Stereochemical recognition of doubly functional aminotransferase in 2-deoxystreptamine biosynthesis

Article abstract of DOI:10.1021/ja0445948

The doubly functional aminotransferase BtrS in the 2-deoxystreptamine (DOS) biosynthesis, in which two transaminations are involved, was characterized by a genetic as well as a chemical approach with the heterologously expressed enzyme. The gene disruptio

Full text of DOI:10.1021/ja0445948

Published on Web 03/30/2005
Stereochemical Recognition of Doubly Functional
Aminotransferase in 2-Deoxystreptamine Biosynthesis
Kenichi Yokoyama,† Fumitaka Kudo,† Mieko Kuwahara,† Kousuke Inomata,†
Hideyuki Tamegai,† Tadashi Eguchi,‡ and Katsumi Kakinuma*,†
Contribution from the Department of Chemistry and the Department of Chemistry and Materials
Science, Tokyo Institute of Technology, 2-12-1 O-okayama, Meguro-ku, Tokyo 152-8551, Japan
Received September 7, 2004; E-mail: kakinuma@chem.titech.ac.jp
Abstract: The doubly functional aminotransferase BtrS in the 2-deoxystreptamine (DOS) biosynthesis, in
which two transaminations are involved, was characterized by a genetic as well as a chemical approach
with the heterologously expressed enzyme. The gene disruption study clearly showed that BtrS is involved,
in addition to the previously confirmed first transamination, in the second transamination as well. This dual
function of BtrS for the DOS biosynthesis was further confirmed by the structural determination of the
reverse reaction product from DOS. Enantiospecific formation of the reverse reaction product from DOS
clearly showed that BtrS distinguishes the enantiotopic amino groups of DOS, but in contrast, both
enantiomers of 2-deoxy-scyllo-inosose (DOI) were efficiently accepted by BtrS to give a racemic product.
This unique stereochemical recognition of DOI chirality and DOS prochirality by BtrS is mechanistically
explained by a specific hydrogen-bond donating force in the enzyme active site as a particular feature of
this doubly functional enzyme.
Aminocyclitols, represented by streptidine and 2-deoxy-
streptamine (1, DOS), are key aglycons of clinically important
aminoglycoside antibiotics and are biosynthesized from the
corresponding inososes through two steps of aminotransferase
reaction (Scheme 1). The responsible enzymes and their
corresponding genes for the biosynthesis of streptidine are
known, in which two distinct aminotransferases are indepen-
dently involved.1-3 A different scenario has been suggested for
the biosynthetic pathway for DOS. Walker et al. previously
showed the involvement of aminotransferase for DOS biosyn-
thesis in certain aminoglycoside producers and further suggested
recently by using an enzyme system derived from gentamicin
producing Micromonospora purpurea that both the first tran-
samination and the reverse of the second could be catalyzed by
the same enzyme.4,5 It seems, therefore, that a single ami-
notransferase can catalyze two almost enantiotopic chemical
conversions from 2-deoxy-scyllo-inosose (2, DOI) and a putative
aminoketone intermediate (4) in the DOS biosynthesis. To
precisely address this intriguing character of this class of
aminotransferase on the molecular level, we took advantage of
genetic as well as stereochemical approaches using a heterolo-
gously overexpressed aminotransferase.
Bacillus circulans SANK72073 and heterologously over-
expressed in Escherichia coli.6 BtrS is known to catalyze the
first transamination from 2 to 2-deoxy-scyllo-inosamine (3) in
the presence of L-glutamine and a PLP cofactor in the DOS
biosynthesis (Scheme 1).6,7
Our first concern was focused on the roles of btrS in the DOS
biosynthesis, since no other appropriate gene was envisioned
for the second transamination within the gene cluster.6,8 We
undertook disruption of the btrS gene and observed as expected
that a btrS disruptant was unable to produce any antibiotics
including butirosin. Supplementation of 1 to the disruptant
culture recovered the production of antibiotics, mostly compris-
ing neamine. By feeding 3 to the culture of disruptant, we were
unable to rescue the antibiotic production at all. These results
clearly indicated on the genetic basis that BtrS is in fact
involved, in addition to the first transamination, in the second
transamination which converts amino-dideoxy-scyllo-inosose,
(2R,3S,4R,5S)-5-amino-2,3,4-trihydroxycyclohexanone (4), into
1 (Scheme 1). This was well-coincided with an independent
observation by Huang et al. that 1 was taken up as an amino
donor for the reverse transamination to pyruvate.7 The present
results also agreed with those reported previously by Walker
and Suzukake.5,9
Recently, we successfully identified the gene btrS as an
aminotransferase in the butirosin biosynthetic gene cluster from
Prior to the further mechanistic studies, we undertook the
chemical identification of the product of the reverse reaction
† Department of Chemistry.
‡ Department of Chemistry and Materials Science.
(1) Ahlert, J.; Distler, J.; Mansouri, K.; Piepersberg, W. Arch. Microbiol. 1997,
168, 102-113.
(6) Tamegai, H.; Nango, E.; Kuwahara, M.; Yamamoto, H.; Ota, Y.; Kuriki,
H.; Eguchi, T.; Kakinuma, K. J. Antibiot. 2002, 55, 707-714.
(7) Huang, F.; Li, Y.; Yu, J.; Spencer, J. B. Chem. Commun. 2002, 2860-
2861.
(8) Ota, Y.; Tamegai, H.; Kudo, F.; Kuriki, H.; Koike-Takeshita, A.; Eguchi,
T.; Kakinuma, K. J. Antibiot. 2000, 53, 1158-1167.
