Facile synthesis of oligodeoxyribonucleotides via the phosphoramidite method without nucleoside base protection

Article abstract of DOI:10.1021/ja973731g

A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or with tert-butyl hydroperoxide, a dinucleoside phosphate in > 95% yield. In the solid-phase synthesis, which requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-phase approach include (5')GTCACGACGTTGTAAAACGAC(3') (21mer), (5')CAGGAAACAG-CTATGACCATG(3') (21mer), (5')CAAGTTGATGAACAATACTTCATACCTAAACT(3') (32mer), and (5')TATGGGCCTTTGATAGGATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTATT(3') (60mer), which are provided in excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated.

Full text of DOI:10.1021/ja973731g

J. Am. Chem. Soc. 1998, 120, 12395-12401
12395
Facile Synthesis of Oligodeoxyribonucleotides via the
Phosphoramidite Method without Nucleoside Base Protection
Yoshihiro Hayakawa* and Masanori Kataoka
Contribution from the Laboratory of Bioorganic Chemistry, Graduate School of Human Informatics,
Nagoya UniVersity, Chikusa, Nagoya 464-8601, Japan
ReceiVed October 28, 1997. ReVised Manuscript ReceiVed June 3, 1998
Abstract: A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base
protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter
for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation
is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside
phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or
with tert-butyl hydroperoxide, a dinucleoside phosphate in >95% yield. In the solid-phase synthesis, which
requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine
undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free
derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the
chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-
phase approach include 5′GTCACGACGTTGTAAAACGAC3′ (21mer), 5′CAGGAAACAG-CTATGACCATG3′
(21mer), 5′CAAGTTGATGAACAATACTTCATACCTAAACT3′ (32mer), and 5′TATGGGCCTTTTGATAG-
GATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTTATT3′ (60mer), which are provided in
excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated.
Introduction
°C) ) ca. 5 h],6 which is a serious problem in the N-protected
method, particularly using the building blocks with acyl
protectors such as benzoyl (t1/2 ) ca. 5 min)6 and phenoxyacetyl
(PAC) (t1/2 ) ca. 25 min).9 To solve these problems, Letsinger
recently reported a pioneering DNA synthesis with N-unpro-
tected building blocks which employs a mixture of pyridinium
hydrochloride and aniline5 or imidazole10 as the activator of
the phosphoramidites.11,12 However, this method has some
drawbacks and limitations, e.g., the pyridinium salt is very
hygroscopic and thus not suitable for a synthesis requiring
anhydrous conditions. Further, the mixed activator is useful
for some limited phosphoramidites such as methyl N,N-
diisopropylphosphoramidites but not quite effective for widely
employed 2-cyanoethyl N,N-diisopropylphosphoramidites.3a In
Synthesis of oligodeoxyribonucleotides is an important
component in nucleic acid researches,1 and the phosphoramidite
method is currently seeing the most use.1a,b,2-4 This method
includes the condensation of a nucleoside phosphoramidite and
a nucleoside; in this key step, NH2 moieties of nucleoside bases
have universally been protected to prevent the undesired
N-phosphitylation in the conventionally employed synthetic
methods.1b As Letsinger has stated,5 ideally it would be best
to avoid the N-protecting groups because they entail at least
two additional steps, introduction and removal, and the reagents
required in these steps limit the range of functional groups that
can be tolerated in the synthesis. Further, the approach without
nucleoside base protection (the N-unprotected method) may
considerably diminish the risk of depurination of deoxyadeno-
sine1b,6,7,8 [t1/2 (2% dichloroacetic acid in dichloromethane, 25
(6) Froehler, B. C.; Matteucci, M. D. Nucleic Acids Res. 1983, 11, 8031-
8036.
(7) (a) Vu, H.; McCollum, C.; Jacobson, K.; Theisen, P. Tetrahedron
Lett. 1990, 31, 7269-7272. (b) McBrid, L. J.; Kierzek, R.; Beaucage, S.
L.; Caruthers, M. H. J. Am. Chem. Soc. 1986, 108, 2040-2048.
(8) Schulhof, J. C.; Molko, D.; Teoule, R. Nucleic Acids Res. 1987, 15,
397-416.
(9) A result obtained in our laboratory.
(10) Gryaznov, S. M.; Letsinger, R. L. Nucleic Acids Res. 1992, 20,
1879-1882.
(11) Solution-phase synthesis of dinucleoside phosphates via the phos-
phoramidite approach, using N-unprotected nucleoside phosphoramidites
and nucleosides as building blocks and N-methylanilinium trifluoroacetate
or trichloroacetate as the promoter, was also reported in the following:
Fourrey, J.-L.; Varenne, J. Tetrahedron Lett. 1985, 2663-2666.
(12) There are a number of methods for the synthesis of oligodeoxyri-
bonucleotides using N-unprotected building blocks, as follows. The H-
phosphonate method: (a) Wada, T.; Sato, Y.; Honda, F.; Kawahara, S.;
Sekine, M. J. Am. Chem. Soc. 1997, 119, 12710-12721. (b) Kung, P. P.;
Jones, R. A. Tetrahedron Lett. 1992, 33, 5869-5872. The hydroxyl-
activation method: (c) Uchiyama, M.; Aso, Y.; Noyori, R.; Hayakawa, Y.
J. Org. Chem. 1993, 58, 373-379 and references therein. (d) Noyori, R.;
Uchiyama, M.; Nobori, T.; Hirose, M.; Hayakawa, Y. Aust. J. Chem. 1992,
45, 205-225.
(1) For comprehensive reviews on oligonucleotide synthesis, see: (a)
Beaucage, S. L.; Iyer, R. P. Tetrahedron 1993, 49, 6123-6194. (b)
Beaucage, S. L.; Iyer, R. P. Tetrahedron 1992, 48, 2223-2311. (c)
Caruthers, M. H. Science 1985, 230, 281-285. (d) Hata, T.; Matsuzaki, J.
J. Synth. Org. Chem., Jpn. (in Japanese) 1984, 42, 429-436. (e) Narang,
S. A. Tetrahedron 1983, 39, 3-22. (f) Ikehara, M.; Ohtsuka, E.; Markham,
A. F. AdV. Carbohydr. Chem. Biochem. 1979, 36, 135-213. (g) Reese, C.
B. Tetrahedron 1978, 34, 3143-3179. (h) Amarnath, V.; Broom, A. D.
Chem. ReV. 1977, 77, 183-217. (i) Zhdanov, R. I.; Zhenodarova.
(2) Hayakawa, Y.; Kataoka, M.; Noyori, R. J. Org. Chem. 1996, 61,
7996-7997.
(3) (a) Sinha, N. D.; Biernat, J.; Ko¨ster, H. Tetrahedron Lett. 1983, 24,
5843-5846. (b) McBride, L. J.; Caruthers, M. H. Ibid. 1983, 24, 245-
248. (c) Adams, S. P.; Kavka, K. S.; Wykes, E. J.; Holder, S. B.; Galluppi,
G. R. J. Am. Chem. Soc. 1983, 105, 661-663. (d) Matteucci, M. D.;
Caruthers, M. H. Ibid. 1981, 103, 3185-3191. (e) Beaucage, S. L.;
Caruthers, M. H. Tetrahedron Lett. 1981, 22, 1859-1862.
(4) (a) Pon, R. T. Tetrahedron Lett. 1987, 28, 3643-3646. (b) Froehler,
B. C.; Matteucci, M. D. Ibid. 1983, 24, 3171-3174.
(5) Gryaznov, S. M.; Letsinger, R. L. J. Am. Chem. Soc. 1991, 113,
5876-5877.
