Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death

Full text of DOI:10.1016/j.chembiol.2019.04.009

Article
Small-Molecule-Targeting Hairpin Loop of hTERT
Promoter G-Quadruplex Induces Cancer Cell Death
Graphical Abstract
Authors
Jin H. Song, Hyun-Jin Kang,
Libia A. Luevano, ...,
H.-H. Sherry Chow, Laurence H. Hurley,
Andrew S. Kraft
Correspondence
jinsong@email.arizona.edu (J.H.S.),
hurley@reglagene.com (L.H.H.),
akraft@uacc.arizona.edu (A.S.K.)
In Brief
Small-molecule targeting of the
cooperative folding process in the hTERT
G-quadruplex promoter element
produces telomerase-independent
events, which impair mitochondrial
processes resulting in apoptotic cell
death and inhibition of prostate cancer
cell growth.
Highlights
d
d
d
d
Small molecule targets hairpin in G-quadruplex structure,
controls hTERT expression
hTERT G-quadruplex exerts telomere-independent
mechanisms of cancer cell death
hTERT inhibition mediates mitochondrial defects, oxidative
stress, and DNA damage
hTERT downregulation by the small molecule kills specifically
cancer cells
Song et al., 2019, Cell Chemical Biology 26, 1–12
August 15, 2019 ª 2019 Elsevier Ltd.
https://doi.org/10.1016/j.chembiol.2019.04.009

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
Cell Chemical Biology
Article
Small-Molecule-Targeting Hairpin Loop
of hTERT Promoter G-Quadruplex
Induces Cancer Cell Death
Jin H. Song,1,2,6, Hyun-Jin Kang,3,4 Libia A. Luevano,2 Vijay Gokhale,4,5 Kui Wu,3 Ritu Pandey,1,2 H.-H. Sherry Chow,2
*
2,
Laurence H. Hurley,3,4, and Andrew S. Kraft
*
*
1Department of Cellular and Molecular Medicine, University of Arizona, 1515 North Campbell Avenue, Tucson, AZ 85724, USA
2University of Arizona Cancer Center, 1515 North Campbell Avenue, Tucson, AZ 85724, USA
3College of Pharmacy, University of Arizona, 1703 East Mabel Street, Tucson, AZ 85721, USA
4Reglagene LLC, 1703 East Mabel Street, Tucson, AZ 85721, USA
5BIO5 Institute, University of Arizona, 1657 East Helen Street, Tucson, AZ 85721, USA
6Lead Contact
*Correspondence: jinsong@email.arizona.edu (J.H.S.), hurley@reglagene.com (L.H.H.), akraft@uacc.arizona.edu (A.S.K.)
https://doi.org/10.1016/j.chembiol.2019.04.009
SUMMARY
including melanoma, glioblastoma, and bladder cancer (Borah
et al., 2015; Horn et al., 2013; Killela et al., 2013). In these studies,
Increased telomerase activity is associated with ma- patients with tumors expressing high levels of hTERT showed
significantly worse overall survival rates than those with lower
expression of hTERT, directly suggesting the role of the pro-
lignancy and poor prognosis in human cancer, but
the development of targeted agents has not yet pro-
vided clinical benefit. Here we report that, instead of
targeting the telomerase enzyme directly, small
molecules that bind to the G-hairpin of the hTERT
G-quadruplex-forming sequence kill selectively ma-
lignant cells without altering the function of normal
cells. RG260 targets the hTERT G-quadruplex
moter in controlling patient outcomes.
Telomeric DNA is capable of folding into four-stranded gua-
nine quadruplex (G4) structures (Bochman et al., 2012; Palumbo
et al., 2009). Starting from single-stranded DNA, the hTERT G4 at
the 30 end nearest the transcription start site presents an unusual
26-base hairpin loop, which is proposed to act as the initiation
point for cooperative folding of the G4 (Kang et al., 2016; Yu
et al., 2012). This sequence is critical to the inhibition of hTERT
transcription because somatic mutations found naturally in the
stem-loop folding but not tetrad DNAs, leading to
downregulation of hTERT expression. To improve
physicochemical and pharmacokinetic properties, same hairpin of the G4 resulted in disruption of G4 folding, lead-
ing to overexpression of hTERT (Kang et al., 2016). Targeting the
major G4 in the hTERT promoter with the guanidine-substituted
we derived a small-molecule analog, RG1603, from
the parent compound. RG1603 induces mitochon-
drial defects including PGC1a and NRF2 inhibition
and increases oxidative stress, followed by DNA
damage and apoptosis. RG1603 injected as a
single agent has tolerable toxicity while achieving
strong anticancer efficacy in a tumor xenograft
mouse model. These results demonstrate a unique
acridine compound GTC365 resulted in inhibition of hTERT ac-
tivity. GTC365 acted as a pharmacological chaperone by rest-
eering the folding process such that the effect of misfolding of
the silencer G4 caused by somatic mutations could be reversed.
The generation of G4 drugs that target the unique heteroduplex
hairpin loop without targeting the G4 tetrad would be predicted
to increase selectivity because tetrads are the conserved fea-
approach to inhibiting the hTERT that functions by
impairing mitochondrial activity, inducing cell death.
tures of G4s found in many other genes, such as BCL2, MYC,
KRAS, and PDGFR-b (Bugaut et al., 2010; Burger et al., 2005;
Zhang et al., 2017a). Sequence variability and associated struc-
tural variability in the loops provide the opportunity for both bet-
ter selectivity and drug-like properties.
INTRODUCTION
We set out to discover whether we could identify a different set
Telomerase is an essential enzyme to cancer cells in maintaining of molecules that lacked the acridine moiety but still possessed
telomere function (Harley et al., 1994; Wellinger et al., 1996). the chaperone properties of GTC365. We find that the folding
Human cancer cells acquire telomerase activity by activating pattern of the final G-quadruplex formed from binding of com-
or upregulating the normally silent human telomerase reverse pounds that lack the tetrad targeting moiety leads to a different
transcriptase gene (hTERT) (Nugent and Lundblad, 1998). folded product than with GTC365, which can be rationalized
hTERT gene is usually silenced in somatic cells but expressed based on the initial drug-binding site and subsequent folding
at high levels in ꢀ90% of human cancers (Blasco and Hahn, steps that most probably mimic the natural folding process.
2003; Kim et al., 1994). Recent studies have shown that key mu- This singular mechanism of action permits reduced telomerase
tations in hTERT promoter region elevate hTERT expression, production and telomere shortening. However, the early onset
telomerase activity, and telomere length in various cancer types, of anticancer effects, for example, inhibition of cell proliferation
Cell Chemical Biology 26, 1–12, August 15, 2019 ª 2019 Elsevier Ltd.
1

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
Figure 1. Identification and Characterization of RG260 as an hTERT Downregulator by Stabilizing the hTERT Promoter G4
(A) Principle of compound screening by FRET assay. The ends of the 5–12 G-tract were labeled with fluorescein amidite (FAM) at the 50 end and tetrame-
thylrhodamine (TAMRA) at the 30 end, and the folding of the oligomer brings each end closer. Subsequently, FAM fluorescence is quenched by TAMRA. A
representative result of screening of the NCI Diversity Set III is shown.
(B) Chemical structures of GTC365 and RG260 (NSC654260).
(C and D) DMS footprinting showing the different folding pattern of the 1–12 full-length G-quadruplex by RG260 (20 equiv) and GTC365 (20 equiv) with 5 mM KCl
(C) or 100 mM CaCl2 (D). Image quality is a reflection of the reduced intensity and partial cleavages.
(E) Dose-dependent decrease of hTERT core promoter activity by RG260. MCF7 cells were transfected with pGL3 constructs and pRL-TK for 6 h and then treated
with RG260 for 24 h. A dual-luciferase assay was performed to obtain luciferase activity of firefly and renilla for normalization. Data are shown as mean SD of four
replicates.
(F) Dose-dependent inhibition of telomerase activity by RG260. MCF7 cells were treated with RG260 for 72 h before being subjected to TRAP assay. Quantitation
showed a clear decrease in FRET signal of RG260 treated in comparison to control.
and induction of apoptosis, are driven by telomere-independent experiments show that the footprinting on the GTC365-bound
mechanisms. In vivo studies demonstrate that systemic admin- wild-type (WT) G4 in 5 mM KCl is similar to the footprinting ob-
istration of small molecules stabilizing hTERT G4s significantly tained on the hTERT WT sequence in 140 mM KCl. This indicates
delays tumor growth. These studies provide data supporting that GTC365 interacts with the same final folding pattern for the
hTERT as an important cancer drug target.
tandem G4s with the 26-base hairpin contained in the 50-G4 (Fig-
ure S1A). GTC365 consists of an acridine-derived moiety similar
to BRACO19 that binds to G-quadruplexes through the recogni-
tion of the G-tetrad and a guanidino group that binds to the lower
part of the 26-base hairpin loop (Kang et al., 2016).
RESULTS
Discovery of a Small Molecule that Selectively Targets
the Hairpin Stem Loop of the WT hTERT G4 to
From this same FRET screening assay we identified a second
set of structurally distinct compounds (Figure 1A), typified by
RG260 (NSC654260). These compounds are the subject of this
contribution, and the characterization of their effect on the
folding pattern of the hTERT G4 was determined by DMS foot-
printing in 5 mM KCl, as was the WT G4 complex with
GTC365. RG260 contains a benzoylphenylurea (BPU) moiety
but lacks the tetrad-binding acridine moiety found in GTC365
(Figure 1B). We initially speculated that the BPU moiety might
mimic the guanidino moiety of GTC365, which has been shown
by chemical footprinting to bind to the base of the 26-base
hairpin stem loop rather than the 30 tetrad in the G4. Unexpect-
edly, RG260 showed no significant change of conformation of
Downregulate hTERT Expression
Single-stranded oligomer for the full-length (FL)-G4 in the hTERT
promoter element can form a tandem G-quadruplex containing
an unusually large 26-base hairpin stem loop (Figure S1A) (Boch-
man et al., 2012; Palumbo et al., 2009). We carried out a fluores-
cence resonance energy transfer (FRET) assay-based screening
of ꢀ1,500 compounds in the NCI diversity set (Kang et al., 2016)
and identified two sets of structurally distinct compounds that
quenched the fluorescence in the FRET assay (Figure 1A). The
subsequent dimethylsulfate (DMS) footprinting experiments on
hTERT G4 in presence of GTC365 were performed with 5 mM
KCl buffer rather than the 140 mM KCl buffer. The results of these
2
Cell Chemical Biology 26, 1–12, August 15, 2019