(9) Suzukake, K.; Tokunaga, K.; Hayashi, H.; Hori, M.; Uehara, Y.; Ikeda,
D.; Umezawa, H. J. Antibiot. 1985, 38, 1211-1218.
(2) Walker, J. B.; Walker, M. S. Biochemistry 1969, 8, 763-770.
(3) Walker, J. B. Methods Enzymol. 1975, 43, 429-470.
(4) Chen, Y. M.; Walker, J. B. Biochem. Biophys. Res. Commun. 1977, 77,
688-692.
(5) Lucher, L. A.; Chen, Y.-M.; Walker, J. B. Antimicrob. Agents Chemother.
1989, 33, 452-459.
9
10.1021/ja0445948 CCC: $30.25 © 2005 American Chemical Society
J. AM. CHEM. SOC. 2005, 127, 5869-5874
5869

A R T I C L E S
Yokoyama et al.
Scheme 1. Two Steps of Transaminaion in the Aminocyclitol Biosynthesisa
a (a) Biosynthesis of 2-deoxystreptamine containing aminoglycoside antibiotics. 1, 2-deoxystreptamine; 2, 2-deoxy-scyllo-inosose; 3, 2-deoxy-scyllo-
inosamine; 4, amino-dideoxy-scyllo-inosose. BtrC, 2-deoxy-scyllo-inosose synthase that catalyzes carbocycle formation from glucose-6-phosphate. BtrS,
L-glutamine:2-deoxy-scyllo-inosose aminotransferase. (b) Relevant enzymatic reactions involved in the biosynthesis of streptidine in streptomycin. StsC,
L-glutamine:scyllo-inosose aminotransferase. StsA or StrS catalyzes the second transamination of the keto intermediate.
Scheme 2. Identification of BtrS Reaction Intermediates 4a
a Reagents: (a) Ac2O; (b) pyridine, NBHA; (c) pyridine, Ac2O; (d) NaBH4; (e) pyridine, DMAP, BzCl.
from 1 and pyruvate using purified BtrS (Scheme 2). After the
enzyme reaction, the mixture was treated in situ with Ac2O for
N-acetylation, and the resulting N-acetamide was further de-
rivatized to nitrobenzyl oxime with 4-nitrobenzyl hydroxylamine
(NBHA).10 LC-MS of the oxime product showed a molecular
ion (M + H)+ at m/z 353.9 corresponding to the expected
derivative (5). The reaction yield was not necessarily good
because most of the added DOS was recovered unchanged. The
product (5) was further subjected to O-acetylation, and the fully
protected product was purified by silica gel chromatography
and was characterized by 1H NMR, 13C NMR, and MS analysis,
which allowed us to unambiguously identify it as the expected
derivative (6) of the biosynthetic intermediate amino-dideoxy-
scyllo-inosose (4).
Our attention was next turned to the mechanistic issue of the
BtrS reaction, particularly concerning the stereochemistry of the
first and second transamination products, to see how the enzyme
recognizes chirality of the substrates. Although Walker showed
previously that chemically biased chiral N3-methyl-2-deoxy-
streptamine was an amino donor in the reverse reaction by a
native aminotransferase,5,11 it appeared to be important to
examine the chirality recognition toward unbiased achiral DOS.
In fact, the above-mentioned nitrobenzyl oxime-N,O-tetraacetate
(6) was optically active; [R]D +28.0 (c 1.09, CHCl3). Therefore,
(10) Yamauchi, N.; Kakinuma, K. J. Antibiot. 1992, 45, 774-780.
(11) Walker, J. B. Appl. EnViron. Microbiol. 2002, 68, 2404-2410.
9
5870 J. AM. CHEM. SOC. VOL. 127, NO. 16, 2005

Doubly Functional Aminotransferase in DOS Biosynthesis
A R T I C L E S
Scheme 3 . BtrS-Catalyzed Reactionsa
a Racemic DOI 2 and ent-2 were converted to 3 and ent-3, respectively, and scyllo-inosose 8 was converted to 9 by BtrS. Isomer 4 was specifically
formed from DOS 1 by BtrS in the presence of pyruvate and pyridoxal phosphate.
Figure 1. Reaction mechanism and substrate recognition by BtrS. (a) The first half-reaction catalyzed by BtrS. L-Glutamine (R1: CO2-, R2: CH2CH2-
CONH2) is utilized as an amino donor in the BtrS-catalyzed transamination. The aldimine intermediate between PLP and L-glutamine is initially formed. The
CR proton in the intermediate is stereospecifically abstracted by the active site amino acid, yielding the quinonoid intermediate. Reprotonation of the cofactor
by the same amino acid residue generates the ketimine intermediate, which is subsequently hydrolyzed to release R-keto-glutaramate, leaving the enzyme
in the PMP form. A complete BtrS catalytic cycle involves subsequent reaction with scyllo-inososes to give 3 and 1 and regenerates the PLP form of the
holo-enzyme. PLP: pyridoxal 5′-phosphate, PMP: pyridoxamine 5′-phosphate. (b) Compounds 2, ent-2, 8, and 4 are acceptable intermediates. Unfavorable
interaction of unacceptable intermediate ent-4 is shaded.
it appears that BtrS obviously distinguishes the two enantiotopic
amino groups of DOS. To confirm the absolute stereochemistry
of 6, we prepared N-acetyl-N-benzoyl-O-tetrabenzoate derivative
(7) of stereochemically pure 2-deoxy-scyllo-inosamine (3) as
the authentic standard, which was prepared from 2 produced
enzymatically from D-glucose by DOI synthase BtrC in vivo.6,12
Separately, the initial product (4) from 1 by BtrS reverse reaction
was first N-acetylated, and the residual ketone was reduced with
NaBH4 to give a mixture of diastereoisomeric tetraols. After
protection of all the hydroxy groups with benzoyl chloride, the
resulting benzoates of diastereoisomeric 2-deoxyinosamine were
separated by preparative thin-layer chromatography (TLC). As
a result, both the authentic 2-deoxy-scyllo-inosamine derivative
(7) derived from 2 and one of the diastereomers derived from
the BtrS reverse reaction product were completely identical in
every respects including optical activity. These results clearly
demonstrate that BtrS distinguishes the two enantiotopic amino
groups of DOS (1) and stereospecifically converts it to 4.