10.1021/ja973731g CCC: $15.00 © 1998 American Chemical Society
Published on Web 11/18/1998

12396 J. Am. Chem. Soc., Vol. 120, No. 48, 1998
Hayakawa and Kataoka
addition, the yield of phosphitylation is not sufficiently high
for the synthesis of long oligonucleotides. We report here that
imidazolium triflate (1)13 eliminates these drawbacks, serving
as a more effective promoter in both solution-phase and solid-
phase syntheses of oligodeoxyribonucleotides via the phos-
phoramidite method without nucleoside base protection.
accordingly, the production of the phosphoramidite 8 required
N-protection by the amidine group. Thus, at first, 2′-deox-
yguanosine was converted to 17 (96% yield) by the treatment
with (dimethoxy)(dimethylamino)methane in methanol (50 °C,
15 h).7 Subsequently, 17 was successively reacted with DMTrCl
in pyridine (25 °C, 60 min), affording 18 (68% yield), and with
aqueous ammonia and pyridine to give 4 (97% yield). Finally,
coupling of 4 with (CNCH2CH2O)[(i-C3H7)2N]PCl in THF by
the assistance of ethyldiisopropylamine (-78 to 25 °C, 60 min)
provided 8 in 97% yield (63% overall yield from the starting
material). In these preparations, the introduction of the phos-
phoramidite function to the 3′-O-free precursor was also
achieved in >95% isolated yield by the reaction with (CNCH2-
CH2O)P[N(i-C3H7)2]2 (1.10 equiv) promoted by 1 (0.30 equiv)
in dichloromethane (25 °C, 60 min). These amidites were
obtained as a colorless solid with >95% purity by trituration
of the crude products from petroleum ether. The structures of
6-9 were confirmed by the 31P NMR signals appearing δ 149-
150 ppm (H3PO4 standard) (cf. the 31P NMR signals due to
N-phosphoramidityl products: δ 123-127 ppm). The stability
of the N-free compounds is similar to that of N-protected
derivatives, and no decrease in their quality was observed by
storage for several months under normal conditions. The
N-unprotected nucleoside phosphoramidites 6-9 could be
obtained generally via a shorter pathway and in higher yields
than the N-acyl-protected analogues employed in conventional
methods.18
Results and Discussion
The key reagent 1, mp 197-198 °C, was quantitatively
prepared by mixing imidazole and trifluoromethanesulfonic acid
in equimolar amounts in dichloromethane at ambient temper-
ature or in a 1:1 mixture of methanol and ether at 0 °C. This
reagent has good solubility in acetonitrile, >1.0 mol/L, and high
stability when stored at ambient temperature under atmospheric
conditions.
The reagent 1 is an excellent promoter20 that allows rapid
and highly chemoselective condensation of the phosphoramidite
and the N-free nucleoside 14, 15, or 16 when equimolar amounts
of these substrates are employed in a solution phase. For
example, the reaction of 6 and 14 in acetonitrile was ac-
complished within 5 min to give, after oxidation with bis-
(18) According to previous studies, some representative N-acyl-protected
nucleoside phosphoramidites are prepared as follows. The deoxyadenosine
phosphoramidite with N4-PAC protection, 10, was obtained from 2′-
deoxyadenosine in 35% overall yield in three steps, i.e., (i) the N-protection
using phenoxyacetic anhydride (65% yield), (ii) the 5′-O-protection with
DMTrCl (60% yield), and (iii) the phosphoramidite formation with CNCH2-
CH2O)P[N(i-C3H7)2]2 in the presence of diisopropylammonium tetrazolide
(90% yield).19 In this preparation, the N-protection was also achieved by
successive treatments with trimethylsilyl chloride in pyridine, DMTrCl,
phenoxyacetyl chloride, and 1-hydroxybenzotriazole (HOBT), and a 1:1:3
mixture of triethylamine, pyridine, and water (65% overall yield).8 Just as
in this latter process, where benzoyl chloride and pyridine are used in place
of phenoxyacetyl chloride and HOBT, N-benzoyldeoxyadenosine phos-
phoramidite can be prepared in a higher overall yield14,15 comparable to
that of the preparation of the N-unprotected analogue. However, the
benzoylated derivative is rarely used at present due to its tendency to undergo
depurination. The preparation of N-isobutyryldeoxycytidine phosphoramidite
11 from deoxycytidine is achieved in 32% overall yield via a pathway
consisting of (i) the introduction of the isobutyryl protecting group to the
nucleoside base by successive treatment in one pot with trimethylsilyl
chloride, isobutyryl chloride, and aqueous ammonia (60% yield), (ii) the
5′-O-dimethoxytritylation (75% yield), and (iii) the phosphoramiditylation
with (CNCH2CH2O)P[N(i-C3H7)2]2 and diisopropylammonium tetrazolide
(70% yield).15 In a similar manner, the N-benzolydeoxycytidine phosphora-
midite 12 can be synthesized in a higher yield (69% overall yield)15
comparable to that of 6, but this derivative is less useful than 11 because
removal of the benzoyl protector requires rather harsh basic conditions that
cause the cleavage of the internucleotide linkage. The N-PAC-protected
deoxyguanosine phosphoramidite 13 is obtained from the parent nucleoside
in 28% overall yield via a five-step process similar to that employed for
the preparation of 11.19
N-free nucleoside 3′-phosphoramidites 6-9 as monomer units
requisite for the synthesis were prepared as follows. Reaction
of 2′-deoxyadenosine and p,p′-dimethoxytrityl chloride (DMTrCl)
(1.00 equiv) in the presence of dichloroacetic acid and triethy-
lamine in pyridine (25 °C, 4 h) gave 2 in 77% yield,14 which
was then condensed with (CNCH2CH2O)[(i-C3H7)2N]PCl in
THF by the aid of ethyldiisopropylamine15 (-78 to 25 °C, 60
min) to afford 6 in >95% yield (>73% overall yield).
Preparation of the deoxycytidine and thymidine analogues 7 and
9 were also performed by starting from the parent nucleosides
via the two-step process shown in the preparation of 6, in which
the yields of tritylation giving 316 and 517 were 70 and 85%,
respectively, and those of the amidite formation were >95% in
both cases (>66 and 81% overall yields, respectively). In 2′-
deoxyguanosine, the 5′-O-selective dimethoxytritylation of the
parent 2′-deoxyguanosine could not be directly achieved, and
(13) Hayakawa, Y.; Kataoka, M. Presented at the International Confer-
ence on Nucleic Acids and Related Macromolecules: Synthesis, Structure,
Function and Applications, Ulm, Germany, September 1997; Paper PL14.
(14) Ti, G. S.; Gaffney, B. L.; Jones, A. R. J. Am. Chem. Soc. 1982,
104, 1316-1319.
(15) Sina, N. D.; Biernet, J.; McMarus, J.; Ko¨ster, H. Nucleic Acids Res.
1884, 12, 4539-3557.
(16) Ishido, Y. Jpn. Kokai Tokkyo Koho Jp. Patent 01 308 294 [89 308
294], 1989; Chem. Abstr. 1990, 112, 700.
(19) Schulhof, J. C.; Molko, D.; Teoule, R. Tetrahedron Lett. 1987, 28,
51-54. The monomer building blocks were supplied by Amersham
Pharmacia Biotech.
(20) As reported in ref 2, 1 is not effective as a promoter of the
condensation using lowly reactive phosphoramidites such as o-chlorophenyl
phosphoromorpholidites. This salt, however, acts as an excellent activator
toward fairly reactive phosphoramidites, such as 2-cyanoethyl N,N-
diisopropylphosphoramidites.
(17) Schaller, H.; Weimann, G.; Lerch, B.; Khorana, H. G. J. Am. Chem.
Soc. 1963, 85, 3821-3827.

