Prospective role of mitochondrial apoptotic pathway in mediating GMG-ITC to reduce cytotoxicity in H2O2-induced oxidative stress in differentiated SH-SY5Y cells

Article abstract of DOI:10.1016/j.biopha.2019.109445

The antioxidant and neuroprotective activity of Glucomoringin isothiocyanate (GMG-ITC) have been reported in in vivo and in vitro models of neurodegenerative diseases. However, its neuroprotective role via mitochondrial-dependent pathway in a noxious envi

Full text of DOI:10.1016/j.biopha.2019.109445

Biomedicine&Pharmacotherapy119(2019)109445
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy
journal homepage: www.elsevier.com/locate/biopha
Prospective role of mitochondrial apoptotic pathway in mediating GMG-ITC
to reduce cytotoxicity in H2O2-induced oxidative stress in differentiated SH-
SY5Y cells
Mohammed Sani Jaafarua,b, Norshariza Nordinc, Rozita Roslic,d, Khozirah Shaarie,f,
⁎
Hauwa’u Yakubu Bakob, Noramaliza Mohd Noorg, Ahmad Faizal Abdull Razisa,h,i,
a Laboratory of Molecular Biomedicine, Institute of Bioscience, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia
b Department of Biochemistry, Kaduna State University, Main Campus, PMB 2339, Kaduna, Nigeria
c Department of Biomedical Sciences, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400, UPM Serdang, Selangor, Malaysia
d UPM-MAKNA Cancer Research Laboratory, Institute of Bioscience, Universiti Putra Malaysia, 43400, UPM Serdang, Selangor, Malaysia
e Laboratory of Natural Products, Institute of Bioscience, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia
f Department of Chemistry, Faculty of Science, Universiti Putra Malaysia, 43400, UPM Serdang, Selangor, Malaysia
g Department of Imaging, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400, UPM Serdang, Selangor, Malaysia
h Department of Food Science, Faculty of Food Science and Technology, Universiti Putra Malaysia, 43400, UPM Serdang, Selangor, Malaysia
i Laboratory of Food Safety and Food Integrity, Institute of Tropical Agriculture and Food Security, Universiti Putra Malaysia, 43400, UPM Serdang, Selangor, Malaysia
A R T I C L E I N F O
A B S T R A C T
Keywords:
Apoptosis
The antioxidant and neuroprotective activity of Glucomoringin isothiocyanate (GMG-ITC) have been reported in
in vivo and in vitro models of neurodegenerative diseases. However, its neuroprotective role via mitochondrial-
dependent pathway in a noxious environment remains unknown. The main objective of the present study was to
unveil the mitochondrial apoptotic genes’ profile and prospectively link with neuroprotective activity of GMG-
ITC through its ROS scavenging. The results showed that pre-treatment of differentiated SH-SY5Y cells with
1.25 μg/mL purified isolated GMG-ITC, significantly reduced reactive oxygen species (ROS) production level,
compared to H2O2 control group, as evidenced by flow cytometry-based evaluation of ROS generation. Presence
of GMG-ITC prior to development of oxidative stress condition, downregulated the expression of cyt-c, p53, Apaf-
1, Bax, CASP3, CASP8 and CASP9 genes with concurrent upregulation of Bcl-2 gene in mitochondrial apoptotic
signalling pathway. Protein Multiplex revealed significant decreased in cyt-c, p53, Apaf-1, Bax, CASP8 and
CASP9 due to GMG-ITC pre-treatment in oxidative stress condition. The present findings speculated that pre-
treatment with GMG-ITC may alleviate oxidative stress condition in neuronal cells by reducing ROS production
level and protect the cells against apoptosis via neurodegenerative disease potential pathways.
Glucomoringin-isothiocyanate
Mitochondria
Neurodegenerative diseases
Neuroprotection
Oxidative stress
Abbreviations: AD, alzheimer’s disease; ALS, amyotrophic lateral sclerosis; Apaf-1, apoptotic protease activating factor 1; ARE, antioxidant response element; ATRA,
all trans retinoic acid; Bax, Bcl-2 associated X protein; BCA, bicinchoninic acid; Bcl-2, B-cell lymphoma 2 protein; Bim, Bcl-2-like protein 11; BSA, bovine serum
albumin; CASP, caspases (cysteine-aspartic proteases); cyt-c, cytochrome c; DMEM/F12, dulbecco’s modified essential eagle medium and Hams’ 12; DMSO, dimethyl
sulfoxide; EDTA, ethylenediaminetetraacetic acid; EMC7, endoplasmic reticulum membrane protein complex subunit 7; ESI, electrospray ionization; FBS, fetal bovine
serum; FITC, fluorescein Isothiocyanate; GMG-ITC, glucomoringin-isothiocyanate; GPI, glucose-6-phosphate isomerase; HD, huntington’s disease; H2O2, hydrogen
peroxide; KanR, kanamycin resistance gene; Mcl-1, myeloid cell leukemia sequence 1 protein; MFI, median fluorescence intensity; MPTP, mitochondrial permeability
transition pore; MYR, myrosinase; MTT, 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; NCBI, national centre for biotechnology information; NDD,
neurodegenerative diseases/ disorders; Nrf2, nuclear factor erythroid 2-related factor 2; OligoCalc, oligonucleotide properties calculator; p53, cellular tumour
antigen protein; PBS, phosphate buffer saline/solution; PCR, polymerase chain reaction; PD, parkinson’s disease; PSMB4, proteasome subunit beta type 4; RIN, RNA
integrity number; RIPA, radioimmunoprecipitation assay; RNA, messenger ribonucleic acid; ROS, reactive oxygen species; RPM, revolution per minute; RT, reverse
transcription; SAPE, streptavidin phycoerythrin; SD, standard deviation; SCI, spinal cord injury; SH-SY5Y, human neuroblastoma cell line; SNRPD3, small nuclear
ribonucleoprotein D3; SPSS, statistical package for the social Sciences; Taq, thermus aquaticus; Tuj-1, class III β-tubulin protein; UMBI, UKM medical molecular
biology institute; UPM, universiti putra malaysia; XP, extreme programming
⁎ Corresponding author at: Laboratory of Molecular Biomedicine, Institute of Bioscience, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia.
E-mail addresses: biojafar@kasu.edu.ng (M.S. Jaafaru), shariza@upm.edu.my (N. Nordin), rozita@upm.edu.my (R. Rosli), khozirah@upm.edu.my (K. Shaari),
lady_h83@yahoo.com (H.Y. Bako), noramaliza@upm.edu.my (N.M. Noor), madfaizal@upm.edu.my (A.F. Abdull Razis).
https://doi.org/10.1016/j.biopha.2019.109445
Received 7 May 2019; Received in revised form 4 September 2019; Accepted 6 September 2019
0753-3322/©2019PublishedbyElsevierMassonSAS.ThisisanopenaccessarticleundertheCCBY-NC-NDlicense
(http://creativecommons.org/licenses/BY-NC-ND/4.0/).

