Tipranavir analogous 3-sulfonylanilidotetronic acids: new synthesis and structure-dependent anti-HIV activity

Article abstract of DOI:10.1016/j.tet.2008.07.094

Sulfonamide-containing tetronic acids 1, structural analogues of the HIV-1 protease inhibitor tipranavir, were synthesised in five steps including a microwave-assisted Claisen rearrangement of cinnamyl tetronates and a modified Charette cyclopropanation of the so-formed 3-allyltetronic acids. Compounds 1 with two non-H residues (R¹, R²) at C-5 of the tetronate core exhibited structure-dependent antiviral activity in two HIV strains. Derivatives 1c (R¹=R²=Me, R³=Cl) and 1d (R^1,2=(CH₂)₅, R³=Me) were most active (IC₅₀<10 μM) in the sensitive strain HIV_NL4-3.

Full text of DOI:10.1016/j.tet.2008.07.094

Tetrahedron 64 (2008) 9401–9407
Contents lists available at ScienceDirect
Tetrahedron
journal homepage: www.elsevier.com/locate/tet
Tipranavir analogous 3-sulfonylanilidotetronic acids: new synthesis and
structure-dependent anti-HIV activity
,
a
b
Rainer Schobert a , Ralf Stehle , Hauke Walter
*
a Organic Chemistry Laboratory, University Bayreuth, Universitaetsstrasse 30, 95440 Bayreuth, Germany
b National Reference Centre for Retrovirus (NRC), University Erlangen, 91054 Erlangen, Germany
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 25 June 2008
Received in revised form 21 July 2008
Accepted 22 July 2008
Available online 26 July 2008
Sulfonamide-containing tetronic acids 1, structural analogues of the HIV-1 protease inhibitor tipranavir,
were synthesised in five steps including a microwave-assisted Claisen rearrangement of cinnamyl tetr-
onates and a modified Charette cyclopropanation of the so-formed 3-allyltetronic acids. Compounds 1
with two non-H residues (R1, R2) at C-5 of the tetronate core exhibited structure-dependent antiviral
activity in two HIV strains. Derivatives 1c (R1¼R2¼Me, R3¼Cl) and 1d (R1,2¼(CH2)5, R3¼Me) were most
active (IC50<10 mM) in the sensitive strain HIVNL4-3.
Keywords:
Tetronic acid
Ó 2008 Elsevier Ltd. All rights reserved.
Claisen rearrangement
Cyclopropanation
HIV-1 protease inhibitor
Microwave
1. Introduction
good binders to the active site of HIV-1 protease.6,7 However, the
given protocols were incomplete and failed to work in our hand.
Thus, herein, we present a conceptionally new, reliable five-step
synthesis of 3-[cyclopropyl-m-(benzsulfonanilido)methyl]tetronic
acids 1 with three variable residues (Fig. 1). We also report the
structure-dependent antiviral activities of eight derivatives of 1 in
two HIV strains.
Regimens with HIV protease inhibitors (PI) in combination
with reverse transcriptase inhibitors continue to be the first line
treatment for control of HIV-1 infections despite serious limitations
such as long term drug toxicity and rapidly developing viral mul-
tidrug resistance.1 As the precise C2-symmetric structure of the
homodimeric HIV-1 protease was known relatively early on, the
rational design of inhibitors was possible.2 Aside of peptidomimetic
PI containing transition-state inserts in place of the dipeptidic
cleavage sites of the substrates,3 non-peptidic inhibitory ligands for
HIV proteases were developed in steadily increasing numbers. They
feature a greater oral bioavailability and slower biliary excretion
when compared to peptide-derived compounds. They are also
faster to synthesise and so lend themselves to a continuous de-
velopment addressing the problem of resistance. In 2005, tipra-
navir (AptivusÒ, Boehringer Ingelheim) was approved by the EMEA
for clinical application in combination therapies. This sulfonamide-
containing 5,6-dihydro-4-hydroxy-2-pyrone had emerged from
screenings of 3-substituted coumarins and dihydropyrones and
proved active even in patients no longer responding to other con-
ventional PI.4 Other 4-hydroxypyrones with anti-HIV activity were
2. Results and discussion
2.1. Chemistry
In contrast to dihydro-4-hydroxypyran-2-ones as occurring in
tipranavir, tetronic acids cannot be directly alkylated in 3-position.
The above mentioned patent literature6 on analogues of 1 de-
scribed an indirect route to achieve 3-alkylation, which comprises
condensation of the respective tetronic acids with aldehydes and
subsequent Grignard addition to the newly formed exocyclic dou-
ble bond. We found this method to fail erratically. Scheme 1 depicts
an alternative five-step synthesis of compounds 1 starting from
tetronic acids 5. These were readily prepared from the corre-
also reported.5 Tipranavir analogous tetronic acids bearing 3-
a-
cyclopropyl groups were earlier pinpointed in patents as equally
sponding benzyl
a-hydroxy carboxylates 2 and the cumulated
phosphorus ylide Ph3P]C]C]O 3.8 Addition of the OH group of 2
across the C]C bond of the ylide afforded an ester ylide, which in
turn underwent an intramolecular Wittig alkenation to give the
benzyl tetronates 4.9 Hydrogenolytic debenzylation then liberated
the tetronic acids 5. These were etherified in microwave with 1-(m-
* Corresponding author. Fax: þ49 (0) 921 552671.
E-mail address: rainer.schobert@uni-bayreuth.de (R. Schobert).
0040-4020/$ – see front matter Ó 2008 Elsevier Ltd. All rights reserved.
doi:10.1016/j.tet.2008.07.094

9402
R. Schobert et al. / Tetrahedron 64 (2008) 9401–9407
Et
rearrangement.10,11 Although the Claisen rearrangement of chiral 5-
O
H
N
O
mono-substituted tetronates, e.g., 6c,d proceeded with some ster-
eoinduction it afforded unassignable mixtures of diastereoisomers
of tetronic acids 7c and 7d, respectively. No attempts were made to
separate them since the corresponding target compounds derived
from them, i.e., 1e–h, later showed disappointingly low anti-HIV
activities in the biotests. The cyclopropanation of 3-allyltetronic
acids 7 was initially planned to be carried out according to the Shi
variant12 of the Charette protocol,13 which uses a mixture of tri-
fluoroacetic acid, CH2I2 and ZnEt2 in dichloromethane. While this
method worked perfectly well for analogues of 7 lacking the nitro
group, it was not applicable to compounds 7 themselves. However,
the original Charette protocol that dispenses with trifluoroacetic
acid converted alkenes 7 to the corresponding cyclopropanes 8
albeit in moderate yields. However, unreacted starting compound 7
could be recovered in each case. The reduction of the nitro group of
8 to give the corresponding aniline 9 was achieved with zinc and
HCl in THF at 30 ꢀC. After 5 min, the reaction mixture was filtered
over a plug of cotton and the eluate was extracted with ethyl ace-
tate. It should be noted that reduction of the nitro compounds 8
was also possible with SnCl2 in DMF. However, removal was tedious
or even impossible of the by-product Sn(II) salts, which interfere
with the subsequent sulfonylation step. The susceptible crude an-
ilines 9 were subjected to the final sulfonylation reaction without
further purification. Only p-substituted benzenesulfonyl chlorides
were employed as they were expected to lead to intrinsically more
active products. Triethylamine (1 equiv at room temperature) was
the auxiliary base of choice while pyridine as a base or an excess of
triethylamine at higher temperature as recommended in the liter-
ature6 gave rise to predominantly N,O-disulfonylated products.
Unreacted anilines 9 could be recovered as hydrochloride salts in
most cases and were subjected to a second sulfonylation step in
order to double yields. The target tetronic acids 1 were finally pu-
rified for the biotests in HIV viruses by two TLC runs in order to rid
them of pertinaciously adhering trace amounts of the disulfonyl
adducts and residual sulfonyl chlorides.
S
N
O
O
Pr
OH
CF3
tipranavir
Ph
O
H
N
O
S
O
O
R2
OH
R3
R1
1
Figure 1. Structures of tipranavir and 3-[cyclopropyl-m-(benzsulfonanilido)methyl]-
tetronic acids 1.
nitrophenyl)allylbromide, prepared from methyl m-nitro-
cinnamoate via DIBAL-H reduction, to give the alcohol and bromi-
nation of the latter with PBr3. When carried out in acetone in the
presence of DBU under optimised conditions, i.e., by irradiating the
mixture with 750 W power input for 20 s to quickly reach 130 ꢀC
and then maintaining this temperature for another 5 min by irra-
diating with 700 W, the product tetronates 6 were obtained in ca.