Facile Synthesis of Oligodeoxyribonucleotides
J. Am. Chem. Soc., Vol. 120, No. 48, 1998 12397
Table 1. Preparation of Dinucleoside Phosphates in a Solution
Phasea
amidite
nucleoside
productb
yield,c %
6
6
6
7
7
7
8
8
9
14
15
16
14
15
16
14
16
14
19
20
21
22
23
24
25
26
27
95
93
95
96
95
94
96
98
98
a Condensation was carried out using amidite, nucleoside, and
imidazolium triflate in an equimolar ratio in acetonitrile at 25 °C for 5
min. The resulting phosphite was directly oxidized by bis(trimethyl-
silyl)peroxide with trimethylsilyl triflate as a catalyst in an acetonitrile-
CH2Cl2 mixture (25 °C, 5 min) to the phosphate. b The product was
obtained as ca. 1:1 mixture of diastereomers. c Isolated yield.
Figure 1. 31P NMR spectrum of crude 20.
used in the solid-phase synthesis of oligonucleotides, was not
achieved with perfect chemoselectivity in the cases using the
N-free adenyl phosphoramidite 6 or cytosyl phosphoramidite
7. Thus, phosphitylation of the thymidine 30, attached to
TentaGel support via the long-chain alkylamine spacer arm, with
a 1:1 mixture of 1 and 6 (25 equiv each to 30) (1 min) gave not
only the desired phosphite 31 (31P NMR: δ 140 ppm) but also
a small amount (4%) of its N-phosphitylated derivative(s)
showing 31P NMR signals at δ 123-127 ppm.22,23 A similar
result was obtained in the reaction of 7, affording ca. 8% of
undesired N-phosphitylated product in addition to 32. However,
these N-phosphitylated compounds could be quantitatively
reverted to the N-free derivative 31 or 32 without cleavage of
the internucleotidic phosphite linkage by treatment with benz-
imidazolium triflate2 (50 equiv) in methanol at 25 °C for 2 min,
while the subsequent treatment with TBHP for oxidation (1 min)
to the phosphate,21 with dichloroacetic acid for detritylation (2
min), and with concentrated ammonia for removal of the
cyanoethyl protector and detachment from the solid support (180
min), gave the target compounds 35 and 36 in 94 and 96%
isolated yields, respectively. Accordingly, the preparation of
nucleotides via the N-unprotected method was considered to
have been accomplished in a formal sense. Here, the removal
of the N-phosphityl group had to be carried out prior to the
oxidation, since the N-phosphoryl group could not be eliminated
by the benzimidazolium triflate-methanol reaction. The phos-
phitylation of 30 by the guanyl or thyminyl phosphoramidite 8
or 9 under similar conditions proceeded in a perfect O-selective
manner to give the phosphites 33 and 34, showing signals at δ
140-141 ppm. The subsequent oxidation, deprotection, and
detachment afforded 37 or 38 in 94 or 95% isolated yield,
respectively. The reaction using other promoters, such as
benzimidazolium triflate, 1H-tetrazole, or 5-(p-nitrophenyl)-1H-
tetrazole, produced a considerable amount of N-phosphitylation
of the adenyl and cytosyl derivatives. For example, the reaction
of 6 or 7 and 30 with 1H-tetrazole gave the N-phosphityl
product(s) in 70-250% yield. In such cases, the quantitative
removal of the N-phosphityl group could not be achieved by
(trimethylsilyl) peroxide21 or with tert-butyl hydroperoxide
(TBHP),21 19 in 95% isolated yield as a mixture of two
diastereomers. The structure of 19 and purity of the crude
material was confirmed by the 31P NMR spectrum, which shows
two eminent signals at -1.1 and -1.0 ppm (H3PO4 standard),
supporting the presence of the diastereomeric phosphotriester
functions, but no detectable signal due to N-phosphoryl products
(Figure 1) (cf. the 31P NMR signals due to N-phosphoryl
products: δ 0-2 ppm). Such high-yield and selective prepara-
tions of dinucleoside phosphates were also achieved with other
N-free phosphoramidites and nucleosides. Table 1 lists several
examples of the preparation via this method. By contrast, the
reaction using excess equivalents of the phosphoramidite and
the promoter to the nucleoside, which is a reaction generally
(22) The 31P NMR signals suggested formation of N-phosphitylated
products, but their exact structure was not determined.
(23) When other promoters were used, such as benzimidazolium triflate,
1H-tetrazole, and 5-(p-nitrophenyl)-1H-tetrazole, there was considerable
N-phosphitylation of the adenyl and cytosyl derivatives. For example, the
reaction of 6 or 7 and 30 with 1H-tetrazole gave the N-phosphityl product-
(s) in 70-250% yield. In such cases, the quantitative removal of the
N-phosphityl group could not be achieved by the brief treatment with
benzimidazolium triflate in methanol. Guanyl and thyminyl bases underwent
little or no N-phosphitylation even when benzimidazolium triflate, 1H-
tetrazole, or 5-(p-nitrophenyl)-1H-tetrazole was used as the promoter.
(21) Hayakawa, Y.; Uchiyama, M.; Noyori, R. Tetrahedron Lett. 1986,
27, 4191-4194.

12398 J. Am. Chem. Soc., Vol. 120, No. 48, 1998
Table 2. Reaction Sequence of the Solid-Phase Synthesis
Hayakawa and Kataoka
step
operation
reagent(s)
CH3CN
3% CCl3COOH/CH2Cl2
CH3CN
time, min
1
2
3
4
washing
detritylation
washing
0.3
2.0
2.0
1.0
coupling
0.1 M amidite/CH3CN +
0.1 M IMTa/CH3CN
CH3CN
5
6
7
8
9
washing
N-P cleavage
washing
oxidation
washing
0.3
2.0
0.6
0.8
0.3
0.5 M BITb/CH3OH
CH3CN
1 M t-C4H9OOH/toluene
CH3CN
the brief treatment with benzimidazolium triflate in methanol.
Guanyl and thyminyl bases did not undergo N-phosphitylation
even when benzimidazolium triflate, 1H-tetrazole, or 5-(p-
nitrophenyl)-1H-tetrazole was used as the promoter. No detri-
tylation, depurination or depyrimdination, or oxidation of the
nucleoside was observed throughout the entire process. These
results confirmed the solid-phase synthesis of oligodeoxyribo-
nucleotides via the phosphoramidite method using N-unprotected
building blocks (the unprotected method).
Figure 2. Capillary gel electrophoresis profiles of crude products of
41 and 42: (A) 41 prepared via the unprotected method; (B) 41 prepared
via the PAC-protected method; (C) 42 synthesized by the unprotected
method.
We prepared four kinds of DNA oligomers, 5′GTCAC-
GACGTTGTAAAACGAC3′ (39) (21mer), 5′CAGGAAACAGC-
TATGACCATG3′ (40) (21mer), 5′CAAGTTGATGAAC-AATA-
5′
CTTCATACCTAAACT3′ (41) (32mer),24 and TATGGGCC-
TTTTGATAGGATG-CTCACCGAGCAAAACCAAGAACAA-
CCAGGAGATTTTATT3′ (42) (60mer).24
The synthesis by the unprotected method was performed with
6-9 as the monomer units on 1-µmol scale on an Applied
Biosystems 381A DNA synthesizer, starting from the suitable
solid-anchored nucleoside 29, 30, or 31. Table 2 shows the
reaction cycle for the chain elongation which required 10.3 min.
