Synthesis of formacetal-linked dinucleotides to facilitate dsDNA bending and binding to the homeodomain of Pax6

Article abstract of DOI:10.1002/ejoc.200701178

Two formacetal-linked dinucleotides T∧T and T∧A were synthesized as phosphoramidite building blocks for solid-phase synthesis. Incorporated in a 29-mer DNA, the oligomers P3_T∧T and P3_T∧A were studied with respect to the binding activ

Full text of DOI:10.1002/ejoc.200701178

FULL PAPER
DOI: 10.1002/ejoc.200701178
Synthesis of Formacetal-Linked Dinucleotides to Facilitate dsDNA Bending
and Binding to the Homeodomain of Pax6
Marian Pitulescu,[a] Marcel Grapp,[b] Ralph Krätzner,[b] Willhart Knepel,[b] and
Ulf Diederichsen*[a]
Keywords: DNA bending / DNA recognition / Formacetal linker / Pax6 homeodomain / Transcription
∧
∧
∧
Two formacetal-linked dinucleotides T T and T A were syn-
thesized as phosphoramidite building blocks for solid-phase
synthesis. Incorporated in a 29-mer DNA, the oligomers
induced by T A was less pronounced. Based on CD spec-
∧
∧
troscopy, the T A formacetal-modified oligomer P3T has
mainly B-DNA topology, whereas the P3T modified oligo-
mer significantly deviated from B-form DNA. The binding
affinity of the P3 oligomer towards Pax6 HD was investigated
by in vitro EMSA experiments providing even a small in-
crease in binding affinity for the P3T oligomer.
(© Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim,
Germany, 2008)
A
∧
T
∧
∧
P3T and P3T were studied with respect to the binding
T
A
activity towards the Pax6 homeodomain. Substitution of the
negatively charged phosphodiester by a neutral formacetal
linker facilitates the bent conformation of double-stranded
DNA. The duplex stability was affected more significantly
∧
T
∧
by the T T formacetal modification, whereas destabilization
(TAD) and binds to specific DNA sequences in the pro-
moter elements G1 and G3 of the rat glucagon gene pro-
moter (Figure 1).[4] Pax proteins use different combinations
of their PD and HD to bind to different promoters and
stimulate gene transcription.[12,13]
Introduction
Transcription factors are proteins acting on gene tran-
scription in the cell nucleus. To achieve their activational or
inhibitory effects on gene transcription, they bind to spe-
cific nucleotide sequences within the promoter region of re-
spective target genes.[1,2] The transcription factor Pax6 be-
longs to the family of paired box proteins and plays an
important role in α-cell differentiation and α-cell-specific
glucagon gene activation.[3–5] The peptide hormone gluca-
gon is produced in α-cells in the pancreatic islets of Langer-
hans and acts on the liver to stimulate glycogenolysis and
gluconeogenesis.[6,7] Insulin, the peptide hormone from
pancreatic islet β-cells, acts as a functional counterpart of
glucagon and directly inhibits glucagon synthesis and se-
cretion.[4,8–10] In insulin-resistant or -deficient states, gluca-
gon synthesis and secretion becomes disinhibited leading to
hyperglucagonemia which contributes to hyperglycemia in
type 2 diabetes mellitus, highlighting the role of Pax6 as a
potential target for the therapy of type 2 diabetes mel-
litus.[7,9,11]
Figure 1. Binding of the HD of the protein paired from Drosophila
as a dimer to an ideal P3 site TAATCTGATTA.[16] The Pax6 HD
shows high sequence identity with the paired HD, and for the
PAX6 HD a similar dimeric binding complex with P3 fragment can
be expected. The recognition helix of HD interacts with the specific
DNA motif ATTA.
Pax6 is composed of an amino-terminal paired domain
(PD) followed by a linker region (L), a homeodomain
(HD), and a carboxyl-terminal transactivation domain
[a] Institut für Organische und Biomolekulare Chemie, Georg-
August-Universität Göttingen,
Tammannstr. 2, 37077 Göttingen, Germany
Fax: +49-551-392944
The Pax6 HD belongs to the paired type of homeodo-
mains which were shown to bind to a so-called P3 site con-
sisting of two palindromic ATTA/TAAT motifs separated
by three nucleotides.[14–16]
E-mail: udieder@gwdg.de
[b] Institut für Molekulare Pharmakologie,
Georg-August-Universität Göttingen,
Robert-Koch-Str. 40, 37075 Göttingen, Germany
2100
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 2008, 2100–2106

Formacetal-Linked Dinucleotides
Therefore, a selective inactivation of the Pax6 HD could
be a therapeutically useful approach to reduce glucagon
levels in diabetic patients. In this regard, therapeutically
active, double-stranded decoy oligonucleotides preventing
transcription factors from binding to their target sites in
promoter regions of genes are an interesting concept.[17]
A
number of chemical modifications has been used to improve
the physiological stability of decoy nucleotides, but, to the
best of our knowledge, no efforts have been made to stabi-
lize decoy oligonucleotides in a bent conformation that re-
sults from binding of certain transcription factors. In this
study we investigated the synthesis of methylene acetal
linked dinucleotides, their incorporation in oligonucleo-
tides, and the affinity as decoy oligonucleotides to the ho-
meodomain of Pax6. Substitution of a charged phosphodi-
ester by a neutral methylene acetal linkage was expected to
facilitate bending of DNA double strands. Based on higher
binding affinity, these bent dsDNA are potential decoy oli-
gonucleotides for the Pax6 HD.
∧
Figure 2. Formacetal-linked dinucleotide building blocks T T (1)
∧
and T A (2) for oligonucleotide solid-phase synthesis.