60% yield. They could be Claisen rearranged in over 90% yield by
carefully controlled microwave irradiation (300 W, 130 ꢀC, 15 min)
of their solutions in DMF in the presence of catalytic amounts of
ytterbium triflate. Longer periods of irradiation led to the formation
of
by-products
originating
from
a
follow-up
Conia
O
Ph PCCO (3)
3
HO
O
THF, refl., 16h
O
R2
50–75%
R1
OBn
R2
OR3
R1
4: R3 = Bn
5: R3 = H
2
H2, Pd/C
MeOH, rt
O2N
Br
2.2. Biological evaluation
O
NO2
Me2CO, µw (700W)
DBU, 130°C, 5 min
Compounds 1 were tested for antiviral activity on two HIV-1
strains, the PI-sensitive HIVNL4-3 and a PI-resistant clone 4lig7,14 by
an assay published previously.15 These strains were obtained by
amplifying the C-terminal part of the gag gene, the entire protease
(PR) and the 50-part of the reverse transcriptase (RT) gene from the
plasma of HIV-1 infected individuals by RT polymerase chain re-
action (RT-PCR). The amplified part of the gag gene included two
protease cleavage sites of the gag polyprotein, NC/p1 and p1/
p6(gag), and two protease cleavage sites of the reading-frame-
shifted gag-pol polyprotein, between NC and the transframe pro-
tein, and between the transframe protein and p6(pol). These C-
terminal cleavage sites are the most frequently mutated in the
context of protease inhibitor resistance. The amplicon was ligated
into the molecular clone of HIV-1NL4-3 containing a deletion of the
respective genes. Bacteria were transformed with the ligation
products, plasmid DNA was prepared from the bacteria and trans-
fected into 293T cells and recombinant virus was harvested from
their supernatant 2 days after transfection. The sensitivity of these
recombinant virus strains towards compounds 1 was then de-
termined with the help of an indicator cell line containing the se-
creted alkaline phosphatase (SEAP) gene under the control of an
HIV-1 long terminal repeat (LTR).16 When infected by HIV-1, the
viral Tat protein transactivates the LTR leading to a strong increase
in SEAP activity in the culture supernatant, which can be easily
monitored. In our case, the indicator cells were infected with the
viruses in the presence of different amounts of compounds 1 and
the ensuing virus replication was monitored as a function of drug
O
R2
6a: R1=R2=Me
6b: R1,2=(CH2)5
55–60%
O
R1
6c: R1=Me,R2=H
6d: R1=Ph,R2=H
O
DMF, YbTf3
µw (300W)
130°C, 15 min
NO2
O
R2
OH
OH
95%
R1
7
O
ZnEt2, 2CH2I2
CH2Cl2, 0°C
X
O
R2
35–75%
R1
8: X = NO2
9: X = NH2
Zn, HCl
THF, 30°C
R3C6H4SO2Cl, NEt3
THF, 0°C–>r.t., 18h
R1
R2
R3
H
1
Me Me
a
b
c
d
e
Me Me
F
35–50%
Me Me Cl
-(CH2)5-
Me
Me
H
Me
Ph
Ph
Ph
H
H
H
H
f
g
F
Me
h
Scheme 1. Synthesis of 3-[cyclopropyl-m-(benzsulfonanilido)methyl]tetronic acids 1
from tetronic acids 5.

R. Schobert et al. / Tetrahedron 64 (2008) 9401–9407
9403
Table 1
One FT-IR spectrophotometer. Nuclear Magnetic resonance (NMR)
spectra were recorded under conditions as indicated on a Bruker
Avance 300 spectrometer. Chemical shifts (d) are given in parts per
Drug sensitivities (IC50 valuesa in
m
M) of HIV strains NL4-3 and 4lig714 towards
compounds 1a–db as ascertained by a published assay15
Compounds
NL4-3
4lig7
million downfield from TMS as an internal standard. Mass spectra
were recorded using a Varian MAT 311A (EI). Optical rotations were
recorded at 589 nm with a PERKIN–ELMER polarimeter 241. Ele-
mental analyses were carried out with a Perkin–Elmer 2400 CHN
elemental analyser. Microwave reactions were carried out in an
1a
1b
1c
1d
11.4
55.6
8.8
>100
>100
>100
8.3
72.3
a
All assays run in duplicate; quoted IC50 values derived from three independent
experiments and referring to the activities of the respective virus in the absence of
a test compound set to 100%; SEAP activity determined 5 days later using the
Phospha-light-kit (Tropix, Bedford, MA, USA).
MLS-m-chemist or a CEM-Discover oven. For column chromatog-
raphy, Merck silica gel 60 (230–400 mesh) was used. Solvents were
dried, distilled and stored under argon. Starting compounds were
purchased from the usual sources.
b
Compounds 1e–h exhibited no activities in either strain at concentrations below
100 mM.
concentration. The concentrations inhibiting the viral activity by
50% relative to the uninhibited control (IC50) for compounds 1 are
listed in Table 1. They are clearly higher for NL4-3 and 4lig7 than
those of approved PI such as tipranavir (6 nM/16 nM), ritonavir
4.2. Synthesis of benzyl tetronates 4
4.2.1. 5,5-Dimethyl-4-oxybenzyl-[5H]furan-2-one 4a: typical
procedure
(37 nM/2.4
mM), nelfinavir (25 nM/2.1 mM) or saquinavir (9 nM/
A solution of benzyl 2-hydroxyisobutyrate 2a (6.0 g, 31.0 mmol),
Ph3PCCO (3) (10.3 g, 34.2 mmol) and a catalytic amount of benzoic
acid (100 mg) in THF (100 mL) was stirred and heated under reflux
for 24 h with exclusion of air and moisture. The solvent was
evaporated and the residue was purified by column chromatogra-
phy (5ꢁ30 cm; silica gel 60, cyclohexane/diethyl ether 1:1, Rf 0.65).
The product obtained from the eluate was finally recrystallised
from pentane/diethyl ether to give 5.2 g (71%) of 4a as a colourless
solid; mp 70 ꢀC (lit.17a 70 ꢀC); nmax/cmꢂ1 2984, 1744, 1623, 1499,
1455, 1342, 1255, 1223, 1195, 934, 805, 741, 696; dH (300 MHz,
CDCl3) 1.36 (6H, s), 4.91 (1H, s), 4.93 (2H, s), 7.3 (5H, m); dC (75 MHz,
CDCl3) 24.3, 74.2, 82.3, 87.6, 127.7, 128.8, 128.9, 134.1, 171.5, 184.5;
m/z (EI, 70 eV) 218 (Mþ, 1%), 203 (1%), 200 (1%), 190 (1%), 174 (1%),
159 (1%), 132 (9%), 91 (100%).
0.9 M). Nonetheless, the figures revealed some tentative struc-
m
ture–activity relations and provided clues as to which residues
should be systematically varied and in what direction in order to
enhance the activity of 1. While derivatives 1e–h with 5-mono-
substituted tetronic acid rings (R2¼H) were virtually inactive
against either virus, the 5,5-dialkyl substituted analogues 1a–
d exhibited distinct activities in the PI-sensitive virus NL4-3.
Among the three 5,5-dimethyltetronic acids 1a–c, the p-chloro
derivative proved the most active one (IC50¼8.8
mM) while the
p-fluoro analogue 1b was distinctly less active even when compared
with the parent compound 1a. 5-Spirocyclohexyltetronic acid 1d
showed the highest activity in NL4-3 and even some activity in the
PI-resistant strain 4lig7 (ninefold decrease compared to NL4-3). An
activity enhancement appears possible by replacing the p-methyl
residue with a Cl substituent in analogy to 1c. We now intend to
place further electron-withdrawing and -releasing groups in o-, m-
and p-position of the terminal arene while retaining the 5,5-dialkyl
motif on the tetronic acid moiety.
4.2.2. 4-Oxybenzyl-1-oxaspiro[4.5]dec-3-en-2-one 4b
Analogous to the synthesis of 4a, compound 4b (3.23 g, 51%) was
obtained from benzyl
19.3 mmol) and ylide 3 (7.6 g, 24.1 mmol) as a colourless solid; Rf
0.71 (cyclohexane/diethyl ether 1:1); mp 93 ꢀC (lit.18 94 ꢀC); nmax
a-hydroxycyclohexylcarboxylate 2b (4.5 g,
/
cmꢂ1 2937, 1747, 1620, 1450, 1340, 1193, 981, 942, 907, 850; dH
(300 MHz, CDCl3) 1.2–2.0 (10H, m), 5.00 (1H, s), 5.04 (2H, s), 7.2–7.4
(5H, m); dC (75 MHz, CDCl3) 21.7, 24.4, 33.1, 74.1, 84.0, 88.1, 127.7,
128.5, 129.0, 134.2, 172.1, 184.9; m/z (EI, 70 eV) 258 (Mþ, 7%), 167
(7%), 132 (28%), 91 (100%).
3. Conclusions
We have established a short synthetic route to sulfonamide-
containing tetronic acids 1, based upon a microwave-assisted,
Lewis acid-catalysed Claisen rearrangement of cinnamyl tetronates
and
a modified Charette cyclopropanation of the so-formed
3-allyltetronic acids. Preliminary biotests of compounds 1 revealed
a distinct structure-dependency of their anti-retroviral activity
against two HIV-1 strains. The 5,5-dialkyltetronic acid motif
seemed to confer a higher basal activity than the 5-mono-
substitution pattern. Derivatives 1c (R1¼R2¼Me, R3¼Cl) and 1d
4.2.3. (S)-5-Methyl-4-oxybenzyl-[5H]furan-2-one 4c
Analogous to the synthesis of 4a, compound 4c (6.3 g, 62%) was
obtained from benzyl
(15.2 g, 50.0 mmol) as a colourless solid; [
L-lactate 2c (9.0 g, 50.0 mmol) and ylide 3
25
a]
ꢂ21.7 (c 1.33, MeOH);
D
Rf 0.66 (cyclohexane/diethyl ether 1:1); mp 84 ꢀC (lit.19,20
90and103–104 ꢀC for rac-4c); nmax/cmꢂ1 1727, 1626, 1293, 1126,
1083, 736, 692; dH (300 MHz, CDCl3) 1.48 (3H, d, J¼6.8 Hz), 4.87
(1H, q, J¼6.8 Hz), 5.06 (2H, s), 5.12 (1H, s), 7.39 (5H, m); dC (75 MHz,
CDCl3) 17.8, 74.6, 75.5, 89.3, 127.9, 128.9, 129.1, 133.8, 172.2, 182.2;
m/z (EI, 70 eV) 204 (Mþ, 3%),186 (2%),159 (2%),132 (14%), 91 (100%).
