Detection of methylcytosine by DNA photoligation via hydrophobic interaction of the alkyl group

Article abstract of DOI:10.1039/b904941j

We report the nonenzymatic detection of 5-methylcytosine by using template-directed photoligation through 5-vinyl-2′-deoxyuridine derivatives with high selectivity. In this paper, we propose a new detection method by using hydrophobic interaction. The photoligation yield of the 5-methylcytosine case was approximately 5.6-fold higher than that in the case of cytosine.

Full text of DOI:10.1039/b904941j

View Article Online / Journal Homepage / Table of Contents for this issue
PAPER
www.rsc.org/obc | Organic & Biomolecular Chemistry
Detection of methylcytosine by DNA photoligation via hydrophobic
interaction of the alkyl group†
Masayuki Ogino, Yuuta Taya and Kenzo Fujimoto*
Received 11th March 2009, Accepted 6th May 2009
First published as an Advance Article on the web 11th June 2009
DOI: 10.1039/b904941j
We report the nonenzymatic detection of 5-methylcytosine by using template-directed photoligation
through 5-vinyl-2¢-deoxyuridine derivatives with high selectivity. In this paper, we propose a new
detection method by using hydrophobic interaction. The photoligation yield of the 5-methylcytosine
case was approximately 5.6-fold higher than that in the case of cytosine.
Introduction
At the chemical level, gene silencing requires the selective methy-
lation of the 5-position of cytidines in DNA, and this established
method is known as the epigenetic control of gene function. For
example, 5-methylcytosine (mC) appears to be involved in various
biologically important processes occurring at the cellular level,
and plays a role in the regulation of gene expression, genomic
imprinting, cell differentiation and tumorigenesis.1 Technological
Fig. 1 Strategy for 5-methylcytosine detecting method by photoligation
via hydrophobic interaction of each vinyluridine derivative.
advancement in DNA methylation analysis is an important and
ongoing endeavor of epigenetic research. However, the epigenetic
information in methylated DNA is lost upon PCR or subcloning
as consecutive replication rounds result in the methylation pattern
of the host strain.2,3 Therefore, various methods have been
developed for detecting mC based on chemical and enzymatic
concepts.4–13 Each method has advantages and disadvantages,
most of which become evident by examining their specificity,
resolution, sensitivity and potential artifacts. One such method
is the reversible DNA photoligation method. The DNA template-
directed reversible photoligation proceeds via [2 + 2] cycloaddition
between the double bond of the 5-carboxyvinyl-2¢-deoxyuridine
side chain and the C5-C6 double bond of pyrimidine.14 We recently
reported a method for selective detection of 5-methylcytosine via
DNA photoligation using 5-cyanovinyl-2¢-deoxyuridine (CU).14
Significantly, 5-methylcytosine in the target sequence yielded
ligated product, with a measured ratio of ligation yield that was
9.8-fold higher than the cytosine case. Although the photochem-
ical ligation approach includes many advantages such as not
needing additional reagents, there were disadvantages to using
side-reactions for detecting methylcytosine such as photo-
crosslinking, which is the connection of photosensitive DNA to
the template DNA. Here we report a detection method of mC by
using DNA photoligation via other photosensitive nucleosides.
As shown in Fig. 1, our strategy is based on the hydrophobic
interaction between the methyl group at the C5 position of the
cytosine and the alkyl residue of the vinyluridine derivatives. We
consider that the ligation yield was increased by stacking the
vinyl group and the C5-C6 double bond to be promoted in the
presence of a methyl group. Cytosine is expected to produce a
low ligation yield as compared to methylcytosine because of low
hydrophobicity in the absence of a methyl group. We propose that
our method can reuse photosensitive DNA and methylated DNA
samples because the photoligation reactions are reversible.
Firstly, we synthesized 5-vinyl-2¢-deoxyuridine (VU) and three
kinds of VU derivatives as photosensitive nucleosides. Each of the
VU derivatives contains hydrophobic residue, pentyl, cyclohexyl
and tert-butyl (Fig. 2).
Fig. 2 Structure of 5-vinyl uracil (1a), 5-heptenyl uracil (1b), 5-cyclohexyl
vinyl uracil (1c) and 5-t-butyl vinyl uracil (1d).