Synthesis of Formacetal-Linked Dinucleotides
Within a large variety of oligonucleotide backbone modi-
fications[18] the replacement of the negatively charged phos-
The synthesis of the formacetal-linked dinucleotide
∧
phodiester group by the achiral and neutral formacetal (T A) 2 was based on the methylthiomethyl nucleoside 3
linker results in a double helix that retains a topology sim- and 2Ј-deoxyadenosine 5 (Scheme 1). Both have been pre-
ilar to B-DNA. The double strand stability is reduced by pared according to literature procedures.[23,24] The phos-
about 3 °C per modification, and the formacetal backbone phate group in the thymine nucleotide was introduced with
has only a slight influence on the backbone conforma- N-iodosuccinimide (NIS) and dibutyl phosphate providing
tion.[19] Furthermore, base pair complementarity by Wat- the phosphotriester 4 as electrophile for dimer formation.
son–Crick hydrogen bonding is not affected by this modifi- Connecting the two nucleosides 4 and 5 by acetalization
cation. The formacetal linker was already used by He et al. was described to be promoted by TMSOTf.[24] By using re-
to investigate the thrombin inhibitor activity of modified action conditions optimized with respect to reaction time
oligodeoxynucleotides based on charge-charge interac- and addition of TMSOTf in small portions, the formacetal
tions.[20] Next to the influence of phosphodiester charge re- T A dimer 6 was provided in 64% yield.
∧
cognition, a missing charge in the DNA backbone might
Exchange of the protecting group of the primary 5Ј-OH
also facilitate bending of the double strand like it is pro- group from the levulinic ester to the DMT protection,
posed for the neutralization of the phosphate group during which is cleavable under acidic conditions as it is required
the contact with positively charged amino acid residues.[21] for solid-phase synthesis, was achieved with hydrazine hy-
A pre-organization of dsDNA in a bent conformation can drate followed by tritylation of dinucleotide 7 with dimeth-
be expected replacing the negatively charged phosphate oxytrityl chloride and DIPEA. The dinucleotide 9 was ob-
group with a neutral formacetal linker. Therefore, especially tained quantitatively from derivative 8 by removal of the
biological processes involving recognition of bent oligo- methoxyacetyl protecting group with potassium tert-butox-
nucleotides should be affected.
ide. Finally, phosphitylation of the secondary 3Ј-OH group
with chloro(2-cyanoethoxy)(diisopropylamino)phosphane
in the presence of DIPEA gave the phosphoramidite 2 in
excellent quality after chromatography on silica gel.
The formacetal-linked dinucleotide 1 with two thymine
∧
Results and Discussion
recognition units (T T) was synthesized according to a pro-
cedure of van Boom[23] by generating the phosphoramidite
∧
The Pax6 HD preferentially binds to ATTA DNA motifs in analogy to the preparation of the T A dinucleotide 2 as
recognizing dsDNA and bending the DNA at this posi- described in Scheme 1.
tion.[16] Therefore, formacetal-linked T-T and T-A dinucleo-
The formacetal-linked dinucleotide phosphoramidites 1
∧
∧
tides 1 (T T) and 2 (T A) were synthesized (Fig- and 2 were incorporated in DNA sequences by standard
ure 2).[22–24] By incorporation of these dinucleotides in oli- protocols used for automated solid-phase oligonucleotide
gonucleotides the binding affinities of dsDNA with a pre- synthesis.[25] The sequence was oriented on the Pax6
formed bent conformation towards the Pax6 HD were in- HD binding P3 oligonucleotide 5ЈGATCCCTGAGAA-
vestigated. The dinucleotide building blocks were intro- TAATCTGATTACTGTA3Ј together with its comple-
duced by solid-phase oligonucleotide synthesis requiring mentary strand 5ЈGATCTACAGTAATCAGATTATTC
phosphoramidites at the 3Ј-terminal end and DMT protec- TCAGG3Ј (P3) providing a four-nucleotide overhang on
tion of the primary 5Ј-OH.
both ends.[16] The formacetal modifications were introduced
Eur. J. Org. Chem. 2008, 2100–2106
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
2101

M. Pitulescu, M. Grapp, R. Krätzner, W. Knepel, U. Diederichsen
FULL PAPER
∧
Scheme 1. Synthesis of the dinucleotide T A as phosphoramidite 2 ready to use in solid-phase oligonucleotide synthesis.
5Ј
∧
as indicated: GATCCCTGAGAAT AATCTGATTAC-
TGTA3Ј (P3T A) and GATCTACAGTAATCAGAT T-
5Ј
∧
∧
ATTCTCAGG3Ј (P3T T).
∧
Double-Strand Stabilities and Secondary Structures
First evidence for the influence of the formacetal modifi-
cations was obtained by determining double-strand stabili-
ties using temperature-dependent UV spectroscopy (Fig-
ure 3). Compared to the native P3 double strand (Tm
=
61 °C, 1.8 µmol, 10 m NaH2PO4, pH = 7, 100 m NaCl)
∧
the modified double strands P3T A (Tm = 58 °C, 1.8 µmol,
∧
10 m NaH2PO4, pH = 7, 100 m NaCl) and P3T T (Tm
=
56 °C, 1.8 µmol, 10 m NaH2PO4, pH = 7, 100 m NaCl)
provided significantly lower stabilities. The replacement of
a negatively charged phosphodiester group by the neutral
formacetal linker seems to interfere with the double-helix
topology leading to reduced stability as it is known already
from other formacetal-linked DNA oligomers.[19] The de-
∧
Figure 3. Temperature-dependent UV measurements of P3, P3T
A
∧
and P3T T measured in 10 m phosphate buffer, pH = 7.0, 260 nm.
∧
stabilization induced by the T T (∆T = 5 °C) modification
is considerably higher than the respective effect based on
∧
the T A formacetal dinucleotide (∆T = 3 °C). This points
to a more pronounced distortion of nucleobase pairing or
stacking as it would result from a stronger bent double he-
lix.
Conformational distortion of the B-DNA double helix
should be also detectable by circular dichroism (CD) spec-
∧
troscopy. The CD spectra recorded for the 29-mer P3T A
provided a typical B-DNA profile, almost identical with the
∧
native DNA oligomer P3 (Figure 4). The P3T A oligomer
exhibited a positive Cotton effect at 286 nm and a negative
one at 242 nm. A shift from the B-DNA conformation was
∧
registered in case of the P3T T oligomer (Figure 4). The CD
spectrum shows a maximum at 288 nm and a very weak
negative Cotton effect at 236 nm.
∧
∧
A
Figure 4. CD spectra of P3T and P3T compared to the native
T
P3 oligomer, measured in 10 m phosphate buffer, pH = 7.0.
2102
www.eurjoc.org
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 2008, 2100–2106

Formacetal-Linked Dinucleotides
Electrophoretic Mobility Shift Assay (EMSA)
the phosphate with its negative charge plays a major role at
the TT step, where a stronger binding of Pax6 to DNA
was observed. The binding properties of the modified DNA
oligomer were slightly improved with the neutral T T
formacetal linker better accommodating the interaction
with the Pax6 HD.