(R1,2¼(CH2)5, R3¼Me) were most active (IC50<10
mM) against the
PI-sensitive strain HIVNL4-3, 1d even noticeably so against the PI-
resistant strain 4lig7. The new synthesis should be flexible enough
to allow the preparation of larger arrays of analogues of 1 with
variation in the pharmacological key positions R1–3. In analogy to
the optimisation of tipranavir, we also intend to conduct in-depth
modelling studies starting with the X-ray geometry of HIV-1 pro-
tease and to co-crystallise and structurally elucidate HIV-1
protease–ligand 1 adducts and to chemically vary the positioning
of R3 as well as the (het)arene of 1.
4.2.4. (ꢃ)-5-Phenyl-4-oxybenzyl-[5H]furan-2-one 4d17a,b
Analogous to the synthesis of 4a, compound 4d (3.84 g, 50%)
was obtained from benzyl mandelate 2d (7.0 g, 29.1 mmol) and
ylide 3 (8.7 g, 28.9 mmol) as a colourless solid; Rf 0.69 (cyclohex-
ane/diethyl ether 1:1); mp 93 ꢀC; nmax/cmꢂ1 1746, 1622, 1455, 1331,
1285, 1232, 1151, 1022, 695; dH (300 MHz, CDCl3) 4.98 (1H, d,
J¼11.9 Hz), 5.06 (1H, d, J¼11.9 Hz), 5.17 (1H, d, J¼1.1 Hz), 5.71 (1H, d,
J¼1.1 Hz), 7.1–7.4 (10H, m); dC (75 MHz, CDCl3) 74.4, 80.3, 89.3,
126.6, 127.5, 128.7, 128.9, 129.3, 133.7, 134.0, 172.5, 180.1; m/z (EI,
70 eV) 266 (Mþ, 21%), 248 (3%), 222 (5%), 180 (17%), 175 (48%), 148
(20%), 132 (13%), 107 (100%), 105 (46%), 92 (97%), 91 (100%).
4. Experimental
4.1. General
Melting points were determined with a Gallenkamp apparatus
and are uncorrected. IR spectra were recorded on a Perkin–Elmer

9404
R. Schobert et al. / Tetrahedron 64 (2008) 9401–9407
4.3. Synthesis of tetronic acids 5
(75 MHz, CDCl3) 24.4, 72.3, 82.3, 87.2,121.2,123.6,124.6,130.8,132.6,
137.3, 148.6, 171.4, 184.4; m/z (EI, 70 eV) 289 (Mþ, 42%), 276 (14%),
271 (40%), 256 (22%), 203 (23%),175 (17%),163 (100%),145 (15%),129
(55%), 128 (95%), 117 (45%), 115 (68%), 102 (18%). Anal. Calcd for
4.3.1. 5,5-Dimethyltetronic acid 5a: typical procedure for the
hydrogenolytic debenzylation
Compound 4a (440 mg, 2.01 mmol) was dissolved in dry
methanol (20 mL), 5% Pd on charcoal (20 mg) was added and the
resulting mixture was purged hydrogen gas and kept under an
atmosphere (1 bar) of this for 0.2–1.0 h while stirring. After filtra-
tion over a pad of Celite, the solvent was removed in vacuo to leave
colourless solid 5a (258 mg, 99%); Rf 0.20 (ethyl acetate); mp 125 ꢀC
(from methanol) (lit.21 145 ꢀC from ethyl acetate); nmax/cmꢂ1 1695,
1675, 1650, 1282, 1190, 1107, 984, 798; dH (300 MHz, acetone-d6)
1.60 (6H, s), 3.52 (2H, s); dC (75 MHz, acetone-d6) 23.8, 36.6, 89.8,
169.1, 207.9; m/z (EI, 70 eV) 128 (Mþ, 3%), 113 (3%), 100 (35%), 84
(1%), 72 (18%), 43 (100%).
C15H15NO5: C, 62.3; H, 5.2; N, 4.8. Found: C, 62.3; H, 5.1; N, 4.7%.
4.4.2. 4-(m-Nitrocinnamyloxy)-1-oxaspiro[4.5]dec-3-en-2-one 6b
Analogous to the synthesis of 6a, tetronate 6b (192 mg, 58%) was
obtained from m-nitrocinnamyl bromide (242 mg, 1.0 mmol) and
5b (167 mg, 0.99 mmol); Rf 0.64 (cyclohexane/ethyl acetate 1:1),
yellow oil; nmax/cmꢂ1 1741, 1622, 1525, 1348, 1338, 1189, 961, 908,
729; dH (300 MHz, CDCl3) 1.5–1.8 (10H, m), 4.69 (2H, d, J¼5.9 Hz),
4.98 (1H, s), 6.41 (1H, dt, J¼16.5, 5.9 Hz), 6.37 (1H, d, J¼16.5 Hz),
7.4–7.5 (1H, m), 7.6–7.7 (1H, m), 8.0–8.1 (1H, m), 8.1–8.2 (1H, m); dC
(75 MHz, CDCl3) 21.5, 24.2, 32.9, 72.0, 83.8, 87.7, 121.0, 122.8, 124.6,
129.6,132.2,132.4,137.2, 148.4,171.7,184.5; m/z (EI, 70 eV) 329 (Mþ,
1%), 312 (1%), 285 (1%), 203 (5%), 186 (2%), 162 (88%), 145 (8%), 116
(100%), 115 (73%). Anal. Calcd for C18H19NO5: C, 65.6; H, 5.8; N, 4.3.
Found: C, 65.4; H, 5.8; N, 4.1%.
4.3.2. 4-Hydroxy-1-oxaspiro[4.5]dec-3-en-2-one 5b
Analogous to the synthesis of 5a, compound 5b (321 mg, 93%)
was obtained from 4b (497 mg, 2.10 mmol) as a colourless solid; Rf
0.22 (ethyl acetate); mp 195 ꢀC (lit.21 198–201 ꢀC); nmax/cmꢂ1 2939,
1684, 1673, 1546, 1312, 1293, 1267, 1242, 1206, 1201, 981, 912, 802;
dH (300 MHz, acetone-d6), mixture (1:2.9) of diketo and enol tau-
tomers: 1.1–1.9 (10H, m), 3.47 (2H, s, diketo), 4.84 (1H, s, enol), 11.19
(1H, s); dC (75 MHz, acetone-d6) 21.7, 24.3, 32.8, 82.7, 87.4, 171.4,
184.3; m/z (EI, 70 eV) 168 (Mþ, 1%), 141 (20%), 98 (100%).
4.4.3. m-Nitrocinnamyl (S)-5-methyltetronate 6c
Analogous to the synthesis of 6a, tetronate 6c (153 mg, 56%) was
obtained from m-nitrocinnamyl bromide (242 mg, 1.0 mmol) and
25
5c (119 mg, 1.0 mmol); [
a
]
ꢂ11.1 (c 1.44, MeOH); Rf 0.56 (cyclo-
D
hexane/ethyl acetate 1:1), yellow oil; nmax/cmꢂ1 2958, 1748, 1624,
1525, 1348, 1291,1160, 1082, 962, 907, 729; dH (300 MHz, CDCl3)
1.43 (3H, d, J¼6.7 Hz), 4.71 (2H, d, J¼6.0 Hz), 4.82 (1H, q, J¼6.7 Hz),
5.08 (1H, s), 6.42 (1H, dt, J¼16.0, 6.0 Hz), 6.75 (1H, d, J¼16.0 Hz),
7.47 (1H, dd, J¼8.0, 8.0 Hz), 7.67 (1H, d, J¼8.0 Hz), 8.06 (1H, d,
J¼8.0 Hz), 8.19 (1H, m); dC (75 MHz, CDCl3) 17.6, 72.2, 75.3, 88.7,
121.1, 122.8, 124.5, 129.6, 132.4, 137.2, 148.4, 172.2, 181.8; m/z (EI,
70 eV) 275 (Mþ, 1%), 257 (1%), 162 (26%), 116 (100%), 115 (95%), 89
(9%). Anal. Calcd for C14H13NO5: C, 61.1; H, 4.8; N, 5.0. Found: C,
60.9; H, 4.8; N, 4.9%.
4.3.3. (S)-5-Methyltetronic acid 5c
Analogous to the synthesis of 5a, compound 5c (225 mg, 99%)
25
was obtained from 4c (408 mg, 2.0 mmol) as a colourless solid, [a]
D
20.4 (c 1.22, MeOH) [lit.22 19.3 (c 0.5, H2O)]; Rf 0.20 (ethyl acetate);
mp 118 ꢀC (lit.22 115 ꢀC); nmax/cmꢂ1 2988, 1701, 1591, 1320, 1268,
1237, 1166, 1075, 808; dH (300 MHz, acetone-d6), mixture (1:3.6) of
diketo and enol tautomers: 1.42 (3H, d, J¼6.7 Hz), 3.32 (2H, s,
diketo), 4.87 (1H, q, J¼6.7 Hz), 4.91 (1H, s, enol); dC (75 MHz, ace-
tone-d6) 17.4, 74.9, 88.2, 175.0, 182.2; m/z (EI, 70 eV) 114 (Mþ, 21%),
99 (7%), 86 (39%), 69 (3%), 43 (79%), 42 (100%).
