Absolutely conserved tryptophan in M49 family of peptidases contributes to catalysis and binding of competitive inhibitors

Article abstract of DOI:10.1016/j.bioorg.2009.03.002

The role of the unique fully conserved tryptophan in metallopeptidase family M49 (dipeptidyl peptidase III family) was investigated by site-directed mutagenesis on human dipeptidyl peptidase III (DPP III) where Trp300 was subjected to two substitutions (W

Full text of DOI:10.1016/j.bioorg.2009.03.002

Bioorganic Chemistry 37 (2009) 70–76
Contents lists available at ScienceDirect
Bioorganic Chemistry
journal homepage: www.elsevier.com/locate/bioorg
Absolutely conserved tryptophan in M49 family of peptidases contributes
to catalysis and binding of competitive inhibitors
a
b
a
a
c
´
´
´
´
Jasminka Špoljaric , Branka Salopek-Sondi , Janja Makarevic , Bojana Vukelic , Dejan Agic ,
a
a
a,
*
ˇ
´
´
Šumski Šimaga , Nina Jajcanin-Jozic , Marija Abramic
a
ˇ
Division of Organic Chemistry and Biochemistry, Ruder Boškovi´c Institute, Bijenicka cesta 54, P.O. Box 180, HR-10002 Zagreb, Croatia
b
ˇ
Division of Molecular Biology, Ruder Boškovi´c Institute, Bijenicka cesta 54, P.O. Box 180, HR-10002 Zagreb, Croatia
c Department of Chemistry, Faculty of Agriculture, The Josip Juraj Strossmayer University, Trg Sv. Trojstva 3, P.O. Box 719, HR-31107 Osijek, Croatia
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 26 October 2008
Available online 20 March 2009
The role of the unique fully conserved tryptophan in metallopeptidase family M49 (dipeptidyl peptidase
III family) was investigated by site-directed mutagenesis on human dipeptidyl peptidase III (DPP III)
where Trp300 was subjected to two substitutions (W300F and W300L). The mutant enzymes showed
thermal stability equal to the wild-type DPP III. Conservative substitution of the Trp300 with phenylal-
anine decreased enzyme activity 2–4 fold, but did not significantly change the Km values for two dipep-
tidyl 2-naphthylamide substrates. However, the Km for the W300L mutant was elevated 5-fold and the
kcat value was reduced 16-fold with Arg-Arg-2-naphthylamide. Both substitutions had a negative effect
on the binding of two competitive inhibitors designed to interact with S1 and S2 subsites.
These results indicate the importance of the aromatic nature of W300 in DPP III ligand binding and
catalysis, and contribution of this residue in maintaining the functional integrity of this enzyme’s S2
subsite.
Keywords:
Dipeptidyl peptidase III
Hydroxamate inhibitor
Peptidase family M49
Protein structure-function
Site-directed mutagenesis
Ó 2009 Elsevier Inc. All rights reserved.
1. Introduction
enzyme, contrary to the previous notion that this amino acid im-
poses restrictions on the hydrolysis of peptide bonds catalyzed
Metallopeptidase family M49 (dipeptidyl peptidase III family)
has been recognized recently, based on the similarity in amino acid
sequences of its members and the structural motif HEXXXH,
important for zinc ligation and catalytic activity. Until now, dipep-
tidyl peptidase III (DPP III; EC 3.4.14.4; formerly known as dipepti-
dyl aminopeptidase III) was purified and biochemically
characterized from several human and animal tissues, and lower
eukaryotes [1]. The cDNA for human, rat and fruit fly DPP III was
cloned and their respective amino acid sequences (737, 738 and
786 amino acids long) were deduced [1–3]. DPP III in vitro hydro-
lyzes distinctive synthetic substrate Arg-Arg-2-naphthylamide
(Arg2-2NA) [4] and a number of biologically active peptides, cleav-
ing dipeptides sequentially from their N-termini. Besides its contri-
bution in normal intracellular protein catabolism, the regulatory
and pathophysiological role for DPP III was suggested [1]. Human
DPP III was recognized by us as a biochemical indicator of endome-
trial and ovarian malignancies [5,6]. Others indicated the role for
DPP III in the endogenous pain-modulatory system, defense
against oxidative stress and in cataractogenesis [7–9]. Recently
we discovered that DPP III could, in some of its substrates (endo-
morphin-1 and -2, b-casomorphin), act as a post-proline-cleaving
by the DPP III type of enzyme [10].
Mutational analysis of rat DPP III identified that two histidines of
the characteristic hexapeptide HELLGH motif (residues 450–455) and
Glu508 are involved in coordination of the active-site zinc, and that
the glutamic acid residue at position 451 is crucial for DPP III catalytic
activity [11]. A functional role for Tyr318 was demonstrated at the ac-
tive site of human DPP III by using the same approach [12].
Most recently, the crystal structure of the yeast DPP III (ligand-
free) was resolved representing a prototype for the whole DPP III
(M49) family [13]. It is a novel protein fold with two domains
forming a cleft containing the active site with catalytic metal ion.
However, in the absence of experimental structures of DPP III-sub-
strate (inhibitor) complexes, the ligand binding is still speculative,
i.e. the structural basis of DPP III broad substrate specificity is lar-
gely unknown. Previous study on human DPP III, based on the
determination of affinity constants of this enzyme for a variety of
peptides suggested hydrophobic S1’ subsite [14].