∧
The oligonucleotides containing the modified T T and
∧
T A dimers were annealed with their complementary
strands. The binding affinity of modified DNA oligomers
∧
∧
∧
P3T A and P3T T was tested towards glutathione S-trans-
ferase (GST)-Pax6 HD and GST produced in E. coli DH5α
cells by performing an EMSA experiment. The dimeric oli-
gonucleotide P3 was included as a native control for Pax6
HD binding. As described, strong binding of GST-Pax6
HD to P3 was achieved. GST-Pax6 HD was further found
Conclusions
∧
∧
Two modified dinucleotides T T and T A containing
one formacetal linker instead of the native phosphodiester
were synthesized and incorporated in a DNA 29-mer. The
binding activities of the modified DNA oligomers were
tested in vitro towards GST-Pax6 HD. The protein-binding
∧
to bind at least as strong to P3T T as to the native P3 oligo-
nucleotide. None or very weak binding was measured for
∧
P3T A incubated with GST-Pax6 HD. As a control experi-
ment, complex formation was not observed between the P3
oligomers and GST only (Figure 5, Lanes 7–9). Statistical
evaluation of four independent EMSA experiments showed
a slightly, but not significantly stronger binding of GST-
∧
activity was slightly increased only in the case of the T T
modified oligomer, whereas the oligomer with the formace-
tal linker at the TA step emerged as weak binder. These
results might be in accordance with a pre-organization of
the DNA in a bent conformation induced by a neutral
∧
Pax6 HD to P3T T compared to P3. The modification
∧
P3T A caused a decrease in binding affinity by more than
∧
∧
85% compared to P3T T (Figure 5, right).
formacetal linker (T T modification). On the other hand,
protein binding of double-stranded DNA could be signifi-
cantly diminished in case the negative phosphate linkage is
of importance for recognition by electrostatic interactions
∧
(T A modification).
Experimental Section
Materials and Methods: Dry reactions were carried out under a dry
argon using an appropriate Schlenk technique. The chemicals were
used as supplied by Fluka, Sigma–Aldrich or Lancaster. Meth-
oxyacetic anhydride was synthesized according to a literature pro-
cedure.[24] The dry solvents were purchased from commercial
sources, except dry pyridine, which was dried with CaC2 and dis-
tilled prior to use. 1H, 13C and 31P NMR spectra were recorded
at room temperature with Bruker AMX 300 or Varian Inova 600
spectrometers. Chemical shifts are given relative to TMS, as in-
ternal reference for 1H NMR as well as 13C NMR spectroscopy
and to external 85% H3PO4 in D2O for 31P NMR spectroscopy.
ESI-MS and HRMS data were recorded with LCQ and TSQ 7000
instruments from Finnigan and APEX-Q IV 7T, respectively. CD
spectra were recorded with a JASCO J-810 spectrometer equipped
with a JASCO ETC-505S/PTC-423S temperature controller. Tem-
perature-dependent UV spectra were measured with a JASCO
V-550 UV/Vis spectrometer equipped with a JASCO ETC-505S/
ETC-505T temperature controller.
Figure 5. Binding of the Pax6 HD to the modified P3 sites. Left:
electrophoretic mobility shift assay of the GST-Pax6 HD fusion
protein with the modified oligonucleotides. The labeled oligonucleo-
∧
∧
tides P3, P3T and P3T were incubated with 250 ng of GST-
T
A
Pax6 HD. GST was incubated with the indicated oligonucleotides
as a specific control (Lanes 7–9). F = free probe; S1 and S2 =
shifted probes; the two bands appearing for shifted probes were
interpreted as homodimeric (S2) and monomeric (S1) binding com-
plexes of HD with the probe.[16] Sequences of the oligonucleotides
used in the gel retardation analysis are shown in the Exp. Sect.
Right: Densitometric measurement of the percentage of binding of
the indicated probes by the Pax6 HD using the PhosphorImager.
Values are means (Ϯ SEM) of four independent experiments statis-
tically evaluated by Student’s t test ***, p Ͻ 0.001.
Pax6 Homeodomain Glutathione S-Transferase Fusion Protein
Preparation: The procaryotic expression vector for GST-Pax6 HD
encoding the Pax6 homeodomain was described before[26] and
kindly provided by Prof. Dr. I. Mikkola (University of Tromsø,
Norway). E. coli DH5α cells with this expression vector were grown
at 26 °C and induced, after reaching OD600 = 0.8, with 1 m IPTG
for 1.5 h. Cells were harvested and suspended (10 mL/1 L culture)
in phosphate buffer, and the protease inhibitors PMSF (1 m) and
DTT (1 m) were added. The resuspended cells were frozen at
–80 °C and lysed by thawing on ice for 2–3 h followed by sonication
for 3 min. The GST-Pax6 fusion protein was purified from the bac-
terial extract using glutathione-agarose beads (Sigma, Munich,
Germany). The protein was eluted using 100 m glutathione in
The homeodomain of the Drosophila paired protein has
been shown to bind as a dimer to a P3-consensus site.[14]
The highly homologous Pax6 HD shows also strong bind-
ing affinity to the P3-consensus site. As a consequence of
chemical modification, binding to the double-stranded oli-
∧
gonucleotide P3T A was mainly lost in EMSA experiments,
∧
while binding to P3T T was not affected. The TA step seems
to be highly involved in the helix recognition by the Pax6
HD, and any change in the DNA linker structure lowers the
binding affinity also from the P3-consensus site. Absence of phosphate-buffered saline (pH = 7.2; containing PMSF and DTT,
Eur. J. Org. Chem. 2008, 2100–2106
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
2103

M. Pitulescu, M. Grapp, R. Krätzner, W. Knepel, U. Diederichsen
FULL PAPER
each 1 m) and dialyzed against phosphate-buffered saline (con-
taining 0.25 m PMSF) at 4 °C.
100 mL), and CCl3COOH (3.20 g, 19.6 mmol) was added. After
stirring for 10 min, the red mixture was poured carefully into
NaHCO3, (0.9 , 200 mL) and extracted with DCM (5ϫ50 mL).