4.4.4. m-Nitrocinnamyl 5-phenyltetronate 6d
Analogous to the synthesis of 6a, tetronate 6d (184 mg, 55%) was
obtained from m-nitrocinnamyl bromide (242 mg, 1.0 mmol) and
5b (175 mg, 0.99 mmol); Rf 0.61 (cyclohexane/ethyl acetate 1:1),
yellow oil; nmax/cmꢂ1 3036,1748,1624,1524,1348, 966, 725, 699; dH
(300 MHz, CDCl3) 4.66 (1H, ddd, J¼13.0, 7.4, 1.1 Hz), 4.75 (1H, ddd,
J¼13.0, 5.7, 1.1 Hz), 5.21 (1H, d, J¼1.1 Hz), 5.71 (1H, s), 6.31 (1H, ddd,
J¼15.9, 7.4, 5.7 Hz), 6.56 (1H, d, J¼15.9 Hz), 7.2–7.4 (5H, m), 7.46
(1H, dd, J¼8.0, 8.0 Hz), 7.59 (1H, d, J¼8.0 Hz), 8.07 (1H, ddd, J¼8.0,
2.2, 1.1 Hz), 8.11 (1H, m); dC (75 MHz, CDCl3) 72.3, 80.3, 88.9, 121.1,
122.8, 124.2, 126.5, 128.7, 129.3, 129.6, 132.2, 132.3, 133.8, 137.1,
148.4, 172.4, 179.9; m/z (EI, 70 eV) 337 (Mþ, 6%), 320 (1%), 319 (1%),
310 (2%), 309 (2%), 260 (1%), 215 (100%), 187 (17%), 175 (9%), 162
(56%),116 (78%), 115 (90%), 105 (100%). Anal. Calcd for C19H15NO5: C,
67.7; H, 4.5; N, 4.2. Found: C, 67.5; H, 4.5; N, 4.1%.
4.3.4. (ꢃ)-5-Phenyltetronic acid 5d
Analogous to the synthesis of 5a, compound 5d (88 mg, 99%)
was obtained from 4d (133 mg, 0.5 mmol) as a colourless solid;
Rf 0.22 (ethyl acetate); mp 119 ꢀC (lit.21 154 ꢀC for (R)-5d); nmax/cmꢂ1
2887, 1700, 1577, 1276, 1235, 1156, 1001, 769, 697; dH (300 MHz,
acetone-d6), mixture (1:9) of diketo and enol tautomers: 3.36 (2H,
s, diketo), 5.13 (1H, s, enol), 5.85 (1H, s), 7.3–7.5 (5H, m); dC (75 MHz,
acetone-d6) 80.4, 88.6,127.0, 128.7, 129.1, 135.2, 173.4,180.6; m/z (EI,
70 eV) 176 (Mþ, 13%), 148 (35%), 120 (15%), 106 (24%), 105 (100%).
4.4. Synthesis of m-nitrocinnamyl tetronates 6
4.4.1. m-Nitrocinnamyl 5,5-dimethyltetronate 6a: typical
procedure for the esterification of tetronic acids
A solution of m-nitrocinnamyl bromide (242 mg, 1.0 mmol) and
tetronic acid 5a (123 mg, 0.97 mmol) in acetone (20 mL) was placed
4.5. Synthesis of 3-allyltetronic acids 7
in a microwave-suitable vial, treated with DBU (150
mL,1 mmol) and
4.5.1. 4-Hydroxy-3-[10-(m-nitrophenyl)prop-20-en-10-yl]-5,5-
dimethyl-[5H]furan-2-one 7a: typical procedure for the Claisen
rearrangement
immediately irradiated in an MLS microwave reactor for 20 s with
750 W and then for a further 5 min with 700 W power input at
maximal 130 ꢀC. The mixture was poured into 10% hydrochloric acid
and extracted with ethyl acetate. The organic phase was washed
with brine and dried over Na2SO4. Evaporation of the volatiles left
a brown oil that upon column chromatography (silica gel 60, cy-
clohexane/ethyl acetate 3:1, Rf 0.23) yielded tetronate 6a (159 mg,
55%) as a yellow oil; nmax/cmꢂ1 1744, 1624, 1525, 1343, 1261, 1219,
1197, 1112, 981, 962, 938, 909, 804, 727, 674, 657; dH (300 MHz,
CDCl3) 1.48 (6H, s), 4.75 (2H, d, J¼6.0 Hz), 5.04 (1H, s), 6.47 (1H, dt,
J¼16.0, 6.0 Hz), 6.79 (1H, d, J¼16.0 Hz), 7.47 (1H, dd, J¼8.0, 8.0 Hz),
7.67 (1H, d, J¼8.0 Hz), 8.11 (1H, d, J¼8.0 Hz), 8.25 (1H, m); dC
A solution of tetronate 6a (872 mg, 3.0 mmol) and a catalytic
amount of YbTf3 in dry DMF (6 mL) was placed in a sealed vial inside
a CEM microwave appliance and irradiated for 15 min with 300 W
maximal power input at 130 ꢀC. The solution was poured into dilute
hydrochloric acid, extracted with ethyl acetate, washed with brine
and dried over Na2SO4. The solvent was evaporated and the residue
applied on top of a 10 cm plug of silica gel 60. Once by-products had
been washed off with cyclohexane/ethyl acetate (5:1), product 7a
was eluted with cyclohexane/ethyl acetate(1:1, Rf 0.24). Evaporation
of the solvent left 825 mg (95%) of pure 7a as awaxysolid; nmax/cmꢂ1

R. Schobert et al. / Tetrahedron 64 (2008) 9401–9407
9405
1713, 1636, 1524, 1347, 1194, 1086, 993, 924, 785, 730; dH (300 MHz,
CDCl3) 1.49 (3H, s), 1.50 (3H, s), 4.61 (1H, d, J¼7.1 Hz), 5.10 (1H, d,
J¼16.9 Hz), 5.29 (1H, d, J¼10.2 Hz), 6.28 (1H, m), 7.43 (1H, dd, J¼8.0,
8.0 Hz), 7.63 (1H, d, J¼8.0 Hz), 7.99 (1H, d, J¼8.0 Hz), 8.07 (1H, m); dC
(75 MHz, CDCl3) 23.9, 24.0, 42.3, 82.3, 99.4,118.3,121.8,122.6,129.4,
134.1, 136.2, 142.8, 148.3, 173.8, 180.5; m/z (EI, 70 eV) 289 (Mþ, 18%),
272 (13%), 271 (9%), 256 (6%), 203 (14%), 186 (30%), 162 (90%), 128
(55%), 116 (100%), 115 (95%). Anal. Calcd for C15H15NO5: C, 62.3; H,
5.2; N, 4.8. Found: C, 62.4; H, 5.1; N, 4.7%.
7.68 mmol) in the same solvent (2 mL). After 10 min, alkene 7a
(277 mg, 0.96 mmol), dissolved in dry CH2Cl2 (10 mL), was added
dropwise. The resulting mixture was stirred at 0 ꢀC for further 8 h
and the formed precipitate was redissolved by the addition of dilute
HCl. The organic phase was separated and the aqueous layer was
extracted with ethyl acetate three times. The combined organic
phases were washed with brine and dried over Na2SO4. After
evaporation of the volatiles, the residue was purified by chroma-
tography on silica gel 60 (CH2Cl2/acetone/cyclohexane, 40:1:1, Rf
0.21) to give 8a (213 mg, 73%) as a brown oil; nmax/cmꢂ1 1743, 1702,
1645, 1524, 1376, 1346, 1307, 1246, 1195, 1156, 1083, 784, 724, 685;
dH (300 MHz, acetone-d6) 0.2–0.3 (2H, m), 0.5–0.7 (2H, m),1.45 (3H,
s), 1.51 (3H, s), 1.6–1.8 (1H, m), 3.14 (1H, d, J¼10.2 Hz), 7.5–7.6 (1H,
m), 7.8–7.9 (1H, m), 8.0–8.1 (1H, m), 8.25 (1H, m); dC (75 MHz, ac-
etone-d6) 5.0, 6.2, 14.4, 24.5, 44.6, 81.1, 102.1, 122.0, 123.2, 130.2,
135.1, 146.7, 149.1, 172.7, 179.3; m/z (EI, 70 eV) 303 (Mþ, 13%), 285
(21%), 262 (16%), 245 (5%), 230 (4%), 216 (7%), 189 (22%), 176 (56%),
158 (36%), 141 (23%), 130 (41%), 128 (91%), 115 (100%). Anal. Calcd
for C16H17NO5: C, 63.4; H, 5.7; N, 4.6. Found: C, 63.4; H, 5.7; N, 4.4%.