M.S. Jaafaru, et al.
Biomedicine&Pharmacotherapy119(2019)109445
1. Introduction
the purely isolated GMG was dissolved in 1 ml PBS at pH 7.2 and in-
cubated with 20 μl myrosinase enzymes (Sigma Aldrich) at 37 °C. After
15 min of incubation, the GMG produced GMG-ITC which is the active
form of the prototype compound used in the present study. The com-
plete hydrolysis of GMG to GMG-ITC was confirmed by HPLC and
LC–MS (Liquid Chromatographic Mass Spectroscopic) analysis em-
ploying sinigrin as internal standard as described by Galuppo et al.
[28].
The world is approaching a period called ageing era, which comes
along side various social issues including cancer and neurodegenerative
diseases (NDDs) [1,2]. Ageing is believed to be the fundamental pre-
disposing factor for the establishment of wide range of NDDs types [3].
The conditions are characterized by selective loss of neuronal structure
and functions in strategic regions of brain, leading to depletion in
nervous communication with consequent loss of certain biological
systems [4–6]. Growing number of studies reported ubiquitin-protea-
some system regulatory proteins [7–9], oxidative stress and mi-
tochondria [10–12] play vital roles in regulating synaptic stability in a
toxic environment [12,13], thus, preserving the integrity of neuronal
cells particularly the surface structures. It was proven that mitochon-
drial impairment, causes rise in ROS production and oxidative damage,
which are responsible for development of many neurodegenerative
disease conditions [14,15]. Rise in ROS generation in neurodegenera-
tive conditions affect mitochondrial parameters with consequent de-
vastation on ATP generation, calcium uptake, activation of mitochon-
drial permeability transition pore (MPTP), which leads to damage in
neuronal segments with eventual loss of the affected cell [16]. Oxida-
tive stress condition often stimulates signal transduction in the neuronal
cells, through cascade of reactions involving mitochondrial death ef-
fector molecules such as Bax and cysteine proteases (caspases) families
[17]. Basically, pro-apoptotic molecules of Bcl-2 families such as Bim
and Bax, are translocated to mitochondria after activation, to coun-
teract the activities of anti-apoptotic proteins such as Bcl-xL (B-cell
lymphoma-extra-large protein), Mcl-1 (Myeloid cell leukemia sequence
1 protein) and Bcl-2 (B-cell lymphoma 2 protein) [18].
Natural compounds, particularly of plants origin with high ther-
apeutic potentials are continuing to fascinate the minds of life science
researchers [19–23] especially those concern with neuronal regenera-
tion and protection [23]. The newly discovered derivative of a rare
glucosinolate of Moringa oleifera Lam origin known as glucomoringin-
isothiocyanate (GMG-ITC), was reported to have broad spectrum of
biological activities including but not limited to, anti-oxidant [24,25],
anti-inflammatory [26,27], antibacterial [28], anticancer [29] and anti-
ulcerative [24] activities. The isothiocyanate was reported to attenuate
damages in spinal cord injury (SCI) [30], ameliorate certain abnorm-
alities in focal ischemia rat model of NDD [31], and slow down disease
phenotype in a transgenic model of amyotrophic lateral sclerosis [32].
These and other reasons made the compound promising candidate for
neuronal protection. GMG-ITC is a product of myrosinase catalysed
hydrolysis of GMG isolated from M. oleifera Lam seeds’ [33], which is
the most popular species under genus Moringaceae [34]. To unravel the
potentials of GMG-ITC, we therefore investigated the influential effect
of the compound on the expression level of mitochondrial-dependent
pathway genes and proteins in an in vitro model of NDD, generated from
terminally differentiated neuronal cells and hydrogen peroxide.
2.2. Cell culture
The cell lines used in the presence study was neuroblastoma SH-
SY5Y (ATCC® CRL-2266™) cell obtained from UKM Medical Molecular
Biology Institute (UMBI), Kuala Lumpur, Malaysia. SH-SY5Y cells pos-
sessed neuron like characteristics and can be fully differentiated into
terminal neurons by appropriate concentration of retinoic acid (RA) in
a low serum containing growth media. Thus, are considered suitable
model for neuroprotection researches. The cells were maintained in a
mixture of Dulbecco’s modified essential eagle medium and Hams’ 12
Media (DMEM/F12) in ratio 1:1, containing 10% fetal bovine serum
(FBS), 1% (10000 unit/ml of penicillin and 10000 μg/ml of strepto-
mycin), 1% 2 mM nonessential amino acid (L-Glutamine) and incubated
under 5% CO2 and 95% humidified atmospheric air at 37 °C incubator.
All the media components were procured from Nacalai, Kyoto, Japan.
2.3. Differentiation of SH-SY5Y cells
SH-SY5Y cells’ differentiation was conducted according to the pro-
tocol described in our previous publication [33]. Concisely, neuro-
blastoma cells were seeded in 6-wells plates at a density of 1 × 103
cells/mL for 24 h. 2 mL of differentiating media (DMEM/Hams’ F12, 3%
heat inactivated FBS and 10 μM all trans retinoic acid (RA)) was added
to each well in the dark after 24 h of incubation. The plates were cov-
ered with sterile aluminium foil and incubated in 5% carbon dioxide
(CO2) incubator at 37 °C. Differentiating media was changed con-
secutively for a period of 10 days. After completion, RA-induced dif-
ferentiation was evaluated under phase contrast in an inverted light
fluorescence microscope (Zeiss Axio Vert A1, Germany) equipped with
image acquisition system (AxioCam MRm, Germany). Multiple images
were captured independently at different magnification and the best
among them were presented. The differentiation was further confirmed
by flow cytometric assay where expression of neuronal synapse specific
marker (synaptotagmin-1) was detected by means of FITC-conjugated
anti rabbit secondary antibody.
2.4. Flow cytometry assay for synaptotagmin-1
To further confirm the differentiation of SH-SY5Y cells into terminal
neurons, immuno-flow cytometry was performed in accordance with
the enclosed protocol in the kit. The protocol comprised of three steps
namely fixation, permeabilization and immunostaining. In summary,
the differentiated cells were detached with trypsin-EDTA
(Ethylenediaminetetraacetic acid), collected and centrifuged at 1000xg
for 5 min. The pellets were washed, re-suspended in phosphate buffer
saline (1 x PBS) and fixed with 4% methanol free formaldehyde at room
temperature for 15 min. Ice-cold 100% methanol was added to the PBS
suspended cells and incubated for 30 min to permeabilize them.
Methanol was removed by centrifugation with excess PBS twice, the
cells were re-suspended in 100 μL diluted synaptotagmin-1 primary
antibody. The tube was incubated for 1 h at room temperature, fol-
lowed by two times washing with PBS. The pellet was re-suspended in
100 μL diluted FITC (Fluorescein Isothiocyanate)-conjugated secondary
antibody and incubated for 30 min at room temperature. The cells were
washed and re-suspended in 1 x PBS and analyzed on Dako Cytomation,
Cyan ADP Flow Cytometry (Beckman Coulter, South Kraemer
Boulevard Brea, California, U.S.A).
2. Materials and methods
2.1. Isolation, purification and bio-activation of glucomoringin (GMG)
Glucomoringin (GMG) was isolated from methanol seeds extract of
M. oleifera Lam as reported in our previous study [34]. Briefly, the
compound was obtained in an intact form (sulphated) using ion ex-
change chromatographic system and purified by gel filtration. The
isolated GMG was characterised by means of proton (1H), carbon (13C)
and two-dimensional (2D) Nuclear Magnetic Resonance (NMR) spec-
trometry. The purity of the compound was ascertained through High
Performance Liquid Chromatographic (HPLC) analysis of desulfo-deri-
vatives in line with ISO (International Standard Organisation) 91671
method approved by European Union commission regulation, EEC No
1864/90 as reported by [35]. Molecular weight of GMG was identified
using electrospray ionization (ESI) in positive mode. However, 1 mg of
2