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
the G4 as measured by circular dichroism (CD) at a pH of 7.5 printing in 5 mM KCl buffer did not reveal any significant differ-
(Figure S1B). To gain some insight into how RG260 interacts ence between the control and the RG260-bound species, we
with the 5–12 G4, we first checked whether changes in pH would explored the effect of different buffer conditions. In this regard
affect the protonation status of cytosine and adenine, but not we were particularly interested in the effect of calcium ion on
guanine, thereby inducing a change of Watson-Crick base pair- the DMS footprinting pattern of the FL-G4 in the presence of
ings in the stem loop but not G-tetrads. The maximum CD signal GTC365 and RG260, because calcium ion is known to stabilize
at around 262 nm at pH 6.8 was significantly decreased with a the G-triplex (Jiang et al., 2015), an intermediate that could
small increase in a shoulder at around 290 nm compared with form in an early step during the formation of the stem loop
the spectra at pH 7.5 (Figure S1C). This change in CD is indica- involving G-runs 5–8. Indeed, with a 100 mM CaCl2 buffer we
tive of a conformational change just in the hairpin stem-loop found that G-runs 6–8 showed a somewhat enhanced DMS
structure. When RG260 was added, the Tm was increased by cleavage in the presence of RG260, whereas there was no signif-
2ꢁC (Figure S1D), which confirms our hypothesis that at a lower icant change in DMS footprinting pattern by GTC365 compared
pH, conformational change of the hairpin stem loop is specif- with the DMSO (Figure 1D). These results show that different
ically induced by addition of the drug so that the entire structure buffers (KCl versus CaCl2) result in different folding patterns,
is stabilized. This result is in line with the role of the hairpin stem and in the 100 mM CaCl2 buffer it is clearly demonstrated that
loop of the 5–12 G4 as a nucleation site for folding of hTERT G4, RG260 indeed binds to the hTERT G4. The enhanced DMS
as proposed previously (Kang et al., 2016).
cleavage in G-runs 6–8 in the presence of RG260 in 100 mM
In the next series of experiments, we compared the DMS foot- CaCl2 buffer suggests this might be the binding site for the
printing pattern of the FL-G4 in the presence of GTC365 and BPU moiety of the RG260 compound, in contrast to G-runs
RG260 using the 5 mM KCl buffer that we had used in the previ- 7–10 for the guanidino moiety of GTC365.
ous experiments with GTC365 (Figure 1C). We were surprised to
To evaluate whether this structural change of the hTERT G4
see that the GTC365- and RG260-bound DMS footprints were induced by RG260 affects hTERT promoter activity, we conduct-
quite distinct and that the WT footprint in 5 mM KCl buffer was ed a luciferase assay in human breast cancer MCF7 cells. RG260
different to that found in the initial DMS footprinting previously reduced the luciferase activity in a dose-dependent manner by
carried out in 140 mM KCl buffer. This clearly shows that the 25% at 2 mM, indicating that RG260 inhibited hTERT promoter
KCl buffer concentration was a determinant of the final folding activity (Figure 1E). The effect on the telomerase activity by
pattern, which is most likely determined by the initial folding in- RG260 was also evaluated by a modified telomeric repeat ampli-
termediates. In reflection, this is not too surprising because the fication protocol (TRAP) assay. As shown in Figure 1F, 72-h
higher concentration of KCl (140 mM) used in the earlier experi- treatment of RG260 decreased the telomerase activity in a
ments is more likely to initially favor formation of the G4s, dose-dependent manner by 70% at 60 nM.
whereas the lower concentration of KCl (5 mM) used in the later
experiments is more likely to favor initial formation of the hairpin Determination of the Binding Site for RG260 Series
loop. The similar footprinting pattern in the dimethylsulfoxide Compounds on the hTERT G4
(DMSO) control and with RG260 suggests that either RG260 To support the role of the BPU structure of RG260 for conforma-
was not binding to the hTERT G4 or that the drug was binding tional change in the hairpin stem-loop structure, we set out to
without significant change in the DMS footprinting pattern. If design and synthesize new analogs (Figure 2A). We then deter-
the latter was the case, this suggests that the binding of the mined the comparative effects of RG260 and other similar ana-
two different drugs results in two different G4 folded products, logs on hTERT mRNA expression and hTERT promoter lucif-
and only in the case of GTC365 is the WT folding pattern erase activity (Figures 2B and 2C). While RG1533 was inactive
changed in 5 mM KCl. At this point it became important to deter- in both assays, RG1534, RG1601, and RG1603 were more
mine whether RG260 was binding to the hTERT G4, especially potent than RG260. Likewise, in a cytotoxicity experiment using
since the DMS footprinting did not confirm this.
human prostate cancer (PCa) PC3-LN4 cells, RG1533 was also
Tm and CD results (Figures S1B and S1C) support the idea that inactive (Figure 2D). We next designed a series of three different
RG260 is bound to the hTERT G4 and that the structure retains size oligomers for FRET experiments with the objective of deter-
two G4s, but the arrangement of the intervening G-runs (5–10) mining the drug-binding site for the RG260 series compounds. In
was different in the two drug-bound species. Indeed G-runs descending order of size they represented the heteroduplex plus
5–10 have distinctly different DMS footprinting patterns in the the 30-G4 (42-mer), the full heteroduplex (31-mer), and what we
presence of either GTC365 or RG260 (Figure 1C). This leads us predicted would be the first intermediate in the folding pathway
to suspect that G-runs 5–8 might form a similar heteroduplex (18-mer) (Figure 2E). The FRET measurements on RG260
in the control and in the presence of RG260, but that in the pres- and this series of analogs (RG1533, RG1534, RG1601, and
ence of GTC365 G-runs 7–10 were utilized to form the heterodu- RG1603) are shown for each oligomer. The FRET measurement
plex. Furthermore, this suggests that while the origin of the 50-G4 is the average of the full set of equilibrating species in each
is the same for both GTC365 and RG260 (G-runs 1–4), the 30-G4 experiment. The results demonstrate that the 18-mer overall
is formed from G-runs 9–12 for RG260 or from G-runs 6–7 and shows the most significant reduction in FRET measurement
11–12 for GTC365. A critical structural difference between upon addition of the RG260 analogs, while the 31-mer interme-
GTC365 and RG260 is that GTC365 contains an acridine ring, diate and the 42-mer have the least reduction in FRET. The
the G-tetrad binding moiety, while RG260 lacks this recognition most biologically active RG260 analogs (i.e., RG1603) show
feature, which could be instrumental in defining the early inter- the most potent effect on FRET with the shorter oligomers
mediates in the different folding pathways. Since the DMS foot- (31-mer and 18-mer). This set of data suggests that the
Cell Chemical Biology 26, 1–12, August 15, 2019
3

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
Figure 2. Site-Specific Binding of Small Molecules with hTERT G4
(A) A series of compounds based on the initial hit RG260.
(B and C) Relative hTERT mRNA level change (B) and promoter activity change (C) by RG260 analogs. MCF7 cells were treated with 250 nM RG260 analogs for
48 h and then subjected to qRT-PCR. For luciferase assay, MCF7 cells were transfected with pGL3-hTERT construct and pRL-TK for 6 h and then treated with
500 nM RG260 analogs for 18 h.
(D) Dose-response effects of PC3-LN4 cells to RG260, RG1534, RG1601, RG1603, and RG1533 (72 h). Data are shown as mean SD of four replicates.
(E) Identification of G-runs 5–7 with 18-mer as a binding site of RG260 analogs by FRET assay. FRET probes with FAM and TAMRA at each end of oligomers were
annealed with compounds at an indicated concentration in a buffer containing 10 mM Na-cacodylate (pH 7.5) and 100 mM CaCl2 before the measurement of
fluorescence intensity of FAM. The relative fluorescence intensity was obtained compared with the DMSO sample.
(F and G) Determination of G-hairpin as a binding target of RG1603 (left) and dose-dependent FRET change (F). WT or a mutant with G-to-A of G-run 6 was
annealed with indicated concentration of RG1603 in a buffer containing 10 mM Na-cacodylate (pH 7.5) and 100 mM CaCl2 before the measurement of fluo-
rescence intensity of FAM (G).
(H) Annealed mixture of FAM-labeled 18-mer and RG1603 in a buffer including 100 mM CaCl2 was subjected to DMS footprinting. Image quality is a reflection of
the reduced intensity and partial cleavages.
Data are shown as mean SD of four replicates. p values (**p < 0.01, ***p < 0.001, ****p < 0.0001) were obtained by two-tailed t test. ns, not significant.
drug-binding site for the RG260 series is within the 18-mer, most this is sufficient to induce a folding of the 5–12 G4 to inhibit the
likely in proximity to the set of four G-G base pairs and the adja- transcription of hTERT. However, in the absence of direct evi-
cent G-C base pair. To further define the binding site, we dence for the binding site, this conclusion must remain tentative.
mutated G-run 6 in the 18-mer, which is positioned at the top Although attempts were made by nuclear magnetic resonance to
of the hairpin. As expected, if this G-run is not involved directly directly determine the binding site in the 18-mer hairpin, these
in the binding of RG1603, drug binding to the mutant sequence were unsuccessful due to the weak binding of these compounds.
still caused significant reduction of the FRET signal upon addi-
tion of RG1603, which was almost as much as the parent WT Treatment of Prostate Cancer Cells with RG260 Results
sequence (Figure 2F). Furthermore, using the WT 18-mer in Selective Toxicity to Cells Expressing hTERT
sequence, we demonstrated a dose dependency in reduction Having identified RG260 as a downregulator of hTERT that
of FRET signal upon addition of RG1603 (Figure 2G). To further works by a mechanism similar to that of GTC365, we sought to
support the 18-mer as the drug-binding site for RG1603, we car- evaluate anticancer efficacy of RG260 focusing on PCa. The crit-
ried out DMS footprinting. In a comparison of the gel lanes of the ical oncogenic function of TERT in PCa during tumorigenesis has
treated versus non-treated samples, G-runs 5 and 7 that showed been demonstrated by others using genetically engineered
the most change in extent of DMS cleavage, confirming that the mouse knockin models inducing expression of TERT in normal
G-G base pairing along with the adjacent G-C base pair is the prostate epithelium (Hu et al., 2012). The RG260 activity was
site for drug occupancy (Figure 2H). Differential binding sites characterized in a culture system using human PCa lines
and pathways for folding of the G-quadruplexes for RG1603 including DU145, PC-3, and LNCaP, and mouse prostate epithe-
and GTC365 are illustrated in the diagram in Figure S2.
lial cancer (mPrEC) cells. Because the unique G4 DNA is present
Overall, these results from DMS footprinting on the 18-mer, in the core promoter region of human TERT but not in mouse
together with the FRET studies on the RG260 analogs, strongly TERT, we hypothesized that RG260 possessed selectivity to-
suggest that RG260 only binds to the hairpin stem loop, and ward human cancers. After exposure of RG260, morphological
4
Cell Chemical Biology 26, 1–12, August 15, 2019

