Mutagenesis study of active site residues in chorismate mutase from Bacillus subtilis

Full text of DOI:10.1021/ja953152g

J. Am. Chem. Soc. 1996, 118, 1787-1788
1787
Mutagenesis Study of Active Site Residues in
Chorismate Mutase from Bacillus subtilis
Sharon T. Cload, David R. Liu, Richard M. Pastor, and
Peter G. Schultz*
Howard Hughes Medical Institute, Department of Chemistry
UniVersity of California, Berkeley, California 94720
ReceiVed September 13, 1995
Chorismate mutase catalyses the [3,3] Claisen rearrangement
of chorismate (1) to prephenate (2), the committed step in the
biosynthesis of tyrosine and phenylalanine in bacteria, fungi,
and higher plants1 (Scheme 1). Despite more than two decades
of studies on this novel biological rearrangement,2-15 the
mechanism of the enzyme-catalyzed reaction remains unclear.
Substrate labeling5,7 and kinetic isotope effect studies6 demon-
strated that both the uncatalyzed and catalyzed reactions proceed
through a chairlike transition state in which the C5-O7 bond
cleavage precedes C9-C1 bond formation. Mechanistic pro-
posals which have been suggested previously include protonation
or deprotonation of the C4 hydroxyl by an active site general
acid or base, respectively, nucleophilic catalysis by attack of
an active site nucleophile at C5, and simple conformational
restriction of the substrate.9,14 Recently, X-ray crystal structures
of monofunctional chorismate mutases from Bacillus subtilis
(BsCM)16,17 Escherichia coli (EcCM),18 and catalytic antibody
1F719 bound to the endo-oxabicyclic transition state analogue
311 were solved (Figure 1). Analysis of the active site structures
has led to a general mechanistic hypothesis that the enzymes
and antibody stabilize the chairlike transition state geometry
via a series of electrostatic and hydrogen-bonding interactions,17-20
which is consistent with the earlier finding that the rearrange-
ment of chorismate and related compounds is more facile in
hydrogen-bonding solvents.8,10 In addition, it has been specu-
lated that enzyme active site residues may stabilize the develop-
ing charge on the enol ether oxygen and the cyclohexadiene
Figure 1. Schematic diagram of transition state analogue 3 bound in
the BsCM active site.
Scheme 1
ring in the polar transition state.6,10 The availability of the
structures combined with the ability to mutate specific residues
provides an opportunity to test these mechanistic hypotheses
and identify key catalytic residues. We have generated and
characterized a series of 16 mutants of the B. subtilis enzyme.
The gene encoding BsCM was subcloned from plasmid
pBSCM221 into the phagemid pAED422 under the control of
the T7 RNA polymerase promoter. Six histidines were added
to the carboxy terminus using PCR23 to afford plasmid
pCM6XH. Mutant genes were constructed using the method
of Kunkel,24 and the resulting proteins were expressed in E.
coli strain BL21 which carries the gene for T7 RNA polymerase
behind the lacUV5 promoter.25 Mutant proteins were purified
to homogeneity (as determined by SDS-PAGE and Coomassie
staining) in a single step using IMAC affinity chromatography
on Ni(II)-chelating resin (Novagen).26,27 The structural integrity
of the mutants was assayed by circular dichroism (CD)
spectroscopy. The CD spectra of all mutants between 200 and
260 nm were superimposable with that of the wild-type (wt)
protein, suggesting that no significant structural changes were
caused by the mutations. Activities of the mutants were
determined by monitoring the disappearance of chorismate
spectrophotometrically at 274 or 304 nm (∆ꢀ274 ) 2340 M-1
cm-1; ∆ꢀ304 ) 808 M-1 cm-1) in 50 mM potassium phosphate
pH 7.5 at 30 °C.28 Table 1 lists the kinetic parameters (kcat,
(1) Weiss, U.; Edwards, J. M. The Biosynthesis of Aromatic Amino
Compounds; Wiley: New York, 1980; pp 134-184.
(2) Andrews, P. R.; Smith, G. D.; Young, I. G. Biochemistry 1973, 12,
3492-3498.
(3) Andrews, P. R.; Cain, E. N.; Rizzardo, E.; Smith, G. D. Biochemistry
1977, 16, 4848-4852.
(4) Gorisch, H. Biochemistry 1978, 17, 3700-3705.