To figure out the above-mentioned doubly functional char-
acter of BtrS, we examined the first transamination step from 2
to 3 in the DOS biosynthesis. Thus, the BtrS reaction was carried
out with racemic DOI to investigate whether the natural
enantiomer was selectively recognized. Surprisingly, the BtrS
reaction product 2-deoxy-scyllo-inosamine was racemic (Scheme
3). Although the reaction kinetics has not been analyzed, BtrS
does accept both enatiomers of DOI with the same efficiency.
Thus, BtrS cannot distinguish the DOI enantiomers. The
particular feature of doubly functional BtrS may be basically
ascribable to the lack of recognition of DOI enantiomers.
An emerging question then was the mechanism of recognition
by BtrS for DOS prochirality. Generally in the transamination
reactions, a PLP or PMP coenzyme is incorporated in a specific
manner at the enzyme active site prior to the incorporation of
substrate so that the orientation of the initially formed aldimine
or ketimine bond is rather fixed and the direction of protonation/
deprotonation is stereospecific (Figure 1a).13,14 R1 and R2 group
of substrates are strictly distinguished so that L-glutamine is
utilized as an amino source in the BtrS-catalyzed transamination,
but not D-glutamine (data not shown). In the transamination to
DOI, both DOI enantiomers are acceptable as substrate, which
(12) Kakinuma, K.; Nango, E.; Kudo, F.; Matsushima, Y.; Eguchi, T. Tetra-
hedron Lett. 2000, 41, 1935-1938.
(13) Eliot, A. C.; Kirsch, J. F. Annu. ReV. Biochem. 2004, 73, 383-415.
(14) Soda, K.; Yoshimura, T.; Esaki, N. Chem. Rec. 2001, 1, 373-384.
9
J. AM. CHEM. SOC. VOL. 127, NO. 16, 2005 5871

A R T I C L E S
Yokoyama et al.
plasmids for gene disruption were constructed with the E. coli-Bacillus
shuttle vector pHB201 (Tanaka et al., unpublished). The plasmid pUC
119 was routinely used as a vector for subcloning and sequencing and
pT7-blue T vector (Novagen, USA) was routinely used as a vector for
subcloning after PCR. Oligonucleotides were purchased from Sigma
Genosis. Restriction enzymes were purchased from Takara. PCR was
performed by GeneAmp PCR System 9700 (Perkin-Elmer Applied
Biosystems) using ULTma DNA polymerase (Roche). DNA sequence
analysis was carried out with a LONG READER 4200 (Li-Cor)
according to the manufacturer’s protocol. HPLC was performed on a
Hitachi L-6250 intelligent pump equipped with a L-4000H UV detector
and a D-2500 chromato-integrator for the enzyme assay. FPLC
(Pharmacia Biotech.) was used for protein purification. Melting point
(mp) data were measured with a Yazawa BY-1 micro melting point
apparatus and were uncorrected. Optical rotations were recorded on a
JASCO DIP-360 digital polarimeter. IR spectra were taken on a Horiba
FT-710 Fourier transform infrared spectrometer. 1H NMR and 13C NMR
spectra were recorded with a JEOL AL-400 spectrometer or a Bruker
DRX-500 spectrometer. Deuteriochloroform (Merck, 99.8 atom %
enriched), deuterium oxide (Merck, 99.9 atom % enriched), deuteri-
omethanol (Acros, 99.5 atom % enriched), or deuteriopyridine (Merck,
99.8 atom % enriched) were used as NMR solvent. Chemical shifts
are reported in δ ppm based on internal TMS (0 ppm) or the solvent
signal (CDCl3 δC ) 77.0; D2O δH ) 4.65; pyridine-d5 δH ) 7.55) as
reference. When D2O was used, dioxane was used an internal standard
(δC ) 66.5). FAB-MS was taken by a JMS-700 spectrometer (JEOL).
Column chromatography was carried out with a Merck silica gel 60
(70-230 mesh, 0.063-0.20 mm Merck) or a Merck silica gel 60 (230-
400 mesh, 0.040-0.063 mm for a flash chromatography, Merck). TLC
was carried out with a Merck silica gel 60 F254 (0.25-mm thick). Other
chemicals were of the highest grade commercially available.
btrS Gene Disruption. A fragment containing 5′-terminus of btrS
gene was amplified by PCR with a primer btrS-d1 TGGATCCGGCGG-
GAGAAAAGCCGGAGTGTG and a primer btrS-d2 TATCGATCG-
TACGATCGGAGTGTTGAGGCC. A fragment containing 3′ terminus
of btrS gene was amplified by PCR with a primer btrS-d3 CATCGAT-
TGTCGCTTCTGGTCGATGCCGTAGCC and a primer btrS-d4
AGAATTCCCTGCCGGACTCCTTGATCGGCC. PCR conditions were
95 °C, 10 min for denature, 30 cycles of 95 °C, 1 min, 55 °C, 1 min,
72 °C, 1 min for extension of DNA. Each PCR product was subcloned
into pT7-blue to obtain pT7dbtrS-N and pT7dbtrS-C. After confirma-
tion of both sequences, a BamHI-ClaI fragment derived from
pT7dbtrS-N was inserted into pHSG398 vector (Takara). The resultant
plasmid was digested with ClaI and introduced into a ClaI site of
pT7dbtrS-C. After confirmation of the direction of inserted DNA in
the resulting plasmid, its BamHI-EcoRI fragment was introduced into
pHB201 to obtain pHB201dbtrS, which lacked a part of the btrS gene.