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
Figure 3. Selective Cytotoxicity of RG260 to hTERT-Expressing Prostate Cancer Cells
(A) Representative dose-response effects of human PCa cells (DU145, PC-3, and LNCaP) and mPrEC cells to RG260 (72 h of treatment). Data are shown as
mean SD of four replicates.
(B) The hTERT mRNA level in RWPE-1 cells and PC3-LN4 cells. qRT-PCR was conducted to obtain the relative mRNA level of hTERT to b-ACTIN. Additionally,
HK2, COXII, and MYC mRNA levels were compared.
(C) Cell viability of RWPE1-and PC3-LN4 cells after 72 h of treatment with RG260. Data are shown as mean SD of four replicates.
(D) Immunoblot analysis of cleavages of caspase-9 (Casp-9), caspase-3 (Casp-3), and PARP-1 in PCa cells following treatment with RG260.
(E) Relative telomere-length changes induced by RG260. Human PCa cells were treated with 0.1 mM RG260 for 72 h. Genomic DNA was extracted and then
subjected to qPCR. Ct values of telomeres were normalized to that of 36B4 (single copy gene) to obtain DCt (triplicates/group).
(F) Relative mRNA expression changes induced by RG260 were assessed by qPCR analysis. MCF7 cells were treated with 0, 0.13, 0.25, or 0.5 mM RG260 for 24 h.
****p < 0.001 compared to vehicle (0); ns, not significant.
examination and MTT assay showed cell death across all human toward cancer cells, resulting in downregulation of hTERT
PCa lines tested, but not the mPrEC cells. These later cells were expression and apoptotic cell death.
resistant even after prolonged incubation (Figure 3A). Similarly,
the RWPE1 cell line, which is immortalized but does not express Synthetically Derived Analogs of RG260 Interacting with
elevated hTERT, was not growth inhibited by this compound the Hairpin Stem Loop in the hTERT G4 Element Induce
(Figures 3B and 3C). Previously reported telomerase-targeting Apoptotic Cell Death Selectively in Cancer Cells without
compounds, including BRACO-19 and BIBR1532 (Kleideiter Harming Normal Epithelial Cells
et al., 2007), exerting their effects through telomeric G4s or the To improve the molecular properties of RG260 and achieve a
RNA component of the telomerase holoenzyme, showed acute more bioavailable small-molecule drug, we synthesized RG260
toxicity to hTERT-negative RWPE1 cells.
analogs with the following considerations: molecular weight
To characterize the antineoplastic effects of RG260 in (<500), cLogP (<4.0), PSA (<140 A2), and number of rotatable
both DU145 and LNCaP cells, RG260 treatment in a dose- bonds (<8). The design of analogs with varying groups at R1,
dependent manner caused the cleavage of caspase-9 R2, and R3 resulted in compounds RG1534, RG1601, and
(Asp330), producing a p37 fragment that is known to amplify RG1603, and these analogs showed improved potency to inhibit
the apoptotic response (Figure 3D). Cleaved caspase-9 led to hTERT promoter activity (Figures 2A–2C). Because the MTT
caspase-3 cleavage to trigger poly(ADP-ribose)polymerase-1 assay after 72-h exposure to these analogs indicated that
(PARP-1) cleavage. Next, we measured telomere length in cells RG1534 has superior effects on growth inhibition when
treated with RG260 using genomic DNA extracts by PCR ampli- compared with RG1601 and RG260 (Figure 2D) and caused a
fication with oligonucleotide primers designed to hybridize to the striking downregulation of hTERT expression and robust cleav-
telomere repeats (Cawthon, 2002). RG260 treatment resulted in age of caspase-9 and PARP-1, apoptotic markers, in PCa cells
significant reduction in telomere length in both DU145 and (Figure S3A), pharmacokinetics studies were carried out
LNCaP (Figure 3E). This change, followed by hTERT downregu- showing that both peak plasma concentration (Cmax) and area
lation, was not mediated by altering expression of c-MYC that under the plasma concentration curve (AUC) were proportional
binds to the E-box of the hTERT promoter and contains G4 tet- to dose and increased in a roughly linear fashion (Figure S3B).
rads (Figure 3F). These results indicate that RG260 binding to the Using a subcutaneous mouse DU145 model, when RG1534
heteroduplex loop, not the conserved tetrads, induces selectivity was dosed intraperitoneally (i.p.) every other day at 2 and
Cell Chemical Biology 26, 1–12, August 15, 2019
5

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
Figure 4. Selective Cancer Cell Death Induced by RG1603
(A) Dose-response effects on proliferation of RG1603 after 72-h treatment of PCa cell lines and normal prostate epithelial RWPE-1 cells. Data are shown as
mean SD of four replicates.
(B) Immunoblot analysis of hTERT, p53, and p21 in PCa cells. Cells were treated with RG1534 for 24 h and total lysates were subjected to immunoblotting.
(C) hTERT mRNA levels change in response to RG1603 doses in DU145 and RWPE-1 cells. qRT-PCR was conducted to obtain the relative mRNA of hTERT to
b-ACTIN.
(legend continued on next page)
6
Cell Chemical Biology 26, 1–12, August 15, 2019

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
5 mg/kg, RG1534 induced moderate tumor growth inhibition in a treated with this therapy eventually becomes resistant. To
dose-dependent manner (Figure S3C) without significant weight explore whether the ability of RG1603 to damage mitochondria
loss (<5%). Treatment with RG1534 at 10 mg/kg (i.p., every other and induce apoptosis can overcome specific chemoresistance,
day) induced complete response in all RG1534-treated animals. we studied LNCaP cells induced to become Taxotere resistant
However, weight loss was higher than 10% in all animals that (Tx-R) by culturing in increased doses of this chemotherapeutic
received this dose (Figure S3D).
agent (Domingo-Domenech et al., 2012; Vidal et al., 2015). Real-
Since RG1534 produced weight loss in animals and RG1603 time qPCR analysis confirmed that expression of hTERT mRNA
showed a dose-dependent anticancer activity in a broad range was increased in Tx-R cells (Figure S4), and these cells had
of PCa lines without killing normal prostate epithelial cells (Fig- elevated expression of CK44 and CK9, previously identified
ure 4A), we next set out to evaluate RG1603 as an alternative markers of Tx-R (Domingo-Domenech et al., 2012). Tx-R LNCaP
lead candidate. Regardless of p53 status in PCa cells, RG1603 cells have increased expression in both HMOX1 and PGC1a
increased p21 expression, a cell-cycle inhibitor, followed by (Figure 5B) (Vidal et al., 2015) when compared with the WT con-
downregulation of hTERT expression (Figure 4B). Since metasta- trol. As shown in Figure 5A, RG1603 treatment reversed the
tic PCa harbor frequent mutations in p53 and loss of p53 causes PGC1a increase found in Tx-R cells. Similarly, expression of
genomic instability and chemoresistance, RG1603 might be an NQO1 and HMOX1, two targets of the NRF2 transcription factor,
alternative option for treating metastatic PCa. Real-time qPCR was also decreased by RG1603 treatment. To determine
analysis showed downregulation of hTERT mRNA expression whether NRF2 signaling is regulated by hTERT, we depleted
by RG1603 in PCa cells (Figure 4C). To show whether the strong hTERT expression in PCa cells by the transduction of small inter-
growth-inhibitory effects of RG1603 were mediated through in- fering RNA (siRNA). Depletion of hTERT expression led to down-
duction of cell death, we stained cells with annexin V/7-AAD regulation of NRF2 as well as targets of NRF2, NQO1, and
(7-aminoactinomycin D) and subjected them to flow-cytometry HMOX1 (Figure 5C). NRF2 depletion inhibited both the survival
analysis. In these PCa cells, cells positive for annexin V/7-AAD and growth of Tx-R cells, suggesting the importance of this tran-
staining were increased with RG1603 treatment in a time-depen- scription factor to growth of these cells (Figure 5D). To examine
dent manner (Figure 4D). After RG1603 treatment, cleavage of whether killing of Tx-R cells by RG1603 is mediated by inhibition
both caspase-3 and PARP-1 were also detected by immunoblot- of cellular redox mechanisms, we examined the levels of pro-
ting (Figure 4E). Consistent with this result, examination of cyto- teins controlling cellular redox, catalase, superoxide dismutase
solic fraction from the cells treated with RG1603 showed an 1 (SOD1), and thioredoxin by immunoblotting. Expression of all
increased cytochrome c level in cytosol (Figure 4F), a known of these reactive oxygen species (ROS) scavengers was reduced
component of the electron transfer chain in mitochondria. in cells treated with RG1603 (Figure 5E). In a similar fashion to the
Once cytochrome c is released to cytosol, it binds to a partner results seen with the knockdown of hTERT, marked decreases in
protein Apaf-1 and procaspase-9 to trigger apoptotic cell death expression of ROS scavengers was induced by RG1603 treat-
through caspase cleavages (Li et al., 1997; Song et al., 2003). ment. This change would permit accumulation of oxidative
Collectively, our data indicated that RG1603 triggers apoptotic stress in the RG1603 treated cells (Sahin et al., 2011). Consistent
cell death selectively in cancer cells while sparing normal cells.
with the ability of this agent to decrease ROS scavenger pro-
teins, after RG1603 treatment MitoSox red staining demon-
strates that RG1603-mediated hTERT downregulation increases
mitochondrial superoxide anion production (Figure 5F). Similarly,
Molecular Mechanism(s) By Which RG1603 Inhibits the
Survival and Growth of Prostate Cancer Cells
In addition to dysfunction and shortening of telomeres and DNA after RG1603 treatment 20,70-dichlorodihydrofluorescein diace-
damage, TERT knockout in mice causes mitochondrial dysfunc- tate (H2DCF-DA) staining followed by flow analysis demon-
tion and elevated oxidative stress (Sahin et al., 2011). This result strates elevated levels of total cellular ROS (Figures 5G and
suggests that the action of this hTERT promoter inhibitor could 5F). The marked induction of g-H2AX expression by RG1603
also involve these specific pathways. RG1603 treatment mark- treatment (Figure 5H), and the detection of cleavage products
edly downregulated the expression of peroxisome proliferator- of DNA fragmentation factor 45 (DFF45/ICAD) (Figure 5I) implies
activated receptor-gamma coactivator alpha (PGC1a), a tran- that RG1603 is inducing cell death through inhibiting hTERT syn-
scription factor important for mitochondrial biogenesis, and thesis, which in turn blocks mitochondrial function and leads to
expression of NQO1 and HMOX1 (Figure 5A). The latter two pro- oxidative DNA damage.
teins are targets of the nuclear factor erythroid 2-related factor 2
(NRF2)-mediated antioxidant/electrophile-responsive element In Vivo Evaluation of Anticancer Efficacy and Safety of
(ARE/ERE) signaling. This result together with increased cyto- RG1603 in a Tumor Xenograft Mouse Model
chrome c release in RG1603-treated PCa cells suggests that Following a single dose of RG1603 (25 mg/kg) by i.p. administra-
RG1603 triggers catastrophic damage to mitochondria.
tion, plasma samples were collected to measure pharmacoki-
Docetaxel (Taxotere) is the only chemotherapeutic agent used netics. The plasma concentration of RG1603 was maintained
to treat prostate cancer that extends life. However, every patient at higher levels for 4 h and then gradually decreased by 12 h
(D) Time-dependent increase of annexin V binding by RG1603. Human prostate cancer DU145 and PC3-LN4 cells were treated with RG1603 for 24 and 48 h
before annexin V binding assay using flow cytometry.
(E) Immunoblot analysis of cleavages of caspase-3 (Casp-3) and PARP-1 in DU145 and LNCaP cells. Cells were treated with RG1603 for 24 h and total lysates
were subjected to immunoblotting.
(F) Immunoblot analysis of cytochrome c release in cytosolic fraction of cells from the treatment of (E).
Cell Chemical Biology 26, 1–12, August 15, 2019
7