The combined organic phases were dried with MgSO4, concen-
trated to a small volume, and the residue was subjected to flash
Electrophoretic Mobility Shift Assay: Synthetic complementary oli-
gonucleotides with 5Ј-GATC overhangs were annealed and labeled
by a fill-in reaction with [α32P]dCTP (Amersham Biosiences,
Braunschweig, Germany) using the Klenow fragment of DNA
polymerase (Fermantas, Munich, Germany). Bacterially expressed
recombinant fusion proteins (ca. 250 ng) were incubated with
0.2 µg of poly(dI-dC)·(dI-dC) (Sigma) as nonspecific competitor in
20 µL (total volume) of 20 m HEPES, pH = 7.9, 1 m EDTA,
0.5 m DTT, 140 m KCl and 10% glycerol for 10 min on ice. The
assay was then performed as described.[27]
chromatography (EtOAc/MeOH, 96:4) to afford
5 (208 mg,
0.48 mmol, 80%) as a colorless hygroscopic foam. TLC (EtOAc/
MeOH, 95:5, v/v): Rf = 0.25. 1H NMR (300 MHz, CDCl3): δ =
2.48 (m, 1 H, H2Ј/2ЈЈ), 3.18 (m, 1 H, H2Ј/2ЈЈ), 3.45 (s, 3 H, CH3,
methoxyacetyl), 3.85–3.99 (m, 2 H, H5Ј, H5ЈЈ), 4.07 (s, 2 H, CH2,
methoxyacetyl), 4.27 (m, 1 H, H4Ј), 5.64 (m, 1 H, H3Ј), 5.85 (br. s,
3
1 H, OH), 6.34 (dd, J = 5.2, 9.8 Hz, 1 H, H1Ј), 7.45–7.62 (m, 3 H,
Har), 7.99 (m, 2 H, Har), 8.09 (s, 1 H, H8), 8.74 (s, 1 H, H2), 9.17
(br. s, 1 H, NH) ppm. 13C NMR (75 MHz, CDCl3): δ = 37.7 (C2Ј),
59.5 (OCH3, methoxyacetyl), 63.0 (C5Ј), 69.7 (CH2, methoxyace-
tyl), 76.7 (C3Ј), 87.3, 87.4 (C1Ј, C4Ј), 124.5 (C5), 127.9, 128.9, 133.0,
133.3 (Car), 142.3 (C4), 150.3 (C3), 150.7 (C2), 152.2 (C6), 164.6
(CO), 169.6 (CO) ppm. ESI-MS: m/z = 450.1 [M + Na]+, 877.1 [2
M + Na]+.
Oligonucleotides: Incorporation of the phosphoramidite derivatives
1 and 2 in the respective DNA oligomers was performed by IBA
GmbH, Göttingen, Germany, using a standard protocol for solid-
phase chemistry based on phosphoramidites.[25] The following
oligomers were synthesized with 0.1 nmol/µL concentration with
the respective formacetal modification indicated in bold letters:
5ЈGATCCCTGAGAATAATCTGATTACTGTA3Ј (P3): ESI-MS:
m/z = 8651.54 [M – 4 H + 3 Na]–, 8673.52 [M – 5 H + 4 Na];
5ЈGATCTACAGTAATCAGATTATTCTCAGG3Ј (P3 complemen-
tary strand): ESI-MS: m/z = 8651.54 [M – 4 H + 3 Na]–, 8673.52
∧
5Ј-O-Levulinyl-3Ј-O-(methoxyacetyl)-T ABz (6): To a freshly pre-
pared solution of nucleoside 4 (400 mg, 0.73 mmol) and adenosine
derivative 5 (155 mg, 0.36 mmol) in dry DCE (4 mL), TMSOTf
(5ϫ33.0 µL, 0.92 mmol) was added in small portions within
50 min. After the last addition of TMSOTf, the mixture was stirred
for additional 10 min and the reaction quenched with Et3N
(0.50 mL). The reaction mixture was diluted with DCM (30 mL)
and washed with 0.9  NaHCO3 (2ϫ30 mL). The organic phase
was dried with MgSO4, concentrated close to dryness and purified
by silica gel column chromatography (EtOAc/MeOH, 96:4 Ǟ 92:8)
to afford 6 (180 mg, 0.23 mmol, 64%, based on the acceptor) as a
colorless foam. TLC (EtOAc/MeOH, 9:1, v/v): Rf = 0.32. 1H NMR
(300 MHz, CD2Cl2): δ = 1.83 (s, 3 H, CH3, T), 2.10 (s, 3 H, CH3,
Lev), 2.12 (m, 1 H, H2Ј/2ЈЈ, dT), 2.35–2.45 (m, 1 H, H2Ј/2ЈЈ, dT),
2.49–2.57 (m, 2 H, CH2, Lev), 2.60–2.70 (m, 1 H, H2Ј/2ЈЈ, dA), 2.73
(m, 2 H, CH2, Lev), 2.93–3.04 (m, 1 H, H2Ј/2ЈЈ, dA), 3.43 (s, 3 H,
CH3, methoxyacetyl), 3.87 (m, 2 H, H5Ј/5ЈЈ, dA), 4.09 (s, 2 H, CH2,
methoxyacetyl), 4.11–4.23 (m, 3 H, H4Ј, dT, H5Ј/5ЈЈ, dT), 4.24–4.40
(m, 2 H, H3Ј, dT, H4Ј, dA), 4.79 (d, 2J = 7.2 Hz, 2 H, OCH2O),
5.56 (m, 1 H, H3Ј, dA), 6.12 (t, 3J = 6.5 Hz, 1 H, H1Ј, dT), 6.56
(dd, 3J = 6.4, 7.9 Hz, 1 H, H1Ј, dA), 7.29 (s, 1 H, H6, T), 7.45–8.05
(m, 5 H, Har), 8.37 (s, 1 H, H8), 8.72 (s, 1 H, H2), 9.63 (s, 1 H,
NH), 9.71 (br. s, 1 H, NH) ppm. 13C NMR (125 MHz, CD2Cl2): δ
= 12.5 (CH3, T), 28.1 (Cβ, Lev), 38.0, 38.2, 38.3 (2ϫ C2Ј, dT, dA,
Cα, Lev), 59.5 (CH3, methoxyacetyl), 64.0 (C5Ј, dT), 68.4 (C5Ј, dA),
69.9 (CH2, methoxyacetyl), 75.5 (C3Ј, dA), 77.6 (C3Ј, dT), 82.8 (C4Ј,
dT), 84.3 (C4Ј, dA), 84.5 (C1Ј, dA), 85.4 (C1Ј, dT), 95.6 (OCH2O),
111.2 (C5, dT), 128.5, 128.9, 132.9 (Car), 135.5 (C6, dT), 141.8 (C8,
dA), 150.1 (C4, dA), 150.6 (C6, dA), 152.2 (C2, dT), 152.7 (C2, dA),
164.2 (C4, dT), 170.2 (CO, methoxyacetyl), 172.8 (COCH2, Lev),
206.8 (COCH3, Lev) ppm. ESI-MS: m/z = 780.2 [M + H]+, 802.3
[M + Na]+.