Results and discussion
School of Materials Science, Japan Advanced Institute of Science and Tech-
nology, Ishikawa, 923-1292, Japan. E-mail: kenzo@jaist.ac.jp; Fax: +81
761 51 1671; Tel: +81 761 51 1671
† Electronic supplementary information (ESI) available: Experimental
details. See http://dx.doi.org/10.1039/b904941j/
The synthesis of the photosensitive nucleosides and the cor-
responding phosphoramidite building block of VU, 5-heptenyl-
2¢-deoxyuridine (HU), 5-cyclohexyl vinyl-2¢-deoxyuridine (HVU)
This journal is
The Royal Society of Chemistry 2009
Org. Biomol. Chem., 2009, 7, 3163–3167 | 3163
©

View Article Online
Table 1 ODN sequences used in this study
Sequence (5¢-3¢)ab
To demonstrate that template-directed photoligation by us-
ing each photosensitive ODN (Table 1) could be incorporated
into platforms suitable for DNA chip technologies, we con-
structed a DNA chip by attaching amino-labeled ODN con-
taining 5-vinyl-2¢-deoxyuridine derivative, onto the aldehyde-
modified glass surface (Scheme 2). We determined the feasibility
ODN(VU)
ODN(HU)
ODN(HVU)
ODN(BuVU)
ODN(C)
VUGACGTGTATCGCATTGGSSSSNH2
HUGACGTGTATCGCATTGGSSSSNH2
HVUGACGTGTATCGCATTGGSSSSNH2
BuVUGACGTGTATCGCATTGGSSSSNH2
GCCCCAGCTGCTCACCATCGCTATCTGAG
CAGCGCTCATGGTGGGGGCAGCGCCTCA
CAACCTCCGTCATGTGCTGTGACTGCTTG
TAGATGGCCATGGC
ODN(mC)
GCCCCAGCTGCTCACCATCGCTATCTGAG
CAGCGCTCATGGTGGGGGCAGmCGCCTCA
CAACCTCCGTCATGTGCTGTGACTGCTTG
TAGATGGCCATGGC
template ODN
ODN(Cy3)
CGATACACGTCAGCTGCCCCCACCA
Cy3-CGCTGCTCAGATAGC
a Bold characters indicate the methylation status. b S corresponds to a
hexa(ethylene glycol) linker fragment.
and 5-t-butylvinyl-2¢-deoxyuridine (BuVU) as well as the syn-
thesis of corresponding oligodeoxynucleotide followed standard
routes in DNA-chemistry.15 VU was synthesized from 5-iodo-2¢-
deoxyuridine; the scheme has been reported previously.14a The
synthesis of three kinds of VU derivatives is shown below. 5-Iodo-
2¢-deoxyuridine was converted to 2a-d by the Heck reaction
using various alkenes. 2a-d was dimethoxytritylated and trans-
ferred to the corresponding cyanoethyl phosphoramidite using
a conventional method (Scheme 1). The modified ODN was
synthesized on an ABI 3400 DNA synthesizer. Incorporation of
VU derivatives ODNs into the ODN was confirmed by enzymatic
digestion and matrix-assisted laser desorption ionization-time-of-
flight mass spectrometry (see ESI†). The ODNs used in this study
are summarized in Table 1.
Scheme 2 Conceptual scheme showing how the target is detected by
photoligation.
Scheme 1 The route for the synthesis of photosensitive nucleosides containing hydrophobic residue.
3164 | Org. Biomol. Chem., 2009, 7, 3163–3167 This journal is The Royal Society of Chemistry 2009
©

View Article Online
Table 2
of the template-directed photoligation through photosensitive
ODN on a DNA chip. We prepared 60 mer DNA strands, 5¢-
d(. . .GGGGGCAGXGCCTCACAACC. . .)-3¢, which contained
a methylation hotspot (X = mC or C) at codon 175 in exon 5 of
the p53 gene.16 A glass chip spotted with 2 mM target ODN(C)
or ODN(mC) and template ODN, was irradiated at 366 nm for
60 min in 50 mM sodium cacodylate buffer (pH 7.0) and 100 mM
sodium chlo◦ride. After the chip had been washed with deionized
water at 98 C for 5 min, Cy3-containing ODN(Cy3) conjugate
was added to the surface, and the chip was washed twice in PBS.
Fluorescence signals were detected on a microarray scanner. As
shown in Fig. 3A, we measured the strong fluorescence signal of
the photoligated product with the mC case by using ODN(HU).