Since the dimethoxytrityl cation analysis indicated that the
average coupling yield is >99.8% in all the syntheses, the step
for capping the unreacted hydroxyl was eliminated in the
reaction sequence. After the final condensation, removal of the
dimethoxytrityl protector of the 5′-hydroxyl terminus by expo-
sure to dichloroacetic acid in dichloromethane (2 min), followed
by the simultaneous deblocking of the cyanoethyl protectors of
the internucleotide linkages and detachment of the product from
the solid support by treatment with concentrated ammonia (180
min), gave the oligomers 39-42. Isolated yields were 72%
for 39, 74% for 40, 78% for 41, and 54% for 42. The purity of
41 and 42 in the crude forms was analyzed by capillary gel
electrophoresis (CGE). With respect to 41, the purity was
compared with that of the crude product obtained by an approach
using the N-PAC-protected nucleoside phosphoramidite as a
monomer unit (the PAC-protected method8,18). Figure 2 il-
lustrates CGE profiles of the two kinds of 41 and 42. The
analysis exhibited that 41 produced by the unprotected approach
is of an excellent quality that is comparable to that derived from
the PAC-protection method (cf. the spectra A and B).25 The
profile of 42 (the spectrum C) also indicated the high purity of
this oligomer. The crude 41 was further subjected to mass
spectrometry to confirm its purity and structure. The MALDI
time-of-flight (TOF) mass spectrum (Figure 3) provided a single
Figure 3. MALDI-TOF mass spectrum of crude 42 synthesized by
the unprotected method.
peak at m/z 9757.94 in the region where the molecular peak
appears. This result supported the structure of 41 (C313H394
-
N119O186P31), whose calculated molecular weight is 9759.43.
The electrospray mass spectrum also suggested that the molec-
ular weight of 41 is 9759.56. These results supported the
structure as well as the high purity of 41, while the same mass
spectrometric analyses of 42 gave no eminent peak in the
molecular-weight area. Therefore, the purity of 42 was further
investigated by HPLC analysis of the products obtained by
digestion of the crude product with snake venom phosphodi-
esterase and bacterial alkaline phosphatase.26 The digests of 42
provided only four kinds of nucleosides, dA:dC:dG:T ) 20.4:
12.1:12.5:14.9, which agrees well with the calculated ratio, 20:
12:13:15, confirming the high purity of 42; few undesired
compounds, including the N-dimethoxytritylated, N-phospho-
rylated, and N-oxidized nucleosides, were detected. In addition,
no product arising from depurination of deoxyadenosine and
deoxyguanosine was observed.
The oligomers obtained by the present method were shown
to be highly effective as primers for use in PCR amplification.
For example, the reaction using 39 and 40 as universal primers
Fw and Rv, respectively, and two kinds of vectors, the
Sphaeroides motA gene27 inserted into the pSU41 vector
(24) Hayakawa, Y.; Wakabayashi, S.; Kato, H.; Noyori, R. J. Am. Chem.
Soc. 1990, 112, 1691-1696.
(25) Another synthesis using benzoyl protectors for adenyl and cytosyl
bases and isobutyryl protectors for guanyl moieties was also examined, but
the CGE of the crude product showed only broad signals and no clearly-
separated peaks. This result indicated that, in this synthesis, removal of the
protecting groups requiring harsh basic conditions (concentrated ammonia,
55 °C, 12 h) caused considerable decomposition of the oligomer, such as
cleavage of internucleotide linkage (see ref 24).
(26) Eadie, J. S.; McBride, L. J.; Efcavitch, J. W.; Hoff, L. B.; Cathcart,
R. Anal. Biochem. 1987, 165, 442-448.
(27) Bartolome`, B.; Jubete, Y.; Martinez, E.; de la Cruz, F. Gene 1991,
102, 75-78.

Facile Synthesis of Oligodeoxyribonucleotides
J. Am. Chem. Soc., Vol. 120, No. 48, 1998 12399
on a JASCO 88-PU chromatograph with a JASCO 870-UV-absorption
detector. A solid-phase syntheses were conducted on a Model 381A
DNA synthesizer of Applied Biosystems. Capillary gel electrophoresis
(CGE) was done in ISIS Pharmaceuticals, Inc. PCR was performed
on a GeneAmp PCR System Model 9700 of Applied Biosystems. Time-
of-flight (TOF) mass analysis was achieved at the Medical School,
Nagoya University. Measurement of electrospray (ES) mass spectra
was carried out at Tokyo Medical and Dental University. Elemental
analysis was performed at the Graduate School of Human Informatics
or the Faculty of Agriculture, Nagoya University. E. Merck Kieselgel
60 (70-230 mesh) deactivated by adding 6% of water was used for
column chromatography. Unless otherwise stated, reactions were
carried out at ambient temperature. Acetonitrile was distilled from
CaH2. Other organic solvents were used after simple distillation of
the commercially supplied ones.
Materials. Imidazole (Nacalai Tesque), benzimidazole (Nacalai
Tesque), trifluoromethanesulfonic acid (Central Glass), (dimethoxy)-
(dimethylamino)methane (Nacalai Tesque), 2′-deoxyadenosine (Ya-
masa), 2′-deoxycytidine hydrochloride (Yamasa), 2′-deoxyguanosine
(Yamasa), thymidine (Yamasa), and 5′-O-(p,p′-dimethoxytrityl)thymi-
dine 3′-(2-cyanoethyl N,N-diisopropylphosphoramidite) (9) (Applied
Biosystems, Inc.) were commercially supplied. 5′-O-(p,p′-Dimethoxy-
trityl)-2′-deoxyadenosine (2),14 5′-O-(p,p′-dimethoxytrityl)-2′-deoxy-
cytidine (3),16 5′-O-(p,p′-dimethoxytrityl)-2′-deoxyguanosine (4),7 5′-
O-(p,p′-dimethoxytrityl)thymidine (5),17 3′-O-(tert-butyldimethylsilyl)-
2′-deoxyadenosine (14),30 3′-O-(tert-butyldimethylsilyl)-2′-deoxycytidine
(15),30 3′-O-(tert-butyldimethylsilyl)thymidine (16),30 and bis(trimeth-
ylsilyl)peroxide (TMSOOTMS)21,31 and a toluene solution of anhydrous
tert-butyl hydroperoxide21,32 were prepared by the reported methods.
Imidazolium Triflate (1). Method A. Trifluoromethanesulfonic
acid (6.6 g, 3.9 mL, 44 mmol) was added over 30 min to a solution of
imidazole (3.0 g, 44 mmol) in dichloromethane (10 mL), and the
mixture was stirred for 30 min. The reaction mixture was diluted with
diethyl ether (20 mL). The occurring crystalline 1 (9.5 g, 99% yield),
mp 197-198 °C, was collected by filtration. IR: 3142, 1589, 1449,
Figure 4. Etidium bromide-stained 2% agarose gel showing the size
variant of the PCR-amplified plasmids of pYA701 and pSK602 with
39 and 40 (crude forms) synthesized by the N-unprotected method (lanes
2 and 4) and purchased from Pharmacia Biotech (lanes 3 and 5) as
primers. Takara 100-bp DNA ladder was used as a standard DNA
marker (lanes 1 and 6).
(pYA701)28 and the pYA2032 H-E fragment inserted into the
pSU41 vector (pSK602),28 as templates was carried out on an
Applied Biosystems GeneAmp PCR System Model 9700 to give
the target 0.9- and 0.5-kb oligomers, respectively. Figure 4
exhibits agarose gel electrophoresis profiles of the crude
products, showing that they have a high purity, which compares
favorably to that of oligomers prepared with commercially
supplied primers from Amersham Pharmacia Biotech.
1254 cm-1 1H NMR (CD3OD): 8.08 (s, 2H), 9.36 (s, 1H). 13C NMR
.
Conclusion
(CD3OD): 119, 122, 134. Anal. Calcd for C4H5F3N2O3S: C, 22.02;
H, 2.31; N, 12.84. Found: C, 21.96; H, 2.30; N, 12.74. This material
was used without further purification for the condensation of a
nucleoside and a nucleoside phosphoramidite.