M.S. Jaafaru, et al.
Biomedicine&Pharmacotherapy119(2019)109445
2.5. Cytotoxicity and cell viability assay
Spectrophotometer (Thermoscientific, USA). Quality of the isolated
RNA was assessed by means RNA integrity number (RIN) using
Bioanalyzer 2100 (Agilent, Santa Clara, California, USA).
Effect of GMG-ITC on cellular viability against H2O2-induced neu-
ronal oxidative damage, alongside cytotoxicity of H2O2 were assessed
using MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bro-
mide) for reduction assay in accordance with reported protocol by
Ismail et al. [36] with little modification. Starting with 10 μg/mL, the
differentiated neurons were treated with serially diluted concentration
of GMG-ITC for 24, 48 and 72 h. MTT reagent (2 mg/mL) was added to
the wells and incubated for 4 h in the dark. MTT reagent was discarded
and 200 μl DMSO (Dimethyl sulfoxide) was added to dissolve the for-
mazan, absorbance was measured immediately on ELISA (Enzyme-
linked immunosorbent assay) microplate reader (Synergy H1, BioTek,
USA) at 540 nm. Similar analysis was carried out to evaluate the cy-
totoxicity of H2O2, where 1000 μM of 30% hydrogen peroxide was se-
rial diluted. Absorbance reading was taken at 540 nm after dissolution
of formazan with DMSO and IC50 (Inhibitory concentration) of H2O2
used in the current study was calculated. Moreover, cell viability effect
of GMG-ITC on H2O2-induced cell damage was ascertained on differ-
entiated neurons pre-treated with 0.313–10 μg/mL (serially diluted) of
the compound in time-dependent manner. The cells were exposed to
another 300 μM (IC50) H2O2 for 4 h, then MTT and DMSO reagents were
also added accordingly. Absorbance reading was also taken at 540 nm,
and all the experiments in this section were conducted in triplicates.
2.7.3. Reverse transcription reaction and polymerase chain reaction
Reverse transcription reactions (RT) and polymerase chain reactions
(PCR) were performed in an XP thermal cycler (Beckman Coulter, South
Kraemer Boulevard Brea, California, U.S.A) in accordance with
GenomeLab™ GeXP start kit (Beckman Coulter, South Kraemer
Boulevard Brea, California, U.S.A). Briefly, preparation of reaction
mixture for RT was carried out by mixing 1 μL of isolated genomic RNA
sample (50 ng/μL) with master mix comprising of 1 μL KanR
(Kanamycin resistance), 2.0 μL RT reverse primers, 4 μL RT buffer (5X),
1 μL reverse transcriptase and 11 μL DNase/RNase free water. The
mixture was placed on to the thermal cycler and cDNA was synthesized
according to the following reaction conditions: 48 °C for 1 min, 42 °C for
60 min, 95 °C for 5 min and the product was hold at 4 °C after com-
pletion. Furthermore, 9.3 μL of RT product (cDNA) was introduced to
PCR master mix which constitute of 4 μL PCR buffer (5X) 4 μL MgCl,
2 μL PCR forward primer and 0.7 μL thermostat DNA polymerase (Taq
DNA polymerase enzyme). The combined volume (20 μL) of the mixture
was subjected to PCR, considering 95 °C and 10 min as amplification
condition. The reaction was completed after 1 h 56 min following 34
cycles of 94 °C for 30 s, 55 °C for 30 s, 70 °C for 1 min and hold at 4 °C
finally.
2.6. Determination of intracellular ROS generation
2.7.4. Gene expression and data analysis
Generation of intracellular ROS was evaluated by means of
OxiSelect Intracellular ROS assay kit (Cells Biolabs, San Diego, CA,
USA) according to the enclosed protocol. SH-SY5Y cells were differ-
entiated as previously described and pre-treated with 1.25 μg/mL GMG-
ITC (concentration with highest cell viability) for 72 h. The cells were
then exposed to 300 μM H2O2 (IC50) for four hours prior to harvest.
Considering H2O2 only treated cells and curcumin pre-treated plus
H2O2 insulted cells as negative and standard control groups. Cells were
harvested using trypsin-EDTA and washed with ice-cold PBS at 1000xg
for 5 min in 4 °C centrifuge. The pellets were re-suspended in ice-cold
100 μl ROS staining solution and incubated in 5% CO2 incubator at
37 °C for one hour. The ability of GMG-ITC to mitigate the production of
intracellular ROS was assessed by Dako Cytomation, Cyan ADP Flow
Cytometry (Beckman Coulter, South Kraemer Boulevard Brea,
California, U.S.A).
The reaction mixture for GeXP was prepared by adding 1 μL of PCR
product to the master mix solution containing 0.5 μL DNA standard size
and 38.5 μL sample loading solution in a 96 wells sample loading plate.
The contents were covered by a drop of mineral oil to prevent eva-
poration. After analyzing the mixture on GeXP machine using Fragment
Analysis Module of the GeXP System Software, the outcome was im-
ported and processed further on the analysis module of eXpress profiler
software (Beckman Coulter, South Kraemer Boulevard Brea, California,
U.S.A), where KanR was used for accomplishing the normalization.
2.8. Protein expression study
2.8.1. Protein extraction and quantification
The cells were differentiated, pre-treated and challenged with GMG-
ITC and H2O2 as described above. They were washed twice with ice-
cold PBS and 500 μL RIPA (Radioimmunoprecipitation assay) buffer
(Nacalai Tesque, Japan) was added to the flask and the cells were
scrapped vigorously to obtain homogenous extract of protein and
debris. The contents were transferred to Eppendorf tubes, sonicated and
incubated on ice for 30 min with vortexing at an interval of 10 min.
Supernatant was separated from the pellet and transferred to a new
tube after centrifugation at 10000xg for 10 min at 4 °C. The protein was
quantified using BCA (Bicinchoninic acid) protein quantification assay
kit (Nacalai Tesque, Japan) by mixing 25 μL protein extracts and 200 μL
combined volume of solution A and B in a ratio of 50:1 in 96 wells
plate, where serial dilution of 2 mg/mL BSA (Bovine serum albumin)
was considered for standard curve. The plate was incubated at 37 °C for
30 min and absorbance was taken at 562 nm thereafter.
2.7. Gene expression study
2.7.1. Primer design
Primers of the selected genes of interest namely Bax, Bcl2, Apaf-1,
Cyt-C, p53, CASP3, CASP8, CASP9 and the house keeping genes (GPI,
EMC7, PSMB4 and SNRPD3) were designed using Genome Lab eXpress
Profiler Software excel sheet. The design was based on human sequence
obtained in the National Centre for Biotechnology Information Gene
Bank Database (NCBI) and universal nucleotides (tag) as shown in
Table 1. While KanR was served as internal control. Quality of the
designed primers was ascertained on OligoCalc (Oligonucleotide prop-
erties calculator), an online software for complementarity checking.
The primers were synthesized by Apical Scientific (Selangor, Malaysia)
and diluted with 1 x Tris-EDTA buffer to the working concentration
(100 nm) for both forward and reverse primers. Diluted primers were
stored at −30 °C until needed as suggested by the manufacturer.
2.8.2. Human mitochondrial apoptosis protein profile array
Expression of mitochondrial apoptotic proteins was performed ac-
cording to immunoassay protocol enclosed in the human Bcl-2 family
apoptosis panel-1, 6-plex magnetic beads kit (MILLIPLEX® MAP,
Billerica, MA 01821, U.S.A). Concisely, the resulting protein lysate was
diluted in assay buffer solution in ration 1:1 in the wells, and each well
received 50 μL assay buffer. The plate was shacked for 10 min at room
temperature and the buffer was decanted. A 25 μL 1 X beads was added
to the appropriate wells and incubated overnight at 4 °C in the dark
with constant shacking. The wells were again washed twice with 100 μL
2.7.2. Extraction of ribonucleic acid (RNA)
The differentiated cells were harvested after treatment, and
genomic messenger ribonucleic acid (mRNA) was isolated using total
RNA extraction kit (Geneaid Biotech Ltd, New Taipei City, Taiwan)
according to the manufacturer’s protocol enclosed in the kit. The purity
and amount of RNA isolated were determined using Nanodrop
3