(5) Sogo, S. G.; Widlanski, T. S.; Hoare, J. H.; Grimshaw, C. E.;
Berchtold, G. A.; Knowles, J. R. J. Am. Chem. Soc. 1984, 106, 2701-
2703.
(6) Addadi, L.; Jaffe, E. K.; Knowles, J. R. Biochemistry 1983, 22, 4494-
4501.
(7) Copley, S. D.; Knowles, J. R. J. Am. Chem. Soc. 1985, 107, 5306-
5308.
(8) Copley, S. D.; Knowles, J. R. J. Am. Chem. Soc. 1987, 109, 5008-
5013.
(9) Guilford, W. J.; Copley, S. D.; Knowles, J. R. J. Am. Chem. Soc.
1987, 109, 5013-5019.
(10) Gajewski, J. J.; Jurayj, J.; Kimbrough, D. R.; Gande, M. E.; Ganem,
B.; Carpenter, B. K. J. Am. Chem. Soc. 1987, 109, 1170-1186.
(11) Bartlett, P. A.; Johnson, C. R. J. Am. Chem. Soc. 1985, 107, 7792-
7793.
(21) Gray, J. V.; Golinelli-Pimpaneau, B.; Knowles, J. R. Biochemistry
1990, 29, 376-383.
(22) Doering, D. S. Thesis, Massachusetts Institute of Technology,
Cambridge, MA, 1992.
(12) Bartlett, P. A.; Nakagawa, Y.; Johnson, C. R.; Riech, S.; Luis, A.
J. Org. Chem. 1988, 53, 3195-3210.
(13) Delany, J. J.; Padykula, R. E.; Berchtold, G. A. J. Am. Chem. Soc.
1992, 114, 1394-1397.
(23) The N-terminal PCR primer, 5′ CTTGACCTGCATATGATGATT
CGCGGAATTCGCGGA 3′, contained an NdeI restriction site and a start
codon; the C-terminal primer, 5′ CAGGTCAAGAAGCTTTTA(GTG)6-
CAATTCAGTATTTTTTGTCAA 3′, contained six histidine codons, a stop
codon; and a HindIII restriction site.
(14) Gray, J. V.; Knowles, J. R. Biochemistry 1994, 33, 9953-9959.
(15) Gray, J. V.; Eren, D.; Knowles, J. R. Biochemistry 1990, 29, 8872-
8878.
(16) Chook, Y.-M.; Ke, H.; Lipscomb, W. H. Proc. Natl. Acad. Sci.
U.S.A. 1993, 90, 8600-8603.
(24) Kunkel Methods Enzymol. 1987, 154, 367-382.
(25) Grodberg, J.; Dunn, J. J. J. Bacteriol. 1988, 170, 1245.
(26) Hochuli, E.; Dobeli, H.; Schracher, A. J. Chromatogr. 1987, 411,
177-184.
(17) Chook, Y.-M.; Gray, J. V.; Ke, H.; Lipscomb, W. N. J. Mol. Biol.
1994, 240, 476-500.
(18) Lee, A. Y.; Karplus, P. A.; Ganem, B.; Clardy, J. J. Am. Chem.
Soc. 1995, 117, 3627-3628.
(27) Protein concentrations were determined spectrophotometrically (280
nM) using extinction coefficients calculated using the equation ꢀ280 )
ntyr*1450 M-1 cm-1 + ntryp*5800 M-1 cm-1; Kuramitsu, S.; Hiromi, K.;
Hayashi, H.; Morino, Y.; Kagaminyama, H. Biochemistry 1990, 29, 5469.
(28) Chorismic acid was isolated from Klebsiella pneumoniae strain 62-1
by the method of Gibson: Gibson, F. Biochem. Prep. 1968, 12, 94.
(19) Haynes, M. R.; Stura, E. A.; Hilvert, D.; Wilson, I. A. Science 1994,
263, 646-652.
(20) Lee, A. Y.; Stewart, J. D.; Clardy, J.; Ganem, B. Chem. Biol. 1995,
2, 195-203.