The results show that a mC-containing ODN(mC) yielded a highly
photoligated product, with a measured fluorescence signal that
was 5.6-fold higher than the C-containing ODN(C) case (Fig. 3B).
b,c
mC /Ca
DTm
VU
2.2
5.6
3.3
1.7
-1.1 ◦
3.4 ◦
C
C
C
C
HU
HVU
BuVU
1.8 ◦
-1.4 ◦
a Values of the ratio of the methylcytosine case to the cytosine case
to be calculated from fluorescent intensity. b DTm values are defined by
deducting the Tm value of the cytosine case from the methylcytosine case.
c Conditions: 100 mM NaCl, 50 mM Na cacodylate buffer (pH 7.0), 1.0 mM
each strand.
nucleosides such as HU is able to detect the methyl group at the C5
position of the cytosine. We previously reported methylcytosine
detection using 5-cyanovinyl-2¢-deoxyuridine, which depended on
the hydrophobicity and planarity of the cyanovinyl group.17 We
considered that the direction of the photoreaction was changed
by the micro-environment such as the hydrophobic interaction
and intercalation in the DNA strands by the presence/absence of
the methyl group at cytosine C5. However, no side reaction was
observed by using HU in this report. Therefore, we speculated that
the difference in reactivity was caused by the heptenyl group of
HU being bulkier than the cyanovinyl group.
To confirm the photosensibility of the ligation process and
reuse of methylated DNA, irradiation of the photoligated product
at 312 nm was examined. As a result, rapid disappearance of
ligated ODN was observed to revert to mC-containing ODN and
photosensitive ODN by 312 nm irradiation (see ESI†).
Fig. 3 (a) Fluorescence images acquired on a microarray scanner for the
product of photoligation on cytosine and 5-methylcytosine target DNAs.
(b) Selectivity for different photosensitive nucleotide conditions. The data
points represent the average of three experimental runs by irradiation at
366 nm for 1 h.
Conclusions
We performed UV melting studies using model sequence 15 mer
of the P53 gene (see ESI†) according to disclosed differences of
reactivity of each vinyluridine derivative. As shown in Fig. 4 and
Table 2, the DTm values of the ODN containing HU were the
highest of all combinations (DTm = 3.4 ◦C). In this case, the
DTm values are defined by deducting the Tm value of the cytosine
case from the methylcytosine case. We confirmed improvement
of the ratio (mC/C) corresponding to the rise of the DTm value
(Fig. 4). As a result, we suggested that photoligation is promoted
by the thermal stability of methylcytosine and vinyluridine
derivatives. Additionally, we considered that the balance of values
between enthalpy and entholopy obtained by the van’t Hoff plot
would seem to explain the differences of reactivity (see ESI†).
These results suggest that the hydrophobicity of photosensitive
In conclusion, we synthesized several vinyluridine derivatives of
which the nucleosides have the property of hydrophobicity. Then,
we demonstrated a 5-methylcytosine detecting system by using a
photoligation method through these vinyluridine derivatives. Sig-
nificantly, 5-methylcytosine in the target sequence yielded ligated
product, with a measured ratio of ligation yield that was 5.6-fold
higher than the cytosine case. We considered that the differences
were obtained by the thermal stability of methylcytosine and
vinyluridine derivatives. Epigenetic research could not use such
small samples because of the methylated DNA that is lost in
PCR. Although we consider the reuse of methylated samples to be
important, reuse of the sample was difficult in the case of using the
CU method. Additionally, the photoligated oligonucleotides were
quantitatively reverted to the original oligonucleotides 312 nm
irradiation. Thus, these results suggest that our method can reuse
photosensitive DNA and methylated DNA samples because the
photoligation reaction is reversible.
Experimental section
General
Tetrazole was purchased from GLEN RESEARCH. The
reagents for the DNA synthesizer such as I2 solution
(I2/H2O/pyridine/tetrahydrofuran, 3:2:19:76), A-, G-, C-, and
T-b-cyanoethyl phosphoroamidites were also purchased from
GLEN RESEARCH. Other reagents were purchased at the
highest commercial quality and used without further purification
Fig. 4 The dependence of the fluorescent intensity ratio (mC/C) on the
DTm values. DTm values are defined by deducting the Tm value of the
cytosine case from the methylcytosine case.
