Synthesis and properties of oligonucleotides containing novel fluorescent biaryl units

Article abstract of DOI:10.1002/ejoc.200900567

We describe the synthesis and properties of oligonucleotides (ONs) containing biaryl units, which are composed of a bis(hydroxymethyl)benzene residue and a naphthalene or pyrene moiety. We found that by introducing the biaryl units into the ONs, the aroma

Full text of DOI:10.1002/ejoc.200900567

FULL PAPER
DOI: 10.1002/ejoc.200900567
Synthesis and Properties of Oligonucleotides Containing Novel Fluorescent
Biaryl Units
Yoshihito Ueno,*[a,b,c,d] Shinji Komatsuzaki,[a] Keiji Takasu,[a] Satoru Kawai,[a]
Yoshiaki Kitamura,[a] and Yukio Kitade[a,b,c,e]
Keywords: Biaryls / DNA / RNA recognition / Oligonucleotides / Fluorescent probes
We describe the synthesis and properties of oligonucleotides
(ONs) containing biaryl units, which are composed of a bis-
(hydroxymethyl)benzene residue and a naphthalene or pyr-
ene moiety. We found that by introducing the biaryl units into
the ONs, the aromatic chromophores were suitably arrayed
in the DNAs. Further, we succeeded in the detection of a
single-base mismatch in RNA by using the ON containing
the biaryl unit as a molecular beacon.
(© Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim,
Germany, 2009)
and properties of ONs that contain biaryl units composed
of aromatic chromophores (Figure 1). We speculated that
since the structures of biaryl units 3 and 4 are such that
interplanar angles are formed between the aromatic chro-
mophores and the benzene moieties, the chromophores can
efficiently stack on top of each other in DNA duplexes;
as a result of this stacking, the duplexes will be thermally
stabilized. The stacked aromatic chromophores would form
exciplexes within the duplexes, and hence, the duplexes will
be functionalized.
Introduction
One major goal of research in biotechnology and nano-
technology is to develop assemblies of novel biomaterials
that can be used in analytical, industrial, and therapeutic
applications. To date, a wide variety of oligonucleotide ana-
logs (ONAs), which contain fluorescent chromophores,
have been synthesized, and their properties have been exten-
sively investigated to evaluate their use in the above-men-
tioned applications.[1–36]
Recently, we reported the synthesis and properties of an
oligonucleotide (ON) that consists of a benzene–phosphate
backbone.[37] The building blocks of this ON are composed
of bis(hydroxymethyl)benzene residues that are connected
to nucleobases through a biaryl-like axis (Figure 1). The
thermal denaturation of the duplexes composed of such
ONs revealed that the ONA having the benzene–phosphate
backbone forms a thermally and thermodynamically stable
duplex in itself.[37] Furthermore, we have designed and syn-
thesized a molecular beacon (MB) that has the benzene–
phosphate backbone at the stem moiety; this MB success-
fully detected a target RNA with excellent efficiency.[38] The
results of this study prompted us to examine the synthesis
[a] Department of Biomolecular Science, Faculty of Engineering,
Gifu University,
1-1 Yanagido, Gifu 501-1193, Japan
Fax: +81-58-293-2794
E-mail: uenoy@gifu-u.ac.jp
[b] United Graduate School of Drug Discovery and Medical Infor-
mation Sciences, Gifu University,
Figure 1. Chemical structures of monomers.
1-1 Yanagido, Gifu 501-1193, Japan
[c] Center for Emerging Infectious Diseases, Gifu University,
1-1 Yanagido, Gifu 501-1193, Japan
In this paper, we report the synthesis and properties of
ONs containing biaryl units that are composed of aromatic
chromophores. We also investigated RNA detection by
using a MB containing the same biaryl unit at the stem
moiety.
[d] PRESTO, JST (Japan Science and Technology Agency),
4-1-8 Honcho Kawaguchi, Saitama 332-0012, Japan
[e] Center for Advanced Drug Research, Gifu University,
1-1 Yanagido, Gifu 501-1193, Japan
Supporting information for this article is available on the
WWW under http://dx.doi.org/10.1002/ejoc.200900567.
Eur. J. Org. Chem. 2009, 4763–4769
© 2009 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
4763