0002-7863/96/1518-1787$12.00/0 © 1996 American Chemical Society

1788 J. Am. Chem. Soc., Vol. 118, No. 7, 1996
Communications to the Editor
Table 1. Kinetic Constants of B. subtilis Chorismate Mutase
Mutants
Arg116Lys, Phe57Trp, Cys75Ser, Cys75Ala, and Cys75Asp,
have little effect on kcat but lead to 4- to 17-fold increases in
Km. Thus it appears that none of these residues plays a
significant catalytic role, either orientational (Arg 116 or Tyr
108), as an active site nucleophile (Cys 75), or in stabilizing
developing positive charge on the cyclohexadienyl ring system
(Phe 57). For mutations at all four sites, the increase in Km for
chorismate correlates well with the increase in Ki for TSq
analogue 3, consistent with the fact that kcat changes little.30
These residues appear to contribute equally to the binding
energies of substrate and transition state, indicating that substrate
is bound in a pseudodiaxial chairlike geometry.
mutant
kcat (s-1
)
Km (µM)
kcat/Km (M-1 s-1
)
Ki (µM)
wild type 69.5 ( 1.8
87 ( 5
8.00 × 105 ( 5.3 × 104 1.7 ( 0.1
wild typea 50
R90K
100
1.00 × 106
31 ( 1
<1
717 ( 11
1 ( 0.1
NDb
ND
ND
ND
R90A
R7K
R7A
Y108F
Y108A
R116K
R116A
C75S
C75A
C75D
C75D/E78A
E78D
E78Q
95.5 ( 7.8 624 ( 84 1.53 × 105 ( 2.4 × 104 7.2 ( 0.7
16.3 ( 0.7 1505 ( 99 1.08 × 104 ( 8.6 × 102 15.7 ( 1.3
100.4 ( 3.5 382 ( 31 2.63 × 105 ( 2.3 × 104 7.9 ( 0.4
95.4 ( 8.0 1048 ( 156 9.11 × 104 ( 1.5 × 104 23.5 ( 2.0
58.0 ( 3.5 817 ( 87 7.1 × 104 ( 8.6 × 103 11.5 ( 1.1
35.7 ( 2.4 1297 ( 139 2.75 × 104 ( 3.5 ( 103 43.6 ( 3.4
3.39 × 103 ( 60
ND
1.42 × 103 ( 65
ND
Reaction mechanisms involving both general acid and general
base catalysis at the C4 hydroxyl group of chorismate have been
proposed.9 Active site groups may also stabilize the positive
charge that develops in the vicinity of C4 in a dipolar transition
state.14,19 Although 4-deshydroxychorismate is a substrate for
the E. coli chorismate mutase-prephenate dehydrogenase en-
zyme, the rate acceleration (kcat/kuncat) for this is 102 compared
to 106 for chorismate.31 This suggests that while the C4
hydroxyl is not required for catalysis, interactions between this
moiety and the enzyme may contribute significantly to the rate
acceleration. The carboxylate side chain of Glu 78 is positioned
2.90 Å from the C4 hydroxyl group of 3 and also lies 3.2 Å
from NH1 and ꢀ-N of Arg 90. Both the Glu78Gln and
Glu78Ala mutants have significantly reduced activities (>104-
fold) compared with wt enzyme, while the Glu78Asp mutant
manifests only a 2-fold reduction in kcat with a 15-fold increase
in Km. The activity of the Glu78Ala mutant is rescued 50-fold
by replacing C75 with aspartate in the double mutant Glu78Ala/
Cys75Asp. Again, the increases in Km and Ki for Glu78Asp
correlate well with the relatively unperturbed kcat,30 suggesting
that Glu 78 contributes equally to the binding energy of substrate
and transition state. These results indicate that a carboxyl group
in the vicinity of the C4 hydroxyl is required, most likely to
orient both chorismate and the critical bidentate hydrogen-
bonding guanidinium group of Arg 90. Because analogue 3
does not mimic the charge distribution expected in a transition
state involving heterolysis of the C5-O7 bond or ionization of
the C4 hydroxyl, it is difficult to determine to what degree this
residue (and to a lesser degree Asp 78 and Asp 75) could also
play an electrostatic role in catalysis. Mutagenesis using
unnatural amino acids,32-34 as well as mutational studies of the
corresponding E. coli chorismate mutase, should help dissect
out electronic versus conformational effects involving the O7
and C4 hydroxyl group of chorismate.
1.66 × 103 ( 30
ND
75 ( 2
33 ( 1
ND
ND
E78A
F57W
29.6 ( 1.4 1071 ( 90 2.76 × 104 ( 2.7 × 103 21.1
a BsCM without polyhistidine tag.21 b ND ) not determined. Par-
ameters were determined by fitting initial rate data to the Michaelis-
Menten equation. In cases in which saturation was not observed at
concentrations of chorismate g1.5 mM, the kcat/Km values were
determined by a linear fit of initial velocity versus chorismate
concentration. Inhibition constants were measured at 30 °C in 50 mM
potassium phosphate pH 7.5 at [chorismate] ) Km with various
concentrations of 3.12 Ki values were determined by fitting the data to
the equation V ) (kcat[Eo][S])/([S] + Km(1 + [I]/Ki)) in which Km
[S].
