CG base pair recognition within DNA triple helices using N-methyl-3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one nucleoside analogues

Article abstract of DOI:10.1080/15257770701533958

Triplex-mediated recognition of Py.Pu base pairs in DNA is a greater challenge than for Pu.Py base pairs as fewer hydrogen bonds are presented for binding in the major groove. Initial studies on m-aminophenyl-modified analogues of the bicyclic nucleoside

Full text of DOI:10.1080/15257770701533958

This article was downloaded by: [Heriot-Watt University]
On: 30 December 2014, At: 17:48
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered
office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Nucleosides, Nucleotides and Nucleic
Acids
Publication details, including instructions for authors and
subscription information:
http://www.tandfonline.com/loi/lncn20
Cg Base Pair Recognition Within Dna
Triple Helices Using N -Methyl-3 H -
Pyrrolo[2,3- d ]Pyrimidin-2(7 H )-One
Nucleoside Analogues
Simon R. Gerrard a , Natarajan Srinivasan a , Keith R. Fox a & Tom
Brown a
a School of Chemistry, University of Southampton, Highfield ,
Southampton, United Kingdom
b School of Biological Sciences, University of Southampton ,
Southampton, United Kingdom
Published online: 05 Dec 2007.
To cite this article: Simon R. Gerrard , Natarajan Srinivasan , Keith R. Fox & Tom Brown (2007) Cg
Base Pair Recognition Within Dna Triple Helices Using N -Methyl-3 H -Pyrrolo[2,3- d ]Pyrimidin-2(7 H
)-One Nucleoside Analogues, Nucleosides, Nucleotides and Nucleic Acids, 26:10-12, 1363-1367, DOI:
10.1080/15257770701533958
To link to this article: http://dx.doi.org/10.1080/15257770701533958
PLEASE SCROLL DOWN FOR ARTICLE
Taylor & Francis makes every effort to ensure the accuracy of all the information (the
“Content”) contained in the publications on our platform. However, Taylor & Francis,
our agents, and our licensors make no representations or warranties whatsoever as to
the accuracy, completeness, or suitability for any purpose of the Content. Any opinions
and views expressed in this publication are the opinions and views of the authors,
and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content
should not be relied upon and should be independently verified with primary sources
of information. Taylor and Francis shall not be liable for any losses, actions, claims,
proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or
howsoever caused arising directly or indirectly in connection with, in relation to or arising
out of the use of the Content.
This article may be used for research, teaching, and private study purposes. Any
substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,
systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &

Conditions of access and use can be found at http://www.tandfonline.com/page/terms-
and-conditions

Nucleosides, Nucleotides, and Nucleic Acids, 26:1363–1367, 2007
Copyright ꢀ Taylor & Francis Group, LLC
C
ISSN: 1525-7770 print / 1532-2335 online
DOI: 10.1080/15257770701533958
CG BASE PAIR RECOGNITION WITHIN DNA TRIPLE HELICES
USING N-METHYL-3H-PYRROLO[2,3-d]PYRIMIDIN-2(7H)-ONE
NUCLEOSIDE ANALOGUES
Simon R. Gerrard and Natarajan Srinivasan
School of Chemistry, University
2
of Southampton, Highfield, Southampton, United Kingdom
Keith R. Fox
United Kingdom
School of Biological Sciences, University of Southampton, Southampton,
School of Chemistry, University of Southampton, Highfield,
2
To m B rown
2
Southampton, United Kingdom
Triplex-mediated recognition of Py.Pu base pairs in DNA is a greater challenge than for
2
Pu.Py base pairs as fewer hydrogen bonds are presented for binding in the major groove. Initial
studies on m-aminophenyl-modified analogues of the bicyclic nucleoside N-methyl-3H-pyrrolo[2,3-
d]pyrimidin-2(7H)-one suggest that selective recognition of the CG base pair is possible.
Keywords Triple helices; CG recognition; triplex; fluorescence melting; UV melting
INTRODUCTION
Mixed-sequence recognition of duplex DNA by triplex-forming oligonu-
cleotides (TFOs) is an essential requirement for their use in medicinal
and biotechnological applications.[1–4] Achieving strong, yet specific bind-
ing to pyrimidine.purine base pairs (CG, TA) by TFOs is a greater chal-
lenge than to Pu.Py base pairs (GC, AT). The purine bases present two
hydrogen-bonding sites in the major groove, yet the pyrimidine bases offer
only one.[5,6] In efforts to find a replacement for T (the only natural base
capable of recognizing CG), 5-methyl-1H-pyrimidin-2-one (4HT) has been
prepared and shown to be selective for CG.7 The proposed interaction oc-
curs via one weak C H· · ·O hydrogen bond and a conventional N H· · ·N
hydrogen bond (Figure 1).
This work was funded by BBSRC and Cancer Research UK. All oligonucleotides were synthesized
by ATDBio Ltd. (www.atdbio.com).
Address correspondence to Tom Brown, School of Chemistry, University of Southampton,
Highfield, Southampton, S017 1BJ, U.K. E-mail: tb2@soton.ac.uk
1363