To reveal yet unknown constituents of (human) DPP III sub-
strate binding site, as a prerequisite, we performed a multiple
alignment of all the DPP III (M49 peptidase) sequences (from more
than 50 species) present in the databases and have revealed that
only one Trp (in position 300 in mammalian amino acid sequences)
is absolutely conserved (Fig. 1 illustrates alignment of DPP III se-
quences from 11 different species).
* Corresponding author. Fax: +385 1 4680 195.
E-mail address: abramic@irb.hr (M. Abramic´).
0045-2068/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved.
doi:10.1016/j.bioorg.2009.03.002

´
71
J. Špoljaric et al. / Bioorganic Chemistry 37 (2009) 70–76
Assuming that evolutionary constraint implies the functional
role for this tryptophan, we considered Trp300 to be good candi-
date for a residue contributing to a hydrophobic pocket of human
DPP III. In this study, we substituted it by site-directed mutagene-
sis, and examined the effects of its replacement on enzyme’s cata-
lytic properties and the binding of hydroxamate inhibitors.
sequencing of complete DPP III gene, as well as confirmation of each
mutant, were obtained with automated sequence analyzer ‘‘ABI
PRISMÒ 3100-Avant Genetic Analyzer” (Applied Biosystems, USA)
using ABI PRISM BigDye Terminator v3.1 Ready Reaction Cycle
Sequencing Kit, commercial T7 forward and T7 reverse primers,
as well as the following internal DPP III primers: DPPIII271F, 50-
gcgttcctggtctatgccgcggg-30; DPPIII521F, 50-ggaattgtaccatggaag
atgcc-30; DPPIII521R, 50-ggcatcttccatggtacaattcc-30; DPPIII1261F,
50-cgggagaagcttacctttctggagg-30; DPPIII1614R, 50-ccatgttgagccagt
tcacgtagatc-30. All primers were custom synthesized by Invitrogen
(USA).
2. Materials and methods
2.1. Construction of the expression vector of human DPP III
Clone IRALp962E0242Q2, containing the full length cDNA
encoding human DPP III from tissue of renal cell adenocarcinoma,
was purchased from the RZPD German Resource Center for Gen-
ome Research (Berlin, Germany). A PCR amplification of the DPP
III gene of 2.214 kb was achieved using a forward (50-gcagcagctag-
catggcggacacccagtacatcc-30) and a reverse primers (50-agggccgtc-
gacagccttggtctgatggaattgg-30), carrying NheI and SalI restriction
sites, respectively. PCR was performed according to standard pro-
cedures using recombinant Taq DNA polymerase (Takara Bio inc.,
Japan) and the following program: initial denaturation at 94 °C
for 5 min, 30 cycles at 94 °C for 30 s, 60 °C for 60 s, 72 °C for
5 min, and final extension at 72 °C for 7 min. Following restriction
digestion of the PCR product and pET21b plasmid with NheI and
SalI restriction enzymes (Invitrogen, USA), ligation was performed
by T4 DNA ligase (Invitrogen, USA) for 2 h at room temperature,
and Escherichia coli XL-10 Gold cells (Stratagene, USA) were trans-
formed. Colonies, grown over night, were subjected to colony PCR
for screening, and that positive for DPP III fragment were subjected
to plasmid isolation by using GenElute Plasmid Miniprep Kit (Sig-
ma, Germany). Since this construct contained three codons (for
methionine, alanine and serine) belonging to pET21b plasmid se-
quence before the first AUG codon of the cloned DPP III gene, dele-
tion of these codons was performed by using QuickChange II XL
Site-Directed Mutagenesis kit (Stratagene, USA) and the following
set of complementary primers: 50-gaaggagatatacatatggcggacacc-
cagtacatcc-30, and 50-ggatgtactgggtgtccgccatatgtatatctccttc-30. It
resulted in the final construct which was used for further mutagen-
esis and protein expressions.
2.3. Heterologous expressions of wild-type and mutants of DPP III
protein
For heterologous expressions, a proper construct (wild-type or a
certain mutant) was transformed into E. coli strain BL21(DE3)RIL+.
Several colonies were inoculated into 5 ml of Luria broth (LB) sup-
plemented with ampicillin (100 lg/ml) and grown over night at
37 °C. The following day 5 ml of the o/n cell culture were added
into 0.5 L of fresh LB medium containing ampicillin and grown un-
til the A600 reached the values of 0.6–0.8. Protein expression was
then induced by addition of isopropyl-b-D-1-thiogalactopyranoside
(IPTG) to 0.5 mM and the cells were grown for additional 3 h at
23 °C. Bacterial cells were then pelleted by centrifugation at
5000 g, at 4 °C for 20 min, and stored at ꢀ20 °C until lysis for pro-
tein analysis and purification.