∧
Na]; 5ЈGATCCCTGAGAAT AATCTGAT-
[M
–
5
H
+
4
∧
TACTGTA3Ј (P3T A): ESI-MS: m/z = 8601.54 [M – 4 H + 3 Na]–,
∧
8623.58 [M – 5 H + 4 Na]–; 5ЈGATCTACAGTAATCAGAT
TATTCTCAGG3Ј (P3T T): ESI-MS: m/z = 8601.53 [M – 4 H + 3
∧
Na]–, 8623.51 [M – 5 H + 4 Na]–.
3Ј-O-{[(Dibutylphosphoryl)oxy]methyl}-5Ј-O-levulinyl-2Ј-deoxy-
thymidine (4): 5Ј-O-Levulinyl-3Ј-O-(methylthiomethyl)-2Ј-deoxy-
thymidine (3) (535 mg, 1.36 mmol) was dissolved in dry DCE
(2 mL) and the mixture cooled to 0 °C. A solution of dibutyl phos-
phate (380 µL, 2.00 mmol) and NIS (450 mg, 2.00 mmol) in dry
THF (2 mL) was added and the mixture stirred at 0 °C for 5 min.
The ice bath was removed, and the reaction mixture was stirred at
room temperature for additional 20 min. The reaction mixture was
diluted with DCM (20 mL) and washed with a mixture of 1 
Na2S2O3 and 0.9  NaHCO3 solution (1:1, v/v; 30 mL). The or-
ganic phase was dried with MgSO4, concentrated in vacuo (the
water bath temperature maintained at less than 30 °C) and purified
by column chromatography (DCM/MeOH, 97:3 Ǟ 95:5) to yield 4
(485 mg, 0.91 mmol, 68%) as a viscous yellow oil. TLC (EtOAc)
Rf = 0.33, 1H NMR (300 MHz, CD2Cl2): δ = 0.91 (dt, 3J = 7.6 Hz,
6 H, 2ϫ CH3, Bu), 1.38 (m, 4 H, 2ϫ CH2, Bu), 1.64 (m, 4 H, 2ϫ
CH2, Bu), 1.89 (s, 3 H, CH3, T), 2.14 (s, 3 H, CH3, Lev), 2.14–2.24
(m, 1 H, H2Ј/2ЈЈ), 2.47 (m, 1 H, H2Ј/2ЈЈ), 2.50–2.58 (m, 2 H, CH2,
Lev), 2.68–2.90 (m, 2 H, CH2, Lev), 4.02 (dq, 3J = 6.3, 3J = 6.8 Hz,
2
4 H, CH2, Bu), 4.22–4.66 (m, 4 H, H3Ј, H4Ј, H5Ј, H5ЈЈ), 5.20 (d, J
= 11.8 Hz, 2 H, OCH2O), 6.23 (dd, 3J = 6.1, 7.8 Hz, 1 H, H1Ј),
7.32 (s, 1 H, H6), 9.42 (br. s, 1 H, NH) ppm. 13C NMR (75 MHz,
CD2Cl2): δ = 12.6 (CH3, T), 13.6 (CH3, Bu), 18.9 (Cγ, Bu), 28.1
(Cβ, Lev), 29.8 (CH3, Lev), 32.4, 32.5 (Cβ, Bu), 38.0, 38.1 (C2Ј, Cα,
Lev), 63.9 (C5Ј), 68.0, 68.0 (Cα, Bu), 79.2 (C4Ј), 82.5 (C3Ј), 85.2
(C1Ј), 91.7, 91.8 (OCH2O), 111.4 (C5), 135.5 (C6), 150.7 (C2), 164.2
(C4), 172.6, 206.6 (CO, Lev) ppm. ESI-MS: m/z = 585.2 [M +
Na]+, 1146.8 [2 M + Na]+.