1364
S. R. Gerrard et al.
FIGURE 1 T.CG, 4HT.CG and MP.CG triplet models.
Previous studies indicate that it may be possible to utilize additional in-
teractions across the CG base pair to form more stable, selective triplets
than those formed by the natural base T.[8] We have now synthesized
m-aminophenyl-modified analogues of the core bicyclic nucleoside MP
(Figure 1), using more rigid yet better-positioned linkers than the amino-
alkyl modifications already evaluated. It was anticipated this would lead to
enhanced binding affinity and selectivity due to hydrogen bonding to the
C6 O and N7 of guanine and (in certain sequence contexts) additional
base-stacking interactions (Figure 2).
The TFOs containing N-methyl-3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one
were obtained by incorporation of the corresponding furano-pyrimidine
phosphoramidite into the oligonucleotide, followed by post synthetic mod-
ification (methylamine insertion, cyclization). Triplex-forming oligonu-
cleotides for UV melting contained only a trace amount of uncyclized ma-
terial and were otherwise clean. TFOs for fluorescence melting contained
the N-methylpyrrolo-dC modification as the major product, but with a sig-
nificant amount of uncyclized material.
RESULTS AND DISCUSSION
Three phosphoramidite monomers were synthesized, with
m-trifluoroacetamido-, ureido-, and acetamido-phenyl modifications at the
FIGURE 2 m-Aminophenyl-modified 3H-pyrrolo[2,3-d]pyrimidin-2(7H)-ones (XPP) in
a putative
XPP.CG triplet.

CG Base Pair Recognition
1365
6-position. The heterocyclic core was constructed by Sonogashira cross-
coupling[9] to form the derivatized 5-alkynyluridine derivative, followed
by triethylamine/CuI-catalyzed cyclization.[8,10] Alkynes 2a and 2b were
obtained from 3-ethynylaniline 1 by reaction with either phenyl carba-
mate or acetylation using acetyl chloride. The alkynes were reacted with
5ꢁ-O-(4,4ꢁ-dimethoxytrityl)-5-iodo-2ꢁ-deoxyuridine 3 via Pd-catalysed cross-
coupling[9] to afford three nucleosides 4a–c. Following cyclization, the
aniline moiety in nucleoside 5a was protected as the trifluoroacetamide
using ethyl trifluoroacetate and subsequent phosphitylation gave the de-
sired furano-pyrimidine phosphoramidite monomers 7a–c. The 6-methyl-
3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one modification (MP) was obtained by
incorporating the commercially available 6-methyl-3H-furo[2,3-d]pyrimidin-
2(7H)-one phosphoramidite 7d into oligonucleotides followed by post-
solid-phase synthetic modification (described below).
SCHEME 1 Synthesis of 3H-furo[2,3-d]pyrimidin-2(7H)-one nucleoside phosphoramidite monomers:
i) phenyl carbamate, 100◦C; ii) AcCl, TEA, Et2O, 0◦C-rt; iii) alkyne 1,2a/b, Pd(PPh3)4, CuI, TEA,
DMF, rt; iv) CuI, MeOH, TEA, 80◦C; v) CF3COOEt, DMAP, TEA, THF, 80–85◦C; vi) 2-cyanoethyl-N ,N -
diisopropyl chlorophosphoramidite, DIPEA, THF, rt.
Following incorporation into oligonucleotides under standard solid-
phase DNA synthesis conditions, the furanopyrimidine bases were converted
to the N-methyl-pyrrolopyrimidines by deprotection in 30% aqueous methy-
lamine, followed by recyclization with DOWEX 50WX8-400 ion-exchange
resin (H+ form).
UV melting studies were conducted on triple helices containing mod-
A
ified nucleotides MP and PP, opposite a single CG inversion in a homop-
urine tract. At both pH 6.1 and 6.4, APP showed enhanced binding affinity
to CG compared to MP (ꢀTm = 4.0◦C). This represents a significant im-
provement over T (Table 1).
Fluorescence melting studies were carried out to evaluate modifications
MP, APP, AAPP, and UPP, opposite a CG inversion (Table 2), using a different