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
Figure 5. Mechanism of Action Responsible
for RG1603-Induced Cell Death
(A and B) Immunoblot analysis of PGC1a, NQO1, and
HMOX1 expression in Taxotere-naive LNCaP cells
and Taxotere-resistant (Tx-R) cells. Cells were either
treated with RG1603 or 100 nM Taxotere for 24 h and
total lysates were subjected to immunoblotting.
(C) DU145 cells were transfected with scramble
control (si-C) or hTERT siRNAs. After 72 h, total ly-
sates were subjected to immunoblot analysis of
hTERT, NRF2, NQO1, and HMOX1.
(D) Representative images of crystal violet-stained
Tx-R cells expressing either short hairpin RNA
(shRNA) scramble control or shRNA NRF2. Cells
were infected with lentiviruses containing scramble
control or shNRF2 for 48 h and then further treated
with or without 1 mM RG1603 for 72 h.
(E) An immunoblot with the oxidative stress defense
western blot cocktail. Tx-R cells were treated with
DMSO or 1 mM RG1603for 24 h and the resulting total
lysates were subjected to immunoblotting. Relative
changes of catalase (60 kDa), smooth muscle actin
(42 kDa), superoxide dismutase 1 (16 kDa), and thi-
oredoxin (12 kDa) are shown on the one blot.
Morphological cell death induced by RG1603 is de-
picted in phase-contrast images (Scale bar, 200 mm).
(F) Detection of superoxide anion and reactive ox-
ygen species (ROS). DU145 cells were treated with
DMSO or 0.3 mM RG1603 for 24 h and then stained
with MitoSox red or H2DCF-DA for 15 min prior to
flow-cytometry analysis. Number of events on the y-
axis of histogram is 200.
(G) Representative fluorescence images (Scale bar,
200 mm) of dichlorofluorescein (DCF) (ROS) and
nuclear (Hoechst 33342) staining in Taxotere-naive
and -resistant (Tx-R) cells at 0, 6, or 16 h treatment
with 0.3 mM RG1603. Relative fluorescent intensity
(RFI) was counted using a fluorescent microplate
reader (excitation wavelength at 485 nm and emis-
sion wavelength at 535 nm). Data are shown as
mean SD of triplicates.
(H and I) Immunoblot analysis of g-H2AX (S139) (H)
and DFF45 expression (I) in DU145, LNCaP, and
Tx-R cells. Cells were treated with RG1603 as
indicated for 24 h.
day) and tumor burden was evaluated for
21 days. RG1603 treatment caused signif-
icant growth inhibition of established PCa
tumors in in vivo xenografts (Figures 6B–
6D). Blood chemistry analyses including
alkaline phosphatase, alanine aminotrans-
ferase, blood urea nitrogen, glucose,
and total protein were not significantly
different between vehicle, RG1603 treat-
(Figure 6A). Pharmacokinetics studies demonstrated that admin- ment groups, and normal mice (Figure S5). Hematological pro-
istration of 25 mg/kg RG1603 to mice produced peak plasma files disclosed that the RG1603-treated group had a mild
drug concentrations of RG1603 of ꢀ8.4 mM, corresponding to hypochromia (two mice) or polychromasia (three mice). To verify
the doses that effectively killed PCa cells in culture. When en- whether tumor suppression was the result of hTERT inhibition, at
grafted DU145 tumors were grown on the flank of SCID mice the end of treatment we dissected tumor tissues from xenograft
and reached a size of ꢀ150 mm3, mice were randomly assigned mice and used them for preparation of tumor extracts and
to two groups: vehicle control and RG1603. Mice were then immunohistochemistry (IHC) analysis. Immunoblot analysis of
treated with either vehicle or 25 mg/kg RG1603 (i.p., every other tumor extracts revealed a striking decrease of hTERT expression
8
Cell Chemical Biology 26, 1–12, August 15, 2019

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
Figure 6. Pharmacokinetic Analysis and Effi-
cacy of RG1603 in Prostate Tumor Xenograft
Model
(A) Pharmacokinetic profile in mouse plasma after
single dose of 25 mg/kg RG1603 i.p.
(B) SCID mice implanted subcutaneously with
DU145 cells were treated every other day with either
vehicle or 25 mg/kg RG1603 i.p. for 21 days to
measure the effect on tumor growth. Data are shown
as mean
SEM. Significant difference in tumor
volume (***p < 0.001; Student’s t test) at day 21
between RG1603-treated or vehicle-treated mice.
(C and D) Differences in tumor size and weight at the
endpoint of (B) treatments (vehicle versus RG1603).
Significant difference in tumor weight (***p < 0.001;
Student’s t test) at day 21 between RG1603-treated
and vehicle-treated mice.
(E) Immunoblot analysis of DU145 tumors from mice
treated with 25 mg/kg RG1603 at the times shown.
(F) Representative immunohistochemical staining
for H&E, Ki67, 8-ox-dG, and cleaved caspase-3 of
tumor tissues of (C).
evident, consistent with the induction of
apoptosis. Collectively, our results show
that the hTERT inhibitor RG1603 is capable
of inducing oxidative stress, DNA damage,
and tumor apoptosis.
DISCUSSION
Telomerase activation is a hallmark of can-
cer and a target for therapeutic interven-
tion. Despite extensive studies and clinical
trials, only moderate clinical success has
been reported. Telomerase inhibition to
date requires proliferating cells over multi-
ple population doublings to induce tumor-
suppressive effects. However, long-term
telomerase inhibition may have undesir-
able effects on normal stem cells and pro-
genitor cells, which need telomerase for
survival (Hiyama and Hiyama, 2007).
hTERT, the catalytic subunit of telome-
rase, synthesizes the new telomeric DNA
from the RNA template hTR (Lai et al.,
2001; Lingner et al., 1997). While hTR is
ubiquitously expressed across cancer
and normal tissues (Yan et al., 2001),
in tumors of RG1603-treated mice (Figure 6E). Compared with hTERT expression is upregulated in the vast majority of cancers
the tumors of control mice, reduced NRF2 signaling was including cervical carcinomas, hepatocellular carcinoma, lung,
apparent in the tumors of mice treated with RG1603 as mirrored breast carcinomas, and neuroblastomas but not in normal cells,
by evidence of lower expression of HMOX1 and SOD2 ROS suggesting that there would be minimal side effects on normal
scavengers. In treated animals, IHC analysis demonstrated cells. Moreover, recent studies in glioblastoma, melanoma,
increased levels of 8-hydroxydeoxyguanosine (8-OH-dG), a and bladder cancer indicated that promoter mutations or un-
marker of oxidative damage, in mice receiving RG1603 treat- usual epigenetic changes can promote constitutive activation
ment when compared with controls (Figure 6F). In tumors from of hTERT (Borah et al., 2015; Horn et al., 2013; Killela et al.,
RG1603-treated mice, IHC analysis with an antibody specific 2013). Somatic mutations such as cytosine to thymine or gua-
for cleaved caspase-3 demonstrated increased staining while nine to adenine mutations were shown to increase hTERT
decreased staining for the tumor proliferation antigen Ki67 was expression and telomerase activity (Horn et al., 2013). These
Cell Chemical Biology 26, 1–12, August 15, 2019
9