Method B. To a solution of imidazole (3.0 g, 44 mmol) in a mixture
of methanol (10 mL) and diethyl ether (10 mL) was slowly added a
solution of trifluoromethanesulfonic acid (6.6 g, 3.9 mL, 44 mmol)
over 10 min at 0 °C, and stirring was continued at the same temperature
for additional 30 min. To the reaction mixture was added diethyl ether
(30 mL), and the resulting 1 as crystals (9.5 g, 99% yield) was collected
by filtration.
5′-O-(p,p′-Dimethoxytrityl)-2′-deoxycytidine (3). To a homoge-
neous mixture of 2′-deoxycytidine hydrochloride (10.5 g, 40.0 mmol),
dichloroacetic acid (3.30 mL, 5.16 g, 40.0 mmol), and triethylamine
(5.58 mL, 4.05 g, 40.0 mmol) in dry pyridine was added p,p′-
dimethoxytrityl chloride (14.9 g, 44.4 mmol), and the resulting solution
was stirred at 25 °C for 1.5 h. The reaction mixture was quenched by
adding methanol (2.0 mL) and concentrated. The occurring gummy
material was dissolved in dichloromethane (100 mL) and washed with
an aqueous sodium hydrogencarbonate solution (40 mL) followed by
brine (40 mL). Concentration of the organic layer gave an orange gum
(28 g), which was treated with a mixture of acetone and toluene to
afford 3 (15.4 g, 70% yield) as a colorless powder. 1H NMR: 2.01-
2.10 (m, 1H), 2.39-2.48 (m, 1H), 3.22-3.34 (m, 2H), 3.63 (s, 6H),
3.86-3.91 (m, 1H), 4.32-4.38 (m, 1H), 5.41 (d, 1H, J ) 6.8 Hz),
6.10 (t, 1H, J ) 5.9 Hz), 6.64-6.69 (m, 5H), 7.05-7.24 (m, 11H),
7.75 (d, 1H, J ) 7.32 Hz).
We have demonstrated an efficient synthesis of oligodeox-
yribonucleotides by the phosphoramidite approach without
nucleoside base protection, in which key reactions include the
highly chemoselective condensation of a nucleoside phosphora-
midite and a nucleoside promoted by 1, as well as the
quantitative removal of a phosphityl group on the amino groups
of the adenine and cytosine moieties by the benzimidazolium
triflate-methanol treatment. The products generally have an
excellent purity in the crude form and can be applied to a variety
of molecular biological or biochemical purposes, including PCR
amplification of DNAs. This new approach is superior to the
existing methods in that it is easier to perform, gives higher
yields of monomer units, and runs little risk of depurination of
adenosine and guanosine bases. Further, this method is expected
to be useful for the synthesis of DNA oligomers with base-
labile modified backbones, such as alkylphosphonates, phos-
photriesters, and phosphorothioates.29
Experimental Section
General Methods. Melting points (mp) are uncorrected. IR spectra
were measured in KBr on a JASCO FT/IR-5300 spectrometer. UV
spectra were taken in MeOH on a JASCO Ubest-55 spectrometer. NMR
spectra were obtained in CDCl3 unless otherwise noted on a JEOL
R-400 instrument. The 1H and 13C NMR chemical shifts are described
as δ values in parts per million relative to (CH3)4Si. 31P NMR chemical
shifts are reported as δ values in parts per million downfield from 85%
H3PO4. High-performance liquid chromatography (HPLC) using a
COSMOSIL 5C18-MS column (ODS-5 µm, 100 Å) was carried out
5′-O-(p,p′-Dimethoxytrityl)-2′-deoxyguanosine (4). To a suspen-
sion of 2′-deoxyguanosine (10.7 g, 40.0 mmol) in dry methanol (100
mL) was added (dimethoxy)(dimethylamino)methane (9.66 mL, 9.53
(30) Ogilvie, K. K. Can. J. Chem. 1973, 51, 3799-3807.
(31) Cookson, P. G.; Davies, A. G.; Fazal, N. J. Organomet. Chem. 1975,
99, C31-C32.
(32) Hill, J. G.; Rossiter, B. E.; Sharpless, K. B. J. Org. Chem. 1983,
48, 3607-3608.
(28) Asai, Y.; Kojima, S.; Kato, H.; Nishioka, N.; Kawagishi, I.; Homma,
M. J. Bacteriol. 1997, 5104-5110.
(29) The syntheses of the modified oligoDNAs will be published in a
separate paper.

12400 J. Am. Chem. Soc., Vol. 120, No. 48, 1998
Hayakawa and Kataoka
g, 80.0 mmol), and the mixture was stirred at 55 °C for 15 h. The
reaction mixture was cooled to ambient temperature. The resulting
colorless precipitates were collected by filtration and dried in vacuo to
give 17 (12.4 g, 96% yield). This material (12.2 g, 37.9 mmol) and
p,p′-dimethoxytrityl chloride (13.5 g, 40.0 mmol) and 17 (12.2 g, 37.9
mmol) were dissolved in dry pyridine (50 mL), and the resulting
solution was stirred at 25 °C for 12 h. The reaction mixture was diluted
with methanol (2.0 mL). Concentration of the organic solution
produced a viscous oil, which was dissolved in dichloromethane (100
mL). The solution was washed with a sodium hydrogencarbonate
solution (40 mL) and brine (40 mL). The organic layer was evaporated
to give an orange gum (30 g). The crude material was subjected to
column chromatography on silica gel with a 1:20 mixture of methanol
and dichloromethane as eluent, giving 18 (16.1 g, 68% yield from 17)
as a colorless amorphous solid. The product 18 (16.0 g, 25.6 mmol)
was then treated with pyridine (50 mL) containing concentrated
ammonia (10 mL) at 25 °C for 24 h. The resulting solution was poured
into vigorously stirred water (10 mL) to form colorless precipitates,
which were collected by filtration and dried in vacuo to give 4 (14.1
g, 97% yield from 18; 63% overall yield from 2′-deoxyguanosine) as
a powder. 1H NMR: 2.22-2.31 (m, 1H), 2.57-2.67 (m, 1H), 3.09-
3.15 (m, 2H), 3.71 (s, 6H), 3.87-3.91 (m, 1H), 4.32-4.35 (m, 1H),
5.28 (d, 1H, J ) 4.4 Hz), 6.12 (dd, 1H, J ) 6.3, 6.8 Hz), 6.42 (br s,
2H), 6.81 (dd, 4H, J ) 6.8, 8.8 Hz), 7.17-7.34 (m, 9H), 7.76 (s, 1H),
10.58 (br s, 1H). This material was used for the next preparation of
the 3′-phosphoramidite without further purification.
5′-O-(p,p′-Dimethoxytrityl)-2′-deoxyadenosine 3′-(2-Cyanoethyl
N,N-diisopropylphosphoramidite) (6). A Typical Procedure for the
Preparation of N-Unprotected Nucleoside 3′-Phosphoramidites.