4.5.2. 4-Hydroxy-3-[10-(m-nitrophenyl)prop-20-en-10-yl]-5-
spirocyclohexyl-[5H]furan-2-one 7b
Analogous to the synthesis of 7a, tetronic acid 7b (180 mg, 94%)
was obtained from tetronate 6b (190 mg, 0.57 mmol) as a colourless
solid of mp 143 ꢀC; Rf 0.24 (cyclohexane/acetone 1:1); nmax/cmꢂ1
1738,1705,1617,1526,1347, 965, 908, 727; dH (300 MHz, CDCl3) 0.9–
2.1 (10H, m), 4.59 (1H, d, J¼7.3 Hz), 5.06 (1H, d, J¼17.2 Hz), 5.19 (1H,
d, J¼10.2 Hz), 6.2–6.3 (1H, m), 7.3–7.4 (1H, m), 7.4–7.6 (1H, m), 7.9–
8.0 (1H, m), 8.0–8.2 (1H, m); dC (75 MHz, CDCl3) 21.6, 24.1, 32.5, 42.3,
83.7, 99.7, 117.7, 121.6, 122.6, 129.2, 134.1, 136.2, 143.2, 148.2, 174.2,
180.9; m/z (EI, 70 eV) 329 (Mþ, 36%), 312 (17%), 311 (11%), 301 (1%),
294 (7%), 285 (5%), 268(8%), 230 (9%), 203 (76%),186 (55%),175 (14%),
167 (9%), 162 (61%), 128 (80%), 116 (89%), 115 (100%). Anal. Calcd for
4.6.2. 4-Hydroxy-3-[cyclopropyl-(m-nitrophenyl)methyl]-5-
spirocyclohexyl-[5H]furan-2-one 8b
Analogous to the synthesis of 8a, tetronic acid 8b (69 mg, 35%)
was obtained as a colourless solid from alkene 7b (195 mg,
C
18H19NO5: C, 65.6; H, 5.8; N, 4.3. Found: C, 65.4; H, 5.7; N, 4.1%.
0.59 mmol), 2.37 mmol ZnEt2 and CH2I2 (379 mL, 4.74 mmol); Rf 0.26
4.5.3. (5S)-4-Hydroxy-5-methyl-3-[10-(m-nitrophenyl)prop-20-en-
10-yl]-[5H]furan-2-one 7c
(CH2Cl2/acetone/cyclohexane, 20:1:1); mp 179 ꢀC; nmax/cmꢂ1 1692,
1588, 1518, 1346, 1295, 1267, 1232, 1149, 1098, 980, 816, 733, 685;
dH (300 MHz, CDCl3) 0.1–0.3 (2H, m), 0.4–0.7 (2H, m), 1.4–1.8 (10H,
m), 1.8–2.0 (1H, m), 3.15 (1H, d, J¼10.2 Hz), 7.5–7.6 (1H, m), 7.8–7.9
(1H, m), 8.0–8.1 (1H, m), 8.33 (1H, m); dC (75 MHz, CDCl3) 5.0, 6.2,
14.5, 22.7, 25.1, 33.7, 33.8, 44.7, 82.4, 102.7, 122.0, 123.2, 130.2, 135.2,
146.9, 149.2, 172.5, 179.0; m/z (EI, 70 eV) 343 (Mþ, 33%), 326 (16%),
302 (18%), 256 (6%), 187 (21%), 176 (53%), 158 (31%), 130 (41%), 146
(18%), 128 (58%), 115 (100%). Anal. Calcd for C19H21NO5: C, 66.5; H,
6.2; N, 4.1. Found: C, 66.4; H, 6.4; N, 3.9%.
Analogous to the synthesis of 7a, tetronic acid 7c (931 mg, 95%)
was obtained as unassignable mixture of diastereomers from tetr-
onate 6c (981 mg, 3.56 mmol) as a colourless viscous oil; Rf 0.25
(cyclohexane/acetone 1:1); nmax/cmꢂ1 2985, 1617, 1526, 1396, 1347,
1077, 731; dH (300 MHz, CDCl3) 1.46 (3H, d, J¼6.7 Hz), 4.58 (1H,
d, J¼7.5 Hz), 4.83 (1H, q, J¼6.7 Hz), 5.10 (1H, d, J¼17.1 Hz), 5.21 (1H,
d, J¼9.9 Hz), 6.29 (1H, m), 7.40 (1H dd, J¼8.0, 8.0 Hz), 7.60 (1H, d,
J¼8.0 Hz), 8.01 (1H, d, J¼8.0 Hz), 8.08 (1H, m); dC (75 MHz, CDCl3)
17.8, 42.5, 75.3, 101.0, 117.7, 121.7, 122.7, 129.3, 134.1, 135.8, 143.2,
148.2, 175.4, 178.2; m/z (EI, 70 eV) 275 (Mþ, 15%), 258 (55%), 247
(5%), 228 (10%), 220 (11%), 203 (14%), 186 (30%), 162 (90%), 128
(55%), 116 (100%), 115 (95%). Anal. Calcd for C14H13NO5: C, 61.1; H,
4.8; N, 5.1. Found: C, 60.9; H, 4.7; N, 5.0%.
4.6.3. (5S)-4-Hydroxy-3-[cyclopropyl-(m-nitrophenyl)methyl]-5-
methyl-[5H]furan-2-one 8c
Analogous to the synthesis of 8a, tetronic acid 8c (133 mg; 40%)
was obtained as a brown waxy solid from alkene 7c (341 mg,
1.16 mmol), 5.80 mmol ZnEt2 and CH2I2 (934 mL, 11.6 mmol); Rf 0.21
4.5.4. 4-Hydroxy-3-[10-(m-nitrophenyl)prop-20-en-10-yl]-5-
phenyl-[5H]furan-2-one 7d
(CH2Cl2/acetone/cyclohexane, 20:2:1); nmax/cmꢂ1 1646, 1528, 1348,
1279, 1060; dH (300 MHz, CDCl3) 0.2–0.3 (2H, m), 0.5–0.7 (2H, m),
1.47 (3H, m), 1.6–1.8 (1H, m), 3.08 (1H, d, J¼10.2 Hz), 4.84 (1H, m),
7.42 (1H, d, J¼7.9 Hz), 7.76 (1H, d, J¼7.9 Hz), 8.04 (1H, d, J¼9.2 Hz),
8.27 (1H, d, J¼7.3 Hz); dC (75 MHz, CDCl3) 4.7, 5.7, 13.3, 17.8, 43.7,
75.4, 102.2, 121.4, 122.7, 129.0, 134.0, 144.8, 148.0, 176.3, 178.6; m/z
(EI, 70 eV) 289 (Mþ, 20%), 272 (66%), 259 (41%), 248 (51%), 176
(99%), 130 (100%), 115 (90%). Anal. Calcd for C15H15NO5: C, 62.3; H,
5.2; N, 4.8. Found: C, 62.1; H, 5.3; N, 4.6%.
Analogous to the synthesis of 7a, tetronic acid 7d (704 mg, 95%)
was obtained as unassignable mixture of diastereomers from tetr-
onate 6d (616 mg, 1.82 mmol) as a viscous oil; Rf 0.22 (cyclohexane/
acetone 1:1); nmax/cmꢂ1 3070, 3034, 1718, 1638, 1524, 1346, 1094,
1001, 913, 729, 698; dH (300 MHz, CDCl3) 4.59 (1H, d, J¼7.6 Hz), 5.09
(1H, d, J¼17.2 Hz), 5.22 (1H, d, J¼10.2 Hz), 5.59 (1H, s), 6.2–6.3 (1H,
m), 7.1–7.3 (5H, m), 7.35 (1H, m), 7.54 (1H, m), 7.95 (1H, m), 8.08
(1H, s); dC (75 MHz, CDCl3) 42.7, 80.2,102.2, 118.1, 121.8, 122.6,127.4,
129.0, 129.4, 129.8, 133.1, 134.2, 135.8, 142.9, 148.3, 174.7, 175.0; m/z
(EI, 70 eV) 337 (Mþ, 43%), 319 (9%), 246 (9%), 215 (17%), 203 (66%),
186 (35%), 176 (13%), 175 (32%), 163 (63%), 162 (12%), 157 (25%), 145
(10%), 129 (58%), 128 (99%), 127 (39%), 118 (37%), 116 (57%), 115
(100%), 105 (72%). Anal. Calcd for C19H15NO5: C, 67.7; H, 4.5; N, 4.2.
Found: C, 67.4; H, 4.7; N, 4.1%.