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
mutations all occur in a G-rich region of the hTERT promoter, RG260 series of compounds acting as small-molecule chaper-
which has previously been shown to form quadruplex DNA. ones at the initial stages of the folding process (Dethoff et al.,
These mutations abrogate the G4-folding process and result in 2012). In this study we found that RG1603 decreased hTERT
aberrant activation of hTERT (Kang et al., 2016), suggesting a mRNA expression and induced apoptotic cell death prior to telo-
negative function of G4 structure on hTERT promoter activity. mere shortening, which is consistent with observation by others
To avoid the toxicity associated with binding in a non-specific that hTERT loss triggers dysfunctional DNA capping. In contrast
manner with the external tetrads in G4s, which are widespread to robust cell death in PCa cells, normal human prostate epithe-
through the human genome, we attempted to identify com- lial RWPE-1 cells deficient in hTERT expression (Huang et al.,
pounds that lack the tetrad-binding moiety but still retain the 2008) were insensitive to RG1603. Moreover, no growth-inhibi-
hairpin stem-loop binding properties. These compounds, exem- tory activity of RG1603 was observed in mouse tumor cells,
plified by RG1603, still retain the ability to facilitate the coopera- which have a lack of G4 stem loop in mouse TERT promoter.
tive folding process leading to the silencer element in the hTERT In contrast to previous generations of G4 molecules targeting
promoter. Thus, this approach differs radically from those previ- the telomeric G4s, which exhibited acute toxicities regardless
ously used to target G4s because it does not rely on binding to of cell type, the improved specificity of RG1603 on the target,
the core G4 structure.
RG260 and the related series of compounds described in this ment of clinically useful anticancer therapeutics.
contribution did not produce the same G4-folding pattern as Mechanistically, it is not well understood how enhancing the
while sparing normal cells, is highly desirable for the develop-
GTC365 in 5 mM KCl buffer. In contrast to GTC365, this new se- hTERT G4 DNA cooperative folding process triggers apoptotic
ries of compounds appears to produce a folding pattern cell death. RNAi-mediated hTERT knockdown resulted in sup-
mimicking that found naturally in the WT sequence. However, pression of tumor cell growth and induced a variable degree of
this depends upon the buffer conditions. In 5 mM KCl buffer programmed cell death prior to telomere shortening (Oliver
DMS footprinting reveals that RG260 forms a folded form similar et al., 2017; Shen et al., 2008). These results suggest that the
to that in the control, while GTC365 forms a different folded hTERT enzyme has telomerase-independent activity. hTERT
structure. In contrast, in CaCl2 buffer the GTC365 and control was previously shown to regulate pro-survival Bcl-2 expression,
form the same folded structure, but RG260 forms a different preventing mitochondrial apoptosis (Del Bufalo et al., 2005).
folded species. The origin of the differently induced folding pat- Mitochondrial localization of hTERT has also been associated
terns produced by the GTC365 and RG260 series of compounds with oxidative stress (Singhapol et al., 2013). To understand
is most probably due to their initial binding interactions with the how hTERT promoter control regulates mitochondrial function
G4-forming units or the hairpin loop, which contains multiple we examined two transcription factors, NRF2 and PGC1a,
G-runs that can form intermediate species such as G-triplexes both important to mitochondrial function and implicated in
(Jiang et al., 2015). In the 5 mM KCl buffer, while RG260 binds oxidative stress regulation (Dinkova-Kostova and Abramov,
to the top of the hairpin loop, which is the earliest intermediate 2015; Valle et al., 2005). We showed that RG1603 decreased
in the folding process and thus appears to mimic the natural NRF2 expression and the expression of its transcription target
folding pathway, GTC365 may bind at an artificially induced HMOX1. siRNA-mediated depletion of hTERT expression also
step, which may involve preferential stabilization of the G4s resulted in inhibition of NRF2 and HMOX1 expression. In our
due to the presence of the acridine moiety of GTC365. In study, DNA damage as shown by g-H2AX induction and DNA
CaCl2 buffer the intermediates in the folding pathway, such as fragmentation by RG1603 coincided with PGC1a inhibition. De-
G-triplexes, are stabilized in the loop region. RG260 more favor- creases in the level of NRF2 and PGC1a by RG1603 resulted in
ably binds to these early intermediates in the loop region, generation of ROS, leading to mitochondrial damage and cell
whereas the presence of GTC365 favors the early folding of death. Similarly, a previous study found that hTERT-induced
the 30-G4 and its stabilization by the acridine moiety. The differ- cisplatin resistance in osteosarcoma cells was associated with
ence between the two series of compounds is the presence of an an increased glutathione antioxidant defense that functioned to
acridine G-tetrad binding moiety present solely in GTC365. The reduce the ROS level (Indran et al., 2011; Zhang et al., 2017b).
presence of this moiety may facilitate the formation of the sec-
In conclusion, small-molecule targeting of the cooperative
ond G4 using G-runs 5 and 6 alongside 11 and 12 prior to allow- folding process in the hTERT G4 promoter element produces
ing the hairpin to form from G-runs 7 to 10. The transcription acti- telomerase-independent events, which impair mitochondrial
vation of hTERT produced by the somatic mutations at ꢂ124 and processes and result in oxidative stress and inhibition of prostate
ꢂ146 (G to A) can be explained by the generation of new binding cancer cell growth.
sites for GABP at the duplex level (Mancini et al., 2018). Further-
more, both these mutations and those at ꢂ124/125 and ꢂ138/ SIGNIFICANCE
139 (GG to AA) would also be expected to compromise the natu-
rally occurring folding pathway involving such intermediates as We have identified small molecules targeting the unique
shown in Figure 2E, which would also lead to overexpression hTERT G4 stem loop but not tetrad DNAs, which increases
of hTERT. It is intriguing and perhaps not coincidental that the the selectivity toward hTERT DNA. These drugs act as phar-
pairs of mutations at ꢂ124/125 and ꢂ138/139 are directly oppo- macological chaperones facilitating the cooperative folding
site each other in the hairpin, in contrast to the less obvious mu- of the G4 silencer element rather than acting by stabilizing
tation pattern found in the hTERT G4-folding pattern induced by the core G4 structure. The ability of RG1603 to selectively
GTC365. We believe that we have uncovered a DNA-folding pro- kill human cancer cells while sparing normal epithelial cells
cess that mimics RNA riboswitches, with the RGT365 and demonstrates for the first time in vivo anticancer efficacy of
10 Cell Chemical Biology 26, 1–12, August 15, 2019