2.4. Purification of recombinant human DPP III
E. coli pellet, containing recombinant human DPP III protein,
was suspended in 10 mM Tris–HCl (pH 8.0; 100 lg lysozyme/ml),
with 1 mM EDTA, and incubated on ice for 10 min. Following son-
ication, and incubation with DNase I (Sigma), cell lysate was clar-
ified by centrifugation at 16,000 g and 4 °C for 20 min. The
supernatant was subjected to gel filtration on Sephacryl S-200,
superfine, column (1.5 ꢁ 90 cm), in 50 mM Tris–HCl, 0.2 M NaCl,
pH 7.4 buffer. After concentration and desalting, active DPP III frac-
tions were further purified by FPLC on Mono Q 5/5 column (Phar-
macia) equilibrated in 50 mM Tris–HCl, 1 mM NaCl, pH 7.4 buffer.
The column was rinsed with the starting buffer containing 0.1 M
NaCl, and then with a linear 0.1–0.5 M NaCl gradient. Fractions
with DPP III activity, eluted between 0.19 and 0.21 M salt, were
stored in 22% glycerol at ꢀ10 °C.
2.2. Site-directed mutagenesis and sequencing
Point mutations of the DPP III gene: W300F, and W300L were
carried out with the QuickChange II XL Site-Directed Mutagenesis
kit (Stratagene, USA) by using the primers listed in Table 1. The
2.5. SDS–PAGE and Western-immunoblot analysis
Protein purity was confirmed by gel electrophoresis under
denaturing conditions. SDS–PAGE and Western blotting were car-
ried out as described earlier [15].
H. sapiens
M. musculus
D. rerio
X. laevis
A. aegypti
AHKRGSRFWIQDKGPIV 308
AHKRGSRFWIQDKGPIV 308
AHKEGSRFWIKDKGPIV 308
AHKEGSKYWVQDKGPIV 310
AHKTGSRYWIKDKGPVI 305
2.6. Enzyme activity assay and determination of kinetic parameters
D. melanogaster EHKNGSRWWIKDKGPVI 366
C. briggsae
L. major
S. cerevisiae
A. clavatus
S. usitatus
AHKDGSRYWIKDAGPAV 299
AHKESQKEWVRDVGPTV 288
AHKEAQKLWVKDISPVI 317
AFKEAQRIWVKDQKPIL 310
DFLAFDAAWVQS-NPRV 300
The enzymatic activities of wild-type and mutant DPP III were
determined by a standard assay at 37 °C with Arg2-2NA as a sub-
strate, using the colorimetric method as previously described [15].
Fig. 1. Conserved Trp in family M49. Multiple sequence alignment of a selection of
significantly similar peptidases of DPP III family (peptidase family M49) was
obtained using CLUSTAL X v.1.83 [25]. Final presentation shows partial alignment
diagram of sequences: Homo sapiens (Q9NY33), Mus musculus (Q99KK7), Danio rerio
(Q6DI20), Xenopus laevis (Q6PA12), Aedes aegypti (Q17GV2), Drosophila melanogas-
ter (Q9VHR8), Caenorhabditis briggsae (A8XGF7), Leishmania major (Q4QJA6),
Saccharomyces cerevisiae (Q08225), Aspergillus clavatus (A1CGS6), and Solibacter
usitatus (Q02C27). Residues printed in white on black are those identical in at least
8 out 11 aligned proteins, whereas similar amino acid residues are shadowed gray.
Fully conserved Trp is framed.
Table 1
Primers used for site-directed mutagenesis of human DPP III cDNA.
Mutant
Nucleotide sequence
(50–30) Primer I
Nucleotide sequence
(50–30) Primer II
W300F
W300L
ctcccgcttcttcatccaggacaaagg
ctcccgcttcttgatccaggacaaagg
cctttgtcctggatgaagaagcgggag
cctttgtcctggatcaagaagcgggag
Codons for the mutated residues are underlined.

´
72
J. Špoljaric et al. / Bioorganic Chemistry 37 (2009) 70–76
*
Kinetic parameters for hydrolysis of Arg2-2NA and Ala2-2NA
were determined at 25 °C and at pH 8.6 and pH 8.0, respectively,
in the presence of 50 M CoCl2 by initial rate measurements, as
previously described [15]. The kinetic parameters were calculated
using Lineweaver-Burk and Hanes plots, with Arg2-2NA concentra-
(CH ), 38.1, 36.2 (CH2,Phe, CH2,Tyr); HRMS calcd. for C18H21N3O4:
344.1615 [M + H]+, found 344.1625.
l
7: 1H NMR (DMSO-d6): d 10.59 (1 H, s, –NH–O), 9.43 (1 H, s br, –
OH), 8.79 (1 H, t, J = 5.4, NHGly), 8.13 (3H, s, –NH3+), 7.05, 6.71 (2x2
H, 2d, J = 8.3, CHarom), 4.11–3.89 (1 H, m, CH*), 3.75 (1 H, dd, J = 5.8,
J = 15.9, CHA,Gly), 3.63 (1 H, dd, J = 5.4, J = 15.9, CHBGly), 2.99 (1 H,
dd, J = 5.5, J = 14.0, CHA,Tyr), 2.84 (1 H, dd, J = 7.7, J = 14.0, CHB,Tyr);
13C NMR (DMSO-d6): d 168.5, 165.0 (C@O), 156.6, 124.8 (Carom),
tions from 2.5 to 120 lM, and Ala2-2NA from 100 to 1000 lM.
Dixon and [S]/v versus [S] plots were used to establish the type
of inhibition exhibited by hydroxamate inhibitor at pH 8.0.