∧
3Ј-O-(Methoxyacetyl)-T ABz (7): To a solution of 6 (180 mg,
0.23 mmol) in pyridine/ethyl acetate (4:1, v/v; 3 mL), a freshly pre-
pared hydrazine hydrate solution in pyridine/acetic acid (3:2, v/v;
1 ; 3 mL) was added. After 2 min of stirring, DCM was added
and the reaction mixture washed with water (10 mL) and NaHCO3
(0.9 , 10 mL). The organic layer was dried with MgSO4, concen-
trated in vacuo and subjected to column chromatography (EtOAc/
MeOH, 9:1) to afford 7 (120 mg, 0.175 mmol, 76%) as a colorless
foam. TLC (EtOAc/MeOH, 9:1, v/v): Rf = 0.16. 1H NMR
(600 MHz, CD2Cl2): δ = 1.74 (s, 3 H, CH3, T), 2.07–2.27 (m, 2 H,
6-Benzoyl-3Ј-O-(methoxyacetyl)-2Ј-deoxyadenosine (5):[24] Meth-
oxyacetic anhydride (200 mg, 1.22 mmol) was added to
a
solution of 6-benzoyl-5Ј-O-(4,4Ј-dimethoxytrityl)-2Ј-deoxyadenos-
ine (400 mg, 0.61 mmol) in dry pyridine (4 mL). After stirring for
2 h, the reaction was quenched with water (1 mL), the mixture con-
centrated under reduced pressure and co-evaporated with toluene
(2ϫ4 mL). The viscous oil was dissolved in CH3NO2/MeOH (95:5;
3
2
H2Ј, H2ЈЈ, dT), 2.67 (ddd, J = 2.7, 6.4, J = 14.4 Hz, 1 H, H2Ј/2ЈЈ
,
dA), 2.98 (m, 1 H, H2Ј/2ЈЈ, dA), 3.42 (s, 3 H, CH3, methoxyacetyl),
2104
www.eurjoc.org
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 2008, 2100–2106

Formacetal-Linked Dinucleotides
3.69–3.89 (m, 4 H, 2ϫ H5Ј/5ЈЈ, dT, dA), 4.00 (m, 1 H, H4Ј, dT), 4.34 H, H5Ј/5ЈЈ, dA), 4.08 (m, 1 H, H4Ј, dT), 4.15 (m, 1 H, H4Ј, dA), 4.38
3
(m, 1 H, H4Ј, dA), 4.37 (m, 1 H, H3Ј, dT), 4.77 (s, 2 H, OCH2O), (m, 1 H, H3Ј, dT), 4.57 (q, J = 4.7 Hz, 1 H, H3Ј, dA), 4.72 (m, 2
3
3
5.58 (m, 1 H, H3Ј, dA), 6.08 (dd, J = 6.4, 7.6 Hz, H1Ј, dT), 6.58
H, OCH2O), 6.22 (m, 1 H, H1Ј, dT), 6.50 (t, J = 6.4 Hz, 1 H, H1Ј,
(t, J = 7.0 Hz, 1 H, H1Ј, dA), 7.45–7.52 (m, 3 H, Har), 7.56 (m, 1 dA), 6.79–6.85 (m, 4 H, Har), 7.24–7.46 (m, 12 H, Har), 7.51 (s, 1
3
H, H6), 8.01 (d, J = 7.2 Hz, 2 H, Har), 8.47 (s, 1 H, H8), 8.71 (s,
H, H6), 7.98 (m, 2 H, Har), 8.32 (s, 1 H, H8), 8.69 (s, 1 H, H2), 9.88
(br. s, 1 H, NH), 10.82 (br. s, 1 H, NH) ppm. 13C NMR (150 MHz,
3
1 H, H2), 9.91 (br. s, 1 H, NH), 10.45 (br. s, 1 H, NH) ppm. 13C
NMR (150 MHz, CD2Cl2): δ = 12.4 (CH3, T), 38.0, 38.3, 39.0 (C2Ј, CD2Cl2): δ = 11.9 (CH3, T), 38.8 (C2Ј, dT), 40.6 (C2Ј, dA), 55.5
dA, dT), 59.5 (CH3, methoxyacetyl), 62.3, 62.4, 68.1 (C5Ј, dA, dT),
69.9 (CH2, methoxyacetyl), 75.6 (C3Ј, dA), 76.9 (C3Ј, dT), 84.4,
(OCH3, DMT), 63.8 (C5Ј, dT), 68.6 (C5Ј, dA), 72.0 (C3Ј, dA), 78.8
(C3Ј, dT), 84.6, 84.8, 85.2, 86.2 (C1Ј, C4Ј, dT, dA), 87.1 (Cq, DMT),
84.5, 84.6 (C1Ј, C4Ј, dA), 85.5, 85.9 (C1Ј, C4Ј, dT), 94.6 (OCH2O), 95.6 (OCH2O), 111.4 (C5, dT), 113.5, 127.3, 128.2, 128.3, 128.5,
111.0 (C5, dT), 128.5, 128.6, 128.8, 128.8 (Car), 132.9 (C6, dT), 128.6, 128.7, 128.8, 130.3 (Car), 132.8 (C6, dT), 135.6, 135.7, 135.8
136.7 (Car), 142.0 (C8, dA), 150.1 (C4, dA), 151.0 (C6, dA), 151.0
(Car), 142.2 (C8, dA), 144.9 (C4, dA), 151.2 (C6, dA), 152.4 (C2,
(C2, dT), 152.6 (C2, dA), 164.6 (C4, dT), 170.2 (CO, methoxyacetyl) dA), 159.0, 159.0 (Car), 164.7 (C4, dT) ppm. ESI-MS: m/z = 934.3
ppm. ESI-MS: m/z = 704.3 [M + Na]+, 1314.2 [2 M + Na]+.
[M + Na]+, 1846.2 [2 M + Na]+.
∧
5Ј-O-(4,4Ј-Dimethoxytrityl)-3Ј-O-(methoxyacetyl)-T ABz (8): Com-
3Ј-O-[(2-Cyanoethyl)(diisopropylamino)phosphanyl]-5Ј-O-(4,4Ј-di-
∧
methoxytrityl)-T ABz (2): Compound 9 (100 mg, 0.11 mmol) was
pound 7 (100 mg, 0.15 mmol) was dried in high vacuum overnight
and dissolved in dry pyridine (3 mL). DIPEA (166 µL, 0.96 mmol)
and DMTCl (224 mg, 0.66 mmol) were added, and the reaction
mixture was stirred at room temperature for 12 h. MeOH (500 µL)
was added, and the reaction mixture was stirred for additional
5 min to neutralize the remaining trityl chloride. Pyridine was re-
moved under reduced pressure by co-evaporation with toluene