M.S. Jaafaru, et al.
Biomedicine&Pharmacotherapy119(2019)109445
Table 1
Genes and primers used for expressions in GeXP analysis. Accession numbers, genes’ names prototype and universal nucleotides for the genes of interest and those of
housekeeping genes used in the present study.
Gene name [accession no.]
Sequence of primers with universal nucleotides
Forward primers
Reverse primers
APAF1 [NM_013229.2]
BaX [NM_004322.3]
CASP8 [NM_001080125.1]
Bcl-2α [NM_000633.2]
Cyt-c [NM_018947.5]
p53 (TP53) [NM_000546.5]
CASP3 [NM_004346.3]
CASP9 [NM_001229.4]
Housekeeping genes
EMC7 [NM_020154.2]
SNRPD3 [NM_004175.4]
PSMB4 [NM_002796.2]
GPI [NM_001184722.1]
Kanr
AGGTGACACTATAGAATACAGCTCAGAGAGAGAAAGAT
AGGTGACACTATAGAATATTGTGGACTCCTTTAAGAAGGG
AGGTGACACTATAGAATAAGGGTGGTTATTGAAAGTAAA
AGGTGACACTATAGAATATCCTAATTTTTACTCCCTCTC
AGGTGACACTATAGAATACGACTAAAAAGAGAATTAAATATG
AGGTGACACTATAGAATAATGGAAACTACTTCCTGAAA
AGGTGACACTATAGAATATCCATTAAAAATTTGGAACC
AGGTGACACTATAGAATATGTTCAGGCCCCATA
GTACGACTCACTATAGGGAATCCATGATGTAGGATGTCT
GTACGACTCACTATAGGGAAGTTTCGGGATGTGGAGCG
GTACGACTCACTATAGGGATGTTCCCCAATATCATAAA
GTACGACTCACTATAGGGAATGATCCTCTGTCAAGTTTC
GTACGACTCACTATAGGGACTTAATGCCGACAAAGAT
GTACGACTCACTATAGGGAATTCTGGGAGCTTCATCT
GTACGACTCACTATAGGGACTTTAGAAACATCACGCATC
GTACGACTCACTATAGGGACTCAAGAGCACCGACA
AGGTGACACTATAGAATATCCTTAAGACAGATGGGAGT
AGGTGACACTATAGAATACGAAGAGAAGAAAAGTAGGC
AGGTGACACTATAGAATATTCTGCTACCGTGACTAAG
AGGTGACACTATAGAATATCTGCAGCCTCCAAC
ATCATCAGCATTGCATTCGATTCCTGTTTG
GTACGACTCACTATAGGGAATTCACATATCTTGCTCTCA
GTACGACTCACTATAGGGATGACAAGTTTAATACCCATCT
GTACGACTCACTATAGGGATGATTGGACCTCTGTAAAGT
GTACGACTCACTATAGGGAAGTAATCCACCAGGATATG
ATTCCGACTCGTCCAACATC
KanR was used as internal control; Bax: Bcl2 associated x protein; Bcl2: B-cell lymphoma 2; Apaf-1: apoptotic protease activating factor 1; Cyt-C: Cytochrome complex;
p53: tumour suppressor gene; CASP3: cysteine aspartic acid protease 3; CASP8: cysteine aspartic acid protease 8; CASP9: cysteine aspartic acid protease 9; EMC7:
Endoplasmic reticulum membrane protein complex subunit 7; GPI: glucose-6-phosphate isomerase; PSMB4: proteasome subunit beta type 4; SNRPD3: small nuclear
ribonucleoprotein D3.
assay buffer, followed by the addition of 25 μL 1X biotinylated detec-
Table 2
1H-NMR and 13C-NMR spectroscopic data for glucomoringin in soluble extract
tion antibody and incubated at room temperature in the dark with
of M. oleifera seeds.
gentle shaking for 1 h. The wells were again washed with 100 μL assay
buffer after removing biotinylated detection antibody. The wells were
incubated with 25 μL 1X SAPE (Streptavidin phycoerythrin) for 15 min
in the dark at room temperature. SAPE was removed and the beads
were re-suspended in 100 μL assay buffer. Median fluorescence in-
tensity (MFI) was measured on Luminex® 200™ system and the results
were further analysed using xPONENT® software.
Moieties
de Graaf et al. [37]
Isolated compound
δC
δH (J in Hz)
δC
δH (J in Hz)
Glucose moiety
1’
2’
3’
4’
5’
6’
80.9
71.9
77.0
68.8
79.7
60.2
4.57, d, (9.0)
3.17-3.30, m
3.17-3.30, m
3.17-3.30, m
3.09, m
80.4
71.9
76.9
68.9
79.7
60.2
4.57, d, (8.9)
3.17-3.36, m
3.17-3.36, m
3.17-3.36, m
3.09, m
2.9. Statistical analysis
3.50, m
3.49, m
The data are presented as means
standard deviation (SD). Where
Benzyl moiety
statistical significance of differences was determined by one-way ana-
lysis of variance (ANOVA) employing post hoc comparison on
Statistical Package for the Social Sciences (SPSS) version 22 software
(SPSS Inc, Chicago IL, USA) at p < 0.05. All the quantitative analysis
in the present study were conducted in triplicates.
1
2
3
4
5
6
7
154.4
117.4
129.3
130.4
129.3
117.4
37.2
———
154.5
117.5
129.4
130.6
129.4
117.5
37.4
—————
7.00, d, (8.7)
7.18, d, (8.7)
———
7.18, d, (8.7)
7.00, d, (8.7)
3.86, d, (17.0)
7.00, d, (8.7)
7.19, d, (8.8)
————
7.21, d, (8.8)
7.00, d, (8.7)
3.86, d, (17.0)
Others
0
3. Results
154.6
————
154.5
————
Rhamnose moiety
3.1. Characterization of isolated glucomoringin (GMG)
1’’
2’’
3’’
4’’
5’’
6’’
98.1
69.9
70.0
70.2
69.3
16.6
5.41, d, (1.7)
4.03, d, (1.7-3.5)
3.86, d, (3.5-7.0)
3.38, t, (9.7)
3.67, m
98.0
69.6
69.9
70.7
69.3
16.6
5.41, d, (1.7)
4.02, d, (1.7-3.6)
3.86, d, (3.5-7.0)
3.37, t, (9.6)
3.66, m
Following extraction and isolation of the compound under study,
1H-NMR and 13C-NMR spectra summarized in Table 2 provided the
information necessary to understand the nature of the chemical com-
ponents (the β-D-glucosyl, benzyl and α-L-rhamnosyl) that gave rise to
the structure (Figs. 1 and 2) of the isolated compound.
1.09, d, (6.3)
1.08, d, (6.2)
Where d stands for double, m for multiple and t for triple peaks respectively.
Analysis using two-dimensional NMR (2D NMR) spectroscopy
techniques namely COSYad, HSQCad and HMBCad after isolation un-
veiled the components of the isolated compound as glucosyl, benzyl and
rhamnosyl moieties. Where the outcome described further the semi-
spatial molecular arrangement in the isolated compound (proton-
carbon and proton-proton coupling), direct and indirect correlations
among the protons on the anomeric and non-anomeric carbon atoms
within the molecule. 13C-NMR spectrum also showed the connection
between benzyl molecules, sulphate group and sugar moiety through
quaternary carbon atom. Likewise, the information from HMBC spec-
trum revealed the correlation between carbon 1 of rhamnosyl and that
of benzyl ring that connect the two moieties together in the compound,
as seen in Figs. 1 and 2.
Section 2.1, showed a single compound eluted at around 9 min with an
intensity of about 700000 μγ (Fig. 1). Identification of the isolated
compound was further confirmed by liquid chromatography mass
spectrometry (LC–MS) using electron spray ionization (ESI) in positive
mode, which yield m/z 588.4111 [M+H]+ (Fig. 2). The digits corre-
spond to the mass of protonated glucomoringin reported by de Graaf
et al. [47]. Thus, the collective outcomes of the above analysis and
supporting data from literature (Table 2), enabled us unequivocally
identified the isolated compound as 4-(α-L-rhamnosyloxy) benzyl glu-
cosinolate known as glucomoringin (GMG). The isolated GMG was
further activated to GMG-ITC (Fig. 3) by myrosinase (a hydrolytic en-
zyme) to enable subsequent bioassay experiments and the reaction was
Similarly, HPLC analysis using 299 nm wavelength as described in
4

M.S. Jaafaru, et al.
Biomedicine&Pharmacotherapy119(2019)109445
Fig. 1. HPLC chromatogram of isolated glucomoringin (GMG). This indicated that GMG was isolated in high purity from the 70% methanol extract of M. oleifera Lam
seed’s sample.
confirmed using HPLC as suggested by Galuppo et al. [28].
of retinoic acid (RA)-mediated differentiation of human neuroblastoma
(SH-SY5Y) cell lines, by means of immuno-flow cytometry. The result
showed that about 82% of the cells were fully differentiated into ma-
tured neuron (Fig. 4a and b) by expressing neurons’ and synapse’s
specific markers after undergoing differentiation process for 7 days
consecutively, which became much better (85%) at 10 days (Fig. 4c and
d). Meanwhile, green colour histograms and bar chart portion (green)
indicated the cells population that expressed synaptotagmin-1 protein
after 7 days and 10 days. Whereas, the non-specific protein expression
was presented in red. Confirming that the cells used in the present study
were terminally differentiated neurons.
The phase contrast differentiation result and cytotoxicity for both
GMG-ITC and hydrogen peroxide (H2O2) were reported in our previous
publication [33], in which dendrites extensions in retinoic acid (RA)-
induced differentiated SH-SY5Y cells were observed on fluorescence
microscopy. Being a prerequisite to all the experiments in the present
study, the authors further reported the confirmation of differentiation
process by determining the expression of post mitotic neuron specific
marker known as class III β-tubulin or Tuj-1. GMG-ITC was found to be
nontoxic to the differentiated cells even at high concentration (10 μg/
mL). Meanwhile, 300 μM H2O2 reduced the population of viable cells to
50%, thus the IC50 for generating neurodegenerative disease model.
Neuroprotection ability of GMG-ITC was derived from 1.25 μg/mL after
72 h of pre-treatment prior to hydrogen peroxide (H2O2) insult as de-
monstrated in our previous report [33].
3.3. GMG-ITC mitigated reactive oxygen species generation
We evaluated the mitigating effect of glucomoringin-isothicyanate
(GMG-ITC) on intracellular ROS production, where percentage of ROS
producing cells in normal control (untreated differentiated neuron
cells) group (Fig. 5a) was found to be relatively lower compared to that
of H2O2 (Fig. 5b) and myrosinase + 300 μM H2O2 (Fig. 5c) control
groups. However, pre-treatment of the cells with GMG-ITC for 72 h
(Fig. 5d) prevented ROS generation remarkably upon exposure to
3.2. Expression of synaptotagmin-1 as evidence of differentiated neuronal
cells
In addition to Tuj-1 as reported in our previous finding, the neuron
expression level of synaptotagmin-1 was examined after 7 and 10 days
Fig. 2. LC–MS ESI (positive mode) spectrogram of isolated glucomoringin (GMG). The analysis confirmed the isolation of GMG in high purity by revealing its
molecular weight (588.4111 m/z) in positive mode, together with few fragments of the compound.
5