Method A. A solution of 5′-O-(p,p′-dimethoxytrityl)-2′-deoxyadenos-
ine (2) (11.1 g, 20.0 mmol) and ethyldiisopropylamine (3.88 g, 5.23
mL, 30.0 mmol) in tetrahydrofuran (40 mL) was cooled to -78 °C,
and to this was added (2-cyanoethyl)(N,N-diisopropylamino)chloro-
phosphine (4.97 g, 4.68 mL, 21.0 mmol). The mixture was warmed
to 25 °C and stirred at the same temperature for 60 min. The reaction
mixture was washed with an aqueous sodium hydrogencarbonate
solution (100 mL) and brine (100 mL). The organic solution was dried
over Mg2SO4 and concentrated to give a viscous oil, which was
dissolved in dichloromethane (50 mL). The resulting solution was
poured into a vigorously stirred petroleum ether (2.0 L) to precipitate
a colorless powder. Filtration of the solid material gave 6 (14.7 g 97%
yield). IR: 1757, 1612, 1510, 1361 cm-1. UV: λmax 237 (ꢀ 22 200),
267 nm (16 800). 1H NMR: 1.05-1.33 (m, 12H), 2.42 (t, 1H, J )
10.5 Hz), 2.43-2.72 (m, 2H), 2.81-2.93 (m, 1H), 3.22-3.78 (m, 12H),
4.23-4.55 (m, 1H), 4.70-4.83 (m, 1H), 6.04-6.20 (br s, 2H), 6.41-
6.49 (m, 1H), 6.72-6.78 (m, 4H), 7.13-7.42 (m, 9H), 7.96, 8.01 (2 s,
1H), 8.25 (s, 1H). 31P NMR: 149.4, 149.3. Anal. Calcd for
C40H48N7O6P: C, 63.73; H, 6.42; N, 13.01. Found: C, 63.70; H, 6.56;
N, 13.01. This product was employed without further purification to
the solid-phase synthesis of oligonucleotides.
Method B. To a suspension of 5′-O-(p,p′-dimethoxytrityl)-2′-
deoxyadenosine (2) (11.1 g, 20.0 mmol) and freshly distilled (2-
cyanoethyl)bis(diisopropylamino)phosphine (6.63 g, 6.99 mL, 22.0
mmol) in dichloromethane (40 mL) was added 1 (1.31 g, 6.00 mmol)
in three portions. The resulting mixture was stirred for 60 min. The
reaction mixture was diluted with dichloromethane (100 mL) and
washed with an aqueous solution of sodium hydrogencarbonate (100
mL) and brine (100 mL). The organic layer was dried over Mg2SO4
and concentrated to ca. 50 mL of the volume. The resulting solution
was added to a vigorously stirred petroleum ether (2.0 L) to afford 6
(14.5 g, 96% yield) as colorless precipitates.
5′-O-(p,p′-Dimethoxytrityl)-2′-deoxycytidine 3′-(2-Cyanoethyl N,N-
diisopropyl-phosphoramidite) (7). Compound 7 was obtained as a
colorless powder. IR: 1759, 1610, 1511, 1362 cm-1. UV: λmax 236
(ꢀ 19 200), 267 nm (16 000). 1H NMR: 0.95-1.09 (m, 12H), 2.03-
2.19 (m, 1H), 2.25 (t, 1H, J ) 10.4 Hz), 2.42-2.55 (m, 2H), 3.22-
3.56 (m, 5H), 3.57-3.72 (m, 7H), 4.03-4.09 (m, 1H), 4.41-4.55 (m,
1H), 5.40-5.55 (m, 1H), 6.10-6.27 (m, 1H), 6.70-6.81 (m, 4H), 7.08-
7.36 (m, 11H), 7.67, 7.78 (2 s, 1H). 31P NMR: 148.7, 148.3. Anal.
Calcd for C39H48N5O7P: C, 64.18; H, 6.63; N, 9.60. Found: C, 63.99;
H, 6.62; N, 9.88.
5′-O-(p,p′-Dimethoxytrityl)-2′-deoxyguanosine 3′-(2-Cyanoethyl
N,N-diisopropylphosphoramidite) (8). Compound 8 was obtained
as a colorless powder. IR: 1762, 1611, 1523, 1365 cm-1. UV: λmax
237 (ꢀ 22 100), 268 nm (17 200). 1H NMR 1.01-1.25 (m, 12H), 2.41
(t, 1H, J ) 10.5 Hz), 2.43-2.77 (m, 3H), 3.31-3.80 (m, 12H), 4.11-
4.18 (m, 1H), 4.55-4.61 (m, 1H), 6.43-6.49 (m, 1H), 6.74-6.80 (m,
4H), 7.10-7.36 (m, 11H), 7.38-7.43 (m, 1H), 7.60-7.69 (m, 1H).
31P NMR: 149.4, 149.3. Anal. Calcd for C40H48N7O7P: C, 62.41; H,
6.28; N, 12.74. Found: C, 62.40; H, 6.39; N, 12.55.
Preparation of 2-Cyanoethyl [5′-O-(p,p′-Dimethoxytrityl)-2′-
deoxyadenylyl]-(3′-5′)-3′-O-(tert-butyldimethylsilyl)-2′-deoxyadenos-
ine (19). A Typical Procedure for the Synthesis of Dinucleoside
Phosphates Using Stoichiometric Amounts of 1, an N-Free Nucleo-
side 3′-Phosphoramidite, and an N-Free Nucleoside in a Solution
Phase. A solution of 1 (43.6 mg, 0.20 mmol), the phosphoramidite 6
(302 mg, 0.40 mmol), and the nucleoside 14 (146 mg, 0.40 mmol) in
dry acetonitrile (0.8 mL) was stirred at room temperature for 1 min.
To this mixture was added a 1.0 M toluene solution of tert-butyl
hydroperoxide (TBHP) (0.60 mL, 0.60 mmol), and stirring was
continued for 5 min. Evaporation of the reaction mixture gave an oil,
which was dissolved in a 1:10 mixture of methanol and dichloromethane
(2.0 mL). The solution was passed through a silica gel pad (2.00 g)
and washed with a 1:10 mixture of methanol and dichloromethane (5.0
mL). The organic filtrate was concentrated to afford 19 (393 mg, 95%
yield) as a colorless amorphous solid. IR: 1735, 1686, 1654, 1648,
1611, 1508, 1466 cm-1. UV: λmax 238 (ꢀ 30700), 260 nm (34100);
1H NMR 0.06 (s, 3H), 0.07 (s, 3H), 1.18 (s, 9H), 2.45-2.80 (m, 3H),
2.95-3.05 (m, 2H), 3.26-3.55 (m, 3H), 3.74, 3.75 (2 s, 3H), 3.88-
3.93 (d, 1H, J ) 12.5 Hz), 4.01-4.42 (m, 4H), 4.65 (d, 2H, J ) 4.6
Hz), 5.15-5.24 (m, 1H), 6.21-6.26 (m, 1H), 6.43-6.57 (m, 4H), 6.74-
6.85 (m, 4H), 7.12-7.37 (m, 10H), 7.82-8.02 (m, 2H), 8.17 (m, 2H).
31P NMR: -2.2, -2.0. Anal. Calcd for C50H60N11O10PSi: C, 58.07;
H, 5.85; N, 14.90. Found: C, 58.03; H, 5.77; N, 14.84.
2-Cyanoethyl [5′-O-(p,p′-Dimethoxytrityl)-2′-deoxyadenylyl]-(3′-
5′)-3′-O-(tert-butyldimethylsilyl)-2′-deoxycytidine (20). Compound
20 was obtained as a colorless amorphous solid (yield 93%). IR: 1718,
1686, 1654, 1608, 1509, 1370 cm-1. UV: λmax 232 (ꢀ 60 100), 260
nm (23 100). 1H NMR: 0.07 (s, 3H), 0.10 (s, 3H), 1.12 (s, 9H), 2.06-
2.40 (m, 2H), 2.51-3.03 (m, 4H), 3.35-3.46 (m, 4H), 3.77, 3.78 (2 s,
3H), 3.84-4.48 (m, 7H), 5.17-5.29 (m, 1H), 5.83-5.98 (m, 2H), 6.44-
6.47 (m, 2H), 6.77-6.80 (m, 4H), 7.19-7.38 (m, 10H), 7.84-8.06
(m, 2H), 8.26 (d, 1H, J ) 5.9 Hz). 31P NMR: -2.0, -1.9. Anal.