B. circulans SANK72073 was transformed with pHB201dbtrS by
electroporation, and a btrS gene disruptant was constructed by
homologous recombination according to the previous method.8 Disrup-
tion of btrS was confirmed by colony direct PCR, under the conditions
of 94 °C, 5 min for denature, 40 cycles of 94 °C, 1 min, 55 °C, 1 min,
72 °C 4.5 min for extension of DNA with primer btrSdt-F CACG-
GATTGTGCGTAGAAGCAGA and primer btrSdt-R GGTCCCGAAGT-
TGTAAGGTTCGG. The btrS disruptant was cultured in a glycerol-
supplemented nutrient broth medium,21 and an aliquot of the culture
was collected every day for 10 days. The supernatant of each specimen
was tested for antibiotic activity by a paper diffusion method. Antibiotic
production by the btrS mutant was further examined by supplementation
of DOS (final 50 mg/L) or 2-deoxy-scyllo-inosamine (final 50 or 250
mg/L) on the first and fourth day of culture. After 10 days, each cultured
medium was centrifuged, and the supernatant was neutralized with
aqueous HCl. The solution was separately loaded onto an Amberlite
IRC50 column (NH4+ form, 3 cm × 10 cm). The column was washed
strongly suggests that any structural element making DOI chiral
is not important at all for the substrate recognition (Figure 1b).
In other words, both a hydroxy and deoxy functionality of the
R-positions to the DOI carbonyl group is not the determinant
of substrate recognition, but rather a plausible hydrogen-bonding
interaction between hydroxy groups at the â-position to the
carbonyl, and certain functionality of the enzyme should be
significant. We confirmed that scyllo-inosose (8) was smoothly
converted to the corresponding scyllo-inosamine (9) by BtrS.5,11
This observation may now rationalize on the molecular level
the well-documented historical successes of mutasynthesis or
mutational biosynthesis using D- (DOS negative) idiotrophic
mutants of M. purpurea.15-18 While the idiotroph produced
gentamicin C upon supplementation with 2-deoxy-scyllo-inosose
(2), 2-hydroxygentamicin C was produced as well when scyllo-
inosose (8) was supplemented. Thus, it appears that the BtrS
homologue in M. purpurea recognizes 8 as well as 2 for the
transamination in the biosynthesis of gentamicin C.
As to the reverse deamination reaction from DOS, its
prochirality was recognized by BtrS, and the enantiotopic amino
groups were completely distinguished (Scheme 3, 4 and ent-
4). The initially formed two putative aldimines are enantiomeric
to each other, and one enantiomer appears to be preferentially
formed through favorable recognition. As discussed above, the
functionality at the â-positions to the carbonyl is important, and
the same should be true for the formation of an aldimine
intermediate in the DOS deamination reaction. The hydroxy and
amino groups at the â-positions can be distinguished by such
interactions as hydrogen-bonding or electrostatic interaction.
Thus, a proper approach of DOS to PLP in the holo-enzyme
appears to be enhanced by hydrogen-bond donating interaction
from the enzyme to the hydroxy group of DOS as illustrated in
the Figure 1b (4), but an unfavorable entry of DOS to the active
site may encounter a repulsive interaction between the amino
group (ammonium) of DOS and the hydrogen-bond donating
residue of the enzyme (ent-4). It seems, therefore, that even a
single-point interaction may be enough for specific recognition
of prochirality. Significance of such a single-point interaction
for chiral recognition has been described in the reports about
the different stereospecificities shown by the same protein hold
of two tropinone reductases involved in the biosynthesis of
tropane alkaloids.19,20
In conclusion, the doubly functional aminotransferase in the
DOS biosynthesis in fact catalyzes the two almost enantiomeric
transaminations, and the second transamination may probably
be controlled by specific hydrogen-bond donating force in the
enzyme active site to the substrate.
Experimental Section
General. B. circulans SANK 72073 was used as the source strain
for butirosin biosynthetic genes and the construction of btrS gene
disruption mutants. E. coli JM 109 and DH5R were used as host strain
for btr genes cloning. E. coli BL21(DE3) was used for gene expression.
Bacillus subtilis PCI 219 was used as an antibiotic test strain. The
(15) Daum, S. J.; Lemke, J. R. Annu. ReV. Microbiol. 1979, 33, 241-265.
(16) Rinehart, K. L., Jr. J. Antibiot. 1979, 32 (Suppl.) S32-S46.
(17) Daum, S. J.; Rosi, D.; Goss, W. J. Am. Chem. Soc. 1977, 99, 283-284.
(18) Daum, S. J.; Rosi, D.; Goss, W. A. J. Antibiot. 1977, 30, 98-105.
(19) Nakajima, K.; Yamashita, A.; Akama, H.; Nakatsu, T.; Kato, H.; Hashimoto,
T.; Oda, J.; Yamada, Y. Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 4876-
4881.
(20) Nakajima, K.; Kato, H.; Oda, J.; Yamada, Y.; Hashimoto, T. J. Biol. Chem.
1999, 274, 16563-16568.
(21) Kudo, F.; Hosomi, Y.; Tamegai, H.; Kakinuma, K. J. Antibiot. 1999, 52,
81-88.