4.6.4. 4-Hydroxy-3-[cyclopropyl-(m-nitrophenyl)methyl]-5-
phenyl-[5H]furan-2-one 8d
Analogous to the synthesis of 8a, tetronic acid 8d (97 mg, 46%)
was obtained as a brown waxy solid from alkene 7d (206 mg,
0.61 mmol), 2.44 mmol ZnEt2 and CH2I2 (394 mL, 4.88 mmol) as
a 1:1.1 mixture of diastereomers; Rf 0.22 (CH2Cl2/acetone/cyclo-
hexane, 20:2:1); nmax/cmꢂ1 1722, 1649, 1524, 1347, 728; dH
(300 MHz, CDCl3) 0.2–0.3 (2H, m), 0.5–0.7 (2H, m), 1.6–1.8 (1H, m),
3.05 (1H, d, J¼12.1 Hz), 5.50/5.52 (1H, s), 7.1–7.3 (5H, m), 7.38 (1H,
m), 7.70 (1H, m), 8.01 (1H, d, J¼8.2 Hz), 8.25 (1H, m); dC (75 MHz,
CDCl3) 4.5, 5.7, 13.2/13.5, 43.8, 80.0, 103.6, 121.4, 122.5, 127.4/127.8,
128.7, 129.6, 133.6, 134.0/134.1, 144.7/144.8, 148.0, 174.9/175.3,
182.8; m/z (EI, 70 eV) 351 (Mþ, 35%), 334 (7%), 333 (7%), 323 (12%),
307 (8%), 278 (11%), 265 (13%), 254 (11%), 217 (22%), 202 (18%), 189
(19%), 176 (41%), 158 (25%), 149 (22%), 130 (41%), 118 (77%), 115
4.6. Synthesis of 3-(cyclopropylmethyl)tetronic acids 8
4.6.1. 4-Hydroxy-3-[cyclopropyl-(m-nitrophenyl)methyl]-5,5-
dimethyl-[5H]furan-2-one 8a: typical procedure for the
cyclopropanation
A solution of ZnEt2 (3.84 mL, 1 M in hexane) in dry CH2Cl2
(150 mL), kept at 0 ꢀC under an argon atmosphere, was vigorously
stirred and treated dropwise with a solution of CH2I2 (619 mL,

9406
R. Schobert et al. / Tetrahedron 64 (2008) 9401–9407
(76%), 105 (100%). Anal. Calcd for C20H17NO5: C, 68.4; H, 4.9; N, 4.0.
Found: C, 68.6; H, 4.9; N, 3.9%.
7.47 (2H, m), 7.93 (2H, m), 9.09 (1H, br); dC (75 MHz, acetone-d6)
4.7, 6.4, 14.5, 24.6, 24.7, 44.8, 80.6, 103.0, 119.8, 121.2, 125.1, 129.7,
129.9, 130.0, 138.2, 139.2, 139.6, 145.8, 172.3, 178.3; m/z (EI, 70 eV)
447 (Mþ, 38%), 429 (11%), 406 (6%), 401 (11%), 388 (6%), 362 (10%),
319 (13%), 302 (6%), 297 (7%), 272 (16%), 254 (13%), 226 (12%), 202
(11%), 186 (10%), 175 (11%), 159 (11%), 144 (100%). Anal. Calcd for
4.7. Synthesis of 3-sulfonylanilidotetronic acids 1
4.7.1. 4-Hydroxy-3-[cyclopropyl-(m-benzsulfonanilido)methyl]-
5,5-dimethyl-[5H]furan-2-one 1a: typical procedure for the
reduction/sulfonation
C22H22ClNO5S: C, 59.0; H, 5.0; N, 3.1. Found: C, 59.2; H, 4.9; N, 3.1%.
A mixture of Zn powder (451 mg, 6.94 mmol), 8a (516 mg,
1.71 mmol) and THF (50 mL) was treated with a solution of hydro-
chloric acid (1 mL, ca. 11 mmol) in THF (5 mL). After 5 min stirring,
the reaction mixture was filtered over a cotton plug into a diluted
aqueous NaHCO3 solution. The product amine was thoroughly
extracted with ethyl acetate. The combined organic phases were
washed with brine, dried over Na2SO4 and concentrated in vacuo.
The resulting brownsolid amine 9awas dissolvedin dry THF (60 mL)
and treated at 0 ꢀC with a solution of benzenesulfonyl chloride
4.7.4. 4-Hydroxy-3-[cyclopropyl-(m-tolylsulfonanilido)methyl]-5-
spirocyclohexyl-[5H]furan-2-one 1d
Analogous to the synthesis of 1a, tetronic acid 1d (112 mg, 48%)
was obtained as a wax from crude amine 9b (167 mg, 0.53 mmol)
and 4-toluenesulfonyl chloride (102 mg, 0.53 mmol); Rf 0.44 (cy-
clohexane/acetone 1:1); nmax/cmꢂ1 3208, 2936, 1700, 1648, 1390,
1256,1246,1158, 1091, 965, 813, 706; dH (300 MHz, acetone-d6) 0.1–
0.2 (2H, m), 0.45 (1H, m), 0.60 (1H, m),1.4–2.0 (11H, m), 2.32 (3H, s),
2.89 (1H, d, J¼10.5 Hz), 6.99 (1H, m), 7.1–7.2 (2H, m), 7.28 (2H, m),
7.31 (1H, m), 7.68 (2H, m), 8.91 (1H, br); dC (75 MHz, acetone-d6) 4.7,
6.6,14.5, 21.4, 22.6, 22.7, 25.2, 33.6, 33.8, 44.8, 82.1,103.3,119.1,120.6,
124.5, 128.1, 129.5, 130.3, 138.1, 138.7, 144.2, 145.5, 172.6, 178.3; m/z
(EI, 70 eV) 467 (Mþ, 16%), 453 (5%), 450 (6%), 422 (8%), 411 (8%), 387
(6%), 367 (7%), 341 (4%), 314 (10%), 270 (9%), 242 (7%), 230 (6%), 180
(9%), 155 (21%), 144 (43%), 115 (35%), 91 (100%). Anal. Calcd for
(195 mL, 1.53 mmol) in THF (5 mL). Triethylamine (213 mL,
1.53 mmol) dissolved in THF (10 mL) was slowly added and the
resulting mixture was stirred overnight while warming up to room
temperature. The solid precipitate was filtered off and the filtrate
was concentrated in vacuo. The remainder was dissolved in ethyl
acetate, extracted with 5% hydrochloric acid and washed with brine.
The volatiles were evaporated and the residue chromatographed
twice on preparative TLC plates (CH2Cl2/MeOH/cyclohexane 20:1:1,
Rf 0.0–0.3). The product was extracted with acetone and dried on an
oil pump to yield 1a (288 mg, 41%) as a waxy solid; Rf 0.35 (cyclo-
hexane/acetone 1:1); dH (300 MHz, acetone-d6) 0.1–0.2 (2H, m), 0.4–
0.5 (1H, m), 0.5–0.6 (1H, m),1.45 (3H, s),1.47 (3H, s),1.6–1.8 (1H, m),
3.88 (1H, d, J¼10.2 Hz), 6.98 (1H, m), 7.0–7.2 (2H, m), 7.35 (1H, m),
7.4–7.6 (3H, m), 7.80 (2H, m), 8.98 (1H, br); dC (75 MHz, acetone-d6)
4.6, 6.5, 14.5, 24.6, 24.7, 44.8, 80.7, 103.0, 119.4, 120.8, 124.6, 127.9,
129.6,129.8,133.5,138.5,140.8,145.5,172.5,178.3; m/z(EI, 70 eV)413
(Mþ, 8%), 344 (9%), 295 (13%), 276 (7%), 272 (8%), 241 (4%), 212 (17%),
195 (9%), 183 (17%), 167 (16%), 139 (15%), 130 (100%). Anal. Calcd for
C26H29NO5S: C, 66.8; H, 6.3; N, 3.0. Found: C, 67.0; H, 6.1; N, 2.9%.
4.7.5. (5S)-4-Hydroxy-3-[cyclopropyl-(m-tolylsulfonanilido)-
methyl]-5-methyl-[5H]furan-2-one 1e
Analogoustothesynthesisof1a, tetronicacid1e(39 mg, 36%)was
obtained as a viscous oil from crude amine 9c (89 mg, 0.34 mmol)
and 4-toluenesulfonyl chloride (50 mg, 0.26 mmol) as a 1:1.2 mix-
ture of diastereomers; Rf 0.27 (cyclohexane/acetone 1:1); nmax/cmꢂ1
2984, 1722, 1693, 1591, 1397, 1332, 1255, 1155, 1091, 1051, 705; dH
(300 MHz, acetone-d6) 0.1–0.2 (2H, m), 0.4–0.6 (2H, m), 1.39 (3Ha, d,
J¼6.6 Hz)/1.41 (3Hb, d, J¼6.9 Hz), 1.6–1.7 (1H, m), 2.38 (3H, s), 2.82
(1Ha, J¼10.2 Hz)/2.84 (1Hb, d, J¼9.9 Hz), 4.68 (1Ha, q, J¼6.6 Hz)/4.70
(1Hb, q, J¼6.9 Hz), 6.98 (1H, d, J¼7.7 Hz), 7.10 (1H, dd, J¼7.7, 7.7 Hz),
7.15(1H, m), 7.28(2H, d, J¼8.0 Hz), 7.32 (1H, m), 7.68(2H, d, J¼8.0 Hz),
9.00 (1H, br); dC (75 MHz, acetone-d6) 5.0/5.1, 6.2/6.3,14.5/14.7,18.8/
18.9, 21.4, 45.1/45.4, 74.3/74.6, 102.2, 119.1, 120.9, 124.7, 128.1, 129.4,
130.3, 137.9, 138.5, 144.2, 146.4, 174.6, 177.7; m/z (EI, 70 eV) 413 (Mþ,
8%), 344 (9%), 295 (13%), 276 (7%), 272 (8%), 241 (4%), 212 (17%), 195
(9%), 183 (17%), 167 (16%), 139 (15%), 130 (100%). Anal. Calcd for
C
22H23NO5S: C, 63.9; H, 5.6; N, 3.4. Found: C, 64.1; H, 5.7; N, 3.4%.