M.S. Jaafaru, et al.
Biomedicine&Pharmacotherapy119(2019)109445
Fig. 3. Myrosinase catalysed hydrolysis of GMG to GMG-ITC. 4-(α-L-rhamnosyloxy) benzyl glucosinolate known as glucomoringin is hydrolysed to 4-(α-L-rham-
nosyloxy) benzyl isothiocyanate or glucomoringin isothiocyanate by myrosinase in phosphate buffered solution (PBS) at pH 7.2.
Fig. 4. Flow cytometric result of
neuron-specific protein expression.
Synaptotagmin-1 expression (green) of
7 (a, b) and 10 (c, d) days of RA-
mediated differentiated SH-SY5Y cells,
whereas, red histogram and Bar charts
in the figures represent nonspecific ex-
pression of markers in the control cells.
[Error bars stands for standard devia-
tion, means with different letter dif-
fered from one another significantly at
p < 0.05 and n = 3], where n stands
for number of replicated experiments.
(For interpretation of the references to
colour in this figure legend, the reader
is referred to the web version of this
article).
oxidative stress condition induced by H2O2, where, majority of the
GMG-ITC pre-treated cells prior to H2O2 exposure survived the harmful
effect of such condition. Similar trend of effect was noted in curcumin
pre-treated cells (Fig. 5e) prior to H2O2 exposure. Even though there
was no much difference in the two groups (GMG-ITC and curcumin pre-
treated cells), ROS generation was significantly attenuated in GMG-ITC
(p < 0.05) and curcumin (p < 0.05) pre-treated cells compared to
H2O2 control groups (Fig. 5g). Although lower than those of H2O2 and
myrosinase + 300 μM H2O2 (control) treated cells, ROS generation
increased significantly in GMG-ITC (p < 0.05) and curcumin
(p < 0.05) only treated cells after 72 h. Demonstrating that the miti-
gating phenomenon is ascribed to the presence of GMG-ITC, which was
confirmed by curcumin pre-treatment.
negatively. Pre-treatment of the differentiated SH-SY5Y cells with
GMG-ITC for 72 h could be the driving force for increase in mRNA
concentration observed in GMG-ITC + HPO group. The quality of the
isolated RNA was indicated by the high RIN (> 9) (supplemented data).
3.5. GMG-ITC influence gene expression in mitochondrial signaling
pathway
Pre-treatment of differentiated neurons with 1.25 μg/mL GMG-ITC
for 72 h prior to 4 h insult of H2O2 caused significant (p < 0.05) de-
crease in the expression level of cyt-c, p53, Apaf-1, Bax, CASP3, CASP8
and CASP9 genes compared to H2O2 control cells (Fig. 6A–G). Mean-
while, the mRNA level of Bcl2 increased significantly (p < 0.05) in the
GMG-ITC pre-treated cells compared to that of H2O2 control cells
(Fig. 6H). Similar trend of effect was observed in the cells pre-treated
with curcumin as positive control before exposing to H2O2 for 4 h.
However, pre-treatment with myrosinase (the enzyme responsible for
activation of GMG to GMG-ITC) and challenged with H2O2 showed no
significant effect (p > 0.05) on the cells with respect to expression
level of all the expressed genes, thus mimicked H2O2 control cells.
GMG-ITC and curcumin control cells were used to support the argument
regarding elevation of the pro-apoptotic gene’s expression due to H2O2-
3.4. Quality, quantity and purity of isolated mRNA for gene expression
The concentration, purity and quality of mRNA isolated from dif-
ferentiated SH-SY5Y cells are presented in the supplementary data. The
mRNA isolated were pure and of high quality as determined by the ratio
of optical density at 260 and 280 nm and by RNA integrity number
(RIN) respectively. Four Hours’ challenge with hydrogen peroxide did
not affect the concentration and integrity of the total RNA isolated
6

M.S. Jaafaru, et al.
Biomedicine&Pharmacotherapy119(2019)109445
Fig. 5. Flow cytometrical determination of re-
active oxygen species production by differ-
entiated SH-SY5Y cells. The ROS production was
before and after treatment, where (a): untreated
cells (normal control); (b): and (c): 4 h H2O2 treated
cells and myrosinase pre-treated plus 4 h H2O2
treatment cells; (d): GMG-ITC pre-treated for 72 h
plus 4 h H2O2 challenge; (e): curcumin pre-treated
for 72 h followed by 4 h assault by H2O2 (positive
control) cells; (f): GMG-ITC treated for 72 h; whereas
g represent quantitative part of the data. Error bars
stand for standard deviation, means with different
letter differed from one another significantly at
p < 0.05, n = 3, where n stands for number of re-
plicated experiments.
induced oxidative damage in all respects. Thus, the suppression in ex-
pression of pro-apoptotic genes and increase level of anti-apoptotic
gene expression in the intrinsic mitochondrial pathway of the present
study may be attributed to the presence of GMG-ITC as an anti-
apoptotic agent.
7

M.S. Jaafaru, et al.
Biomedicine&Pharmacotherapy119(2019)109445
Fig. 6. Modulation of gene expression in mitochondrial signalling pathway by GMG-ITC. The cells were grouped accordingly prior to treatment as follows: normal
control is a group of untreated cells; H2O2 control: cells treated with 300 μM hydrogen peroxide only for 4 h; MYR control: myrosinase (enzyme) pre-treated (72 h)
and HPO exposed cells; GMG-ITC + H2O2: cells pre-treated with GMG-ITC (72 h) plus 4 h exposure to H2O2; curcumin + H2O2: cells pre-treated with curcumin (72 h)
plus 4 h exposure to H2O2; GMG-ITC only: and curcumin only: cells treated with only GMG-ITC and curcumin for 72 h each. The result was expressed as relative
expression of mRNA normalized against SNRPD3 (housekeeping gene) and means of each cluster labelled with different letters varied significantly (p < 0.05, n = 3)
with one another.
3.6. GMG-ITC influenced the expression of mitochondrial apoptotic proteins
which include Bcl-2, Apaf-1, Bax, cyt-c, p53, Casp-8 and Casp-9. The
expression of pro-apoptotic proteins (cyt-c, p53, Apaf-1, Bax, CASP8
and CASP9) after 72 h of GMG-ITC pre-treatment and 4 h H2O2 ex-
posure was significantly (p < 0.05) hindered when compared to their
expressions in H2O2 control cells (Fig. 7A–F). Similar trend of event was
observed in the cells treated with GMG-ITC only. Fold change of Bcl-2
expression was significantly (p < 0.05) higher in GMG-ITC pre-treated
cells for 72 h prior to 4 h insult by H2O2 compared to that of H2O2 and
Bcl-2 family protein multiplex analysis revealed that pre-treatment
of differentiated neuron cells with GMG-ITC before their exposure to
oxidative stress condition prevented upregulation of pro-apoptotic
proteins in the cells. The observable effects of GMG-ITC treatment of
the differentiated neuronal cells were noticed on the proteins involved
actively in mitochondrial apoptotic particularly intrinsic pathway
8

M.S. Jaafaru, et al.
Biomedicine&Pharmacotherapy119(2019)109445
Fig. 7. Modulation of protein expression in mitochondrial signalling pathway by GMG-ITC. Proteins were analysed using MILLIPLEX®MAP Human Bcl-2 Family
Apoptosis Panel 1, 6-plex Magnetic Beads Kit. the cells were grouped accordingly prior to the analysis as follows: normal control was a group of untreated cells; H2O2
control: cells treated with 300 μM hydrogen peroxide only for 4 h; Myrosinase control: myrosinase (enzyme) pre-treated and 4 h hydrogen peroxide exposure; GMG-
ITC + H2O2: cells pre-treated with GMG-ITC for 24, 48 and 72 h followed by 4 h exposure to hydrogen peroxide; GMG-ITC only: cells treated with only GMG-ITC for
72 h. The result was expressed as fold change in protein expression normalized against normal control group and different letters on similar means in each cluster
varies significantly (p < 0.05, n = 3) with one another and vice versa, where n stands for the number of replicated experiments.
9