9
5872 J. AM. CHEM. SOC. VOL. 127, NO. 16, 2005

Doubly Functional Aminotransferase in DOS Biosynthesis
A R T I C L E S
with 400 mL of water and 400 mL of 0.1 M aqueous NH4OH and
eluted with 500 mL of 1 M aqueous NH4OH. The bioactive fractions
were combined, and the solution was concentrated. The concentrated
solution was loaded onto an Amberlite CG50 column (NH4+ form, 1.2
cm × 50 cm), and the column was washed with 0.3 M aqueous NH4-
OH. Aminoglycosides were eluted with 0.3-0.8 M aqueous NH4OH
in a linear gradient mode. The bioactive fractions were combined and
concentrated. The residue was dissolved in 1 mL of water, and an
aliquot of the solution (50 µL) was applied onto a TLC plate. The
TLC plate was developed with CHCl3/MeOH/aqueous NH4OH/EtOH
) 4:6:7:1. After being dried, the TLC plate was placed over an agar
medium containing B. subtilis PCI 219 for 1 day at 4 °C. After the
plate was removed, the bacteria were cultured at 37 °C for 1 day.
A solution of 5 (20 mg) in 2.8 mL of pyridine was mixed with 0.27
mL of Ac2O, and the solution was stirred for 12 h at room temperature.
After evaporation, the residue was purified by preparative TLC (ethyl
acetate) to afford 24 mg of 6 (88%) as colorless solid. mp 181-182
°C; [R]24D +28.0 (c 1.09, CHCl3); IR (CHCl3): 1755, 1683, 1522, 1373,
1346, 1223, 1038 cm-1; 1H NMR (400 MHz, CDCl3): δ 1.92 (dd, J )
12.0, 15.2 Hz, 1H), 1.95 (s, 3H), 2.05 (s, 3H), 2.06 (s, 3H), 2.07 (s,
3H), 3.68 (dd, J ) 5.2, 15.2 Hz, 1H), 4.19 (dddd, J ) 5.2, 8.4, 10.4,
12.0 Hz, 1H), 5.03 (dd, J ) 8.6, 10.6 Hz, 1H), 5.18 (s, 2H), 5.26 (t, J
) 8.8 Hz, 1H), 5.33 (d, J ) 8.8 Hz, 1H), 5.74 (d, J ) 8.4 Hz, 1H),
7.47 (m, 2H), 8.22 (m, 2H); 13C NMR (125 MHz, CDCl3): δ 20.49,
20.55, 20.65, 23.22, 27.49, 47.91, 71.13, 71.47, 73.24, 75.11, 123.7,
128.5, 144.6, 147.6, 148.3, 169.0, 169.4, 169.7, 171.5; HRMS (FAB)
m/z 480.1608 (M + H)+; calcd for C21H26N3O10: 480.1618.
Preparation of BtrS. The plasmid pUCbtrS containing the btrS
gene6 was digested with NdeI and EcoRI, and the NdeI-EcoRI fragment
containing btrS gene was introduced into the NdeI-EcoRI site of pET30b
to give pETbtrS, which was subsequently introduced into E. coli BL21-
(DE3). The transformant harboring pETbtrS was incubated in LB
medium containing 30 mg/mL of kanamycin at 37 °C. The expression
was induced at OD600 ≈ 0.6-1.0 by adding final 1.0 mM of isopropyl
thio-â-D-galactoside (IPTG), and the culture was continued for an
additional 4 h. The cells were harvested by centrifugation at 7000 rpm
for 15 min at 4 °C and washed with a 50 mM Tris buffer (pH 8.0).
The wet cells (14 g) were suspended in 25 mL of 50 mM Tris buffer
(pH 8.0) and then disrupted by a French Press (Thermo IEC). After
removal of cell debris by centrifugation at 15 000 rpm for 30 min at 4
°C, the supernatant was loaded onto a DEAE-Sepharose fast flow
column (2.5 cm × 10 cm) previously equilibrated with a 50 mM Tris
buffer (pH 8.0). BtrS was eluted with a linear gradient of 0.05-0.5 M
of NaCl in the same buffer. The fractions containing BtrS were
combined and concentrated by ultrafiltration (VIVASPIN 20, Viva-
science, Germany). The concentrated solution was loaded onto a
Superdex Hi-load 75 gel filtration column (Amersham Pharmacia)
equilibrated with a 50 mM Tris buffer containing 100 mM of NaCl.
The fractions containing BtrS were combined and concentrated. The
concentration of protein was estimated by the method of Lowry using
bovine serum albumin as a standard.
N-Acetyl-N-benzoyl-3,4,5,6-tetra-O-benzoyl-2-deoxyinosamine (7).
2-Deoxy-scyllo-inosamine hydrochloride 3 was prepared by the previ-
ously reported synthetic method6 from 2. To a solution of 3 (32 mg) in
water (3 mL) was added 9 mL of Ac2O at 0 °C, and the mixture was
stirred for 36 h. After concentration in vacuo, the crude product was
successively passed through columns of Dowex 50WX8 (H+ form, 1.8
cm × 10 cm) and Dowex AG1X8 (OH- form, 1.8 cm × 10 cm), and
the product was eluted with water. The solvent was removed in vacuo
to afford 24 mg of N-acetyl-2-deoxy-scyllo-inosamine (72%) as a
1
colorless syrup. IR (neat): 3301, 2885, 1635, 1558 cm-1; H NMR
(400 MHz, D2O): δ 1.24 (q, J ) 12.2 Hz, 1H), 1.85 (s, 3H), 1.94 (dt,
J ) 12.6, 4.4 Hz, 1H), 3.17 (m, 3H), 3.44 (ddd, J ) 5.3, 9.0, 15.3 Hz,
1H), 3.61 (ddd, J ) 4.0, 9.5, 13.0 Hz, 1H); 13C NMR (100 MHz, D2O);
δ 22.0, 34.6, 48.2, 69.1, 74.4, 74.9, 76.5, 173.8.