1366
S. R. Gerrard et al.
TABLE 1 Tm values (◦C) obtained from UV/melting
curves (λ = 260 nm) of singly substituted 15-mer
TFOs 5ꢁ-TTTTTmCTXTmCTmCTmCTa,b with target
duplex 5ꢁ-GCTAAAAAGACAGAGAGATCG/3ꢁ-
CGATTTTTCTGTCTCTCTAGC (average over four
experiments). Duplex melting temperatures are
shown in parentheses. Concentration 5 µM:1 µM
(TFO:duplex) in 10 mM sodium phosphate buffer
with 200 mM NaCl and 1 mM Na2EDTA
X =
pH
MP
APP
6.07
6.40
31.7 (62.3)
25.2 (62.5)
35.7 (63.7)
29.2 (63.9)
amC = 5-methyl-2ꢁ-deoxycytidine.
b MALDI-TOF MS of modified TFO: X = APP found
m/z 4612.0 (expected 4611.2).
and longer duplex target. Under these conditions UPP showed the strongest
binding affinity for CG as expected, but it was slightly less selective than MP
for CG relative to AT and TA. All XPP modifications were more selective for
CG relative to GC than the control MP. Although UV melting studies indi-
cated that APP binds more strongly to CG than MP, fluorescence melting in-
dicated the opposite. This is probably due to the nature of the neighbouring
triplets (UV melting ..TXT.., fluorescence melting ..TXP..); the P.AT triplet
is very stable compared to T.AT and will present a different base-stacking
environment.
TABLE 2 Tm values determined at pH 6.0 from fluorescence
melting curves of singly substituted 15-mer TFOs
5ꢁ-D-PmCmCTPmCTXPTPTPTmCPTa,b with target hairpin
duplex 5ꢁ-F-GTGTTAGGAAGA YAAAAAAGAACTGGT–
HEG2–ACCAGTTCTTTTTTZTCTTCCTAACAC (average
over two or four runs). Concentration 2.5 µM:0.25 µM
(TFO:duplex) in 20 mM NaOAc solution with 200 mM NaCl
YZ
MP
APP
AAPP
UPP
CG
GC
AT
TA
53.0
40.6
40.3
39.9
51.9
38.1
40.3
42.3
52.0
38.8
40.6
44.7
53.9
39.8
42.4
44.6
amC = 5-methylcytidine, P = propargylamino-dU, D = DAB-
CYL (fluorescence quencher), F = FAM (fluorescent marker).
b MALDI-TOF MS of modified TFO: X = MP found m/z 5807.4
[M+H]+ (expected 5806.1), X = APP found m/z 5884.7
[M+H]+ (expected 5884.2), X = AAPP found m/z 5926.7
[M+H]+ (expected 5926.3), X = UPP found m/z 5927.3
[M+H]+ (expected 5927.3).

CG Base Pair Recognition
1367
CONCLUSION
Three modified 3H-furo[2,3-d]pyrimidin-2-one nucleoside phospho-
ramidites have been synthesised, incorporated into oligonucleotides and
post-synthetically converted to N-methyl-3H-pyrrolo[2,3-d]pyrimidin-2(7H)-
one nucleosides. Triplex melting studies suggest that the base-stacking en-
vironment plays an important role in triplet stability. The order of affinity
of the modified bases (MP, APP) for CG was reversed on replacement of the
neighbouring T.AT triplet with propargylamino-dU.AT. Studies are under-
way to synthesise N-methylpyrrolo-dC phosphoramidites for incorporation
into oligonucleotides.
REFERENCES
1. Praseuth, D.; Guieysse, A.L.; Helene, C. Triple helix formation and the antigene strategy for
sequence-specific control of gene expression. Biochimica et Biophysica Acta 1999, 1489, 181–206.
2. Karympalis, V.; Kalopita, K.; Zarros, A.; Carageorgiou, H. Regulation of gene expression via triple
helical formations. Biochemistry (Moscow) 2004, 69, 855–860.
3. Moser, H.E.; Dervan, P.B. Sequence-specific cleavage of double helical DNA by triple helix forma-
tion. Science 1987, 238, 645–650.
4. Seidman, M.M.; Glazer, P.M. The potential for gene repair via triple helix formation. J. Clin. Invest.
2003, 112, 487–494.
5. Gowers, D.M.; Fox, K.R. Towards mixed sequence recognition by triple helix formation. Nucleic Acids
Res. 1999, 27, 1569–1577.
6. Fox, K.R. Targeting DNA with triplexes. Curr. Med. Chem. 2000, 7, 17–37.
7. Prevo´t-Halter, I.; Leumann, C.J. Selective recognition of a C-G base pair in the Parallel DNA triple-
helical binding motif. Ang. Chem. Int. Ed. 1999, 43, 2657–2660.
8. Ranasinghe, R.T.; Rusling, D.A.; Powers, V.E.C.; Fox, K.R.; Brown, T. Recognition of CG inversions
in DNA triple helices by methylated 3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one nucleoside analogues.
Chem. Comm. 2005, 2555–2557.
9. Hobbs, F.W., Jr. Palladium-catalyzed synthesis of alkynylamino nucleoside. A universal linker for
nucleic acids. J. Org. Chem. 1989, 54, 3420–3422.
10. McGuigan, C.; Barucki, H.; Blewett, S.; Carangio, A.; Erichsen, J.T.; Andrei, G.; Snck, R.; De Clercq,
E.; Balzarini, J. Highly potent and selective inhibition of varicella-zoster virus by bicyclic furopyrim-
idine nucleosides bearing an aryl side chain. J. Med. Chem. 2000, 43, 4993–4997.