4.7.2. 4-Hydroxy-3-[cyclopropyl-(m-(40-fluorobenz)sulfonanilido)-
methyl]-5,5-dimethyl-[5H]furan-2-one 1b
Analogous to the synthesis of 1a, tetronic acid 1b (85 mg; 44%)
was obtained as a viscous, slowly solidifying oil from crude amine
9a (124 mg, 0.45 mmol) and 4-fluorobenzsulfonyl chloride (81 mg,
0.42 mmol); Rf 0.26 (cyclohexane/acetone 1:1); nmax/cmꢂ1 3190,
3070, 2978, 2931, 1710, 1655, 1600, 1475, 1397, 1333, 1249, 1160,
1095, 1081, 1014, 936, 827, 750, 699; dH (300 MHz, acetone-d6) 0.0–
0.2 (2H, m), 0.3–0.6 (2H, m),1.43 (6H, s),1.6–1.8 (1H, m), 3.94 (1H, d,
J¼10.0 Hz), 6.96 (1H, m), 7.0–7.1 (1H, m), 7.20 (1H, m), 7.25 (2H, dd,
J¼8.7, 8.9 Hz), 7.35 (1H, m), 7.84 (2H, dd, J¼5.2, 8.9 Hz), 8.90 (1H,
br); dC (75 MHz, acetone-d6) 3.9, 5.5,13.7, 23.8, 23.9, 43.9, 80.2, 99.4,
116.0 (d, J¼23.0 Hz), 118.5, 120.4, 124.3, 128.5, 130.1 (d, J¼9.2 Hz),
136.1, 137.2, 145.9, 164.8 (d, J¼251 Hz), 173.2, 181.4; m/z (EI, 70 eV)
431 (Mþ, 33%), 413 (8%), 403 (6%), 387 (6%), 341 (4%), 330 (16%), 303
(11%), 286 (14%), 272 (19%), 254 (35%), 239 (12%), 208 (8%), 198
(16%),185 (10%),144 (100%). Anal. Calcd for C22H22FNO5S: C, 61.2; H,
5.1; N, 4.4. Found: C, 61.0; H, 5.0; N, 4.3%.
C22H23NO5S: C, 63.9; H, 5.6; N, 3.4. Found: C, 64.1; H, 5.7; N, 3.3%.
4.7.6. 4-Hydroxy-3-[cyclopropyl-(m-benzsulfonanilido)methyl]-5-
phenyl-[5H]furan-2-one 1f
Analogous to the synthesis of 1a, tetronic acid 1f (65 mg, 42%)
was obtained as a viscous oil from crude amine 9d (112 mg,
0.35 mmol) and benzsulfonyl chloride (45
mL, 0.35 mmol); 1:1.5
mixture of diastereomers; Rf 0.38 (cyclohexane/acetone 1:1); nmax
/
cmꢂ1 1724, 1685, 1330, 1155, 1092, 688; dH (300 MHz, acetone-d6)
0.1–0.3 (2H, m), 0.5–0.7 (2H, m), 1.7–1.9 (1H, m), 2.92 (1Ha, d,
J¼10.2 Hz)/2.97 (1Hb, d, J¼8.2 Hz), 5.45/5.46 (2ꢁ1H, s), 7.02 (1H, m),
7.12 (1H, m), 7.18 (1H, m), 7.2–7.6 (9H, m), 7.82 (2H, m), 8.95 (1H,
br); dC (75 MHz, acetone-d6) 5.1, 6.3, 14.8, 45.5, 80.1, 102.9, 119.4,
121.3, 125.1, 128.1, 128.6,129.4,129.5,129.7, 129.8,133.5,137.1, 138.5,
141.1, 146.5, 174.7, 176.7; m/z (EI, 70 eV) 461 (Mþ, 19%), 427 (5%), 337
(14%), 327 (15%), 303 (6%), 283 (25%), 256 (21%), 228 (28%), 215
(25%), 207 (28%), 186 (28%), 178 (44%), 167 (21%), 156 (31%), 152
(32%), 144 (100%). Anal. Calcd for C26H23NO5S: C, 67.7; H, 5.0; N, 3.0.
Found: C, 67.5; H, 4.8; N, 2.9%.
4.7.3. 4-Hydroxy-3-[cyclopropyl-(m-(40-chlorobenz)sulfonanilido)-
methyl]-5,5-dimethyl[5H]furan-2-one 1c
Analogous to the synthesis of 1a, tetronic acid 1c (70 mg, 35%)
was obtained as a viscous, slowly solidifying oil from crude amine
9a (124 mg, 0.45 mmol) and 4-chlorobenzsulfonyl chloride (88 mg,
0.42 mmol); Rf 0.26 (cyclohexane/acetone 1:1); nmax/cmꢂ1 3185,
3076, 2979, 2932, 1699, 1653, 1605, 1588, 1477, 1396, 1334, 1247,
1161, 1083, 1014, 939, 826, 754, 696; dH (300 MHz, acetone-d6) 0.1–
0.3 (2H, m), 0.4–0.6 (2H, m),1.48 (6H, s),1.6–1.8 (1H, m), 2.89 (1H, d,
J¼10.4 Hz), 6.92 (1H, m), 7.1–7.2 (1H, m), 7.19 (1H, m), 7.29 (1H, m),
4.7.7. 4-Hydroxy-3-[cyclopropyl-(m-(40-fluorobenz)sulfonanilido)-
methyl]-5-phenyl-[5H]furan-2-one 1g
Analogous to the synthesis of 1a, tetronic acid 1g (69 mg, 41%)
was obtained as aviscous, slowly solidifying oil from crude amine 9d

R. Schobert et al. / Tetrahedron 64 (2008) 9401–9407
9407
5. Sun, C.-L.; Pang, R.-F.; Zhang, H.; Yang, M. Bioorg. Med. Chem. Lett. 2005, 15,
3257–3262.
(112 mg, 0.35 mmol) and 4-fluorobenzylsulfonyl chloride (68 mg,
0.35 mmol); 1:1.4 mixture of diastereomers; Rf 0.36 (cyclohexane/
acetone 1:1); nmax/cmꢂ1 1716, 1700, 1591, 1494, 1169, 1153, 699; dH
(300 MHz, acetone-d6) 0.0–0.3 (2H, m), 0.5–0.6 (2H, m),1.7–1.9 (1H,
m), 2.92/2.94 (2ꢁ1H, d, J¼8.2 Hz), 5.25/5.29 (2ꢁ1H, s), 7.00 (1H, m),
7.11 (1H, d, J¼7.6 Hz), 7.2–7.6 (7H, m), 7.41 (2H, m), 7.68 (2H, dd,
J¼8.7, 8.7 Hz), 8.96 (1H, br); dC (75 MHz, acetone-d6) 5.2, 6.2, 14.9,
45.5, 80.4,102.0,116.9 (d, J¼22.5 Hz),119.5,121.6,125.5,128.4,129.2,
129.3, 129.4, 131.1 (d, J¼9.2 Hz), 137.3, 138.2, 145.0, 147.4, 166.1 (d,
J¼207 Hz), 174.1, 176.5; m/z (EI, 70 eV) 479 (Mþ, 34%), 461 (5%), 451
(4%), 343 (7%), 320 (9%), 304 (24%), 277 (14%), 246 (7%), 202 (9%),184
(8%), 158 (13%), 144 (100%). Anal. Calcd for C26H22FNO5S: C, 65.1; H,
4.6; N, 2.9. Found: C, 64.9; H, 4.6; N, 2.8%.
6. (a) Chrusciel, R. A.; Maggiora, L. L; Tustin, J. M. (Pharmacia & Upjohn). Patent
WO 096/29333, 1996. (b) Crusciel, R. A.; Maggiora, L. L.; Thaisrivongs, S.; Tustin,
J. M.; Smith, C. W.; Tommasi, R. A.; Aristoff, P. A.; Skulnik, H. I.; Howe, W. J.;
Bundy, G. L.; Gordon, L. (Upjohn Co.). PCT Int. Appl. WO 9507,901, 23.3.1995;
Chem. Abstr. 1995, 123, 55683.
7. For tetronic acids in general, see: (a) Tejedor, D.; Garcia-Tellado, F. Org. Prep.
Proced. Int. 2004, 36, 35–59; (b) Zografos, A. L.; Georgiadis, D. Synthesis 2006,
3157–3188; (c) Schobert, R.; Schlenk, A. Bioorg. Med. Chem. 2008, 16, 4203–4221.
8. (a) Schobert, R.; Jagusch, C.; Melanophy, C.; Mullen, G. Org. Biomol. Chem. 2004,
2, 3524–3529; (b) Schobert, R.; Boeckman, R. K., Jr.; Pero, J. E. Org. Synth. 2005,
82, 140–144.
9. Lo¨ffler, J.; Schobert, R. J. Chem. Soc., Perkin Trans. 1 1996, 2799–2802.
10. Schobert, R.; Siegfried, S.; Gordon, G.; Nieuwenhuyzen, M.; Allenmark, M. Eur. J.
Org. Chem. 2001, 1951–1958.
11. Schobert, R.; Siegfried, S.; Gordon, G.; Mulholland, D.; Nieuwenhuyzen, M.
Tetrahedron Lett. 2001, 42, 4561–4564.