This journal is
The Royal Society of Chemistry 2009
Org. Biomol. Chem., 2009, 7, 3163–3167 | 3165
©

View Article Online
unless otherwise stated. Microwave reactions were conducted
using the CEM Discover as a focused microwave unit. Calf
intestine alkaline phosphatase (AP) (1,500 units) was purchased
from Promega and Roch. Nuclease P1 (500 units) was purchased
from Yamasa. Reactions were monitored on TLC plates precoated
with Merck silica gel 60 F254. Kanto Chemical Silica Gel 60 N
was used for silica gel column chromatography. ODNs were
synthesized on an Applied Biosystems 3400 DNA Synthesizer.
Reverse phase HPLC was performed on a Cosmosil 5C18AR-II
(Nacalai Tesque) column (4.6 ¥ 150 mm) or a CHEMCOBOND
5-ODS-H (Chemco) column (4.6 ¥ 150 mm) with a JASCO PU-
980, HG-980–31, DG-980–50 system equipped with a JASCO
UV 970 spectrometer at 260 nm. Irradiation was performed by
a transilluminator (Funakoshi TR-366 nm). Mass spectra were
recorded on a Voyager-DE PRO-SF, Applied Biosystems.
acetonitrile and coevaporated three times in vacuo. After substitu-
tion with nitrogen, 2-cyanoethyl N, N, N¢, N¢-tetraisopropyl phos-
phorodiamidite (120 ml, 0.38 mmol) in dry acetonitrile (1.5 ml),
and 0.5 M tetrazole (0.95 ml) were added, and the reaction mixture
was stirred at ambient temperature for 2 h. The reaction mixture
was then extracted with AcOEt (10 ml x 3) and water (15 ml).
The organic layer was collected, dried over anhydrous Mg2SO4,
filtered, and evaporated to dryness under reduced pressure. Then,
the crude product cyanoethylphosphoramidite of 4b (316 mg,
0.38 mmol, quant.) in a sealed bottle with septum was dissolved
in dry acetonitrile and coevaporated three times, and was used for
automated DNA synthesis without further purification.
Synthesis and characterization of HU-containing ODN
VUderivatives-containing ODN were synthesized by the auto-
mated solid-phase phosphoramidite method as reported. [S1] After
automated synthesis, the oligomer was deprotected by incubation
with 28% ammonia for 4 h at 65 ◦C and was purified on a Chem-
cobond 5-ODS-H column (4.6 ¥ 150 mm) by reverse phase HPLC;
elution was with 0.05M ammonium formate containing 3–20%
acetonitrile, linear gradient (30 min) at a flow rate of 1.0 mL/min,
30 ◦C. Preparation of oligonucleotides was confirmed by MALDI-
TOF-MS analysis.
Preparation of 5-heptenyl-2¢-deoxyuridine (2b). 5-Iodo-2¢-
deoxyuridine (500 mg, 1.41 mmol) was dissolved in DMF in a
microwave tube with a stirring bar. To this was added palla-
dium (II) acetate (33 mg, 0.15 mmol), tri-n-butylamine (340 ml,
1.41 mmol) and 1-heptene (5 ml, 3.53 mmol). The reaction tube
was sealed and reacted in a microwave reactor for 20 min at
100 ◦C with continuous stirring. The reaction mixture was filtered
to remove the resulting precipitate, and extracted with EtOAc
(20 ml x 3) and water (30 ml). The organic layer was collected,
dried over anhydrous Na2SO4, filtered, and evaporated to dryness
under reduced pressure. The crude product was purified by silica
gel column chromatography (CHCl3/MeOH 9:1) to afford 2b
MALDI-TOF MS: calcd. 7114.95 for ODN (VU) [(M + H)+],
found 7114.20).
MALDI-TOF MS: calcd. 7185.08 for ODN (HU) [(M + H)+],
found 7184.95).
1
(326 mg, 1.36 mmol, 97%). H NMR (300 MHz, CDCl3): d 7.58
MALDI-TOF MS: calcd. 7197.09 for ODN(HVU) [(M + H)+],
found 7197.76).
(s, 1H, H-C(6)); 6.21–6.13 (m, 1H, H-C(1¢)); 6.04 (d, 1H, J= 15.9,
vinylic H); 5.54–5.38 (m, 1H, vinylic H); 4.58 (br. s, 1H, H-C(3¢));
4.03 (br, d, 1H, J= 3.3, H-C(4¢)); 3.95–3.80 (m, 2H, H-C(5¢));
2.45–2.32 (m, 2H, H-C(2¢)); 2.16–0.84 (m, 11H, H of heptene).
