectively. Curcumin or Y20 treatment re-
duced the histopathological alterations in the myofibril organization of the HFD hearts
(Fig. 5A). Cardiac transverse section H&E staining showed that the cardiomyocyte diameter
was significantly increased in the HFD group, while curcumin or Y20 administration signifi-
cantly attenuated the HFD-induced cardiomyocyte hypertrophy (Fig. 5A). Cell size measure-
ments from the transverse section confirmed a significant reduction in the cardiaomyocyte
hypertrophy by curcumin and Y20 (Fig. 5B). Consistent with the morphologic observations,
the protein expression of the cardiac hypertrophic marker ANP was significantly increased in
HFD-fed rats, which were reversed by cucumin or Y20 treatment (Fig. 5C). Real-time PCR
analysis further confirmed similar results in the level of mRNA transcription of ANP and BNP
(Fig. 5D & 5E).
Y20 attenuates HFD-induced cardiac fibrosis
Myocardial fibrosis was examined by Sirius Red staining and Masson’s trichrome staining, re-
spectively. Increased collagen type I synthesis and deposition contribute to enhancement of
myocardial fibrosis [22]. As shown in Fig. 6A, increased collagen 1 and fibrosis were observed
in the HFD-induced hearts. However, these fibrotic changes were significantly attenuated in
the curcumin and Y20 treated groups. Western blot analysis revealed a significant increase in
the pro-fibrotic gene, TGF-β expression in the hearts of HFD-fed rats (Fig. 6B); real-time
qPCR assay showed marked increases in the expression of pro-fibrotic genes including collagen
1
, TGF-β, MMP-2, and MMP-9 in the hearts of HFD-fed rats (Fig. 6C-6F). Either curcumin
(
50 mg/kg) or Y20 (20 mg/kg) treatment for 4 weeks significantly attenuated HFD-induced ex-
pression of these genes (Fig. 6C-6F). In general, Y20 displays a stronger anti-fibrosis activity
than curcumin.
Y20 attenuates HFD-induce myocardial apoptosis
Cardiomyocyte apoptosis is a comprehensive consequence of myocardial abnormalities.[23]
As shown in Fig. 7A, apoptotic cells stained in bright green by TUNEL staining, were remark-
ably increased in HFD-induced rat hearts, while either curcumin or Y20 treatment significantly
reversed HFD-induced myocardial cell apoptosis. Y20 at 20 mg/kg also showed stronger anti-
apoptotic ability than curcumin at 50 mg/kg. The expression of anti-apoptotic protein Bcl-2
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
8 / 16

Y20 Attenuates Obesity-Induced Heart Injury
Fig 3. Y20 attenuates cardiac inflammation in the hearts of HFD-fed rats. (A) Representative images for immunohistochemical staining and
immunofluorescent staining of TNF-α accumulation using the formalin-fixed myocardial tissues as described in Methods (400×magnification). The statistic
data of the relative intensity was determined by imageJ software (NIH, Bethesda, MD), and data are presented as mean±SDs, n = 4; (B) Representative
images for immunohistochemical staining of CD68 expression using the formalin-fixed myocardial tissues as described in Methods (400×magnification). The
statistic data of the relative intensity was determined by imageJ software (NIH, Bethesda, MD), and data are presented as mean±SDs, n = 4; (C) Western blot
analysis for the protein expression of IκB-α and VCAM-1 in the myocardial tissues was performed. (D-I) The mRNA expression of TNF-α, IL-6, IL-1β, VCAM-
1, ICAM-1 and COX-2 in myocardial tissues was detected by real-time qPCR. Four rats in each group were used for above analysis. * P<0.05, ** P<0.01 v.
s. HFD group; # P<0.05 v.s. vehicle control (Ctrl).