Protein concentrations were determined using the protein-dye
binding assay [16], with bovine serum albumin as a standard.
*
130.5, 115.4 (CHarom), 53.8 (CH ), 40.0 (CH2,Gly), 36.2 (CH2,Tyr);
HRMS calcd. for C11H15N3O4: 254.1135 [M + H]+, found 254.1142.
2.7. Thermal stability
2.9. Fluorescence measurements
Thermal stability measurements were performed by incubating
the samples (0.03 lM enzyme in 17 mM Tris–HCl buffer, pH 7.5)
at each temperature for 15 min. Residual DPP III activity was
determined at the end of the incubation by a standard activity
assay.
All enzyme samples were dialyzed against 50 mM Tris–HCl, pH
7.4, and adjusted for the same protein absorption at 280 nm (0.03)
before the measurements. Steady-state fluorescence measure-
ments were performed on Varian Cary Eclipse spectrofluorimeter,
at 20 °C, using 1 cm quartz cuvette. The excitation wavelength
was set at 295 nm for selective excitation of tryptophan and emis-
sion spectra were collected from 300 to 400 nm. The bandwidth for
excitation monochromator was 5 nm and for emission 10 nm.
Emission spectra were corrected for the background and dilution
effect. Analysis of fluorescence data (obtained from at least 3 mea-
surements) was performed using OriginPro7.5 program and adja-
cent averaging options.
2.8. Synthesis of hydroxamate inhibitors
The synthesis, via N-hydroxy succinimide intermediates [17], of
the two dipeptide hydroxamate inhibitors,
L-tyrosyl-L-phenylala-
nine hydroxamic acid (4) and -tyrosyl-glycine hydroxamic acid
L
(7) is outlined in Scheme 1. The reaction of Boc-Tyr(OBzl)OSu (1)
with HPheNHOBzl.CF3COOH and triethylamine in dry tetrahydro-
furan afforded the protected derivative 2. The O-benzyl groups
were deprotected by the hydrogenolysis with 10% Pd/C in ethanol
(to improve solubility a small amount of dichlormethane was
added) [18]. The final compound 4 was obtained by the treatment
of compound 3 with trifluoracetic acid [18]. By the same proce-
dure, Tyr-Gly derivative 7 was prepared.
3. Results and discussion
3.1. Generation and purification of wild-type human DPP III and
mutant enzymes
Constructs for the wild-type and for mutants were generated
and the genes were overexpressed in E. coli BL21(DE3)RIL+ as de-
scribed in the Section 2. Tryptophan at position 300 in human
DPP III was replaced by site-directed mutagenesis to phenylalanine
or leucine residue. Mutations were confirmed by DNA sequence
analysis. The wild-type DPP III and the produced mutated proteins
were purified to apparent homogeneity (SDS–PAGE data not
shown). The flow of the purification is presented in Table 2. During
purification, the two mutant enzymes showed physical properties
essentially identical to those of the wild-type DPP III. Western-
immunoblot analysis demonstrated that the wild-type and mutant
recombinant proteins appeared as bands with identical molecular
mass of 82 kDa (Fig. 2).
The identity of synthesized inhibitors 4 and 7 was confirmed by
1H and 13C NMR spectra (recorded at 300 and 75 MHz, respectively,
on a Bruker Avance 300 spectrometer) and by high resolution mass
spectra (HRMS). Mass spectra in reflectron mode were obtained on
an Applied Biosystems MALDI-TOF/TOF mass spectrometer (Foster
City, USA).
4: 1H NMR (DMSO-d6): d 10.75 (1 H, s, –NH–O), 9.43 (1 H, s br, –
OH), 8.93 (1 H, d, J = 8.3, NHPhe), 8.02 (3H, s, –NH3+), 7.35–7.17 (5 H,
m, CHarom, Phe), 7.04, 6.71 (2 ꢁ 2 H, 2d, J = 8.4, CHarom, Tyr), 4.57–
4.38, 4.00–3.80 (2 ꢁ 1 H, 2 m, 2CH*), 3.08–2.70 (4 H, m, CH2,Phe
,
CH2,Tyr); 13C NMR (DMSO-d6): d 167.9, 166.8 (C@O), 156.6, 137.2,
130.3, 129.2, 128.3, 126.5, 124.6, 115.3 (Carom, CHarom), 56.0, 53.5
O
OR'
OR'
b)
a)
O
O
H
O
N
O
N
H
O
O
H
O
H
O
H
N
H
N
1
OR'
OR'
N
H
RHN
N
H
RHN
H
H
H
O
O
2 R=Boc, R'=CH2Ph
5 R=Boc, R'=CH2Ph,
c)
d)
c)
d)
3 R=Boc, R'=H
6 R=Boc, R'=H
4 R=R'=H
7 R=R'=H
Scheme 1. The synthesis of the hydroxamate inhibitors: (a) H2N-Phe-NHOBzlꢂCF3COOH, TEA, THF; (b) H2N-Gly-NHOBzlꢂCF3COOH, TEA, THF; (c) H2, 10% Pd/C, EtOH; (d)
CF3COOH.

´
73
J. Špoljaric et al. / Bioorganic Chemistry 37 (2009) 70–76
Table 2
Purification of wild-type and DPP III mutants.