MALDI-TOF MS; calcd. for 325.70 [M + H]+; found 325.80.
MALDI-TOF MS: calcd. 7171.05 for ODN (BuVU) [(M + H)+],
found 7171.08).
Preparation of 5-heptenyl-2¢-deoxy-5¢-O-(4,4-dimethoxytrityl)-
uridine (3b). 5-Heptenyl-2¢-deoxyuridine (2b) (600 mg,
1.85 mmol) was dissolved in dry pyridine and coevaporated
three times. 4, 4¢-dimethoxytrityl chloride (752 mg, 2.22 mmol), N,
N-dimethylamino pyridine (68 mg, 0.56 mmol) and triethylamine
(310 ml, 2.22 mmol) were added to a solution of 2b in dry pyridine
(10 ml). The solution was stirred at ambient temperature under a
nitrogen atmosphere for 16 h. The reaction mixture was extracted
with EtOAc (100 ml x 3) and water (150 ml). The organic layer was
collected, dried over anhydrous Mg2SO4, filtered, and evaporated
to dryness under reduced pressure. The crude product was then
purified by silica gel column chromatography (CHCl3/EtOH
97:3) to afford 3b (863 mg, 1.38 mmol, 75%).
1H NMR (300 MHz, CDCl3): d 8.40 (br. s, 1H, H-C(6)); 7.45–
7.20 (m, 8H, arom.H); 6.83–6.80 (m, 5H, arom. H); 6.39 (t, 1H,
J= 6.9, H-C(1¢)); 6.27–6.17(m, 1H, vinylic H); 5.57–5.52 (d, 1H,
J= 15.9, vinylic H); 4.54 (br, s, 1H, H-C(3¢)); 4.05–4.01 (m, 1H,
H-C(4¢)); 3.78 (s, 6H, H of methoxyl); 3.53–3.31 (m, 2H, H-C(5¢));
2.43–2.18 (m, 2H, H-C(2¢)); 1.98–0.73 (m, 11H, H of heptene).
MALDI-TOF MS; calcd. for 649.29 [M + Na]+; found 649.29.
Photochemical detection of 5-methylcytosine on a DNA chip using
5-vinyl-2¢-deoxyuridine derivatives
To demonstrate that template-directed photoligation by using
photosensitive ODNs could be incorporated into platforms suit-
able for DNA chip technologies, we constructed the DNA chip by
attaching amino-labeled ODN containing VU derivatives onto the
aldehyde-modified glass surface. We determined the feasibility of
the template-directed photoligation through photosensitive ODNs
on a DNA chip. A glass chip spotted with 2 mM target ODN(C)
or ODN(mC) and template ODN was irradiated at 366 nm for 1 h
in 50 mM sodium cacodylate buffer (pH 7.0) and 100 mM sodium
chloride. After the chip had been washed with deionized water at
98 ◦C for 5 min, 5 mM Cy3-containing ODN(Cy3) conjugate was
added to the surface for 4 h in 50 mM sodium cacodylate buffer
(pH 7.0) and 100 mM sodium chloride, and the chip was washed
twice in PBS. Fluorescence signals were detected on a microarray
scanner.
Acknowledgements
Preparation of 5-heptenyl-2¢-deoxy-5¢-O-(4,4-dimethoxytrityl)-
uridine phosphoramidite (4b). 5-heptenyl-2¢-deoxy-5¢-O-(4,4-
dimethoxytrityl)uridine (3b) (235 mg, 0.38 mmol) in dry CH3CN
(1.5 ml) in a sealed bottle with septum was dissolved in dry
This work was supported by a Grant-in-Aid for Scientific Research
from the Ministry of Education, Culture, Sports, Science, and
Technology, Japan.
3166 | Org. Biomol. Chem., 2009, 7, 3163–3167
This journal is
The Royal Society of Chemistry 2009
©

View Article Online
10 (a) V. E. Velculescu, L. Zhang, B. Vogelstein and K. W. Kinzler, Science,
1995, 270, 484–487; (b) M. Beier and J. D. Hoheisel, J. Biotechnol.,
2002, 94, 15–22; (c) I. Hatada, M. Fukasawa, M. Kimura, S. Morita,
K. Yamada, S. Yamanaka, C. Endo, A. Sakurada, M. Sato, T. Kondo,
A. Horii, T. Ushijima and H. Sasaki, Oncogene,, 2006, 25, 3059–3064.
11 A. Chibber and B. G. Schroeder, Analytical Biochemistry, 2008, 377,
46–54.