doi:10.1371/journal.pone.0120215.g003
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
9 / 16

Y20 Attenuates Obesity-Induced Heart Injury
Fig 4. Y20 attenuates HFD-induced myocardial oxidative stress. (A) Representative images for DHE staining using the frozen section of heart tissues as
described in Methods (400×magnification).The statistic data of the relative intensity was determined by imageJ software (NIH, Bethesda, MD), and data are
presented as mean±SDs, n = 4; (B) Representative images for immunohistochemical staining of 3-NT accumulation using the formalin-fixed myocardial
tissues as described in Methods (400×magnification). The statistic data of the relative intensity was determined by imageJ software (NIH, Bethesda, MD),
and the date are presented as mean±SDs, n = 4; (C) Representative images for immunofluorescent staining of Nrf2 using the formalin-fixed myocardial
tissues as described in Methods (400×magnification). The statistic data of the relative intensity was determined by imageJ software (NIH, Bethesda, MD),
and the date are presented as mean±SDs, n = 4; (D-F) The mRNA expression of Nrf2, HO-1 and NQO-1 in myocardial tissues was detected by real-time
qPCR. Data are presented as mean±SDs, n = 4. * P<0.05, ** P<0.01 v.s. HFD group; # P<0.05 v.s. vehicle control (Ctrl).
doi:10.1371/journal.pone.0120215.g004
and pro-apoptotic protein Bax were assessed by western blot analysis. Enhanced expression of
Bax and reduced expression of Bcl-2 was observed in HFD group, both of which were signifi-
cantly reversed by curcumin or Y20 administration (Fig. 7B). In addition, similar results were
observed when examining the level of cleaved PARP, a marker of cell apoptosis (Fig. 7B).
Discussion
The incidence of obesity is increasing worldwide and considered a major public health concern.
Researches on ways to slow the development of obesity have traditionally focused on dietary
and lifestyle modifications such as restricting caloric intake and increasing physical activity
[24]. Obesity is strongly associated with structural and functional changes in the heart in both
humans and animal models [2]. Cardiac consequences of obesity include cardiac remodeling
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
10 / 16

Y20 Attenuates Obesity-Induced Heart Injury
Fig 5. Y20 attenuates cardiac histological abnormalities and hypertrophy in the hearts of HFD-fed rats. (A) Representative images for the
Hematoxylin-Eosin (H&E) staining in the formalin-fixed myocardial tissues (400× magnification). (B) Qantitative data of myocyte cross-section lenth of 100
cells chosen from different visual scopes of 4 samples per group in myocardial transverse H&E staining were shown. (C) Western blot analysis for the protein
expression of ANP in the myocardial tissues was performed. (D & E) The mRNA expression of the hypertrophic markers ANP and BNP in the myocardial
tissues was detected by real-time qPCR. Four rats in each group were used for above analysis. *, P<0.05, **, P<0.01 v.s. HFD; # P<0.05 v.s. vehicle
control (Ctrl).
doi:10.1371/journal.pone.0120215.g005
such as cardiac hypertrophy, cardiac fibrosis, cardiac apoptosis and subclinical impairment of
LV systolic and diastolic function [4,25]. As observed in our study, HFD feeding for 12 weeks
significantly increased the rat body weight and hyperlipidemia (Fig. 2). Under a HFD regimen,
cardiac remodeling including cardiomyocyte disorganization, hypertrophy, fibrosis and apo-
ptosis were evident in the hearts of obese rats (Figs. 5–7), accompanied by significantly in-
creased cardiac inflammation and oxidative stress (Figs. 3–4). These results are consistent with
previous reports that the mechanisms underlying the obesity-induced cardiac remodeling is
multifactorial using several mechanisms such as inflammation and oxidative stress [4].
Studies to prevent or reverse HFD-induced cardiac pathophysiology are of high interest due
to their translation to the clinical setting for the prevention of cardiac disorders. Our data col-
lectively favor a unique role of a newly designed curcumin analog, Y20, against HFD-induced
heart injury, possibly through the mechanisms associated with reduced inflammation and
oxidative stress.