(2ϫ10 mL) and the remaining oil dissolved in DCM (20 mL). The
organic layer was washed with NaHCO3, (0.9 , 2ϫ20 mL) and
the DCM layer dried with MgSO4. Silica gel chromatography
(EtOAc/MeOH, 95:5) afforded 8 (110 mg, 0.11 mmol, 76%) as a
colorless solid. TLC (EtOAc/MeOH, 95:5, v/v): Rf = 0.27. 1H
NMR (300 MHz, CD2Cl2): δ = 1.41 (br. s, 3 H, CH3, T), 2.21 (m,
1 H, H2Ј/2ЈЈ, dT), 2.45 (ddd, 3J = 2.4, 5.7, 2J = 13.6 Hz, 1 H,
H2Ј/2ЈЈ, dT), 2.61 (ddd, 3J = 2.4, 6.3, 2J = 14.5 Hz, 1 H, H2Ј/2ЈЈ, dA),
dissolved in dry DCM (1.50 mL). DIPEA (76.0 µL, 0.44 mmol),
DMAP (2.60 mg, 22.0 µmol), and chloro(2-cyanoethoxy)(diisopro-
pylamino)phosphane (36.5 µL, 0.16 mmol) were carefully added to
the reaction mixture. After stirring for 25 min, the reaction mixture
was diluted with DCM (10 mL), washed with brine (20 mL), and
0.9  NaHCO3 (10 mL). The organic layer was dried with MgSO4
and concentrated in vacuo. The residue was purified by column
chromatography (EtOAc/MeOH, 95:5) to yield
2 (80 mg,
72.0 µmol, 66%) as a colorless foam. TLC (EtOAc/MeOH, 95:5,
1
v/v): Rf = 0.51. H NMR (600 MHz, CD2Cl2): δ = 1.19 [m, 12 H,
2ϫ CH(CH3)2], 1.40 (s, 3 H, CH3, T), 2.19 (m, 1 H, H2Ј/2ЈЈ, dT),
3
2.43 (m, 1 H, H2Ј/2ЈЈ, dT), 2.62 (t, J = 6.2 Hz, 2 H, CH2CN), 2.67
(m, 1 H, H2Ј/2ЈЈ, dA), 2.85 (m, 1 H, H2Ј/2ЈЈ, dA), 3.29 (m, 2 H, H5Ј,
H5ЈЈ, dT), 3.63 [m, 2 H, 2ϫ NCH(CH3)2], 3.70–3.94 (m, 10 H, 2ϫ
OCH3, DMT, OCH2CH2CN, H5Ј, H5ЈЈ, dA), 4.04 (m, 1 H, H4Ј,
2.90 (m, 1 H, H2Ј/2ЈЈ, dA), 3.30 (dd, J = 3.0, 2J = 10.8 Hz, 1 H,
3
H5Ј/5ЈЈ, dT), 3.37 (dd, 3J = 3.3, J = 10.2 Hz, 1 H, H5Ј/5ЈЈ, dT), 3.42
2
3
dT), 4.29 (dq, J = 4.1 Hz, 1 H, H4Ј, dA), 4.39 (m, 1 H, H3Ј, dT),
4.74 (m, 3 H, OCH2O, H3Ј, dA), 6.21 (m, 1 H, H1Ј, dT), 6.49 (dt,
(s, 2 H, CH2, methoxyacetyl), 3.73 (s, 6 H, OCH3, DMT), 3.82 (dd,
2
3
2
3J = 3.6, J = 11.1 Hz, 1 H, H5Ј/5ЈЈ, dA), 3.87 (dd, J = 3.9, J =
3
3J = 6.3 Hz, 1 H, H1Ј, dA), 6.81 (d, J = 8.2 Hz, 4 H, Har), 7.16–
10.8 Hz, 1 H, H5Ј/5ЈЈ, dA), 4.07 (s, 2 H, CH2, methoxyacetyl), 4.09
3
7.60 (m, 13 H, Har, H6), 7.98 (d, J = 7.7 Hz, 2 H, Har), 8.25 (s, 1
(m, 1 H, H4Ј, dT), 4.30 (q, J = 3.3 Hz, 1 H, H4Ј, dA), 4.41 (m, 1
3
H, H8), 8.70 (s, 1 H, H2), 9.46 (br. s, 2 H, 2ϫ NH) ppm. 13C
NMR (150 MHz, CD2Cl2): δ = 11.9 (CH3, T), 20.6, 20.7, 20.7, 20.7
(CH2CN), 24.6, 24.6, 24.7, 24.7 [CH(CH3)2], 38.7, 38.8 (C2Ј, dT),
39.8, 39.8 (C2Ј, dA), 43.5, 43.5, 43.6, 43.6 [CH(CH3)2], 55.5 (OCH3,
DMT), 58.4, 58.5, 58.6, 58.7 (OCH2CH2CN), 63.8 (C5Ј, dT), 68.2,
68.4 (C5Ј, dA), 73.6, 73.7, 73.8, 73.9 (C3Ј, dA), 78.6, 78.7 (C3Ј, dT),
84.4, 84.5 (C4Ј, dT), 84.7, 84.7 (C1Ј, dA), 84.9, 84.9 (C1Ј, dT), 85.3,
85.4, 85.6, 85.6 (C4Ј, dA), 87.1 (Cq, DMT), 95.7, 95.8 (OCH2O),
111.1 (C5, dT), 113.5 (Car), 117.4, 118.1 (CN), 123.9, 127.3, 128.2,
128.3, 128.4, 128.9, 130.3, 130.3, 132.8 (Car), 135.7, 135.8 (C6, dT),
142.0, 142.0 (C8, dA), 144.9 (C4, dA), 150.6 (C6, dA), 152.5 (C2,
dA), 159.0 (Car), 164.1 (C4, dT) ppm. 31P NMR (121 MHz,
CD2Cl2): δ = 149.7, 149.8 ppm. ESI-MS: m/z = 1134.4 [M + Na]+.
H, H3Ј, dT), 4.78 (d, 2J = 7.5 Hz, 2 H, OCH2O), 5.45 (dt, 3J =
2.1 Hz, 1 H, H3Ј, dA), 6.22 (dd, 3J = 5.8, 7.9 Hz, 1 H, H1Ј, dT),
6.54 (dd, J = 6.5, 8.3 Hz, 1 H, H1Ј, dA), 6.79–6.86, 7.24–7.53 (m,
3
16 H, Har), 7.59 (s, 1 H, H6), 7.99 (m, 2 H, Har), 8.31 (s, 1 H, H8),
8.71 (s, 1 H, H2), 9.54 (s, 1 H, NH), 9.81 (br. s, 1 H, NH) ppm.
13C NMR (150 MHz, CD2Cl2): δ = 11.9, 11.9 (CH3, T), 38.2, 38.7
(C2Ј, dT, dA), 55.5 (OCH3, DMT), 59.5 (OCH3, methoxyacetyl),
63.8 (C5Ј, dT), 68.5 (C5Ј, dA), 69.9 (CH2, methoxyacetyl), 75.6 (C3Ј,
dA), 78.6 (C3Ј, dT), 84.3, 84.5, 84.6, 85.0 (C1Ј, C4Ј), 87.1 (Cq,
DMT), 95.6 (OCH2O), 111.2 (C5, dT), 113.5, 127.27–130.3 (Car),
132.8 (C6, dT), 135.7, 135.8 (Car), 141.7 (C8, dA), 144.9 (C4, dA),
150.7 (C6, dA), 152.6 (C2, dT), 159.0, 159.1 (Car), 164.3 (C4, dT),
170.1 (CO, methoxyacetyl) ppm. ESI-MS: m/z = 1006.4 [M +
Na]+, 1989.2 [2 M + Na]+.