Y. Ueno, S. Komatsuzaki, K. Takasu, S. Kawai, Y. Kitamura, Y. Kitade
FULL PAPER
phosphoramidite 9 in 88% yield. In a similar manner, phos-
phoramidite 13 was synthesized from 1-bromopyrene (10);
the total yield of 13 was 29%.
Results and Discussion
Syntheses of Amidite Units
The syntheses of the phosphoramidite units of biaryl
units 3 and 4 are shown in Schemes 1 and 2, respectively.
Arylboronic acid derivative 5, which was synthesized by a
previously reported method,[38] was coupled with 1-iodo-
naphthalene (6) in the presence of PdCl2(dppf) [dppf = 1,1Ј-
bis(diphenylphosphanyl)ferrocene] at 65 °C; this coupling
reaction afforded biaryl derivative 7; subsequently, 7 was
desilylated upon treatment with tetra-n-butylammonium
fluoride (TBAF) to give biaryl unit 3 in a yield of 84%.
One out of the two hydroxy groups of 3 was protected by
a 4,4Ј-dimethoxytrityl (DMTr) group to give mono-DMTr
derivative 8 in 37% yield. Derivative 8 was phosphitylated
by the standard procedure to afford the corresponding
Scheme 2. Reagents and conditions: (a) PdCl2(dppf)·CH2Cl2,
NaOH, THF/H2O (5:1), 65 °C, 48 h; (b) TBAF, THF/CH2Cl2 (1:1),
room temp., 1 h, 54% (2 steps); (c) DMTrCl, pyridine, room temp.,
4 h, 58%; (d) chloro(2-cyanoethoxy)(N,N-diisopropylamino)phos-
phane, iPr2NEt, THF, room temp., 1 h, 93%.
Before introducing biaryl units 3 and 4 into the ONs,
their fluorescence properties were studied. Biaryl unit 4
showed emission maxima at 380 and 400 nm under 341-nm
excitation in methanol; biaryl unit 3 exhibited an emission
band at 348 nm under 287-nm excitation in methanol. The
quantum yield (Φem) of biaryl unit 4 in methanol was found
to be 0.07.
Scheme 1. Reagents and conditions: (a) PdCl2(dppf)·CH2Cl2,
NaOH, THF/H2O (5:1), 65 °C, 24 h; (b) TBAF, THF, room temp.,
1 h, 84% (2 steps); (c) DMTrCl, pyridine, room temp., 4 h, 37%;
Oligonucleotide Syntheses
The various sequences of ONs used in this study are
summarized in Table 1. All ONs were synthesized with a
(d)
chloro(2-cyanoethoxy)(N,N-diisopropylamino)phosphane,
iPr2NEt, THF, room temp., 1 h, 88%.
Table 1. Sequences of oligonucleotides used in this study.[a]
Duplex
ON
Sequence
Duplex1
ON 1
5Ј-AGCTCGGTCATCGAGAGTGCA-3Ј
3Ј-TCGAGCCAGTAGCTCTCACGT-5Ј
5Ј-AGCTCGGTCA3CGAGAGTGCA-3Ј
3Ј-TCGAGCCAGT3GCTCTCACGT-5Ј
5Ј-AGCTCGGTC33CGAGAGTGCA-3Ј
3Ј-TCGAGCCAG33GCTCTCACGT-5Ј
5Ј-AGCTCGGT333CGAGAGTGCA-3Ј
3Ј-TCGAGCCA333GCTCTCACGT-5Ј
5Ј-AGCTCGGTCA4CGAGAGTGCA-3Ј
3Ј-TCGAGCCAGT4GCTCTCACGT-5Ј
5Ј-AGCTCGGTC44CGAGAGTGCA-3Ј
3Ј-TCGAGCCAG44GCTCTCACGT-5Ј
5Ј-AGCTCGGT444CGAGAGTGCA-3Ј
3Ј-TCGAGCCA444GCTCTCACGT-5Ј
5Ј-GCA4AGC-GAAGGTCAAGGTATCTCT-GCT4TGC-3Ј
3Ј-r(ACCCCUCUUCCAGUUCCAUAGAGACCUGGAG)-5Ј
3Ј-r(ACCCCUCUUCCAGUUACAUAGAGACCUGGAG)-5Ј
ON 2
Duplex2
Duplex3
Duplex4
Duplex5
Duplex6
Duplex7
ON 3
ON 4
ON 5
ON 6
ON 7
ON 8
ON 9
ON 10
ON 11
ON 12
ON 13
ON 14
ON 15
RNA 16
RNA 17
–
–
–
[a] The italicized letters indicate complementary sequences to the loop regions of the MB. The bolded, italicized letter represents the
mismatched base.
4764
www.eurjoc.org
© 2009 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 2009, 4763–4769