Curcumin has been used in a variety of chronic diseases. Growing evidence has suggested
that curcumin can be used to treat obesity and obesity-related metabolic diseases because it can
reverse insulin resistance, hyperglycemia, hyperlipidemia, and inflammatory symptoms associ-
ated with obesity and metabolic diseases [26]. It is also reported that curcuminoid can protect
from obesity-induced cardiac injury [27]. However, due to the chemical instability and poor
bioavailability, the clinical application of curcumin has been significantly limited [11] Our lab
previously designed a series of mono-carbonyl analogs of curcumin (MACs), which showed
enhanced stability in vitro and improved pharmacokinetic profile in vivo [14]. Among these
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
11 / 16

Y20 Attenuates Obesity-Induced Heart Injury
Fig 6. Y20 attenuates cardiac fibrosis in the hearts of HFD-fed rats. (A) Representative images for Sirius Red staining and masson staining in the
formalin-fixed myocardial tissues indicating collagen deposition and implying the extent of cardiac fibrosis (400×magnification). (B) Western blot analysis for
the protein expression of TGF-β in the myocardial tissues was performed. (C-F) The mRNA expression of fibrotic markers such as collagen 1, TGF-β, MMP-2
and MMP-9 in the myocardial tissues was detected by real-time qPCR. Four rats in each group were used for above analysis. * P<0.05, ** P<0.01 v.s. HFD
group; # P<0.05 v.s. vehicle control (Ctrl).
doi:10.1371/journal.pone.0120215.g006
MACs, an analog, C66, has been found to be able to attenuate diabetic nephropathy and car-
diomyopathy via an anti-inflammatory mechanism [15,16]. In order to further confer C66
with anti-oxidant activity, an antioxidant modification of C66 has been performed via the in-
troduction of a bromine atom, which has been applied in the structures of a number of anti-
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
12 / 16

Y20 Attenuates Obesity-Induced Heart Injury
Fig 7. Y20 mitigates HFD-induced cardiac apoptosis in HFD-fed rats. (A) Representative images and
statistic figure for TUNEL staining in heart tissues sections. (B) Western Blot analysis for the protein
expression of apoptosis-related proteins in myocardial tissues was performed. Four to six rats in each group
were used for above analysis. * P<0.05, ** P<0.01 v.s. HFD group; # P<0.05 v.s. vehicle control (Ctrl).
doi:10.1371/journal.pone.0120215.g007
oxidant agents [17,18]. Thus, a new derivative, Y20 was developed with the hopes of having
both anti-inflammatory and anti-oxidant activities. Y20 showed both anti-inflammatory and
anti-oxidant effects when applied in vivo, even slightly stronger than curcumin (Figs. 3 and 4).
More importantly, Y20 was able to have the desired anti-inflammatory and anti-oxidative ef-
fects when the dosage was 2.5-fold lower than that of curcumin, which may attribute to the im-
provement of the pharmaceutical profile of Y20 as one of the MACs. Although Y20 is not
significantly different from curcumin in vivo when examining the present figures and data, the
dosage of Y20 used here is 2.5-fold lower than that of curcumin. Thus, Y20 may be a more
promising candidate than curcumin in cardioprotection both pharmacokinetically and
pharmacologically. Further studies should be performed to test the in vitro anti-inflammatory
and anti-oxidative effects and in vivo pharmacokinetic profile of Y20.
A large body of evidence suggests that obesity is associated with a low-grade chronic inflam-
mation characterized by overproduction of pro-inflammatory cytokines and infiltration of
monocyte/macrophages in the kidney, heart, liver, and adipose tissues [28,29]. Here, we also
found that there was increased accumulation of cytokines and macrophages in the obese hearts,
which matches with the previous studies [30]. These results suggested that the obesity causes
inflammation in cardiomyopathy. Studies have demonstrated a pivotal role of various cyto-
kines in the myocardial injury by directly inducing fibrosis, hypertrophy, apoptosis, and ulti-
mately contractility [31,32]. Interestingly, all these abnormalities were reversed by treatment
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
13 / 16

Y20 Attenuates Obesity-Induced Heart Injury
with curcumin or Y20. The anti-inflammatory activity of Y20 was closely associated with its
cardiac protective effects.