M.S. Jaafaru, et al.
Biomedicine&Pharmacotherapy119(2019)109445
myrosinase control cells (Fig. 7G). The effect of GMG-ITC pre-treatment
for 24 and 48 h on the expression level of all the proteins were not
remarkable, compared to that of 72 h. Hence, the longer the GMG-ITC
pre-treatment time, the higher the efficacy of the compound.
sulforaphane and erucin demonstrated strong neuroprotection ability
[52,53], none of the compounds seemed to affect mitochondrial de-
pendent intrinsic pathway proteins’ expression [54]. Expression level of
Bcl-2 protein significantly increased following pre-treatment of term-
inally differentiated SH-SY5Y cells with GMG-ITC prior to H2O2 insult.
This event is in line with what was reported by Zhu et al. [55], where
exposure of primary rat cortical neurons to synthetic opioid peptide
upregulated the expression of Bcl-2 proteins thereby providing pro-
tection to the neurons in question. These finding suggested a new po-
tential pathway for GMG-ITC in attenuating the impact of oxidative
damage in neurodegenerative disease development. However, we re-
commend that protein inhibition study should be conducted in the fu-
ture work to investigate the relationship between upstream and
downstream of mitochondrial apoptotic-related genes and proteins to
strengthen the claim.
4. Discussion
Dysfunction of mitochondria is a noticeable feature in many neu-
rodegenerative disorders associated with abnormal generation of re-
active oxygen species (ROS) [15,38,39]. This phenomenon has been
described in several in vitro and in vivo models of neurodegenerative
diseases [11,12,15], where the established condition of imbalance be-
tween ROS generation and their chelation in the cells causes cascade of
signaling reactions via multiple pathways that lead to apoptotic cell
death [11,40]. Oxidative stress condition as a consequential cumulative
ROS production, stimulates the internalization of Bax protein in to
mitochondria with eventual increment in mitochondrial permeability
that show cytochrome c (cyt-c) move in to cytoplasm [41–43]. The
released cyt-c triggers a series of reactions involving cysteine proteases
(caspases) resulting in cellular damage with eventual death [44].
The like of this phenomenon was observed in the present study,
where oxidative stress condition induced by H2O2 perhaps stimulated
translocation of Bax into mitochondria, enhancing the release of cyt-c
to cytosol, which in turn, initiated the formation of death complex
(apoptosome). The alteration in mitochondrial permeability with re-
spect to cyt-c release implies the activation of mitochondrial intrinsic
apoptotic pathway that leads to neuronal cell death [45]. These find-
ings are found similar with many other reports on the involvement of
mitochondria in oxidative stress-induced neuronal cell death [46–48].
However, the oxidative effect was mitigated in the presence of GMG-
ITC prior to induction. Although, the differentiated cells were incubated
with 20 μL of myrosinase as control and 2.2 μg/mL curcumin as stan-
dard for 72 h prior to their exposure to H2O2 as reported in our previous
publication [33], the present findings revealed that GMG-ITC attributed
to the observable protection of terminally differentiated neuronal cells
against H2O2-iduced apoptotic death by suppressing the effect of the
key markers of mitochondrial intrinsic apoptotic pathway.
Cumulative number of studies on neurodegenerative disorders re-
ported the neuroprotective effect of glucomoringin isothiocyanate in
vivo and in vitro [30,31]. Nrf2/ARE is the widely studied pathway for
neuroprotection activity of many natural compounds, for its key role in
reducing inflammatory response, oxidative stress and cumulative toxic
metabolites [12,49–55]. [52] demonstrated the ability of GMG-ITC to
reduce ROS generation in an oxidative stress condition to the minimum
level, through its antioxidant properties. This was also observed in the
present studies (Fig. 5). The results indicated that GMG-ITC could incite
the cells to initiate production of natural antioxidants at limited level
even without H2O2 insult. Suggesting that, its present in the cells ab-
rogates the harmful effect of toxic oxidants, thereby increasing the life
span of its host cells.
5. Conclusions
Conclusively, as the search for potential molecular signaling path-
ways to arrest the development of neurodegenerative diseases and en-
hance the quality of life intensified, the findings in the present studies
revealed the prospective role of mitochondrial apoptotic pathway in
mediating neuroprotective ability of GMG-ITC in diminishing cyto-
toxicity of H2O2-induced oxidative stress in differentiated SH-SY5Y
cells. This is achieved by facilitating the regulation of expression of
mRNA and key proteins influencing mitochondrial intrinsic apoptotic
pathway. The effect was believed to slow down the expression and
translocation of cytosolic Bax protein into mitochondrial matrix thereby
mitigating the apoptotic processes triggered by the release of mi-
tochondrial cyt-c from inner mitochondrial membrane. This and other
findings reported in our previous studies indicated that pre-treatment of
differentiated neuronal cells with GMG-ITC may potentially decrease
the expression of apoptotic markers involved in the mitochondrial
apoptotic pathway which could be a promising therapeutic approach
for attenuation of apoptosis resulting from oxidative stress damage.
This is the first study that discovered and reported the prospective in-
fluence of GMG-ITC on the expression of markers involved in neuronal
degeneration due to oxidative stress-induce mitochondrial damage,
which could have great impact in drug discovery and development
processes.
Author contributions
MSJ, NN, KS, RR and AFAR: conceived and designed the experi-
ments; MSJ, NN, and AFAR: performed the experiments and analyzed
the data; MSJ, HYB, NN, NMN and AFAR: drafted and proofread the
paper; all authors read and approved the final manuscript.
Funding
However, little is delineated about the implication of other path-
ways rather than Nrf2/ARE for neuroprotective activity of GMG-ITC. To
establish the evidence of mitochondrial-dependent apoptotic signalling
pathway in GMG-ITC mediated neuroprotection in an in vitro model of
neurodegenerative diseases (NDDs), we studied the expression level of
mRNA of genes and translational level of proteins influencing apoptosis
via mitochondrial intrinsic pathway. We found out that, pre-treatment
of differentiated SH-SY5Y cells with GMG-ITC downregulated the ex-
pression of mRNA for all the mitochondrial-dependent apoptotic genes
involved in this study except for Bcl-2.
This work was funded by Universiti Putra Malaysia through GP-IPS
(Vot no. 9537300) and GP (Vot no. 9628600).
Declaration of Competing Interest
The authors declared that there is no conflict of interest
Acknowledgments
Moreover, the effect reflected on translational level of mitochon-
Our sincere appreciation goes to Universiti Putra Malaysia, the
funder of this research through GP-IPS and to MitoMasa Sdn. Bhd.,
Malaysia, for the provision of Moringa oleifera seeds sample used in this
study. We thank Dr. Leon Sze Wei for his guide in the isolation part of
this study. We also appreciate the effort and support from Dr. Ooi Der
Jiun and Dr. Norsharina Ismail throughout the study period.
drial apoptotic proteins in
a similar trend with that of mRNA.
Suggesting that, the action of the compound interfered with mi-
tochondrial membrane stability and protection of its structural integrity
via unknown approaches that worth further investigation. Although
some glucosinolates derivatives such as allyl-isothiocyanate,
10