Oligonucleotides Containing Novel Fluorescent Biaryl Units
DNA synthesizer. The fully protected ONs (1.0 µmol each) centration of single-stranded DNAs. The calculated param-
linked to solid supports were deprotected upon treatment eters are summarized in Table 3. The ∆G°310 values of du-
with concentrated NH4OH at 55 °C for 12 h. The ONs that plexes 1 and 6 were –21.0 and –23.8 kcalmol–1, respectively.
were released from the support were purified by using 20% Thus, it was found that incorporation of biaryl unit 4 ther-
denaturing polyacrylamide gel electrophoresis (PAGE) to modynamically stabilized the DNA duplex. The ∆∆H° and
afford ONs 3–15. These ONs were analyzed by matrix-as- ∆∆S° values between duplexes 1 and 6 were calculated to
sisted laser desorption/ionization time-of-flight mass spec- be +22 kcalmol–1 and +78 calmol–1 K–1, respectively. Thus,
trometry (MALDI-TOF MS); the observed molecular duplex formation between ONs 11 and 12, which contain
weights were in good agreement with their structures. All biaryl unit 4, is less favorable in terms of enthalpy but more
ONs are soluble in water.
favorable in terms of entropy than duplex formation be-
tween ONs 1 and 2, which consist of the natural nucleo-
sides. These results suggest that the enhanced thermo-
dynamic stability of duplex 6 is contributed by the entropy
term, which is associated with the hydrophobic interactions
between the pyrene residues of duplex 6.
Thermal Stabilities of Duplexes
The thermal stabilities of the DNA duplexes containing
the biaryl units were studied by carrying out thermal dena-
turation in 0.01  sodium phosphate buffer (pH 7.0) con-
taining 0.1  NaCl (Table 2). Their UV absorbances were
measured at 260 nm. It was found that biaryl units 3 and 4
thermally stabilize the DNA duplexes. The stabilities of the
duplexes depended on the number and type of the biaryl
units. Biaryl unit 4, which has a pyrene moiety, stabilized
the duplex more efficiently than 3, which has a naphthalene
moiety. The thermal stability of the duplexes increased as
the number of units 3 or 4 increased, till four residues of 3
or 4 were incorporated into the duplexes. In contrast, the
stability of the duplex (Tm = 66.0 °C) containing six resi-
dues of 3 was slightly lower than that (Tm = 67.0 °C) of the
duplex containing two residues of 3; moreover, the stability
of the duplex (Tm = 74.0 °C) containing six residues of 4
was comparable to that (Tm = 74.5 °C) of the duplex con-
taining four residues of 4. Although the exact reason for
the low thermal stability of the duplexes (duplexes 4 and 7)
containing six residues of the biaryl units as compared to
that of the duplexes (duplexes 3 and 6) containing four resi-
dues of the units is not elucidated, we speculate that it may
be attributed to the distance between the aromatic chromo-
phores in the duplex. The number of carbon atoms between
the hydroxy groups in the biaryl units (five carbons) is
greater than that in a natural nucleoside (three carbons);
that is, the distances between the aromatic chromophores
in the duplexes are probably slightly greater than those in
the case of natural nucleosides. As a result, the stacking
interaction between the aromatic chromophores may be-
come weak with increasing number of the biaryl units.
Table 3. Thermodynamic parameters.
∆S°
∆G°310
Duplex
∆H° [kcalmol–1]
[calmol–1 K–1]
[kcalmol–1]
Duplex1
Duplex6
–166
–144
–466
–388
–21.0
–23.8
Absorption Properties
Next, we performed a series of temperature-dependent
UV/Vis absorption experiments on the double-stranded
DNAs. Figure 2 shows the UV absorbance profiles of du-
plexes 5–7 in the range 300–400 nm, which corresponds to
the absorbance range of pyrene moieties. The intensity of
Table 2. Melting temperatures.[a]
Duplex
Tm [°C] ∆Tm [°C] Duplex
Tm [°C] ∆Tm [°C]
Duplex1
Duplex2
Duplex3
Duplex4
62.9
67.0
68.7
66.0
–
Duplex1
Duplex5
Duplex6
Duplex7
62.9
71.4
74.5
74.0
–
+4.1
+5.8
+3.1
+8.5
+11.6
+11.1
[a] Tm values at 3.0 µ duplex concentrations.
To determine which factor is responsible for the stabiliza-
tion of the duplexes, thermodynamic parameters of the du-
plexes (duplexes 1 and 6) on duplex formation were studied;
these parameters were determined by calculations using the
slope of a 1/Tm vs. ln(CT/4) plot, where CT is the total con- Figure 2. UV absorbance measurement.
Eur. J. Org. Chem. 2009, 4763–4769
© 2009 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
4765