Degradation of IκBα mediates the transcription factor NF-κB activation. NF-κB has a cen-
tral role in the regulation of inflammation and has been demonstrated to be involved in the
pathogenesis of obesity-related cardiovascular diseases [33,34]. Thus, NF-κB may be consid-
ered a therapeutic target in obesity-induced cardiac inflammation or cardiac injury. Curcumin
has been reported to inhibit NF-κB activation in a variety of cell lines [35,36]. Interestingly,
our study showed that the analog Y20 also efficiently reversed IκB degradation. Therefore anti-
inflammatory effect of Y20 may be due to NF-κB inhibition.
Evidence has suggested that obesity could result in cardiac oxidative stress [37]. Further-
more, increased oxidative stress has been linked with cardiac hypertrophy, fibrosis, contractile
dysfunction, and heart failure [38]. Meanwhile, pharmacological antioxidants have been
shown to improve obesity-induced cardiomyopathy [39], indicating the independent involve-
ment of oxidative stress in the pathogenesis of cardiomyopathy in obesity. Superoxide anion
-
2
(
O ) production and 3-NT accumulation were increased in the hearts of HFD-fed rats, indi-
cating an obesity-induced oxidative stress and high ROS levels in the obese hearts (Fig. 4). Y20
treatment in obese rats significantly reversed HFD-induced cardiac oxidative stress, which con-
tributes to its cardioprotective effects. Our studies also revealed Y20 increases the expression of
Nrf2 and the downstream antioxidant genes such as HO-1 and NQO-1. Nrf2, as a master regu-
lator of cellular defense against oxidative stress, has been reported to be a promising target to
treat obesity [40]. Previous studies already suggested there was a reduced expression of Nrf2 in
the heart, skeletal muscle, and liver in HFD-fed animals [41,42]. Curcumin has also been found
to up-regulate Nrf2 expression and activity in cellular and animal models [21]. Y20 treatment
significantly enhanced Nrf2 expression, as well as Nrf2 activity as revealed by increased levels
of HO-1 and NQO-1, in the hearts of HFD-fed rats. It is speculated that the anti-oxidative
properties of Y20 may result from the Nrf2 activation. This study also suggests that attenuating
oxidative stress may be a therapeutic strategy in treating obesity-induced heart injury.
In conclusion, the findings of the present study demonstrated the defensive role of a newly
designed curcumin analog, Y20, against oxidative stress, inflammation, apoptosis, hypertrophy
and fibrosis in obesity-induced heart injury. Although the reduced body weight gain and
serum triglyceride increase may partially contribute to the beneficial effects of Y20 in obesity
cardiomyopathy, the beneficial actions of Y20 are closely associated with its ability to increase
Nrf2 and inhibit NF-κB. This clearly suggests that Y20 could be used for therapeutic applica-
tion in the treatment of obesity-related cardiac disorders. In addition, Nrf2 and NF-κB, for the
regulation of oxidative stress and inflammation, respectively mediate the hypertrophic, apopto-
tic, and fibrotic effects in HFD-induced hearts. These results may provide a deeper understand-
ing of the mechanism and treatment of hyperlipidemia-induced cardiac injury and obesity-
related disorders.
Author Contributions
Conceived and designed the experiments: GL XL CZ LW. Performed the experiments: YQ DL
PZ ZX. Analyzed the data: GL PZ LW. Contributed reagents/materials/analysis tools: TW.
Wrote the paper: PZ MS GL.
References
1.
Wisse BE, Kim F, Schwartz MW. Physiology. An integrative view of obesity. Science. 2007; 318:
28–929. PMID: 17991852
9
2.
Abel ED, Litwin SE, Sweeney G. Cardiac remodeling in obesity. Physiol Rev. 2008; 88: 389–419. doi:
0.1152/physrev.00017.2007 PMID: 18391168
1
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
14 / 16

Y20 Attenuates Obesity-Induced Heart Injury
3.
4.
5.
6.
7.