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
REFERENCES
an hTERT G4-targeting small molecule. Importantly, using
these drugs we uncovered the role of hTERT in NRF2 and
Blasco, M.A., and Hahn, W.C. (2003). Evolving views of telomerase and can-
PGC1a regulation of redox signaling and DNA-damage
cer. Trends Cell Biol. 13, 289–294.
response. The potential use of hTERT inhibitory following
Bochman, M.L., Paeschke, K., and Zakian, V.A. (2012). DNA secondary struc-
Tx-R of prostate cancer may provide an alternative thera-
tures: stability and function of G-quadruplex structures. Nat. Rev. Genet. 13,
peutic option to overcome tumor resistance.
770–780.
Borah, S., Xi, L., Zaug, A.J., Powell, N.M., Dancik, G.M., Cohen, S.B., Costello,
STAR+METHODS
J.C., Theodorescu, D., and Cech, T.R. (2015). Cancer. TERT promoter muta-
tions and telomerase reactivation in urothelial cancer. Science 347,
1006–1010.
Detailed methods are provided in the online version of this paper
and include the following:
Bugaut, A., Rodriguez, R., Kumari, S., Hsu, S.T., and Balasubramanian, S.
(2010). Small molecule-mediated inhibition of translation by targeting a native
RNA G-quadruplex. Org. Biomol. Chem. 8, 2771–2776.
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESOURCE SHARING
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Cell Lines
Burger, A.M., Dai, F., Schultes, C.M., Reszka, A.P., Moore, M.J., Double, J.A.,
and Neidle, S. (2005). The G-quadruplex-interactive molecule BRACO-19 in-
hibits tumor growth, consistent with telomere targeting and interference with
telomerase function. Cancer Res. 65, 1489–1496.
B Animal Studies
Cawthon, R.M. (2002). Telomere measurement by quantitative PCR. Nucleic
d METHOD DETAILS
Acids Res. 30, e47.
B FRET Assay
Del Bufalo, D., Rizzo, A., Trisciuoglio, D., Cardinali, G., Torrisi, M.R.,
Zangemeister-Wittke, U., Zupi, G., and Biroccio, A. (2005). Involvement of
hTERT in apoptosis induced by interference with Bcl-2 expression and func-
tion. Cell Death Differ. 12, 1429–1438.
B DMS Footprinting
B Luciferase Assay
B Circular Dichroism (CD) Analysis
B Gene Transduction
Dethoff, E.A., Chugh, J., Mustoe, A.M., and Al-Hashimi, H.M. (2012).
Functional complexity and regulation through RNA dynamics. Nature 482,
322–330.
B Cell Proliferation and Apoptosis Assays
B Immunoblotting
B Immunofluorescence and Immunohistochemistry
B Measurements of Telomere Length and Telomerase
Enzyme Activity
Dinkova-Kostova, A.T., and Abramov, A.Y. (2015). The emerging role of Nrf2 in
mitochondrial function. Free Radic. Biol. Med. 88, 179–188.
Domingo-Domenech, J., Vidal, S.J., Rodriguez-Bravo, V., Castillo-Martin, M.,
Quinn, S.A., Rodriguez-Barrueco, R., Bonal, D.M., Charytonowicz, E.,
Gladoun, N., de la Iglesia-Vicente, J., et al. (2012). Suppression of acquired do-
cetaxel resistance in prostate cancer through depletion of notch- and hedge-
hog-dependent tumor-initiating cells. Cancer Cell 22, 373–388.
B Real-Time PCR Analysis
B Synthesis of RG260 Analogs
B In Vivo Studies
d QUANTIFICATION AND STATISTICAL ANALYSIS
d DATA AND SOFTWARE AVAILABILITY
Harley, C.B., Kim, N.W., Prowse, K.R., Weinrich, S.L., Hirsch, K.S., West, M.D.,
Bacchetti, S., Hirte, H.W., Counter, C.M., Greider, C.W., et al. (1994).
Telomerase, cell immortality, and cancer. Cold Spring Harb. Symp. Quant.
Biol. 59, 307–315.
SUPPLEMENTAL INFORMATION
Hiyama, E., and Hiyama, K. (2007). Telomere and telomerase in stem cells. Br.
Supplemental Information can be found online at https://doi.org/10.1016/j.
chembiol.2019.04.009.
J. Cancer 96, 1020–1024.
Horn, S., Figl, A., Rachakonda, P.S., Fischer, C., Sucker, A., Gast, A., Kadel,
S., Moll, I., Nagore, E., Hemminki, K., et al. (2013). TERT promoter mutations
in familial and sporadic melanoma. Science 339, 959–961.
ACKNOWLEDGMENTS
The UACC Shared Resources provided support for histological and tissue
staining, flow-cytometry analysis, and analytical chemistry. This study was
supported by the University of Arizona Cancer Center support grant NIH
P30CA023074, NIH award R01CA173200, and DOD award W81XWH-12-1-
0560 (to A.S.K.), and by NIH awards R01CA177585 and R41CA224497, and
Reglagene (to L.H.H.).
Hu, J., Hwang, S.S., Liesa, M., Gan, B., Sahin, E., Jaskelioff, M., Ding, Z., Ying,
H., Boutin, A.T., Zhang, H., et al. (2012). Antitelomerase therapy provokes ALT
and mitochondrial adaptive mechanisms in cancer. Cell 148, 651–663.
Huang, P., Watanabe, M., Kaku, H., Kashiwakura, Y., Chen, J., Saika, T., Nasu,
Y., Fujiwara, T., Urata, Y., and Kumon, H. (2008). Direct and distant antitumor
effects of a telomerase-selective oncolytic adenoviral agent, OBP-301, in a
mouse prostate cancer model. Cancer Gene Ther. 15, 315–322.
AUTHOR CONTRIBUTIONS
Indran, I.R., Hande, M.P., and Pervaiz, S. (2011). hTERT overexpression alle-
viates intracellular ROS production, improves mitochondrial function, and in-
hibits ROS-mediated apoptosis in cancer cells. Cancer Res. 71, 266–276.
Conceptualization, J.H.S., L.H.H., and A.S.K.; Methodology, Analysis, and
Investigation, J.H.S., L.A.L., H.-J.K., V.G., R.P., K.W., and H.-H.S.C.; Writing,
J.H.S., L.H.H., and A.S.K.
Jiang, H.X., Cui, Y., Zhao, T., Fu, H.W., Koirala, D., Punnoose, J.A., Kong,
D.M., and Mao, H. (2015). Divalent cations and molecular crowding buffers
stabilize G-triplex at physiologically relevant temperatures. Sci. Rep. 5, 9255.
DECLARATION OF INTERESTS
Kang, H.J., Cui, Y., Yin, H., Scheid, A., Hendricks, W.P., Schmidt, J., Sekulic,
A., Kong, D., Trent, J.M., Gokhale, V., et al. (2016). A pharmacological chap-
erone molecule induces cancer cell death by restoring tertiary DNA structures
in mutant hTERT promoters. J. Am. Chem. Soc. 138, 13673–13692.
V.G., H.-J.K., and L.H.H. are a shareholder, an employee, and CSO, respec-
tively, of Reglagene, LLC.
Received: June 29, 2018
Revised: January 28, 2019
Accepted: April 16, 2019
Published: May 30, 2019
Killela, P.J., Reitman, Z.J., Jiao, Y., Bettegowda, C., Agrawal, N., Diaz, L.A.,
Jr., Friedman, A.H., Friedman, H., Gallia, G.L., Giovanella, B.C., et al. (2013).
TERT promoter mutations occur frequently in gliomas and a subset of tumors
Cell Chemical Biology 26, 1–12, August 15, 2019 11

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
derived from cells with low rates of self-renewal. Proc. Natl. Acad. Sci. U S A
Song, J.H., An, N., Chatterjee, S., Kistner-Griffin, E., Mahajan, S., Mehrotra, S.,
and Kraft, A.S. (2015). Deletion of Pim kinases elevates the cellular levels of
reactive oxygen species and sensitizes to K-Ras-induced cell killing.
Oncogene 34, 3728–3736.
110, 6021–6026.
Kim, N.W., Piatyszek, M.A., Prowse, K.R., Harley, C.B., West, M.D., Ho, P.L.,
Coviello, G.M., Wright, W.E., Weinrich, S.L., and Shay, J.W. (1994). Specific
association of human telomerase activity with immortal cells and cancer.
Science 266, 2011–2015.
Song, J.H., and Kraft, A.S. (2012). Pim kinase inhibitors sensitize prostate can-
cer cells to apoptosis triggered by Bcl-2 family inhibitor ABT-737. Cancer Res.
72, 294–303.
Kleideiter, E., Piotrowska, K., and Klotz, U. (2007). Screening of telomerase in-
hibitors. Methods Mol. Biol. 405, 167–180.
Song, J.H., Padi, S.K., Luevano, L.A., Minden, M.D., DeAngelo, D.J.,
Hardiman, G., Ball, L.E., Warfel, N.A., and Kraft, A.S. (2016). Insulin receptor
Lai, C.K., Mitchell, J.R., and Collins, K. (2001). RNA binding domain of telome-
rase reverse transcriptase. Mol. Cell. Biol. 21, 990–1000.
substrate
1 is a substrate of the Pim protein kinases. Oncotarget 7,
Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S.M., Ahmad, M., Alnemri, E.S.,
and Wang, X. (1997). Cytochrome c and dATP-dependent formation of Apaf-1/
caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479–489.
20152–20165.
Song, J.H., Song, D.K., Pyrzynska, B., Petruk, K.C., Van Meir, E.G., and Hao,
C. (2003). TRAIL triggers apoptosis in human malignant glioma cells through
extrinsic and intrinsic pathways. Brain Pathol. 13, 539–553.
Lingner, J., Hughes, T.R., Shevchenko, A., Mann, M., Lundblad, V., and Cech,
T.R. (1997). Reverse transcriptase motifs in the catalytic subunit of telomerase.
Science 276, 561–567.
Sun, H., Wang, Y., Chinnam, M., Zhang, X., Hayward, S.W., Foster, B.A.,
Nikitin, A.Y., Wills, M., and Goodrich, D.W. (2011). E2f binding-deficient Rb1
protein suppresses prostate tumor progression in vivo. Proc. Natl. Acad.
Sci. U S A 108, 704–709.
Mancini, A., Xavier-Magalhaes, A., Woods, W.S., Nguyen, K.T., Amen, A.M.,
Hayes, J.L., Fellmann, C., Gapinske, M., McKinney, A.M., Hong, C., et al.
(2018). Disruption of the beta1L isoform of GABP reverses glioblastoma repli-
cative immortality in a TERT promoter mutation-dependent manner. Cancer
Cell 34, 513–528.e8.
Valle, I., Alvarez-Barrientos, A., Arza, E., Lamas, S., and Monsalve, M. (2005).
PGC-1alpha regulates the mitochondrial antioxidant defense system in
vascular endothelial cells. Cardiovasc. Res. 66, 562–573.
Nugent, C.I., and Lundblad, V. (1998). The telomerase reverse transcriptase:
components and regulation. Genes Dev. 12, 1073–1085.
Vidal, S.J., Rodriguez-Bravo, V., Quinn, S.A., Rodriguez-Barrueco, R.,
Lujambio, A., Williams, E., Sun, X., de la Iglesia-Vicente, J., Lee, A.,
Readhead, B., et al. (2015). A targetable GATA2-IGF2 axis confers aggressive-
ness in lethal prostate cancer. Cancer Cell 27, 223–239.
Oliver, D., Ji, H., Liu, P., Gasparian, A., Gardiner, E., Lee, S., Zenteno, A.,
Perinskaya, L.O., Chen, M., Buckhaults, P., et al. (2017). Identification of novel
cancer therapeutic targets using a designed and pooled shRNA library screen.
Sci. Rep. 7, 43023.
Wellinger, R.J., Ethier, K., Labrecque, P., and Zakian, V.A. (1996). Evidence for
Palumbo, S.L., Ebbinghaus, S.W., and Hurley, L.H. (2009). Formation of a
unique end-to-end stacked pair of G-quadruplexes in the hTERT core pro-
moter with implications for inhibition of telomerase by G-quadruplex-interac-
tive ligands. J. Am. Chem. Soc. 131, 10878–10891.
a new step in telomere maintenance. Cell 85, 423–433.
Yan, P., Saraga, E.P., Bouzourene, H., Bosman, F.T., and Benhattar, J. (2001).
Expression of telomerase genes correlates with telomerase activity in human
colorectal carcinogenesis. J. Pathol. 193, 21–26.
Pettaway, C.A., Pathak, S., Greene, G., Ramirez, E., Wilson, M.R., Killion, J.J.,
and Fidler, I.J. (1996). Selection of highly metastatic variants of different human
prostatic carcinomas using orthotopic implantation in nude mice. Clin. Cancer
Res. 2, 1627–1636.
Yu, Z., Gaerig, V., Cui, Y., Kang, H., Gokhale, V., Zhao, Y., Hurley, L.H., and
Mao, H. (2012). Tertiary DNA structure in the single-stranded hTERT promoter
fragment unfolds and refolds by parallel pathways via cooperative or sequen-
tial events. J. Am. Chem. Soc. 134, 5157–5164.
Sahin, E., Colla, S., Liesa, M., Moslehi, J., Muller, F.L., Guo, M., Cooper, M.,
Kotton, D., Fabian, A.J., Walkey, C., et al. (2011). Telomere dysfunction in-
duces metabolic and mitochondrial compromise. Nature 470, 359–365.
Zhang, L., Tan, W., Zhou, J., Xu, M., and Yuan, G. (2017a). Investigation of G-
quadruplex formation in the FGFR2 promoter region and its transcriptional
regulation by liensinine. Biochim. Biophys. Acta 1861, 884–891.
Shen, Y., Zhang, Y.W., Zhang, Z.X., Miao, Z.H., and Ding, J. (2008). hTERT-tar-
geted RNA interference inhibits tumorigenicity and motility of HCT116 cells.
Cancer Biol. Ther. 7, 228–236.
Zhang, Z., Yu, L., Dai, G., Xia, K., Liu, G., Song, Q., Tao, C., Gao, T., and Guo,
W. (2017b). Telomerase reverse transcriptase promotes chemoresistance by
suppressing cisplatin-dependent apoptosis in osteosarcoma cells. Sci. Rep.
7, 7070.
Singhapol, C., Pal, D., Czapiewski, R., Porika, M., Nelson, G., and Saretzki,
G.C. (2013). Mitochondrial telomerase protects cancer cells from nuclear
DNA damage and apoptosis. PLoS One 8, e52989.
12 Cell Chemical Biology 26, 1–12, August 15, 2019