M.S. Jaafaru, et al.
Biomedicine&Pharmacotherapy119(2019)109445
Appendix A. Supplementary data
M. Mustapha Barau, L. Kong, A. Abdull Razis, Nontoxic Glucomoringin-
Isothiocyanate (GMG-ITC) rich soluble extract induces apoptosis and inhibits pro-
liferation of human prostate Adenocarcinoma Cells (PC-3), Nutrients 10 (9) (2018)
1174, https://doi.org/10.3390/nu10091174.
Supplementary material related to this article can be found, in the
online version, at doi:https://doi.org/10.1016/j.biopha.2019.109445.
[22] P.M. Waziri, R. Abdullah, R. Rosli, A.R. Omar, A.B. Abdul, N.K. Kassim, I. Malami,
I.C. Etti, J.A.M. Sani, M.A.M. Lila, J.F.F. Abdullah, Clausenidin induces caspase 8-
dependent apoptosis and suppresses production of VEGF in liver cancer cells, Asian
Pac. J. Cancer Prev.: APJCP 19 (4) (2018) 917, https://doi.org/10.22034/APJCP.
2018.19.4.917.
References
[23] M. Jaafaru, N. Abd Karim, M. Enas, P. Rollin, E. Mazzon, A. Abdull Razis, Protective
effect of glucosinolates hydrolytic products in neurodegenerative diseases (NDDs),
Nutrients 10 (5) (2018) 580, https://doi.org/10.3390/nu10050580.
[24] N.A.A. Karim, M.D. Ibrahim, S.B. Kntayya, Y. Rukayadi, H.A. Hamid, A.F.A. Razis,
Moringa oleifera Lam: targeting chemoprevention, Asian Pac. J. Cancer Prev. 17
(2016) 3675–3686.
[25] T.S. Rajan, S. Giacoppo, R. Iori, G.R. De Nicola, G. Grassi, F. Pollastro, P. Bramanti,
E. Mazzon, Anti-inflammatory and antioxidant effects of a combination of canna-
bidiol and moringin in LPS-stimulated macrophages, Fitoterapia 112 (2016)
104–115, https://doi.org/10.1016/j.fitote.2016.05.008.
[1] M.H. Baig, K. Ahmad, M. Saeed, A.M. Alharbi, G.E. Barreto, G.M. Ashraf, I. Choi,
Peptide based therapeutics and their use for the treatment of neurodegenerative and
other diseases, Biomed. Pharmacother. 103 (2018) 574–581, https://doi.org/10.
1016/j.biopha.2018.04.025.
[2] B. Eftekharzadeh, B.T. Hyman, S. Wegmann, Structural studies on the mechanism of
protein aggregation in age related neurodegenerative diseases, Mech. Ageing Dev.
156 (2016) 1–13, https://doi.org/10.1016/j.mad.2016.03.001.
[3] A.H. Morgan, D.J. Rees, Z.B. Andrews, J.S. Davies, Ghrelin mediated neuropro-
tection-a possible therapy for Parkinson’s disease? Neuropharmacology 136 (2018)
317–326, https://doi.org/10.1016/j.neuropharm.2017.12.027.
[26] M. Galuppo, S. Giacoppo, G.R. De Nicola, R. Iori, M. Navarra, G.E. Lombardo,
P. Bramanti, E. Mazzon, Antiinflammatory activity of glucomoringin isothiocyanate
in a mouse model of experimental autoimmune encephalomyelitis, Fitoterapia 95
(2014) 160–174, https://doi.org/10.1016/j.fitote.2014.03.018.
[27] A.A.R. Mohamed, M.M. Metwally, S.R. Khalil, G.A. Salem, H.A. Ali, Moringa olei-
fera extract attenuates the CoCl2 induced hypoxia of rat’s brain: Expression pattern
of HIF-1α, NF-kB, MAO and EPO, Biomed. Pharmacother. 109 (2019) 1688–1697,
https://doi.org/10.1016/j.biopha.2018.11.019.
[28] M. Galuppo, G. Nicola, R. Iori, P. Dell’Utri, P. Bramanti, E. Mazzon, Antibacterial
activity of glucomoringin bioactivated with myrosinase against two important pa-
thogens affecting the health of long-term patients in hospitals, Molecules 18 (11)
(2013) 14340–14348, https://doi.org/10.3390/molecules181114340.
[29] C. Tiloke, K. Anand, R.M. Gengan, A.A. Chuturgoon, Moringa oleifera and their
phytonanoparticles: Potential antiproliferative agents against cancer, Biomed.
Pharmacother. 108 (2018) 457–466, https://doi.org/10.1016/j.biopha.2018.09.
060.
[30] S. Giacoppo, M. Galuppo, G.R. De Nicola, R. Iori, P. Bramanti, E. Mazzon, 4 (α-l-
Rhamnosyloxy)-benzyl isothiocyanate, a bioactive phytochemical that attenuates
secondary damage in an experimental model of spinal cord injury, Bioorg. Med.
Chem. 23 (1) (2015) 80–88, https://doi.org/10.1016/j.bmc.2014.11.022.
[31] M. Galuppo, S. Giacoppo, R. Iori, G.R. De Nicola, D. Milardi, P. Bramanti,
E. Mazzon, 4 (α-L-rhamnosyloxy)-benzyl isothiocyanate, a bioactive phytochemical
that defends cerebral tissue and prevents severe damage induced by focal ischemia/
reperfusion, J. Biol. Regul. Homeost. Agents 29 (2015) 343–356.
[32] M. Galuppo, S. Giacoppo, R. Iori, G.R. De Nicola, P. Bramanti, E. Mazzon,
Administration of 4-(α-L-rhamnosyloxy)-benzyl isothiocyanate delays disease phe-
notype in SOD1G93A rats: A transgenic model of amyotrophic lateral sclerosis,
Biomed Res. Int. 2015 (2015), https://doi.org/10.1155/2015/259417.
[33] M.S. Jaafaru, N. Nordin, K. Shaari, R. Rosli, A.F.A. Razis, Isothiocyanate from
Moringa oleifera seeds mitigates hydrogen peroxide-induced cytotoxicity and pre-
served morphological features of human neuronal cells, PLoS One 13 (5) (2018)
e0196403, https://doi.org/10.1371/journal.pone.0196403.
[34] R. Abdull, F. Ahmad, M.D. Ibrahim, S.B. Kntayya, Health benefits of Moringa
oleifera, Asian Pacific J. Cancer Prev. 15 (20) (2014) 8571–8576, https://doi.org/
10.7314/APJCP.2014.15.20.8571.
[35] C. Nastruzzi, R. Cortesi, E. Esposito, E. Menegatti, O. Leoni, R. Iori, S. Palmieri, In
vitro antiproliferative activity of isothiocyanates and nitriles generated by myr-
osinase-mediated hydrolysis of glucosinolates from seeds of cruciferous vegetables,
J. Agric. Food Chem. 48 (8) (2000) 3572–3575, https://doi.org/10.1021/
jf000191p.
[36] N. Ismail, M. Ismail, M.U. Imam, N.H. Azmi, S.F. Fathy, J.B. Foo, M.F.A. Bakar,
Mechanistic basis for protection of differentiated SH-SY5Y cells by oryzanol-rich
fraction against hydrogen peroxide-induced neurotoxicity, BMC Complement.
Altern. Med. 14 (1) (2014) 467, https://doi.org/10.1186/1472-6882-14-467.
[37] R.M. De Graaf, S. Krosse, A.E. Swolfs, E. Te Brinke, N. Prill, R. Leimu, P.M. Van
Galen, Y. Wang, M.G. Aarts, N.M. Van Dam, Isolation and identification of 4-α-
rhamnosyloxy benzyl glucosinolate in Noccaea caerulescens showing intraspecific
variation, Phytochemistry 110 (2015) 166–171, https://doi.org/10.1016/j.
phytochem.2014.11.016.
[38] W.B. Zhu, F.J. Tian, L.Q. Liu, Chikusetsu (CHI) triggers mitochondria-regulated
apoptosis in human prostate cancer via reactive oxygen species (ROS) production,
Biomed. Pharmacother. 90 (2017) 446–454, https://doi.org/10.1016/j.biopha.
2017.03.050.
[39] R. Moniruzzaman, M.U. Rehman, Q.L. Zhao, P. Jawaid, Y. Mitsuhashi, S. Imaue,
K. Fujiwara, R. Ogawa, K. Tomihara, J.I. Saitoh, K. Noguchi, Roles of intracellular
and extracellular ROS formation in apoptosis induced by cold atmospheric helium
plasma and X-irradiation in the presence of sulfasalazine, Free Radic. Biol. Med. 129
(2018) 537–547, https://doi.org/10.1016/j.freeradbiomed.2018.10.434.
[40] C.Y. Lee, C.H. Su, P.K. Tsai, M.L. Yang, Y.C. Ho, S.S. Lee, C.H. Chen, W.Y. Chen,
M.L. Lin, C.J. Chen, C.Y. Chian, Cadmium nitrate-induced neuronal apoptosis is
protected by N-acetyl-l-cysteine via reducing reactive oxygen species generation
and mitochondria dysfunction, Biomed. Pharmacother. 108 (2018) 448–456,
https://doi.org/10.1016/j.biopha.2018.09.054.
[4] M. Bourdenx, S. Dovero, M. Engeln, S. Bido, M.F. Bastide, N. Dutheil,
I. Vollenweider, L. Baud, C. Piron, V. Grouthier, T. Boraud, Lack of additive role of
ageing in nigrostriatal neurodegeneration triggered by α-synuclein overexpression,
Acta Neuropathol. Commun. 3 (1) (2015) 46, https://doi.org/10.1186/s40478-
015-0222-2.
[5] K. Georgiadis, S. Wray, S. Ourselin, J.D. Warren, M. Modat, Computational mod-
elling of pathogenic protein spread in neurodegenerative diseases, PLoS One 13 (2)
(2018) e0192518, https://doi.org/10.1371/journal.pone.0192518.
[6] K.X. Wen, J. Miliç, B. El-Khodor, K. Dhana, J. Nano, T. Pulido, B. Kraja, A. Zaciragic,
W.M. Bramer, J. Troup, R. Chowdhury, The role of DNA methylation and histone
modifications in neurodegenerative diseases: a systematic review, PLoS One 11 (12)
(2016) e0167201, https://doi.org/10.1371/journal.pone.0167201.
[7] T.H. Gillingwater, T.M. Wishart, Mechanisms underlying synaptic vulnerability and
degeneration in neurodegenerative disease, Neuropathol. Appl. Neurobiol. 39 (4)
(2013) 320–334, https://doi.org/10.1111/nan.12014.
[8] S. Campello, F. Strappazzon, F. Cecconi, Mitochondrial dismissal in mammals, from
protein degradation to mitophagy, Biochimica et Biophysica Acta (BBA)-
Bioenergetics 1837 (4) (2014) 451–460, https://doi.org/10.1016/j.bbabio.2013.
11.010.
[9] C. McKinnon, S.J. Tabrizi, The ubiquitin-proteasome system in neurodegeneration,
Antioxid. Redox Signal. 21 (17) (2014) 2302–2321, https://doi.org/10.1089/ars.
2013.5802 Epub 2014 Feb 27.
[10] P. Singh, P.S. Hanson, C.M. Morris, SIRT1 ameliorates oxidative stress induced
neural cell death and is down-regulated in Parkinson’s disease, BMC Neurosci. 18
(1) (2017) 46, https://doi.org/10.1186/s12868-017-0364-1.
[11] N.H. Abdallah, A. Baulies, A. Bouhlel, M. Bejaoui, M.A. Zaouali, S.B. Mimouna,
I. Messaoudi, J.C. Fernandez-Checa, C.G. Ruiz, H.B. Abdennebi, The effect of zinc
acexamate on oxidative stress, inflammation and mitochondria induced apoptosis in
rat model of renal warm ischemia, Biomed. Pharmacother. 105 (2018) 573–581,
https://doi.org/10.1016/j.biopha.2018.06.017.
[12] S. Jung, M. Choi, K. Choi, E.B. Kwon, M. Kang, D.E. Kim, H. Jeong, J. Kim, J.H. Kim,
M.O. Kim, S.B. Han, Inactivation of human DGAT2 by oxidative stress on cysteine
residues, PLoS One 12 (7) (2017) e0181076, https://doi.org/10.1371/journal.
pone.0181076.
[13] J. Morud, J. Strandberg, A. Andrén, M. Ericson, B. Söderpalm, L. Adermark,
Progressive modulation of accumbal neurotransmission and anxiety-like behavior
following protracted nicotine withdrawal, Neuropharmacology 128 (2018) 86–95,
https://doi.org/10.1016/j.neuropharm.2017.10.002.
[14] G. Gao, Z. Wang, L. Lu, C. Duan, X. Wang, H. Yang, Morphological analysis of
mitochondria for evaluating the toxicity of α-synuclein in transgenic mice and
isolated preparations by atomic force microscopy, Biomed. Pharmacother. 96
(2017) 1380–1388, https://doi.org/10.1016/j.biopha.2017.11.057.
[15] A.R. Jones IV, T. Meshulam, M.F. Oliveira, N. Burritt, B.E. Corkey, Extracellular
redox regulation of intracellular reactive oxygen generation, mitochondrial func-
tion and lipid turnover in cultured human adipocytes, PLoS One 11 (10) (2016)
e0164011, https://doi.org/10.1371/journal.pone.0164011.
[16] M. Pokusa, A. Kráľová Trančíková, The central role of biometals maintains oxida-
tive balance in the context of metabolic and neurodegenerative disorders, Oxid.
Med. Cell. Longev. 2017 (2017), https://doi.org/10.1155/2017/8210734.
[17] W.X. Yu, C.Q. Lin, Q. Zhao, X.J. Lin, X.L. Dong, Neuroprotection against hydrogen
peroxide-induced toxicity by Dictyophora echinovolvata polysaccharide via in-
hibiting the mitochondria-dependent apoptotic pathway, Biomed. Pharmacother.
88 (2017) 569–573, https://doi.org/10.1016/j.biopha.2017.01.103.
[18] A.H. Bhat, K.B. Dar, S. Anees, M.A. Zargar, A. Masood, M.A. Sofi, S.A. Ganie,
Oxidative stress, mitochondrial dysfunction and neurodegenerative diseases; a
mechanistic insight, Biomed. Pharmacother. 74 (2015) 101–110, https://doi.org/
10.1016/j.biopha.2015.07.025.
[19] A.F.A. Razis, M. Bagatta, G.R. De Nicola, R. Iori, C. Ioannides, Induction of epoxide
hydrolase and glucuronosyl transferase by isothiocyanates and intact glucosinolates
in precision-cut rat liver slices: importance of side-chain substituent and chirality,
Arch. Toxicol. 85 (8) (2011) 919–927, https://doi.org/10.1007/s00204-010-
0629-2.
[20] M.S. Jaafaru, I.D. Kyomson, P.M. Waziri, Y. Yakubu, M.B. Mustapha, J.S. Gyutorwa,
In vivo ameliorative effect of methanolic extract of Boswellia dalzielli Hutch
(Mebdh) stem bark on Triton X-100 induced hyperlipidaemia, Sci. World J. 12 (4)
(2017) 34–37.
[41] E. Zamani, F. Shaki, S. AbedianKenari, M. Shokrzadeh, Acrylamide induces im-
munotoxicity through reactive oxygen species production and caspase-dependent
apoptosis in mice splenocytes via the mitochondria-dependent signaling pathways,
Biomed. Pharmacother. 94 (2017) 523–530, https://doi.org/10.1016/j.biopha.
[21] M. Jaafaru, N. Abd Karim, E. Mohamed Eliaser, P. Maitalata Waziri, H. Ahmed,
11