Wong C, Marwick TH. Obesity cardiomyopathy: pathogenesis and pathophysiology. Nat Clin Pract
Card. 2007; 4: 436–443. PMID: 17653116
Aurigemma GP, de Simone G, Fitzgibbons TP. Cardiac remodeling in obesity. Circ-Cardiovasc Imag.
2013; 6: 142–152. doi: 10.1161/CIRCIMAGING.111.964627 PMID: 23322729
Wang Z, Nakayama T. Inflammation, a link between obesity and cardiovascular disease. Mediators
Inflamm. 2010; 2010: 535918. doi: 10.1155/2010/535918 PMID: 20847813
Ilkun O, Boudina S. Cardiac dysfunction and oxidative stress in the metabolic syndrome: an update on
antioxidant therapies. Curr Pharm Des. 2013; 19: 4806–4817. PMID: 23323621
Lee JE, Yi C, Jeon BT, Shin HJ, Kim SK, Jung TS, et al. Alpha-lipoic acid attenuates cardiac fibrosis in
Otsuka Long-Evans Tokushima Fatty rats. Cardiovasc Diabetol. 2012; 11: 111. doi: 10.1186/1475-
2840-11-111 PMID: 22992429
8
.
.
Ma Y, Lindsey ML, Halade GV. DHA derivatives of fish oil as dietary supplements: a nutrition-based
drug discovery approach for therapies to prevent metabolic cardiotoxicity. Expert Opin Drug Dis. 2012;
7: 711–721. doi: 10.1517/17460441.2012.694862 PMID: 22724444
9
Anand P, Thomas SG, Kunnumakkara AB, Sundaram C, Harikumar KB, Sung B, et al. Biological activi-
ties of curcumin and its analogues (Congeners) made by man and Mother Nature. Biochem Pharmacol.
2008; 76: 1590–1611. doi: 10.1016/j.bcp.2008.08.008 PMID: 18775680
10. Zeng C, Zhong P, Zhao Y, Kanchana K, Zhang Y, Khan ZA, et al. Curcumin protects hearts from FFA-
induced injury by activating Nrf2 and inactivating NF-κB both in vitro and in vivo. J Mol Cell Cardiol.
2015; 79: 1–12 doi: 10.1016/j.yjmcc.2014.10.002 PMID: 25444713
1
1
1. Anand P, Kunnumakkara AB, Newman RA, Aggarwal BB. Bioavailability of curcumin: problems and
promises. Mol Pharm. 2007; 4: 807–818. PMID: 17999464
2. Liang G, Yang S, Zhou H, Shao L, Huang K, Xiao J, et al. Synthesis, crystal structure and anti-inflam-
matory properties of curcumin analogues. Eur J Med Chem. 2009; 44: 915–919. doi: 10.1016/j.ejmech.
2008.01.031 PMID: 18336957
1
3. Zhao C, Yang J, Wang Y, Liang D, Yang X, Li X, et al. Synthesis of mono-carbonyl analogues of curcu-
min and their effects on inhibition of cytokine release in LPS-stimulated RAW 264.7 macrophages.
Bioorg Med Chem. 2010; 18: 2388–2393. doi: 10.1016/j.bmc.2010.03.001 PMID: 20338767
14. Zhao C, Liu Z, Liang G. Promising curcumin-based drug design: mono-carbonyl analogues of curcumin
(
MACs). Curr Pharm Des. 2013; 19: 2114–2135. PMID: 23116317
1
5. Pan Y, Wang Y, Cai L, Cai Y, Hu J, Yu C, et al. Inhibition of high glucose-induced inflammatory re-
sponse and macrophage infiltration by a novel curcumin derivative prevents renal injury in diabetic rats.