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE
Antibodies
SOURCE
IDENTIFIER
See Table S1.
Chemicals, Peptides, and Recombinant Proteins
MitoSox Red
Invitrogen
Invitrogen
Sigma-Aldrich
NCI
Cat# M36008
Cat# C6827
Cat# M5655
CM-H2DCF-DA
Thiazolyl blue tetrazolium bromide
RG260 (NSC654260)
https://wiki.nci.nih.gov/display/NCIDTPdata/
Compound+Sets
RG1534
This paper
This paper
This paper
This paper
N/A
N/A
N/A
N/A
RG1603
RG1601
RG1533
Experimental Models: Cell Lines
Human Prostate cancer PC-3
Human Prostate cancer DU145
Human Prostate cancer LNCaP
Human Prostate cancer PC3-LN4
ATCC
ATCC
ATCC
Cat# ATCC CRL-1435
Cat# ATCC HTB81
Cat# ATCC CRL-1740
N/A
The University of Texas
M. D. Anderson Cancer
Center (Pettaway et al., 1996)
Human prostate epithelial RWPE1
Human breast cancer MCF7
HEK293T
ATCC
Cat# ATCC-CRL-11609
Cat# ATCC-HTB-22
Cat# HCL4517
N/A
ATCC
Dharmacon
Mouse prostate epithelial cancer cells
Experimental Models: Organisms/Strains
Tx-R LNCaP cells
Roswell Park Cancer Center
This paper
N/A
N/A
hTERT luciferase expressing MCF7 cells
Oligonucleotides
(Kang et al., 2016)
Oligonucleotides used in DMS footprinting and FRET (see Table S2)
Primers for real time PCR (see Table S3)
ON-TARGETplus Human TERT (7015) siRNA
ON-TARGETplus Non-targeting Pool siRNA
Recombinant DNA
Dharmacon
Dharmacon
Cat# L-003547-00-0005
Cat# D-001810-10-05
pLKO human shRNA NFE2L2
TRC Lentiviral Non-targeting shRNA Control
VSV-G
Dharmacon
Dharmacon
Addgene
Cat# RHS3979-201739828
Cat. #RHS6848
Cat# 8454
psPAX2
Addgene
Cat# 12260
Software and Algorithms
Microsoft Office 365 Excel
GraphPad Prism
Microsoft
https://www.office.com/
GraphPad Software
https://www.graphpad.com/scientific-
software/prism/
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Jin H
Song (jinsong@email.arizona.edu).
Cell Chemical Biology 26, 1–12.e1–e4, August 15, 2019 e1

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Cell Lines
The human prostate cancer cell lines LNCaP, PC-3, DU145 (ATCC), and PC-3LN4 were cultured as previously described (Pettaway
et al., 1996; Song and Kraft, 2012; Song et al., 2016). RWPE1 cells (ATCC) were maintained in keratinocyte medium supplemented
with 5 ng/mL human recombinant epidermal growth factor and 0.05 mg/mL bovine pituitary extract (Invitrogen). Mouse prostate
epithelial cells were grown in DMEM medium supplemented with 2.5% charcoal stripped FCS, 5 mg/mL of insulin/transferring/sele-
nium, 10 mg/mL of bovine pituitary extract, 10 mg/mL of epidermal growth factor, 1 mg/mL of cholera toxin as described previously
(Sun et al., 2011). HEK293T cells were cultured in 10% FBS-containing DMEM. MCF7 cells were cultured in RPMI-1640 with 10%
FBS and 1% penicillin/streptomycin. All cell lines were maintained at 37ꢁC in 5 % CO2 and were authenticated by short tandem
repeat DNA profiling performed by the University of Arizona Genetics Core Facility. The cell lines were routinely tested for myco-
plasma and used for fewer than 50 passages.
Animal Studies
All in vivo studies were approved by and conducted in accordance with the guidelines of the Institutional Animal Care and Use Com-
mittees at the University of Arizona Cancer Center. Male SCID immune-deficient mice (C.B-Igh-1b/IcrTac-Prkdcscid) were purchased
from Taconic Laboratories and maintained by the Experimental Mouse Shared Resource in an ABSL-2 immunodeficient animal hous-
ing facility at University of Arizona. Mice of 8 weeks old were randomly assigned to treatment groups. For the pharmacokinetics
study, male FVB/NJ mice were purchased from The Jackson Laboratory (stock number #001800).
METHOD DETAILS
FRET Assay
FRET assay for compound screening and FRET probe of the 5ꢂ12 G4 were reported previously (Kang et al., 2016). For the FRET
assay in this study, FRET probes with FAM (Ex. 490 nm/Em. 520 nm) and TAMRA (Ex. 560 nm/Em. 580 nm) at each end were
synthesized and HPLC purified by MGW Operon Inc (sequences are provided in Table S2).
The FRET probes (100 nM) were annealed in a buffer containing 10 mM Na-cacodylate (pH 7.5) and 100 mM CaCl2 with DMSO or
compounds by heating at 95ꢁC for 30 s and then cooled down for 1–2 min at room temperature. The fluorescence intensity at 528 nm
with excitation at 485 nm was measured by a microplate reader (BioTek Synergy HT). The data were corrected with the blank signal of
buffer and compound, and the relative fluorescence intensity compared to DMSO was obtained.
DMS Footprinting
FAM-labeled oligomers with full-length and 18-nt were synthesized by MGW Operon Inc. and PAGE purified. Sequences are provided
in Table S2. These oligomers (250 nM) and 5 mM/L of compounds were dissolved in a buffer containing 10 mM Na-cacodylate (pH 7.5),
and 5 mM KCl or 100 mM CaCl2. The mixtures were annealed by heating at 95ꢁC for 30 s and then cooled down for 1–2 min at room
temperature. For the DMS reaction, annealed samples were incubated with 2 mg of salmon sperm DNA (Sigma, D1626) and 5% DMS in
50% ethanol for 8 min for full-length and 5 min for 18-nt, respectively, at room temperature. The reaction was stopped by 10% of b-mer-
captoethanol and then subjected to ethanol precipitation and cleavage by 10% piperidine with incubation at 93ꢁC for 12 min. Cleaved
product was washed twice by water and then separated by 15% denaturing PAGE with 7 M urea. Fluorescent bands were scanned by
Bio-Rad PharosFXꢀ Plus.
Luciferase Assay
The pGL3 luciferase constructs used in a previous publication (Kang et al., 2016) were used for this study. MCF7 cells in a 24-well
plate were incubated with serum-free RPMI-1640 and then transfected with 200 ng of pGL3 construct and 5 ng of pRL-TK by
FuGENEꢁ HD or Lipofectamine 3000 and then incubated for 6 h. After replacing media by RPMI-1640 with 10% FBS, cells were
treated with 0.1% DMSO or indicated concentrations of compounds. After 18 h of incubation, cells were lysed by passive lysis buffer
and subjected to dual-luciferase assay (Promega, #E1910) using an FB12 luminometer or GloMaxꢁ 20/20 Luminometer (Promega).
Relative ratio of firefly to renilla luciferase activity compared to the DMSO was obtained. Each experiment was performed in
quadruplicate.
Circular Dichroism (CD) Analysis
The WT 5–12 G4-forming oligomer was synthesized and HPSF-purified by MWG Operon, Inc. The concentration of oligomers dis-
solved in deionized water was determined by the Lambert–Beer law using molecular extinction coefficient, 463,850 L (mol*cm).
For CD analysis, the oligomers (5 mM) in a buffer containing 10 mM Tris-HCl (pH 6.8 or pH 7.5) with 5 mM KCl were heated at
95ꢁC for 5 min and then cooled at room temperature. After 1–2 h of incubation of annealed oligomers with DMSO or RG260, samples
were subjected to CD spectra and melting analysis using a Jasco 810 spectropolarimeter with parameters of 2 nm band width and a
rate of 1.6ꢁC/min. The spectra of oligomers were corrected by subtraction of the spectra of buffer with DMSO or RG260. Tm was
determined by sigmoidal curve fitting of a melting curve using GraphPad Prism software.
e2 Cell Chemical Biology 26, 1–12.e1–e4, August 15, 2019