To a solution of N-acetyl-2-deoxy-scyllo-inosamine (24 mg, 0.115
mmol) in pyridine (6 mL) were added 4-(dimethylamino)pyridine
(DMAP) (8.0 mg, 0.065 mmol) and benzoyl chloride (0.41 mL, 3.5
mmol) at 0 °C. The mixture was warmed to room temperature and
was stirred for an additional 15 h. The reaction was quenched with
water, and the mixture was extracted with ethyl acetate. The organic
layer was washed with NaHCO3 aq, water, and brine and dried over
MgSO4. After filtration and evaporation, the residue was purified by
flash silica gel column chromatography (8 g of silica gel, hexane/ethyl
acetate ) 2:3) to afford 69 mg of the almost pure product (83%). The
product was recrystallized from CHCl3/hexane to afford 52 mg of
N-acetyl-3,4,5,6-tetra-O-benzoyl-2-deoxy-scyllo-inosamine as white
powder: mp 240-241 °C; [R]28D -31.3 (c 1.09, CHCl3); IR (CHCl3):
1730, 1664, 1450, 1278, 1111, 1070, 1025 cm-1; 1H NMR (400 MHz,
CDCl3): δ 1.85 (q, J ) 12.4, 1H), 1.87 (s, 3H), 2.82 (dt, J ) 12.6, 4.6
Hz, 1H), 4.56 (m, 1H), 5.46 (dd, J ) 9.5, 10.8 Hz, 1H), 5.51 (ddd, J
) 4.9, 9.3, 11.5 Hz, 1H), 5.86 (m, 3H), 7.27 (m, 4H), 7.40 (m, 6H),
7.51 (m, 2H), 7.79 (m, 2H), 7.83 (m, 2H), 7.93 (m, 4H); 13C NMR
(100 MHz, CDCl3): δ 23.22, 33.18, 47.80, 69.63, 71.40, 73.14, 74.09,
128.17, 128.20, 128.30, 128.42, 128.69, 128.75, 129.13, 129.52, 129.60,
129.63, 129.85, 133.10, 133.14, 133.16, 133.60, 165.20, 165.28, 165.61,
167.18, 169.66; Anal. Calcd for C36H31NO9: C, 69.56; H, 5.03; N,
2.25. Found: C, 69.31; H, 4.74; N, 1.97.
Identification of BtrS Reverse Reaction Product from DOS. The
BtrS reverse reaction was carried out with 157 mg of purified BtrS, 50
mM sodium pyruvate, 100 mM DOS, and 0.5 mM pyridoxal 5′-
phosphate in 39 mL of 50 mM Tris buffer (pH 8.0). After the reaction
at 37 °C for 3 h, BtrS was removed by ultrafiltration. The resultant
solution was mixed with 60 mL of Ac2O and was stirred for 3 h at
room temperature. After concentration, 40 mL of methanol, 28 mL of
pyridine, and 105 mg of O-(p-nitrobenzyl)-hydroxylamine hydrochloride
(NBHA) were added, and the solution was stirred for 4 h at 60 °C.
After removal of the solvent, the residue was purified by silica gel
column chromatography (100 g of silica gel, CHCl3/CH3OH ) 5:1) to
afford 94 mg of crude product. Because of the poor solubility of the
product, a part of the crude product was further purified by HPLC
equipped with a Senshu Pak ODS 1251N column (4.6 mm × 250 mm,
Senshu Scientific, Japan) with 30% aqueous methanol at a flow rate
of 1 mL/min. Elution was monitored by 254 nm, and appropriate
fractions were combined and concentrated to give compound 5 (20
To a solution of N-acetyl-3,4,5,6-tetra-O-benzoyl-2-deoxy-scyllo-
inosamine (30 mg, 0.048 mmol) in pyridine (2.4 mL) were added
DMAP (9 mg, 0.074 mmol) and benzoyl chloride (0.35 mL, 3.0 mmol)
at 0 °C. The reaction mixture was warmed to room temperature and
was stirred for 17 h. The reaction was quenched with water, and the
mixture was extracted 3 times with ethyl acetate. The combined organic
layer was washed with NaHCO3 aq, water, and brine and dried over
MgSO4. After filtration and removal of the solvent, the crude product
was recrystallized from CHCl3/hexane to afford 23 mg of 7 (66%) as
1
mg). H NMR (400 MHz, pyridine-d5): δ 2.07 (s, 3H), 2.48 (dd, J )
11.0, 14.2 Hz, 1H), 4.10 (dd, J ) 5.0, 14.3 Hz, 1H), 4.25 (m, 2H),
4.71 (m, 2H), 5.29 (s, 2H), 7.50 (m, 2H), 8.09 (m, 2H).