Calcd for C49H60N9O11PSi: C, 58.26; H, 5.99; N, 12.48. Found: C,
57.99; H, 6.08; N, 12.44.
2-Cyanoethyl [5′-O-(p,p′-Dimethoxytrityl)-2′-deoxyadenylyl]-(3′-
5′)-3′-O-(tert-butyldimethylsilyl)thymidine (21). Compound 21 was
obtained as a colorless amorphous solid (yield 95%). IR: 1701, 1607,
1560, 1508, 1474, 1406 cm-1
. UV λmax 236 (ꢀ 28 700), 261 nm
(26 100). 1H NMR 0.05 (s, 3H), 0.08 (s, 3H), 1.23, 1.24 (2 s, 9H),
2.01-2.08 (m, 1H), 2.18-2.33 (m, 2H), 2.72-2.76 (m, 3H), 3.35-
3.51 (m, 4H), 3.75 (s, 6H), 3.81-4.49 (m, 7H), 4.71 (d, 2H, J ) 4.6
Hz), 5.15-5.28 (m, 1H), 6.14-6.43 (m, 3H), 6.76-6.78 (m, 4H), 7.16-
7.37 (m, 9H), 7.45 (s, 1H), 7.60 (s, 1H), 8.04-8.10 (m, 1H), 8.29-
8.31 (m, 1H), 8.84-9.89 (br s, 1H). 31P NMR: -2.1, -2.0. Anal.
Calcd for C50H61N8O12PSi: C, 58.58; H, 6.00; N, 10.93. Found: C,
58.33; H, 5.83; N, 11.05.
2-Cyanoethyl [5′-O-(p,p′-Dimethoxytrityl)-2′-deoxycytosylyl]-(3′-
5′)-3′-O-(tert-butyldimethylsilyl)-2′-deoxyadenosine (22). Compound
22 was obtained as a colorless amorphous solid (yield 96%). IR: 1701,
1607, 1508, 1474 cm-1. UV: λmax 239 (ꢀ 39 400), 261 nm (51 800).
1H NMR 0.07 (s, 3H), 0.12 (s, 3H), 1.38 (s, 9H), 2.18-2.74 (m, 6H),
3.30-3.55 (m, 4H), 3.78, 3.79 (2 s, 6H), 3.86-4.19 (m, 7H), 4.69-
4.75 (m, 1H), 5.07-5.11 (m, 1H), 6.28-6.67 (m, 4H), 6.81-6.84 (m,
4H), 7.11-7.39 (m, 9H), 7.48-7.62 (m, 1H), 7.98 (m, 1H), 8.33 (s,
1H). 31P NMR: -2.2. Anal. Calcd for C49H60N9O11PSi: C, 58.26;
H, 5.99; N, 12.48. Found: C, 58.26; H, 5.97; N, 12.56.
2-Cyanoethyl [5′-O-(p,p′-Dimethoxytrityl)-2′-deoxycytosylyl]-(3′-
5′)-3′-O-(tert-butyldimethylsilyl)-2′-deoxycytidine (23). Compound
23 was obtained as a colorless amorphous solid (yield 95%). IR: 1749,
1671, 1613, 1584, 1508, 1464 cm-1. UV: λmax 235 (ꢀ 44 800), 269
nm (29 000). 1H NMR 0.05 (s, 3H), 0.12 (s, 3H), 1.34, 1.36 (2 s, 9H),

Facile Synthesis of Oligodeoxyribonucleotides
J. Am. Chem. Soc., Vol. 120, No. 48, 1998 12401
2.02-2.38 (m, 3H), 2.52-2.81 (m, 3H), 3.32-3.46 (m, 4H), 3.80-
4.46 (m, 13H), 5.00-5.13 (m, 1H), 5.59-5.72 (m, 1H), 5.87 (d, 1H,
J ) 7.8 Hz), 6.10-6.43 (m, 3H), 6.83 (d, 4H, J ) 8.3 Hz), 7.10-7.37
(m, 10H), 7.53-7.94 (m, 1H), 7.99 (d, 1H, J ) 7.8 Hz). 31P NMR:
-1.9, -1.6. Anal. Calcd for C48H60N7O12PSi: C, 58.47; H, 6.13; N,
9.94. Found: C, 58.57; H, 6.24; N, 9.84.
2-Cyanoethyl [5′-O-(p,p′-Dimethoxytrityl)-2′-deoxycytosylyl]-(3′-
5′)-3′-O-(tert-butyldimethylsilyl)thymidine (24). Compound 24 was
obtained as a colorless amorphous solid (yield 94%). IR: 1701, 1507,
1474 cm-1. UV: λmax 235 (ꢀ 42 800), 271 nm (23 400). 1H NMR:
0.07 (s, 3H), 0.08 (s, 3H), 1.37 (s, 9H), 2.01-2.07 (m, 1H), 2.17-
2.21 (m, 3H), 2.58-2.79 (m, 2H), 3.39-3.45 (m, 2H), 3.68-3.93 (m,
13H), 4.26-4.49 (m, 4H), 5.01-5.12 (m, 1H), 6.15-6.34 (m, 3H),
6.83-6.85 (m, 4H), 7.23-7.33 (m, 9H), 7.46 (s, 1H), 7.71 (d, 1H, J )
7.3 Hz), 9.10-9.55 (br s, 1H). 31P NMR -2.2, -1.9. Anal. Calcd
for C49H61N6O13PSi: C, 58.79; H, 6.14; N, 8.39. Found: C, 58.67; H,
5.98; N, 8.45.
2-Cyanoethyl [5′-O-(p,p′-Dimethoxytrityl)-2′-deoxyguanylyl]-(3′-
5′)-3′-O-(tert-butyldimethylsilyl)-2′-deoxyadenosine (25). Compound
25 was obtained as a colorless amorphous solid (yield 96%). IR: 1749,
1671, 1613, 1584, 1508, 1464 cm-1. UV λmax 238 (ꢀ 38 800), 256 nm
(36 000). 1H NMR: 0.11 (s, 3H), 0.13 (s, 3H), 1.33, 1.34 (2 s, 9H),
2.18-2.22 (m, 1H), 2.41-2.79 (m, 3H), 2.84-3.03 (m, 2H), 3.37-
3.84 (m, 4H), 3.93-4.29 (m, 13H), 5.16-5.28 (m, 1H), 6.10-6.47
(m, 3H), 6.74-6.82 (m, 4H), 7.14-7.37 (m, 10H), 7.62-7.71 (m, 1H),
7.87 (s, 1H), 8.19 (s, 1H), 11.59-11.86 (br s, 1H). 31P NMR: -2.5,
-2.2. Anal. Calcd for C50H60N11O11PSi: C, 57.19; H, 5.76; N, 14.67.
Found: C, 57.23; H, 5.84; N, 14.59.
2-Cyanoethyl [5′-O-(p,p′-Dimethoxytrityl)-2′-deoxyguanylyl]-(3′-
5′)-3′-O-(tert-butyldimethylsilyl)thymidine (26). Compound 26 was
obtained as a colorless amorphous solid (yield 98%). IR: 1691, 1609,
1535, 1508, 1473 cm-1. UV: λmax 238 (ꢀ 43 900), 268 nm (30 800).