M.S. Jaafaru, et al.
Biomedicine&Pharmacotherapy119(2019)109445
2017.07.033.
(2018) 522–534, https://doi.org/10.1016/j.redox.2017.10.010.
[42] M. Seervi, A. Rani, A.K. Sharma, T.S. Kumar, ROS mediated ER stress induces Bax-
Bak dependent and independent apoptosis in response to Thioridazine, Biomed.
Pharmacother. 106 (2018) 200–209, https://doi.org/10.1016/j.biopha.2018.06.
123.
[43] D. Liu, J.L. Perfettini, C. Brenner, Mitochondrial regulation of cell death,
Mitochondrial Biology and Experimental Therapeutics, Springer, Cham, 2018, pp.
75–90.
[44] R.A.S.G. Don, M.K.K. Yap, Arctium lappa L. root extract induces cell death via
mitochondrial-mediated caspase-dependent apoptosis in Jurkat human leukemic T
cells, Biomed. Pharmacother. 110 (2019) 918–929, https://doi.org/10.1016/j.
biopha.2018.12.023.
[45] Z. Li, M. Sheng, Caspases in synaptic plasticity, Mol. Brain 5 (1) (2012) 15, https://
doi.org/10.1186/1756-6606-5-15.
[50] D.H. Kwon, H.J. Cha, H. Lee, S.H. Hong, C. Park, S.H. Park, G.Y. Kim, S. Kim,
H.S. Kim, H.J. Hwang, Y.H. Choi, Protective effect of Glutathione against Oxidative
Stress-induced Cytotoxicity in RAW 264.7 Macrophages through activating the
nuclear factor Erythroid 2-related factor-2/Heme Oxygenase-1 pathway,
Antioxidants 8 (4) (2019) 82, https://doi.org/10.3390/antiox8040082.
[51] M.E. Rubio-Ruiz, V. Guarner-Lans, A. Cano-Martínez, E. Díaz-Díaz, L. Manzano-
Pech, A. Gamas-Magaña, V. Castrejón-Tellez, C. Tapia-Cortina, I. Pérez-Torres,
Resveratrol and quercetin administration improves antioxidant DEFENSES and re-
duces fatty liver in metabolic syndrome rats, Molecules 24 (7) (2019) 1297, https://
doi.org/10.3390/molecules24071297.
[52] S. Giacoppo, T.S. Rajan, G.R. De Nicola, R. Iori, P. Rollin, P. Bramanti, E. Mazzon,
The Isothiocyanate isolated from Moringa Oleifera shows potent anti-inflammatory
activity in the treatment of murine subacute Parkinson’s disease, Rejuvenation Res.
20 (1) (2017) 50–63, https://doi.org/10.1089/rej.2016.1828.
[53] L. Subedi, R. Venkatesan, S. Kim, Neuroprotective and anti-inflammatory activities
of allyl isothiocyanate through attenuation of JNK/NF-κB/TNF-α signaling, Int. J.
Mol. Sci. 18 (7) (2017) 1423, https://doi.org/10.3390/ijms18071423.
[54] F. Morroni, G. Sita, A. Djemil, M. D’Amico, L. Pruccoli, G. Cantelli-Forti, P. Hrelia,
A. Tarozzi, Comparison of adaptive neuroprotective mechanisms of sulforaphane
and its interconversion product erucin in in vitro and in vivo models of Parkinson’s
disease, J. Agric. Food Chem. 66 (4) (2018) 856–865, https://doi.org/10.1021/acs.
jafc.7b04641.
[46] L. Prenek, F. Boldizsár, R. Kugyelka, E. Ugor, G. Berta, P. Németh, T. Berki, The
regulation of the mitochondrial apoptotic pathway by glucocorticoid receptor in
collaboration with Bcl-2 family proteins in developing T cells, Apoptosis 22 (2)
(2017) 239–253, https://doi.org/10.1007/s10495-016-1320-8.
[47] R. Khanam, R. Kumar, I.I. Hejazi, S. Shahabuddin, R. Meena, V. Jayant, P. Kumar,
A.R. Bhat, F. Athar, Piperazine clubbed with 2-azetidinone derivatives suppresses
proliferation, migration and induces apoptosis in human cervical cancer HeLa cells
through oxidative stress mediated intrinsic mitochondrial pathway, Apoptosis 23
(2) (2018) 113–131, https://doi.org/10.1007/s10495-018-1439-x.
[48] M. Jewett, I. Jimenez-Ferrer, M. Swanberg, Astrocytic expression of GSTA4 is as-
sociated to dopaminergic neuroprotection in a rat 6-OHDA model of Parkinson’s
disease, Brain Sci. 7 (7) (2017) 73, https://doi.org/10.3390/brainsci7070073.
[49] A. Cuadrado, S. Kügler, I. Lastres-Becker, Pharmacological targeting of GSK-3 and
NRF2 provides neuroprotection in a preclinical model of tauopathy, Redox Biol. 14
[55] M. Zhu, M. Liu, Q.L. Guo, C.Q. Zhu, J.C. Guo, Prolonged DADLE exposure epi-
genetically promotes Bcl-2 expression and elicits neuroprotection in primary rat
cortical neurons via the PI3K/Akt/NF-κB pathway, Acta Pharmacol. Sin. 39 (10)
(2018) 1582, https://doi.org/10.1038/aps.2018.7.
12