Purification step Specific activitya (U/mg)
Yield (%)
Wild-type W300F W300L Wild-type W300F W300L
Cell lysateb
Gel filtration
FPLC (Mono Q)
1.81
25.37
45.60
1.06
5.38
24.90
0.05
0.39
1.43
100
71
28
100
42
37
100
69
49
a
Specific activity was determined at 37 °C by a standard assay with Arg2-2NA, as
described in Section 2.
b
Supernatant 16,000 g.
3.2. Thermal stability
The thermal stability of the mutant and wild-type enzymes is
shown in Fig. 3. The curves of the W300F and W300L mutants
are coincident with that of the wild-type DPP III: 50% inactivation
occurred at approximately 50 °C, while at 55 °C all these enzyme
forms were completely inactivated. Identical thermal stability of
the wild-type and mutated enzymes suggested that the substitu-
tion of Trp300 to Phe or Leu did not affect the overall stability of
the protein.
Fig. 3. Effect of temperature on the stability of wild-type and tryptophanyl mutants
of human DPP III.
3.3. Substrate specificity towards dipeptidyl 2-naphthylamides
Table 3
Substrate specificity of mutated enzymes and the wild-type was
examined with dipeptidyl 2-naphthylamides. Both mutants and the
wild-type preferred Arg2-2NA (Table 3) which is in agreement with
the published data on human erythrocyte DPP III [19]. Ala2-2NA and
Ala-Phe-2NA were hydrolyzed much more slowly (Table 3).
Substrate specificity towards dipeptidyl 2-naphthylamides.
Substrate
Relative hydrolysis rate (%)
Wild-type DPP III
W300F
W300L
Arg-Arg-2NA
Ala-Ala-2NA
Ala-Phe-2NA
Gly-Phe-2NA
100
100
100
1.64
0.25
0.02
0.73
0.05
0.05
2.01
1.15
0.14
3.4. Kinetic characterization of tryptophanyl mutants
The nomenclature used for the characterization of the individ-
ual amino acid residues of a peptide substrate or an inhibitor
The enzymes were incubated at 37 °C in 50 mM Tris-HCl buffer, pH 8.0 with 50
CoCl2 with the substrates at a final concentration of 0.04 mM. (100% = 20.6 mol or
7.5 mol or 0.47 mol of Arg2-2NA hydrolyzed per min and milligram of the wild-
type DPP III, W300F or W300L, respectively).
lM
l
l
l
(P1, P2, P10) and of the corresponding subsites (S1, S2, S10) of the
enzyme is that of Schechter and Berger [20].
Catalytic properties of mutants and the wild-type human DPP
III were determined using two synthetic substrates which bear
identical residue in P10 position, Arg2-2NA and Ala2-2NA. The latter
was found to be a much less favorable substrate than Arg2-2NA for
all DPP III forms (Table 4).
Mr x 103
The substitution of Trp300 with Phe lowered kcat for the hydro-
lysis of Arg2-2NA and Ala2-2NA 2-fold and 4-fold, respectively,
leaving Km almost unchanged. However, a more dramatic 5-fold in-
crease in Km and 16-fold decrease in kcat for Arg2-2NA (78-fold low-
ered catalytic efficiency, kcat/Km value) was observed when Trp300
was mutated to Leu (Table 4). Also in the case of a poor substrate
(Ala2-2NA), the decrease in catalytic efficiency of W300L versus the
wild-type was more pronounced (22-fold) than that of W300F (5-
fold).
Based on the kinetic investigation of hydrolysis of dipeptidyl 2-
naphthylamides it is evident that the substitution of evolutionary
conserved Trp by a Phe or Leu did not change the preference for
these synthetic substrates (overall substrate specificity) (Table 3),
but significantly impaired catalytic properties of mutated DPP III
(Table 4). More pronounced change of both kinetic parameters,
Km and kcat, observed with W300L indicates the importance of aro-
matic amino acid residue in that position (300) for catalytic mech-
anism of DPP III.
250 –
160 –
105 –
75 –
50 –
35 –
30 –
Fig. 2. Western-immunoblot analysis of the purified human DPP III proteins.
Samples of wild-type (100 ng/lane) and of recombinant human DPPs III (120 ng of
W300F/lane and 150 ng of W300L/lane)) were analyzed by Western blot as
described earlier [15].
The decrease in catalytic efficiency of W300L is comparable
with the loss of catalytic power (a 125-fold decrease in kcat/Km)

´
74
J. Špoljaric et al. / Bioorganic Chemistry 37 (2009) 70–76
Table 4
Kinetic characterization of wild-type and DPP III mutantsa.