Acknowledgments
∧
5Ј-O-(4,4Ј-Dimethoxytrityl)-T ABz (9): Compound
8 (108 mg,
0.11 mmol) was dissolved in DCM/MeOH (1:1, v/v; 3 mL) and po-
tassium tert-butoxide (25.0 mg, 0.22 mmol) added. After 15 min of
stirring, the reaction mixture was diluted with DCM (25 mL),
washed with water (2ϫ20 mL), brine (20 mL), and dried with
MgSO4. The organic layer was co-evaporated in vacuo and the resi-
due purified by column chromatography (EtOAc) to provide 9
(100 mg, 0.11 mmol, 99%) as a colorless foam. TLC (EtOAc): Rf
Generous support of the Deutsche Forschungsgemeinschaft is
gratefully acknowledged.
[1] P. J. Mitchell, R. Tjian, Science 1989, 245, 371.
[2] C. F. Calkhoven, G. Ab, Biochem. J. 1996, 317, 329.
[3] M. Sander, A. Neubuser, J. Kalamaras, H. C. Ee, G. R. Martin,
M. S. German, Genes Dev. 1997, 11, 1662.
[4] R. Grzeskowiak, J. Amin, E. Oetjen, W. Knepel, J. Biol. Chem.
2000, 275, 30037.
[5] Z. Kozmik, Curr. Opin. Genet. Dev. 2005, 15, 430.
[6] G. Jiang, B. B. Zhang, Am. J. Physiol. Endocrinol. Metab. 2003,
284, 671.
1
= 0.50. H NMR (600 MHz, CD2Cl2): δ = 1.43 (s, 3 H, CH3, T),
2.21 (m, 1 H, H2Ј/2ЈЈ, dT), 2.51 (m, 2 H, H2Ј/2ЈЈ, dT, dA), 2.73 (m,
1 H, H2Ј/2ЈЈ, dA), 3.28 (dd, 3J = 3.0, 2J = 10.8 Hz, 1 H, H5Ј/5ЈЈ, dT),
3
2
3.36 (dd, J = 2.5, J = 10.4 Hz, 1 H, H5Ј/5ЈЈ, dT), 3.67–3.77 (m, 7
H, OCH3, DMT, H5Ј/5ЈЈ, dA), 3.83 (dd, 3J = 3.2, J = 10.9 Hz, 1
2
Eur. J. Org. Chem. 2008, 2100–2106
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
2105

M. Pitulescu, M. Grapp, R. Krätzner, W. Knepel, U. Diederichsen
FULL PAPER
[7] R. W. Gelling, X. Q. Du, D. S. Dichmann, J. Romer, H. Huang,
L. Cui, S. Obici, B. Tang, J. J. Holst, C. Fledelius, P. B.
Johansen, L. Rossetti, L. A. Jelicks, P. Serup, E. Nishmura,
M. J. Charron, Proc. Natl. Acad. Sci. USA 2003, 100, 1438.
[8] L. St-Onge, B. Sosa-Pineda, K. Chowdhury, A. Mansouri, P.
Gruss, Nature 1997, 387, 406.
[9] R. H. Unger, L. Orci, N. Engl. J. Med. 1981, 304, 1518.
[10] R. H. Unger, L. Orci, N. Engl. J. Med. 1981, 304, 1575.
[11] S. Schinner, A. Barthel, C. Dellas, R. Grzeskowiak, S. K.
Sharma, E. Oetjen, R. Blume, W. Knepel, J. Biol. Chem. 2005,
280, 7369.
[20]
G.-X. He, J. P. Williams, M. J. Postich, S. Swaminathan, R. G.
Shea, T. Terhorst, V. S. Law, C. T. Mao, C. Sueoka, S. Coutré,
N. Bischofberger, J. Med. Chem. 1998, 41, 4224.
A. D. Mirzabekov, A. Rich, Proc. Natl. Acad. Sci. USA 1979,
76, 1118.
a) M. Matteucci, Tetrahedron Lett. 1990, 31, 2385; b) R. J.
Jones, K.-Y. Lin, J. F. Milligan, S. Wadwani, M. D. Matteucci,
J. Org. Chem. 1993, 58, 2983.
[21]
[22]
[23]
G. H. Veeneman, G. A. van der Marel, H. van den Elst, J. H.
van Boom, Tetrahedron 1991, 47, 1547.
[24] P. L. M. Quaedflieg, C. Timmers, G. A. van der Marel, E.
Kuyl-Yeheskiely, J. H. van Boom, Synthesis 1993, 627.
[25] M. J. Gait, Oligonucleotide Synthesis – A Practical Approach,
IRL Oxford University Press, Oxford, 1984.
[26] I. Mikkola, J. A. Bruun, T. Holm, T. Johansen, J. Biol. Chem.
2001, 276, 4109.
[12] P. J. Lefebvre, Diabetes Care 1995, 18, 715.
[13] C. Punzo, S. Kurata, W. J. Gehring, Genes Dev. 2001, 15, 1716.
[14] Y. Zhang, S. W. Emmons, Nature 1995, 377, 55.
[15] D. Wilson, G. Sheng, T. Lecuit, N. Dostatni, C. Desplan, Genes
Dev. 1993, 7, 2120.
[16] D. S. Wilson, B. Guenther, C. Desplan, J. Kuriyan, Cell 1995,
82, 709.
[17] Y. Fichou, C. Ferec, Trends Biotechnol. 2006, 24, 563.
[18] J. Micklefield, Curr. Med. Chem. 2001, 8, 1157.
[19] X. Gao, F. K. Brown, P. Jeffs, N. Bischofberger, K.-Y. Lin, A. J.
Pipe, S. A. Noble, Biochemistry 1992, 31, 6228.
[27] W. Knepel, L. Jepeal, J. F. Habener, J. Biol. Chem. 1990, 265,
8725.
Received: December 12, 2007
Published Online: February 27, 2008
2106
www.eurjoc.org
© 2008 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 2008, 2100–2106