LC-MS analysis of 5 was performed by a LCQ mass spectrometer
(Finnigan) connected with NANOSPACE HPLC and SE-1 UV
detector (Shiseido, Japan) equipped with a RP-18 GP column (Kanto
Chemical, Japan) with 10% aqueous methanol containing 0.1% TFA
for 10 min, a linear gradient of 10-60% aqueous methanol containing
0.1% TFA for 35 min, and a linear gradient of 60-100% aqueous
methanol containing 0.1% TFA for 15 min at a flow rate 40 µL/min,
and elution was monitored by 262 nm. LC-ESI-MS (positive): 40.8
min, m/z 353.9 (M + H)+; calcd for C15H20N3O7: 354.1301.
white powder: mp 249-251 °C; [R]28 +12 (c 0.991, CHCl3); IR
D
1
(CHCl3): 1730, 1666, 1450, 1279, 1107, 1070, 1026 cm-1; H NMR
(400 MHz, CDCl3, room temperature): δ 1.81 (s, 3H), 2.59 (dt, J )
12.4, 4.4 Hz, 1H), 2.97 (br, 1H), 5.03 (br, 1H), 5.44 (br, 1H), 5.79 (t,
J ) 9.8 Hz, 1H), 5.98 (t, J ) 10.2 Hz, 1H), 6.47 (t, J ) 10.0 Hz, 1H),
7.26 (m, 3H), 7.36 (m, 8H), 7.53 (m, 6H), 7.80 (d, J ) 8.0 Hz, 2H),
9
J. AM. CHEM. SOC. VOL. 127, NO. 16, 2005 5873

A R T I C L E S
Yokoyama et al.
1
7.85 (t, J ) 8.0 Hz, 4H), 7.95 (d, J ) 8.0 Hz, 2H); H NMR (400
MHz, CDCl3, 80 °C): δ 1.83 (s, 3H), 2.57 (dt, J ) 12.4, 4.6, Hz, 1H),
2.99 (q, J ) 12.3, 1H), 4.97 (m, 1H), 5.42 (ddd, J ) 5.0, 10.2, 11.5
Hz, 1H), 5.75 (t, J ) 9.9 Hz, 1H), 5.93 (t, J ) 10.0, 1H), 6.43 (t, J )
10.1 Hz, 1H), 7.22 (m, 4H), 7.35 (m, 8H), 7.48 (m, 3H), 7.55 (m, 2H),
7.77 (m, 2H), 7.80 (m, 2H), 7.84 (m, 2H), 7.93 (m, 2H); 13C NMR
(100 MHz, CDCl3): δ 27.65, 29.57, 70.44, 71.95, 72.39, 72.89, 128.13,
128.16, 128.28, 128.33, 128.70, 128.75, 128.81, 128.96, 129.04, 129.58,
129.67, 133.02, 133.19, 133.24, 165.10, 165.39, 165.46, 165.56; Anal.
Calcd for C43H35NO10: C, 71.16; H, 4.86; N, 1.93. Found: C, 70.88;
H, 4.86; N, 1.76.
for 2 h at 4 °C and allowed to be warmed to room temperature. After
being stirred for an additional 10 h, the solvent was evaporated and
the residue was dissolved in 10 mL of water. The solution successively
passed through columns of Dowex 50WX8 (H+ form, 1.5 cm × 7 cm)
and Dowex AG1X8 (OH- form, 1.4 cm × 7 cm), and the product was
eluted with water. Appropriate fractions were combined and evaporated
to give 58 mg of N-acetyl-2-deoxy-scyllo-inosamine and acetylated Tris.
The residue was then dissolved in pyridine (13 mL), and the solution
was mixed with DMAP (16 mg) and benzoyl chloride (2.0 mL) at 0
°C. The mixture was allowed to be warmed to room temperature and
was stirred for 20 h. The reaction was quenched with water, and the
product was extracted with ethyl acetate. The organic layer was washed
with NaHCO3 aq, water, and brine and dried over MgSO4. After
filtration and evaporation, the product was purified by a silica gel
column chromatography (hexane/ethyl acetate ) 2:3) to obtain 25 mg
of N-acetyl-tetra-O-benzoyl-2-deoxyinosamine as colorless solid: mp
Stereochemistry of the BtrS Reverse Reaction Product from
DOS. The BtrS reverse reaction was carried out with 30 mg of purified
enzyme, 50 mM sodium pyruvate, 100 mM DOS, and 0.5 mM
pyridoxal-5′-phosphate in 7.5 mL of 50 mM Tris buffer (pH 8.0). After
the reaction at 37 °C for 3 h, BtrS was removed by ultrafiltration. The
resultant solution was mixed with 60 mL of Ac2O and was stirred for
3 h at room temperature. After the removal of solvent, the residue was
dissolved in methanol, and the solution was mixed with 116 mg of
NaBH4. After being stirred for 2 h at 0 °C, the reaction was quenched
with water and methanol was removed. The resultant mixture was
loaded onto Dowex AG1X8 column (OH- form), and the product was
eluted with water. The obtained solution was neutralized with HCl and
was evaporated. After being dried, the residue was redissolved in 9
mL of pyridine and the solution was mixed with DMAP (8 mg, 0.065
mmol) and benzoyl chloride (0.41 mL, 3.5 mmol) at 0 °C. The solution
was warmed to room temperature and was stirred for an additional 15
h. The reaction was quenched with water, and the mixture was extracted
with ethyl acetate. The organic layer was washed with NaHCO3 aq,
water, and brine and dried over MgSO4. After filtration and evaporation
in vacuo, the product was purified by standard silica gel column
chromatography (70 g of silica gel, hexane/ethyl acetate ) 1:1) and
was further purified by preparative TLC (ethyl acetate) to separate 7
and its 3-epi isomer to give 7 as colorless solid (12 mg). 7: mp 249-
250-252 °C; [R]21 +0.1 (c 1.27, CHCl3); IR (CHCl3): 1728, 1659,
D
1
1450, 1279, 1111, 1070, 1025 cm-1; H NMR (400 MHz, CDCl3): δ
1.85 (q, J ) 12.4 Hz, 1H), 1.87 (s, 3H), 2.82 (dt, J ) 12.9, 4.6 Hz,
1H), 4.56 (m, 1H), 5.46 (t, J ) 10.0 Hz, 1H), 5.52 (m, 1H), 5.86 (m,
2H), 7.27 (m, 4H), 7.40 (m, 6H), 7.51 (m, 2H), 7.79 (m, 2H), 7.83 (m,
2H), 7.93 (m, 4H); 13C NMR (100 MHz, CDCl3): δ 23.22, 33.18, 47.80,
69.63, 71.40, 73.14, 74.09, 128.17, 128.20, 128.30, 128.37, 128.42,
129.69, 128.75, 129.13, 129.52, 129.60, 129.63, 129.85, 133.10, 133.14,
133.16, 133.60, 165.20, 165.28, 165.61, 167.18, 169.66; Anal. Calcd
for C36H31NO9: C, 69.56; H, 5.03; N, 2.25. Found: C, 69.30; H, 4.77;
N, 1.99.