Wild-type
W300F
W300L
Arg-Arg-2NA
Km M)
(
l
11.6 1.4
21.8 2.8
1879.3
13.8 0.8
10.7 1.5
775.4
57.0 4.2
1.4 0.0
24.6
kcat (sꢀ1
)
kcat/Km (mMꢀ1 sꢀ1
)
Ala-Ala-2NA
Km
(
l
M)
299.9 3.4
21.0 0.5
70.0
355.7 46.2
5.1 0.9
14.3
441.1 26.7
1.4 0.2
3.2
kcat (minꢀ1
)
kcat/Km (mMꢀ1 minꢀ1
)
a
The kinetic parameters were determined from the initial reaction rates at 25 °C
M and Ala2-2NA from 100 to
Lineweaver-Burk plot. The enzyme concentrations were:
with the Arg2-2NA concentrations from 2.5 to 120
1000 M, using
l
l
a
3.8 ꢁ 10ꢀ11 M wild-type, 8.8 ꢁ 10ꢀ11 M W300F and 6.6 ꢁ 10ꢀ10 M W300L in reac-
tion mixture with Arg2-2NA, and 2.0 ꢁ 10ꢀ9 M wild-type, 4.3 ꢁ 10ꢀ9 M W300F and
1.4 ꢁ 10ꢀ8M W300L, respectively, when hydrolysis of Ala2-2NA was measured. Km
and kcat shown are means S.E. for three separate determinations.
in Y318F mutant of human DPP III, shown by us most recently [12].
However, the substitution of Tyr318 did not influence the Km value
and its involvement in transition state stabilization was suggested
[12].
Fig. 4. Inhibition of human DPP III tryptophanyl mutants by Tyr-Phe-NHOH. d and
j: W300L; and W300F. The data are shown as Dixon plots. The Ki
:
N
.
corresponds to the negative X-axis value of the intersection of the lines obtained at
various substrate concentrations: (j, 5.0 M; (d, 20 M. The initial
)
l
)
.
.
l
N
3.5. Inhibition with dipeptidyl hydroxamic acids
velocities are expressed in arbitrary units F(fluorescence) sꢀ1
In order to further characterize the mutated enzymes, their
interaction with two dipeptidyl hydroxamic acids, Tyr-Phe-NHOH
and Tyr-Gly-NHOH, was investigated. Most recently we have
shown strong inhibition of the wild-type human DPP III by Tyr-
Phe-NHOH [12]. Therefore, at first, affinity of mutants for this
dipeptidyl hydroxamic acid was determined. As shown in Table
5, W300F and W300L were both potently inhibited. The competi-
tive character of this inhibition, illustrated in Fig. 4, was confirmed
by s/v versus s plots (not shown). Interestingly, the mutants’ affin-
ity for Tyr-Phe-NHOH was significantly (6-fold of W300F, and 29-
fold of W300L, respectively) reduced in comparison to that of the
wild-type DPP III (Table 5). More pronounced increase of Ki ob-
served with W300L, compared to W300F, indicates the importance
of aromatic amino acid residue in position 300 for inhibitor
binding.
To investigate if a hydroxamic acid moiety is sufficient for
strong binding to the active site of human DPP III, we changed ami-
no acid in the position P1 (Phe for Gly) in hydroxamate inhibitor.
As seen in Table 5, replacement of Phe by Gly in dipeptidyl
hydroxamic acid caused dramatic change in inhibitory potency
for the wild-type human DPP III and both mutated enzymes. Al-
most identical increase (70 to 82-fold) in Ki values for Tyr-Gly-
NHOH was observed for the wild-type and enzymes with substi-
tuted Trp300 compared to the Ki determined for inhibition by
Tyr-Phe-NHOH (Table 5).
(332.7 0.6), 337 (336.7 1.2) and 339 (339.0 1.0) nm, respec-
tively. Compared with the wild-type, mutated enzymes W300F
and W300L showed a decrease in the fluorescence intensity, mea-
sured at a peak maxima, of about 21% and 14%, respectively.
Addition of inhibitor in saturating concentration resulted in a
rapid fluorescence decrease. The steady-state tryptophan fluores-
cence of human DPP III wild-type was quenched 7.9% by the com-
petitive inhibitor Tyr-Phe-NHOH (Supplemental Fig. 1). The
fluorescence of the W300F enzyme was slightly less sensitive to
the occupancy of the binding site with competitive inhibitor
(7.7% decrease of fluorescence), and that of the W300L mutant
showed 5.5% decrease (Supplemental Fig. 1).
Human DPP III is spectroscopically very complex because it has
10 Trp per molecule. Therefore, the interpretation of fluorescence
measurements is not unambiguous. Our results indicate that the
contribution of Trp300 to the overall protein fluorescence is rather
moderate. The finding that W300L showed smaller fluorescence
quenching upon inhibitor binding than the wild-type enzyme
might indicate the involvement of Trp300. On the other hand,
the presence of quenching phenomenon, although in some smaller
extent than in the wild-type enzyme, in the W300 mutants could
indicate involvement of additional Trp(s) in human DPP III ligand
binding. However, evaluation of the contribution of Trp300 to the
competitive inhibitor binding using fluorescence measurement
could be additionally hindered by the change (which might be in-
crease or decrease) in fluorescence of some other Trp (there are
nine Trp residues in addition to Trp300 in human DPP III molecule),
which may be remote from the active-site cleft but could also re-
flect possible conformational changes induced by ligand binding.
For instance, Cheung and Mas have shown for 3-phosphoglycerate
kinase, another enzyme with an active-site cleft between the two
domains, by using fluorescence measurements of single trypto-
phan probes which were not in direct contact with substrates, that
binding of substrates to one domain can also induce spectral per-
turbation of the probes in the opposite domain [21]. For the yeast
DPP III, a TLS (Translation/Libration/Screw) – analysis indicated an
opening and closing motion of the substrate binding cleft, i.e. an
interdomain movement [13]. A high degree of conservation around
The inhibitor interaction with DPP III was followed also by fluo-
rimetry. The intrinsic fluorescence properties of the wild-type and
tryptophan mutant enzymes were analyzed (Supplemental Fig. 1).