Br J Pharmacol. 2012; 166: 1169–1182. doi: 10.1111/j.1476-5381.2012.01854.x PMID: 22242942
1
1
6. Pan Y, Wang Y, Zhao Y, Peng K, Li W, Wang Y, et al. Inhibition of JNK phosphorylation by a novel cur-
cumin analog prevents high glucose-induced inflammation and apoptosis in cardiomyocytes and the
development of diabetic cardiomyopathy. Diabetes. 2014; 63: 3497–3511. doi: 10.2337/db13-1577
PMID: 24848068
7. Küpper FC, Carpenter LJ, Leblanc C, Toyama C, Uchida Y, Maskrey BH, et al. In vivo speciation stud-
ies and antioxidant properties of bromine in Laminaria digitata reinforce the significance of iodine accu-
mulation for kelps. J Exp Bot. 2013; 64: 2653–2664. doi: 10.1093/jxb/ert110 PMID: 23606364
1
1
8. Justino GC, Rodrigues M, Florêncio MH, Mira L. Structure and antioxidant activity of brominated flavo-
nols and flavanones. J Mass Spectrom. 2009; 44: 1459–1468. doi: 10.1002/jms.1630 PMID: 19708016
9. Sharma RA, Euden SA, Platton SL, Cooke DN, Shafayat A, Hewitt HR, et al. Phase I clinical trial of oral
curcumin: biomarkers of systemic activity and compliance. Clin Cancer Res. 2004; 10: 6847–6854.
PMID: 15501961
2
2
2
0. Sharma RA, Steward WP, Gescher AJ. Pharmacokinetics and pharmacodynamics of curcumin. Adv
Exp Med Biol. 2007; 595: 453–470. PMID: 17569224
1. Jung K-A, Kwak M-K. The Nrf2 system as a potential target for the development of indirect antioxidants.
Molecules. 2010; 15: 7266–7291. doi: 10.3390/molecules15107266 PMID: 20966874
2. Querejeta R, Lopez B, Gonzalez A, Sanchez E, Larman M, Martinez Ubago JL, et al. Increased colla-
gen type I synthesis in patients with heart failure of hypertensive origin: relation to myocardial fibrosis.
Circulation. 2004; 110: 1263–1268. PMID: 15313958
2
3. Cai L, Wang Y, Zhou G, Chen T, Song Y, Li X, et al. Attenuation by metallothionein of early cardiac cell
death via suppression of mitochondrial oxidative stress results in a prevention of diabetic cardiomyopa-
thy. J Am Coll Cardiol. 2006; 48: 1688–1697. PMID: 17045908
24. Alappat L, Awad AB. Curcumin and obesity: evidence and mechanisms. Nutr Rev. 2010; 68: 729–738.
doi: 10.1111/j.1753-4887.2010.00341.x PMID: 21091916
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
15 / 16

Y20 Attenuates Obesity-Induced Heart Injury
2
2
2
2
5. Cavalera M, Wang J, Frangogiannis NG. Obesity, metabolic dysfunction, and cardiac fibrosis: patho-
physiological pathways, molecular mechanisms, and therapeutic opportunities. Transl Res. 2014; 164:
323–335. doi: 10.1016/j.trsl.2014.05.001 PMID: 24880146
6. Shehzad A, Ha T, Subhan F, Lee Y. New mechanisms and the anti-inflammatory role of curcumin in
obesity and obesity-related metabolic diseases. Eur J Nutr. 2011; 50: 151–161. doi: 10.1007/s00394-
011-0188-1 PMID: 21442412
7. Pongchaidecha A, Lailerd N, Boonprasert W, Chattipakorn N. Effects of curcuminoid supplement on
cardiac autonomic status in high-fat–induced obese rats. Nutrition. 2009; 25: 870–878. doi: 10.1016/j.
nut.2009.02.001 PMID: 19398300
8. Ko HJ, Zhang Z, Jung DY, Jun JY, Ma Z, Jones KE, et al. Nutrient stress activates inflammation and re-
duces glucose metabolism by suppressing AMP-activated protein kinase in the heart. Diabetes. 2009;