12. Yang, Z.; Lorenz, J. C.; Shi, Y. Tetrahedron Lett. 1998, 39, 8621–8624.
13. Charette, A. B.; Brochu, C. J. Am. Chem. Soc. 1995, 117, 11367–11368.
14. Sequences of the PR genes of the two viruses are given underneath. For de-
viations from the HIV-1 consensus B (Los Alamos) and interpretations of effects
of commercial protease inhibitors refer to www.hiv-grade.de.
4.7.8. 4-Hydroxy-3-[cyclopropyl-(m-tolylsulfonanilido)methyl]-5-
phenyl-[5H]furan-2-one 1h
Analogous to the synthesis of 1a, tetronic acid 1h (33 mg, 36%)
was obtained as aviscous, slowlysolidifying oil from crude amine 9d
(68 mg, 0.19 mmol) and 4-toluenesulfonyl chloride (36 mg,
0.19 mmol); 1:1.05 mixture of diastereomers; Rf 0.29 (cyclohexane/
acetone 1:1); nmax/cmꢂ1 1734, 1653, 1331, 1156, 1092, 702; dH
(300 MHz, acetone-d6) 0.0–0.3 (2H, m), 0.4–0.6 (2H, m),1.7–1.9 (1H,
m), 2.30/2.31 (2ꢁ3H, s), 2.90 (1Ha, d, J¼9.5 Hz), 2.94 (1Hb, d,
J¼9.3 Hz), 5.25/5.28 (2ꢁ1H, s), 6.9–7.4 (10H, m), 7.41 (1H, m), 7.69
(2H, m), 8.90 (1H, br); dC (75 MHz, acetone-d6) 4.2, 5.3, 13.9/14.0,
21.9, 44.3/44.5, 79.5,100.1,117.9,118.0,120.2,124.1,127.1,127.2,127.5,
128.2,128.3,129.3,129.5,136.9,137.0,137.2,137.5,143.2,146.2,174.7,
177.9; m/z (EI, 70 eV) 475 (Mþ,19%), 447 (2%), 351 (4%), 321 (5%), 302
(8%), 272 (8%), 259 (10%), 229 (8%), 178 (12%), 155 (17%), 144 (32%),
130 (49%), 115 (29%), 105 (36%), 91 (100%). Anal. Calcd for
NL4–3:CCTCAGATCACTCTTTGGCAGCGACCCCTCGTCACAATAAAGATAGGGGGGC
AATTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGA
ATTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAA
GTAAGACAGTATGATCAGATACTCATAGAAATCTGCGGACATAAAGCTATAGGTACAG
TATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGG
CTGCACTTTAAATTTTCCCATTAGTCCTATTGAGACTGTACCAGTAAAATTAAAGCCAG
GAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCA
TTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCT
GAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGA
GAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGATTTCTGGGAAGTTCA
ATTAGGAATsCCACATCCTGCAGGGTTAAAACAGAAAAAATCAGTAACAGTACTGGAT
GTGGGCGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTCAGGAAGTATACTGCATT
TACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTT
CCACAGGGATGGAAAGGATCACCAGCAATATTCCAGTGTAGCATGACAAAAATCTTA
GAGCCTTTTAGAAAACAAAATCCAGACGTAGTCATCTATCAATACATGGATGATTTGT
ATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGAC
AACATCTGTTGAGGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCTC
CATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGT
GCTGCCAGAAAAGGACAGCTGGACTGTCAATGACATACAGAAATTAGTGGGAAAATT
GAATTGGGCAAGTCAGATTTATGCAGGGATTAAAGTAAGGCAATTATGTAAACTTCTT
AGGGGAACCAAAGCACTAACAGAAGTAGTACCACTAACAGAAGAAGCAGAGCTAGA
ACTGGCAGAAAACAGGGAGATTCTAAAAGAACCGGTACATGGAGTGTATTATGACCC
ATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATATCA
AATTTATCAAGAGCCATTTAGAAATCTGAAAACAGGAAAGTATGCAAGAATGAAGGG
TGCCCACACTAATGATGTGAAACAATTAACAGAGGCAGTACAAAAAA.
C
27H25NO5S: C, 68.2; H, 5.3; N, 2.9. Found: C, 68.0; H, 5.1; N, 3.0%.
4.8. HIV-1 drug sensitivity assay15
Indicator CEMx174-SEAP cells in 96 well plates (2500/well) were
treated in triplicates with the test compounds 1 (0, 0.01, 0.1, 1, 10,
100 mM) and 2 h later were infected with either PI-sensitive HIVNL4-3
4lig7:CCTCAGATCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGAGGGCAA
CTAATTGAAGCCCTATTAGATACAGGAGCAGATGATACAGTATTAGAGGATATAAATT
TGCCAGGGAGATGGAAGCCAAAAATAATAGGGGGAATTGGAGGTTTTATCAAAGTA
AGACAGTATGACCAAGTACCCATAGAAATCTGTGGACACAAAGTTATGAGTACAGTAT
TAGTAGGACCTACACCTGTCAACGTAATtGGCAGAAAcCTGAtGACCCAGATCGGCTG
CACTTTAAACTTTCCCATtAGTCCTATtGAAACTGTACCAGTAAAATTAAAGCCAGGAA
TGGATGGCCCAAAAGTTAAACAATGRCCMTTGACAGaASWWAAWATMMAAGCAT
TAGTAGAAATTTGTACAGAGTTGGAGAAGGATGGAAAAATTTCAAAAATTGGGCCTG
AAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTGATAAATGGAG
AAAGTTAGTAGACTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAA
TTAGGAATACCACATCCTGCAGGGTTAAAACAGAAAAAATCAGTAACAATACTGGAT
GTGGGTGATGCATATTTTTCAATTCCCTTAGACAAAGACTTCAGGAAGTATACTGCATT
TACCATACCTAGTACAAACAATGAGACACCAGGGATAAGATATCAATATAATGTGCTT
CCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAGATCTTA
GAGCCTTTTAGAAAACAATATCCAGACATAGTTATCTATCAATACGTGGATGATTTGTA
TGTAGGATCTGACTTAGAAATAGGACAGCATAGGACAATGATAAAGGAACTCAGACA
ATATCTGTGGAAGTGGGGGTTTTACACACCAGATAGAAAACATCAGCAAGAACCTCC
ATTCCGTTGGATGGGCTATGAACTCCACCCTGACAAATGGACAGTACAGCCTATAAAG
CTGCCAGATAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTA
AATTGGGCAAGCCAGATTTATGCAGGGATTAAAGTAAAGCAATTATGTAAACTCCTTA
AGGGAACCAAGTCACTAACAGAAGTTGTACCACTAACAAAAGAAGCAGAGCTAGAAC
TGGCAGAAAACAGGGAGATTCTAAAAGAACCGGTACATGGAGTGTATTATGACCCAT
CAAAAGACTTAATAGCAGAA.
or PI-resistant 4lig7 viruses at a concentration equivalent to 15,000
relative light units (RLU). The infectious dose for each virus was
estimated beforehand by infecting CEMx174-SEAP cells with 1, 5, 10
or 20
mL virus-containing supernatant. The minimal volume of this
supernatant that had resulted in at least 15,000 RLU in a 15
m
L vol-
ume of supernatantof CEMx174-SEAP cells 3 daysafterinfectionwas
determined as described15 using a Phospha-light-kit (Tropix, Bed-
ford, MA, USA). Five days after the cells had been treated with
compounds 1, the SEAPactivity was determined in the samewayand
IC50 values were calculated fromthe means of two independent runs
with the activities of untreated infected cells set to 100%.
Acknowledgements
We are grateful to the Deutsche Forschungsgemeinschaft for
financial support (grant Scho 402/7).
¨
15. Walter, H.; Schmidt, B.; Korn, K.; Vandamme, A.-M.; Harrer, T.; Uberla, K. J. Clin.
References and notes
Virol. 1999, 13, 71–80.
16. Means, R. E.; Greenough, T. J. Virol. 1997, 71, 7895–7902.
17. (a) Gelin, S.; Pollet, P. Synth. Commun. 1980, 10, 805–811; (b) Gelin, S.; Pollet, P.
Bull. Soc. Chim. Fr. 1975, 307–308.
18. Hirsenkorn, R.; Schmidt, R. R. Liebigs Ann. Chem. 1990, 883–899.
19. Paintner, F. F.; Allmendinger, L.; Bauschke, G. Synlett 2005, 2735–2738.
20. Pollet, P.; Gelin, S. Tetrahedron 1978, 34, 1453–1455.
21. Effenberger, F.; Syed, J. Tetrahedron: Asymmetry 1998, 9, 817–825.
22. Branda¨nge, S.; Flodman, L.; Norberg, Å; Boll, P. M. J. Org. Chem.1984, 49, 927–928.
1. Sepkowitz, K. A. N. Engl. J. Med. 2001, 344, 1764–1772.
2. Ala, P. J.; Chang, C.-H. In Enzymes and their Inhibition; Smith, H. J., Simons, C.,
Eds.; CRC LLC: Boca Raton, FL, 2005; p 268.
3. De Clercq, E. Med. Res. Rev. 2002, 22, 531–565.
4. Poppe, S. M.; Slade, D. E.; Chong, K.-T.; Hinshaw, R. R.; Pagano, P. J.; Markowitz,
M.; Ho, D. D.; Mo, H.; Gorman, R. R.; Dueweke, T. J.; Thaisrivongs, S.; Tarpley, W.
G. Antimicrob. Agents Chemother. 1997, 41, 1058–1063.