Notes and references
1 (a) E. Li, C. Beard and R. Jaenisch, Nature, 1993, 366, 362–365; (b) A.
Bird, Genes Dev., 2002, 16, 6–21.
2 (a) V. Valineluck and L. C. Sowers, Cancer Res., 2007, 67, 5583–5586;
(b) E. A. Moskalyov, A. T. Eprintsev and J. D. Hoheisel, Molecular
Biology,, 2007, 5, 723–726; (c) P. A. Jones and D. Takai, Science,, 2001,
293, 1068–1670; (d) M. Widschwendter and P. A. Jones, Oncogene,
2002, 21, 5462–5482.
12 A. Meissner, A. Gnirke, G. W. Bell, B. Ramsahoye, E. S. Lander and
R. Jaenisch, Nucleic Acids Res., 2005, 33, 5868–5877.
3 (a) P. A. Jones and S. B. Baylin, Nat. Rev. Genet., 2002, 3, 415–428;
(b) G. Egger, G. Liang, A. Aparicio and P. A. Jones, Nature, 2004, 429,
457–463.
4 (a) M. Ronaghi, M. Uhlen and P. Nyren, Science, 1998, 281, 363–365;
(b) M. Frommer, L. McDonald, C. Collis, F. Watt, G. M. Grigg, P. L.
Molloy and C. L. Paul, Proc. Natl. Acad. Sci. U. S. A., 1992, 89, 1827–
1831; (c) V. L. Boyd, K. I. Moody, A. E. Karger, K. J. Livak, G. Zon
and J. W. Burns, Analytical Biochemistry, 2006, 354, 266–273.
5 A. Okamoto, Org. Biomol. Chem., 2009, 7, 21–26.
6 (a) K. Tanaka, K. Tainaka and A. Okamoto, Bioorg. Med. Chem., 2007,
15, 1615–1521; (b) K. Tanaka, K. Tainaka, T. Umemoto, A. Nomura
and A. Okamoto, J. Am. Chem. Soc., 2007, 129, 14511–14517.
7 H. Yamada, K. Tanabe, T. Ito and S. Nishimoto, Chem. Eur. J., 2008,
14, 10453–10461.
13 (a) S. Bareyt and T. Carell, Angew. Chem., Int. Ed., 2008, 47, 181–184;
(b) H. Yamada, K. Tanabe and S. Nishimoto, Bioconjugate Chem.,
2008, 19, 20–23; (c) H. Cao and Y. Wang, Nucleic Acids Res., 2007, 35,
4833–4844.
14 (a) K. Fujimoto, S. Matsuda, N. Takahashi and I. Saito, J. Am. Chem.
Soc., 2000, 122, 5646–5647; (b) Y. Saito, Y. Miyauchi and K. Fujimoto,
Tetrahedron Lett., 2005, 46, 97–99; (c) M. Ogino, Y. Yoshimura, A.
Nakazawa, I. Saito and K. Fujimoto, Org. Lett., 2005, 7, 2853–
2856; (d) S. Ogasawara and K. Fujimoto, ChemBioChem, 2005, 6,
1756–1760; (e) Y. Yoshimura, Y. Noguchi, H. Sato and K. Fujimoto,
ChemBioChem, 2006, 7, 598–601.
15 (a) M. D. Matteucci and M. H. Caruthers, J. Am. Chem. Soc., 1981,
103, 3185–3191; (b) S. L. Beaucage and M. H. Caruthers, Tetrahedron
Lett., 1981, 22, 1859–1862.
8 A. Nomura and A. Okamoto, Org. Biomol. Chem., 2008, 6, 3905–3907.
9 M. Minoshima, T. Bando, S. Sasaki, J. Fujimoto and H. Sugiyama,
Nucleic Acids Res., 2008, 36, 2889–2894.
16 S. Tornaletti and G. P. Pfeifer, Oncogene, 1995, 10, 1493–1499.
17 M. Ogino, Y. Taya and K. Fujimoto, Chem. Commun., 2008, 45, 5996–
5998.
This journal is
The Royal Society of Chemistry 2009
Org. Biomol. Chem., 2009, 7, 3163–3167 | 3167
©