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
Gene Transduction
Cells were transfected with SMARTpool: ON-TARGETplus TERT siRNA (Dharmacon) using lipofectamine 3000 (Thermo Fisher Sci-
entific) as previously described (Song et al., 2015, 2016). To knock down expression of NRF2, short hairpin RNAs against human
NRF2 (TRC gene set 7555) and TRC lentiviral non-targeting shRNA control were purchased from Dharmacon. Lentiviruses were pro-
duced in 293T cells coexpressing the packaging vectors (pPAX2 and VSVG), concentrated by ultracentrifugation (20,000 g for 2 h at
4ꢁC), and resuspended with culture media for 48 h infection.
Cell Proliferation and Apoptosis Assays
Cells were seeded in 96-well plates and treated with drugs as indicated. At the end of treatment, the medium was removed gently and
the cells were washed once with 200 ml of PBS, then 100 ml of medium containing MTT assay solution (1 mg/mL thiazolyl blue tetra-
zolium bromide, Sigma Cat# M5655) was added to each well. The plates were placed in a water-jacketed incubator at 37ꢁC for 2 h
and then MTT containing medium was removed. The color development was monitored by addition of 100 ml of DMSO to each well
prior to absorbance reading at 490 nm using the microplate reader (Spectra Max 190, Molecular Devices). Each drug treatment was
performed in quadruplicate and verified in three independent experiments. Apoptotic cells were quantitated by flow cytometry using
PE Annexin V Apoptosis Detection kit 1 (BD Pharmingen, Catalog # 559763).
Immunoblotting
Cells were lysed in RIPA buffer (50 mmol/L Tris-HCl pH 7.4, 150 mmol/L NaCl, 0.5 % sodium deoxycholate, 0.1 % SDS, 1% NP-40,
5 mmol/L EDTA) supplemented with complete protease/phosphatase inhibitor cocktail (Cell Signaling Cat# 5872S). After centrifuga-
tion (15,000 g for 15 min at 4ꢁC), aliquots of total lystates were subjected to SDS-PAGE as described previously (Song et al., 2015).
The antibodies were listed in Table S1.
Immunofluorescence and Immunohistochemistry
Staining with MitoSox Red and H2DCF-DA followed by flow cytometry was as previously described (Song et al., 2015). Phase
contrast and fluorescence images were taken with EVOS FL Auto (Bio-Rad). Immunohistochemical staining of tumors tissues
were performed with anti-8-ox-dG (Trevigen, Cat # 4354-MC-050), cleaved caapse-3 (Cell Signaling, Cat # 9661) and Ki67 (Leica,
Cat # NCL-L-Ki67-MM1) antibodies. Hematoxylin 560 MX (Leica Biosystems, Cat # 3801575) and Eosin Phloxine 515 (Leica Bio-
systems, Cat# 3801606) were used for H&E staining.
Measurements of Telomere Length and Telomerase Enzyme Activity
To measure telomere length in cells, genomic DNA (gDNA) was extracted with DNA extraction kit (Qiagen). A pair of Tel1
(GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT) and Tel2 (TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA)
primers was used for amplification of the telomere region and a pair of 36B4F (CAGCAAGTGGGAAGGTGTAATCC) and 36B4R
(CCCATTCTATCATCAACGGGTACAA) primers for amplification of a single-copy gene to normalize data. The PCR was initiated at
95ꢁC for 3 min and then 27 cycles at 95ꢁC for 3 s and 60ꢁC for 2 min. The fluorescence signal at 60ꢁC was acquired. Triplicate
data were averaged and normalized to 36B4 to obtain DCt. The relative telomere length was determined compared to the DMSO.
Telomerase enzyme activity was assessed by TRAP assay as previously reported (Kang et al., 2016).
Real-Time PCR Analysis
Total RNA was extracted from cells by using Qiagen QIAshredder and RNeasy Mini kit. Equal amounts of total RNA (1 mg RNA)
was subjected to first-strand cDNA synthesis using iScript cDNA synthesis kit according to the manufacturer’s protocol. Real-
time PCR reactions with Bio-Rad SsoAdvanced Universal SYBR Green Supermix were performed using a Bio-Rad CFX96 Touch
System. Samples were assayed in triplicate and the data were normalized to 18S mRNA levels. The primer sets for TERT, NRF2,
HK2, MYC, COX2, and b-ACTIN genes were purchased from Sigma-Aldrich to measure gene expression (see Table S3 for primer
sequences).
Synthesis of RG260 Analogs
RG260 is a benzoylphenyl urea derivative in which two aromatic rings are connected by the urea functionality. RG1534, RG1601, and
RG1603 are structural analogs of RG260 (Scheme S1). Oxalyl chloride (0.5 g) was added to 2-nitrobenzamide (0.2 g) in toluene at 0ꢁC.
The solution was warmed to room temperature, then refluxed with stirring for 24 h. The solvent was evaporated and product 2-nitro-
benzoyl isocyanate was used directly without further purification for the next reaction. A solution of 2,5-dichloropyrimidine (382 mg),
4-amino-2-methylphenol (319 mg), and K2CO3 (718 mg) in dry DMSO (20 mL) was stirred at 120ꢁC for 2.5 h. After cooling to room
temperature, the reaction mixture was poured into water and extracted with ethyl acetate. The organic layer was washed with
water, saturated brine and then dried. The organic solvent was evaporated to give a residue that was purified using silica gel column
chromatography (ethyl acetate-hexane 1:3) to give product 190 mg of 4-((5-chloropyrimidin-2-yl)oxy)-3-methylaniline. 1H NMR (400
MHz, Chloroform-d) d 8.46 (s, 2H), 6.87 (d, J = 8.4 Hz, 1H), 6.60 – 6.49 (m, 2H), 3.66 (s, 1H), 2.08 (s, 3H). A solution of 2-nitrobenzoyl
isocyanate (115 mg) in 15 mL dry dioxane was added dropwise to a solution of 4-((5-chloropyrimidin-2-yl)oxy)-3-methylaniline
(141 mg) in dry 1,4-dioxane with stirring at room temperature. The reaction mixture was stirred for 18 h and then diluted with water.
The precipitated solid was collected by filtration and washed with water. The solid was dissolved in ethyl acetate, and the organic
Cell Chemical Biology 26, 1–12.e1–e4, August 15, 2019 e3

Please cite this article in press as: Song et al., Small-Molecule-Targeting Hairpin Loop of hTERT Promoter G-Quadruplex Induces Cancer Cell Death,
Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.04.009
layer was washed with (3 3 30 mL) water, dried and concentrated to give 180 mg of N-((4-((5-chloropyrimidin-2-yl)oxy)-3-methyl-
phenyl)carbamoyl)-2-nitrobenzamide. 1H NMR (400 MHz, DMSO-d6) d 11.29 (s, 1H), 10.22 (s, 1H), 8.80 (s, 2H), 8.22 (ddd, J = 8.1,
1.2, 0.6 Hz, 1H), 7.94 – 7.88 (m, 1H), 7.83 – 7.76 (m, 2H), 7.47 (d, J = 19.8 Hz, 2H), 7.13 (d, J = 8.6 Hz, 1H), 2.08 (s, 3H). Iron powder
(160 mg) was added in portions to a mixture of N-((4-((5-chloropyrimidin-2-yl)oxy)-3-methylphenyl)carbamoyl)-2-nitrobenzamide
(256 mg) and ammonium chloride (335 mg) in ethanol at 80ꢁC. The reaction mixture was refluxed for 30 min and then cooled to
room temperature and diluted with water. The precipitated solid was collected by filtration. The solid was dissolved in excess ethyl
acetate and filtered. The filtrate was dried and concentrated to give a residue that was purified by column chromatography (ethyl
acetate: hexane 2:3) to give 110 mg compound RG1534, 2-amino-N-((4-((5-chloropyrimidin-2-yl)oxy)-3-methylphenyl)carbamoyl)
benzamide. Nuclear magnetic resonance (NMR) data: 1H NMR (400 MHz, DMSO-d6) d 10.77 (s, 1H), 10.57 (s, 1H), 8.75 (s, 2H),
7.72 (dd, J = 8.1, 1.5 Hz, 1H), 7.53 – 7.45 (m, 2H), 7.26 (dt, J = 8.4, 1.5 Hz, 1H), 7.16 – 7.08 (m, 1H), 6.79 (dd, J = 8.4, 1.2 Hz, 1H),
6.66 – 6.50 (m, 3H), 2.09 (s, 3H). 13C NMR (101 MHz, DMSO) d 170.98, 163.48, 158.71, 151.80, 151.34, 147.42, 135.72, 134.18,
130.93, 129.84, 125.16, 122.87, 122.74, 119.21, 117.25, 115.17, 112.24, 16.43. High-Performance Liquid Chromatography
(HPLC) Purity = 97.246 % (retention time: 1.790 min). Column: Zorbax SB C18, 4.6 x150 mm, 3.5 u, Mobile phase: 35/65/0.25, Aceto-
nitrile: water: Acetic acid, Flow rate: 0.5 mL/min.
High Resolution Mass Spectra (HRMS): Found = 398.1014 (MH+) (Theoretically = 398.1020).
In Vivo Studies
To investigate the pharmacokinetics of RG1603 after a single oral dose of 25 mg/kg given by intraperitoneally (for RG1534, 10 and
50 mg/kg i.p.), at each time point the plasma concentrations were measured in three FVB mice using triplicate determinations. Blood
samples were collected from the mice via the cheek pouch or retro-orbital bleeding. Total plasma concentrations of RG1603 were
determined by high performance liquid chromatography/tandem mass spectrometry method. RG1603 was extracted from plasma
by protein precipitation with acetonitrile. After centrifugation, the supernatant was injected onto the HPLC-MS system for analysis.
HPLC separation was achieved using a C-18 column and a gradient mobile phase of 10 mM ammonium acetate and acetonitrile.
Detection was performed on a TSQ Quantum Ultra Triple Quadrupole system operating in negative polarity utilizing atmospheric
pressure chemical ionization. The instrument is operated in multiple reaction monitoring mode, monitoring the fragment mass of
117.01 from the parent mass of 395.9 at a collision energy of 44eV with argon as the collision gas. For xenograft studies, DU145 cells
(5 3 106) were implanted with Matrigel subcutaneously into the left flank of mice (male SCID, 8 weeks). When the tumor size reached
ꢀ150 to 200 mm3, mice were randomly assigned and treated every other day with vehicle (0.5% hydroxypropyl methylcellulose),
RG1603 by intraperitoneal injection. Tumor volume was measured twice per week with calipers and calculated as tumor volume =
(length 3 width2) 3 0.5. The unpaired Student t test was used to evaluate the significance of differences observed between groups,
accepting P < 0.05 as a threshold of significance. All animal studies were approved by the Institutional Animal Care and Use
Committee at the University of Arizona.
QUANTIFICATION AND STATISTICAL ANALYSIS
Each drug treatment was performed in quadruplicate and verified in three independent experiments unless stated otherwise. Graphs
were generated using Microsoft Excel and GraphPad Prism. The unpaired Student t test was used to evaluate the significance of
differences observed between groups, accepting P < 0.05 as a threshold of significance. Data analyses were performed using the
Prism software (GraphPad).
DATA AND SOFTWARE AVAILABILITY
The software used in this study is listed in the Key Resources Table. Additional experimental data are provided as Supplemental In-
formation and are available from the corresponding author upon request.
e4 Cell Chemical Biology 26, 1–12.e1–e4, August 15, 2019