Emission spectra were obtained after excitation at 295 nm. The
wild-type, W300F and W300L had emission maxima at 333
Table 5
Affinity of human DPP III wild-type and mutants for dipeptidyl hydroxamic acids.
Wild-type, Ki (lM)
W300F, Ki (lM)
W300L, Ki (lM)
Tyr-Phe-NHOH
Tyr-Gly-NHOH
0.15a 0.04
10.50 2.10
0.92 0.12
61.62 1.29
4.27 1.44
351.62 88.80
a
Ki of the wild-type human DPP III for Tyr-Phe-NHOH was published recently by
us [12]. Presented are means S.E. for three separate determinations. Ki values were
determined with Arg2-2NA as substrate at pH 8.0, using Dixon plots.

´
75
J. Špoljaric et al. / Bioorganic Chemistry 37 (2009) 70–76
L
-Tyr-L-Phe-NHOH in DPP III active site. It is assumed that dipep-
the zinc-binding site and the proposed active-site cleft is found
among eukaryotic DPP III enzymes [13].
tide inhibitor interacts with its N-terminal group with a putative
negatively charged acceptor group and that the hydroxamate moi-
ety interacts with the zinc of the catalytic site.
Due to their ability to form bidentate complexes with metal lo-
cated in the metallopeptidase catalytic site, hydroxamic acid deriv-
atives are among the most potent inhibitors of such enzymes.
Particularly peptidyl hydroxamates have potential for developing
of affinity probes for metalloproteases [22,23].
4. Conclusions
We selected a substrate analog Tyr-Phe-NHOH containing a
hydroxamic acid moiety as a zinc coordinating ligand and a dipep-
tide with a free N-terminal amino group for binding to S1 and S2
subsites (Fig. 5). Tyr-Phe-NHOH was shown by Chérot et al. [24]
to be selective inhibitor of enkephalin-degrading dipeptidyl ami-
nopeptidase from the membranes of porcine brain, which inhibited
this enzyme competitively with a Ki value of 9 nM at pH 7.0. In our
previous work we have used this hydroxamate derivative to inves-
tigate the role of Tyr318 in the catalysis of human DPP III. The
wild-type DPP III and the Phe318 mutant were inhibited by
Tyr-Phe-NHOH, with virtually the same Ki value, indicating that this
inhibitor binds similarly in the mutated active site, and that Tyr318
is not the constituent of S1 or S2 subsite. In contrast, in the present
study the decreased binding of two competitive inhibitors to the
Trp300 mutants implies the role of this fully conserved tryptophan
residue in substrate (ligand) binding of M49 peptidases.
Furthermore, our results show that, for strong interactions of
DPP III with hydroxamate inhibitor, chelating effect of the
hydroxamate moiety is not sufficient. Of crucial importance are
interactions with substrate binding subsites. Since the difference
in affinity of the wild-type DPP III and of tryptophanyl mutants
for Tyr-Phe-NHOH and Tyr-Gly-NHOH was almost two orders of
magnitude (Table 5), it is evident that P1 residue of the dipeptidyl
hydroxamic acid inhibitor strongly influences the binding (to the
S1 subsite of the enzyme). As the decrease for binding of Tyr-
Gly-NHOH in both mutated enzymes (W300F and W300L) was
practically the same as in the wild-type, Trp300 does not seem
to contribute to the enzyme’s S1 subsite. However, as Ki values of
these two inhibitors designed to bind to the S1 and S2 subsites
of dipeptidyl aminopeptidase were greatly increased compared
to the Ki value of the wild-type DPP III, these results indicate that
Trp300 might participate in maintaining the functional integrity
of enzyme’s S2 subsite (Fig. 5). Fig. 5 depicts the binding of
In order to investigate the functional role of the unique evolu-
tionary conserved tryptophan residue in DPP III family of metallo-
peptidases, recombinant human DPP III (the wild-type and two
mutant enzymes, W300F and W300L) was heterologously ex-
pressed, purified and kinetically characterized.
In addition, two dipeptidyl hydroxamic acids, Tyr-Phe-NHOH
and Tyr-Gly-NHOH, were synthesized and, for the first time, shown
to be potent competitive inhibitors of human DPP III.
Obtained kinetic results support the contribution of Trp300 in
the ligand (competitive peptide inhibitor) binding and catalysis
of human DPP III. Effect of mutations (Trp300 to Phe and Leu) on
enzyme’s affinity for inhibitors designed to bind to the S1 and S2
subsites indicates that this residue might participate in maintain-
ing the functional integrity of enzyme’s S2 subsite.
This investigation provided information on the functional role
of Trp300 in human DPP III and on the dipeptidyl hydroxamic acids
as potent competitive inhibitors of this metallopeptidase.
Acknowledgments
Support for this study by the Croatian Ministry of Science, Edu-
cation and Sport (Projects 098-1191344-2938, 098-0982913-2829
and 098-0982904-2912) is gratefully acknowledged. Authors
ˇ
´
thank Dr. Mario Gabricevic for his generous help with fluorescence
measurements.