58: 2536–2546. doi: 10.2337/db08-1361 PMID: 19690060
2
3
9. Wellen KE, Hotamisligil GS. Inflammation, stress, and diabetes. J Clin Invest. 2005; 115: 1111–1119.
PMID: 15864338
0. Fukuda M, Nakamura T, Kataoka K, Nako H, Tokutomi Y, Dong YF, et al. Ezetimibe ameliorates cardio-
vascular complications and hepatic steatosis in obese and type 2 diabetic db/db mice. J Pharmacol
Exp Ther. 2010; 335: 70–75. doi: 10.1124/jpet.110.170373 PMID: 20651026
3
3
3
3
1. Aukrust P, Yndestad A, Damås JK, Gullestad L. Inflammation and chronic heart failure–potential thera-
peutic role of intravenous immunoglobulin. Autoimmun Rev. 2004; 3: 221–227. PMID: 15110235
2. Hilfiker-Kleiner D, Landmesser U, Drexler H. Molecular Mechanisms in Heart FailureFocus on Cardiac
Hypertrophy, Inflammation, Angiogenesis, and Apoptosis. J Am Coll Cardiol. 2006; 48: A56’A66.
3. Madonna R, Wu H, Shelat H, Geng YJ. CD1d-associated expression of NF-κB and cardiac dysfunction
in diabetic and obese mice. Int J Immunopathol Pharmacol. 2013; 26: 59–73. PMID: 23527709
4. Rial NS, Choi K, Nguyen T, Snyder B, Slepian MJ. Nuclear factor kappa B (NF-kappaB): a novel cause
for diabetes, coronary artery disease and cancer initiation and promotion? Med Hypotheses. 2012; 78:
29–32. doi: 10.1016/j.mehy.2011.09.034 PMID: 22014759
3
3
3
5. Meng Z, Yan C, Deng Q, Gao DF, Niu XL. Curcumin inhibits LPS-induced inflammation in rat vascular
smooth muscle cells in vitro via ROS-relative TLR4-MAPK/NF-kappaB pathways. Acta Pharmacol Sin.
2013; 34: 901–911. doi: 10.1038/aps.2013.24 PMID: 23645013
6. Hu P, Huang P, Chen MW. Curcumin attenuates cyclooxygenase-2 expression via inhibition of the NF-
kappaB pathway in lipopolysaccharide-stimulated human gingival fibroblasts. Cell Biol Int. 2013; 37:
443–448. doi: 10.1002/cbin.10050 PMID: 23494805
7. Ballal K, Wilson CR, Harmancey R, Taegtmeyer H. Obesogenic high fat western diet induces oxidative
stress and apoptosis in rat heart. Mol Cell Biochem 2010; 344: 221–230. doi: 10.1007/s11010-010-
0546-y PMID: 20676734
3
3
8. Seddon M, Looi YH, Shah AM. Oxidative stress and redox signalling in cardiac hypertrophy and heart
failure. Heart. 2007; 93: 903–907. PMID: 16670100
9. Huynh K, Kiriazis H, Du X-J, Love J, Jandeleit-Dahm K, Forbes JM, et al. Coenzyme Q10 attenuates di-
astolic dysfunction, cardiomyocyte hypertrophy and cardiac fibrosis in the db/db mouse model of type 2
diabetes. Diabetologia. 2012; 55: 1544–1553. doi: 10.1007/s00125-012-2495-3 PMID: 22374176
40. Seo HA, Lee IK. The role of Nrf2: adipocyte differentiation, obesity, and insulin resistance. Oxid Med
Cell Longev. 2013; 2013: 184598. doi: 10.1155/2013/184598 PMID: 24194976
41. Panchal SK, Ward L, Brown L. Ellagic acid attenuates high-carbohydrate, high-fat diet-induced meta-
bolic syndrome in rats. Eur J Nutr. 2013; 52: 559–568. doi: 10.1007/s00394-012-0358-9 PMID:
22538930
42. He HJ, Wang GY, Gao Y, Ling WH, Yu ZW, Jin TR. Curcumin attenuates Nrf2 signaling defect, oxida-
tive stress in muscle and glucose intolerance in high fat diet-fed mice. World J Diabetes. 2012; 3:
94–104. doi: 10.4239/wjd.v3.i5.94 PMID: 22645638
PLOS ONE | DOI:10.1371/journal.pone.0120215 March 18, 2015
16 / 16