)
Km, kcat/Km, Ki) for the wt and mutant enzymes. The poly-his
tag does not significantly affect the catalytic properties of the
wt enzyme.
Hydrogen bonds between the C11 carboxylate group of
chorismate and Arg 7 have been proposed to play an important
role in positioning the enolpyruvyl side chain in the chairlike
transition state geometry.16,17,20 Consistent with this notion,
removal of this bidentate hydrogen-bonding interaction in the
Arg7Ala mutant leads to an approximately 106-fold reduction
in kcat/Km. Substitution of Arg 7 with lysine leads to a 103-
fold decrease in kcat/Km, indicating that the ꢀ-amino group of
lysine interacts with the C11 carboxylate less effectively. The
crystal structure also suggests that the guanidinium group of
Arg 90 hydrogen bonds to one of the oxygens of the C11
carboxylate group as well as the ether oxygen (O7) of 3.16,17
Substitution of Arg 90 with lysine results in a 2.6 × 104
reduction in kcat/Km relative to wt enzyme, and the Arg90Ala
mutant has no measurable activity. The large decrease in
activity associated with these mutations indicates that this
residue also plays a critical catalytic role. Hydrogen bonds made
by Arg 90 may stabilize the negative charge which develops
O7 in the transition state as well as stabilize the required
chairlike transition state conformation. An analogous bridging
residue, Lys 39, is present in the E. coli enzyme (kcat/Km ) 2.4
× 105 M-1 s-1),29 but in the antibody 1F7, which has
significantly lower activity compared to the enzymes (kcat/Km
) 23.5 M-1 s-1), the corresponding arginine is not positioned
well to interact with O7.19
Acknowledgment. This work was supported by NIH Grant
(R01GM49220). S.T.C. is supported by a National Institutes of Health
postdoctoral fellowship (GM15958); D.R.L. is supported by a Howard
Hughes predoctoral fellowship (HHMI-M940) and was formerly
supported by NDSEG fellowship DAAH04-94-G-0296. We thank
Jeremy Knowles for providing us with pBSCM2 and Whitney Smith
for the generous gift of transition state analogue 3. We also thank
Helle Ulrich for helpful discussions.
JA953152G
The X-ray crystal structure indicates that Tyr 108, Arg 116,
Phe 57, and Cys 75 are all proximal to 3 in the active site.16-18
Tyr 108 is within hydrogen-bonding distance of the C11
carboxylate, and Arg 116 is a potential hydrogen-bonding
partner for the C10 carboxylate, although this region is not well-
defined crystallographically. The side chain thiol group and
backbone amide of Cys 75 are situated within hydrogen-bonding
distance of the C4 hydroxyl group of 3, and Phe 57 lies under
C5. Substitutions at each of these positions, Tyr108Phe,
(30) It has been suggested that the kcat value for BsCM may be limited
by the dissociation of prephenate, although there is some discrepancy in
the reported prephenate dissociation rates: 60 s-1 at 25 °C (Gray, J. V.;
Eren, D.; Knowles, J. R. Biochemistry 1990, 29, 8872-8878) and 270 s-1
at 25 °C (Rajagopalan, J. S.; Taylor, K. M.; Jaffe, E. K. Biochemistry 1993,
32, 3965).
(31) Pawlak, J. L.; Padykula, R. E.; Kronis, J. D.; Aleksejczyk, R. A.;
Berchtold, G. A. J. Am. Chem. Soc. 1989, 111, 3374-3381.
(32) Cornish, V. W.; Mendel, D.; Schultz, P. G. Angew. Chem., Int. Ed.
Engl. 1995, 34, 621-633.
(33) Ellman, J.; Mendel, D.; Anthony-Cahill, S.; Noren, C. J.; Schultz,
P. G. Methods Enzymol. 1991, 202, 301-337.
(29) Stewart, J.; Wilson, D. B.; Ganem, B. J. Am. Chem. Soc. 1990,
112, 4582-4584.
(34) Noren, C. J.; Anthony-Cahill, S. J.; Griffith, M. C.; Schultz, P. G.
Science 1989, 244, 182-188.