Appendix A. Supplementary material
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.bioorg.2009.03.002.
References
[1] J.-M. Chen, A.J. Barrett, in: A.J. Barrett, N.D. Rawlings, J.F. Woessner (Eds.),
Handbook of Proteolytic Enzymes, second ed., vol. 1, Elsevier, Amsterdam,
2004, pp. 809–812.
[2] K. Fukasawa, K.M. Fukasawa, M. Kanai, S. Fujii, J. Hirose, M. Harada, Biochem. J.
329 (1998) 275–282.
[3] C. Mazzocco, K.M. Fukasawa, P. Auguste, J. Puiroux, Eur. J. Biochem. 270 (2003)
3074–3082.
S
1
[4] S. Ellis, J.M. Nuenke, J. Biol. Chem. 242 (1967) 4623–4629.
[5] Š. Šimaga, D. Babic´, M. Osmak, J. Ilic´-Forko, Lj. Vitale, D. Milicic, M. Abramic,
ˇ ´
´
Eur. J. Cancer 34 (1998) 399–405.
[6] Š. Šimaga, D. Babic´, M. Osmak, M. Šprem, M. Abramic´, Gynecol. Oncol. 91
(2003) 194–200.
[7] T. Chiba, Y.-H. Li, T. Yamane, O. Ogikubo, M. Fukuoka, R. Arai, S. Takahashi, T.
Ohtsuka, I. Ohkubo, N. Matsui, Peptides 24 (2003) 773–778.
[8] Y. Liu, J.T. Kern, J.R. Walker, J.A. Johnson, P.G. Schultz, H. Luesch, Proc. Natl.
Acad. Sci. USA 104 (2007) 5205–5210.
O
O
H
H
N
-
+
H
N
H
O
3
N
H
O
H
O
[9] H. Zhang, Y. Yamamoto, S. Shumiya, M. Kunimatsu, K. Nishi, I. Ohkubo, K. Kani,
Histochem. J. 33 (2001) 511–521.
ˇ
´
´
´
[10] M. Baršun, N. Jajcanin, B. Vukelic, J. Špoljaric, M. Abramic, Biol. Chem. 388
(2007) 343–348.
Zn
[11] K. Fukasawa, K.M. Fukasawa, H. Iwamoto, J. Hirose, M. Harada, Biochemistry
38 (1999) 8299–8303.
[12] B. Salopek-Sondi, B. Vukelic´, J. Špoljaric´, Š. Šimaga, D. Vujaklija, J. Makarevic´, N.
Glu508
His455
OH
Trp300
ˇ
´
Jajcanin, M. Abramic, Biol. Chem. 389 (2008) 163–167.
His450
ˇ
´
´
[13] P. Kumar Baral, N. Jajcanin-Jozic, S. Deller, P. Macheroux, M. Abramic, K.
Gruber, J. Biol. Chem. 283 (2008) 22316–22324.
´
´
[14] M. Abramic, M. Zubanovic, Lj. Vitale, Biol. Chem. Hoppe-Seyler 369 (1988) 29–
38.
S
2
ˇ
´
ˇ
´
ˇ
[15] M. Abramic, Š. Šimaga, M. Osmak, L. Cicin-Šain, B. Vukelic, K. Vlahovicek, Lj.
ˇ
Dolovcak, Int. J. Biochem. Cell Biol. 36 (2004) 434–446.
[16] M.M. Bradford, Anal. Biochem. 72 (1976) 248–254.
[17] Methoden Org. Chem. (Houben-Weyl) fourth ed., vol. XV/2, 1974, pp. 149–166.
Fig. 5. Schematic representation of the active site of human DPP III binding a
competitive inhibitor Tyr-Phe-NHOH.

´
J. Špoljaric et al. / Bioorganic Chemistry 37 (2009) 70–76
76
[18] T. Greene, P.G.M. Wuts, Protecting Groups in Organic Synthesis, John
Wiley&Sons Inc., 1991.
[23] A. Saghatelian, N. Jessani, A. Joseph, M. Humphrey, B.F. Cravatt, Proc. Natl.
Acad. Sci. USA 101 (2004) 10000–10005.
ˇ
[19] M. Abramic´, D. Schleuder, Lj. Dolovcak, W. Schröder, K. Strupat, D. Šagi, J.
[24] P. Chérot, J. Devin, M.-C. Fournié-Zaluski, B.P. Roques, Mol. Pharmacol. 30
(1986) 338–344.
[25] J.D. Thompson, T.J. Gibson, F. Plewniak, F. Jeanmougin, D.G. Higgins, Nucleic
Acids Res. 24 (1997) 4876–4882.
Peter-Katalinic´, Lj. Vitale, Biol. Chem. 381 (2000) 1233–1243.
[20] I. Schechter, A. Berger, Biochem. Biophys. Res. Commun. 27 (1967) 157–159.
[21] C.-W. Cheung, M.T. Mas, Protein Sci. 5 (1996) 1144–1149.
[22] E.W.S. Chan, S. Chattopadhaya, R.C. Panicker, X. Huang, S.Q. Yao, J. Am. Chem.
Soc. 126 (2004) 14435–14446.