1H NMR 0.05 (s, 3H), 0.06 (s, 3H), 1.31, 1.33 (2 s, 9H), 2.02-2.07
(m, 3H), 2.54-2.75 (m, 3H), 2.72-2.76 (m, 3H), 3.35-3.40 (m, 4H),
3.69 (s, 6H), 3.74-4.47 (m, 7H), 5.23-5.28 (m, 1H), 6.15-6.34 (m,
3H), 6.76-6.78 (m, 4H), 7.16-7.36 (m, 9H), 7.50 (s, 1H), 7.60 (s,
1H), 11.25-11.93 (br s, 1H). 31P NMR: -2.2, -2.0. Anal. Calcd
for C50H61N8O13PSi: C, 57.68; H, 5.91; N, 10.76. Found: C, 57.66;
H, 5.82; N, 11.00.
2-Cyanoethyl [5′-O-(p,p′-Dimethoxytrityl)thymylyl]-(3′-5′)-3′-O-
(tert-butyldimethylsilyl)-2′-deoxyadenosine (27). Compound 27 was
obtained as a colorless amorphous solid (yield 96%). IR: 1701, 1681,
1608, 1474 cm-1. UV: λmax 273 (ꢀ 19 500), 261 nm (20 300). 1H
NMR 0.08 (s, 3H), 0.09 (s, 3H), 1.34, 1.36 (2 s, 9H), 2.17-2.20 (m,
1H), 2.20-2.78 (m, 5H), 3.25-3.57 (m, 4H), 3.76, 3.77 (2 s, 6H),
3.85-4.32 (m, 7H), 5.10-5.12 (m, 1H), 6.26-6.48 (m, 4H), 6.60-
6.67 (br s, 2H), 6.80-6.83 (m, 4H), 7.15-7.39 (m, 12H), 8.00 (s, 1H),
8.31 (s, 1H). 31P NMR: -2.3, -2.2. Anal. Calcd for C50H61N8O12-
PSi: C, 58.58; H, 6.00; N, 10.93. Found: C, 58.57; H, 5.96; N, 10.94.
Preparation of 2′-Deoxyadenylyl-(3′-5′)-thymidine (35) via Phos-
phitylation of the Solid-Anchored Thymidine 30 Using Excess
Amounts of 1 and 6. To 30 (50.0 mg, 10 µmol) was added a solution
of 1 (54.5 mg, 250 µmol) in acetonitrile (2.5 mL) and a solution of 6
(189 mg, 250 µmol) in acetonitrile (2.5 mL). After 1 min, an aliquot
of the resins was taken up form the reaction mixture, washed with
acetonitrile, and subjected to the 31P NMR analysis. The NMR spectrum
showed a ca. 95:5 ratio of two kinds of peaks at δ 140-141 ppm arising
from phosphites and 127-128 ppm due to phosphoramidites. To the
reaction mixture was added a solution of benzimidazolium triflate (268
mg, 1.0 mmol) in methanol (2.0 mL), and the mixture was stirred for
2 min. An aliquot of the resins was again subjected to the 31P NMR
assay. In the spectrum, only the signals at δ 140-141 ppm due to the
phosphites were observed. The reaction mixture was then treated with
a 1.0 M solution of tert-butyl hydroperoxide in toluene (0.5 mL, 500
µmol) for 2 min and washed with acetonitrile (1.0 mL). The resulting
resins were stirred with a 5% solution of dichloroacetic acid in
dichloromethane (4 mL) for 4 min. The solution phase was removed
by filtration. The resulting solid material was washed with acetonitrile
and exposed to concd ammonia (4.0 mL) for 180 min. The aqueous
layer was collected and concentrated to give an oil, which was treated
with ethanol to afford the ammonium salt of 35 (5.25 mg, 94% yield)
as an oil.
Preparation of 2′-Deoxycytosylyl-(3′-5′)-thymidine (36) via Phos-
phitylation of 30 Using Excess Amounts of 1 and 7. In a manner
similar to that described above, the ammonium salt of 36 (5.15 mg,
96% yield) was prepared using 7 (183 mg, 250 µmol), 30 (50.0 mg,
10 µmol), and 1 (54.5 mg, 250 µmol).
Preparation of 2′-Deoxyguanylyl-(3′-5′)-thymidine (37) via Phos-
phitylation of the Solid-Anchored Thymidine 30 Using Excess
Amounts of 1 and 8. To 30 (50.0 mg, 10 µmol) was added a solution
of 1 (54.5 mg, 250 µmol) in acetonitrile (2.5 mL) and a solution of 8
(193 mg, 250 µmol) in acetonitrile (2.5 mL). After 1 min, an aliquot
of the resins was subjected to the 31P NMR spectrum, which showed
only signals due to phosphites at δ 140-141 ppm. To the reaction
mixture was added a 1.0 M solution of tert-butyl hydroperoxide in
toluene (0.5 mL, 500 µmol), and stirring was continued for 2 min. The
reaction mixture was filtered, and the resulting resins were exposed to
a 5% dichloromethane solution of dichloroacetic acid (4.0 mL) for 4
min. The organic layer was filtered off, and the solid was treated with
concentrated ammonia (2.0 mL) for 180 min. Concentration of the
aqueous layer afforded the ammonium salt of 37 (5.40 mg, 94% yield)
as an oil.
Preparation of Thymylyl-(3′-5′)-thymidine (38) via Phosphity-
lation of 30 Using Excess Amounts of 1 and 9. According to a
procedure similar to that for preparation of 37, the ammonium salt of
38 (5.20 mg, 95% yield) was obtained using 30 (50.0 mg, 10 µmol),
1 (55.0 mg, 250 µmol), and 9 (186 mg, 250 µmol).
HPLC Analysis of the Enzymatic Digestion Products. A mixture
of the purified oligoDNA (0.2-1.5 OD260) in H2O (31.5 mL)
synthesized by the N-unprotected method, snake venom phosphodi-
esterase (SVP) (1 mL, 0.1 unit), and bacterial alkaline phosphatase
(BAP) (10 mL, 2.5 unit) in 300 mM Tris-HCl (5 mL) and 300 mM
MgCl2 (2.5 mL) was incubated at 37 °C for 12 h and then heated at 90
°C for 0.5 min. The aliquots (5 mL) were injected directly onto an
COSMOSIL column and eluted with H2O-MeOH (9:1) or H2O-
MeOH (6:4) (1 mL/min, 40 °C). The ratio of deoxyribonucleosides
was determined by the usual method [dC, tR ) 3.5 min; dG, 4.6 min;
T, 5.8 min; dA, 7.0 min: eluted with H2O-MeOH (9:1)]. 41:
Found: dC, 7.3; dG, 2.8; T, 9.0; dA, 12.7. Calcd: dC, 7; dG, 3; T, 9;
dA, 13. 42: Found: dC, 12.1; dG, 12.5; T, 14.9; dA, 20.4. Calcd:
dC, 12; dG, 13; T, 15; dA, 20.
Acknowledgment. This work was supported in part by
Grants-in-Aid for Scientific Research (Nos. 08454200, 10169225,
and 10554042) from the Ministry of Education, Science, Sports
and Culture, by a Grant from “Research for the Future” Program
of the Japan Society for the Promotion of Science (JSPS-
RFTF97I00301), and by contributions from the Asahi Glass
Foundation. We are also grateful to Dr. Yogesh Sanghvi of ISIS
Pharmaceutical for his generous analysis of the capillary gel
electrophoresis, to Professors Hiroyoshi Hidaka and Hisayuki
Yokokura of Nagoya University for their measurement of the
MALDI-TOF mass spectra, to Professor Hiroshi Sugiyama of
Tokyo Medical and Dental University for his help with the ES
mass spectrometry, and to Professor Michio Honma and Dr.
Yukako Asai of Nagoya University for their generous gift of
the Sphaeroides motA gene and their valuable suggestions and
help on the PCR reaction.
Supporting Information Available: Characterization data
including 1H and 31P NMR spectral charts for all new
compounds (27 pages, print/PDF). See any current masthead
page for ordering information and Web access instructions.
JA973731G