BtrS Reaction Using scyllo-Inosose (8). scyllo-Inosose was prepared
from 2,3,4,5,6-penta-O-benzyl-scyllo-inosose.23 Briefly, to a solution
of 2,3,4,5,6-penta-O-benzyl-scyllo-inosose (44 mg) in CH3OH/H2O/
AcOH ) 5:1:1 (4 mL) was added 10% Pd/C (10 mg), and the mixture
was stirred for 3 days under H2 atmosphere. After removal of the
catalyst, the solvent was evaporated to obtain 5 mg of scyllo-inosose.
The BtrS reaction (1.2 mL) was carried out with purified enzyme (1.0
mg), L-glutamine (50 mM), scyllo-inosose (20 mM), and pyridoxal-
5′-phosphate (0.5 mM) in a 50 mM Tris buffer (pH 8.0). The solution
was incubated at 32 °C for 3 h. After removal of the protein by
ultrafiltration, the resultant solution was subsequently applied onto a
Dowex AG1X8 column (OH- form, 0.5 cm × 6 cm), and the product
was eluted with water. Ninhydrin-positive fractions were collected and
251 °C; [R]27 +13 (c 0.79, CHCl3); IR (CHCl3): 1728, 1666, 1450,
D
1277, 1106, 1070, 1026 cm-1; 1H NMR (400 MHz, CDCl3); δ 1.81 (s,
3H), 2.59 (dt, J ) 12.4, 4.4 Hz, 1H), 2.97 (br, 1H), 5.03 (br, 1H), 5.44
(br, 1H), 5.79 (1H, t, J ) 9.8 Hz), 5.98 (1H, t, J ) 10.2 Hz), 6.47 (1H,
t, J ) 10.0 Hz), 7.26 (m, 3H), 7.36 (m, 8H), 7.53 (m, 6H), 7.80 (d, J
) 8.0 Hz, 2H), 7.85 (t, J ) 8.0 Hz, 4H), 7.95 (d, J ) 8.0 Hz, 2H); 13
C
+
applied onto an Amberlite CG50 column (NH4 form, 0.5 cm × 4
NMR (100 MHz, CDCl3); δ 27.65, 29.57, 70.44, 71.95, 72.39, 72.89,
128.13, 128.16, 128.28, 128.33, 128.70, 128.75, 128.81, 128.96, 129.04,
129.58, 129.67, 133.02, 133.19, 133.24, 165.10, 165.39, 165.46, 165.56;
Anal. Calcd for C43H35NO10: C, 71.16; H, 4.86; N, 1.93. Found: C,
70.89; H, 4.58; N, 1.90.
cm). The product was eluted with a stepwise elution 0.1-0.7 M NH4-
OH aq. scyllo-Inosamine was eluted with 0.4 M NH4Cl aq. The
appropriate fractions were combined and applied onto an Amberlite
CG50 column (H+ form, 0.5 cm × 4 cm, eluted by 1 N HCl aq), giving
scyllo-inosamine hydrochloride 9: 1H NMR (400 MHz, D2O): δ 2.86
(t, J ) 10.0 Hz, 1H), 3.19 (t, J ) 9.2 Hz, 1H), 3.26 (t, J ) 9.2 Hz,
2H), 3.30 (t, J ) 9.6 Hz, 2H).
Stereochemistry of the BtrS Reaction Product from Racemic
DOI. Racemic DOI was synthesized from myo-inositol by a previously
reported procedure.22 The BtrS reaction (final 40 mL) was carried out
with 30 mg of purified enzyme, 50 mM L-glutamine, 25 mM racemic
DOI, and 0.5 mM pyridoxal 5′-phosphate in a 50 mM Tris buffer (pH
8.0). After incubation at 37 °C for 3 h, the protein was removed by
ultrafiltration. The resultant solution was applied onto a Dowex 50WX8
column (H+ form, 1.8 cm × 7 cm), and the product was eluted with
0.1-0.7 M HCl aq linear gradient (600 mL). Fractions containing
2-deoxy-scyllo-inosamine were combined, and the solvent was evapo-
rated to give a mixture of 2-deoxy-scyllo-inosamine and 2-amino-2-
hydroxymethyl-1,3-propandiol (Tris). The residue was dissolved in a
mixture of 7 mL of water and 28 mL of Ac2O. The mixture was stirred
Acknowledgment. This work was supported in part by a
Grant-in-Aid for Scientific Research and a COE21 program from
the Ministry of Education, Culture, Sports, Science and Tech-
nology.
Supporting Information Available: All spectroscopic data.
This material is available free of charge via the Internet at
http://pubs.acs.org.
JA0445948
(23) Martin, S. F.; Josey, J. A.; Wong, Y.-L.; Dean, D. W. J. Org. Chem. 1994,
59, 4805-4820.
(22) Yamauchi, N.; Kakinuma, K. J. Antibiot. 1992, 45, 756-766.
9
5874 J. AM. CHEM. SOC. VOL. 127, NO. 16, 2005