Y. Ueno, S. Komatsuzaki, K. Takasu, S. Kawai, Y. Kitamura, Y. Kitade
FULL PAPER
the UV absorbance was dependent on the temperatures at moieties in the ONs interact with each other in the duplex.
which they were measured. In the case of all duplexes, the The intensities of the emissions of the duplexes increased
UV absorbance drastically decreased around Tm (measured with increasing number of biaryl unit 4 and were clearly
at 260 nm) of the duplexes. This finding strongly suggests higher than the sum of emission intensities of the corre-
that the pyrene moieties participate in interstrand stacking sponding single-stranded DNAs (Figure 3a,b). These obser-
interactions, because stacking interactions of chromophores vations indicate that the presence of a benzene–phosphate
are generally accompanied with a decrease in the absorp- backbone ensures that the aromatic chromophores are suit-
tion intensity (hypochromic effect). In the profile of duplex ably arrayed in the duplexes.
5, two isosbestic points were observed at 356 and
364 nm.[29] This indicates that there exists two different
types of interactions between the pyrene moieties in duplex
Synthesis of MB
5. The first isosbestic point observed at 364 nm, which was
formed by the curves measured below Tm (71.4 °C), is at-
tributable to the dissociation of the duplex; the second
isosbestic point observed at 356 nm, which was formed by
the curves measured above Tm, is attributable to a confor-
mational change in the single-stranded DNAs. In contrast,
no isosbestic point was observed in the profiles of duplexes
6 and 7.
Nucleic acid probes modified with fluorescent dyes are
widely used to detect specific DNA or RNA mole-
cules.[40–48] MBs are self-reporting nucleic acid probes that
have complementary arm sequences and a loop that is com-
plementary to a target sequence (Figure 4). MBs possess a
fluorophore and a quencher at the termini and form a
closed structure to bring these fluorophore labels into juxta-
position under unhybridized conditions; the juxtaposition
of the labels leads to fluorescence quenching. When the
MBs bind to a complementary target, they adopt an open
conformation, wherein the labels are spatially separated. As
a result, the MBs brightly fluoresce in the presence of a
nucleic acid target sequence.
Fluorescence Properties
To elucidate the fluorescence properties of the ONs con-
taining biaryl unit 4, their emission spectra were measured
from 370 to 670 nm. The single-stranded DNAs, ONs 9 and
10, which contain a single residue of 4, showed monomer
fluorescence around 395 nm under 342-nm excitation (Fig-
ure 3c). In contrast, duplex 5, which contains ONs 9 and
10, exhibited excimer fluorescence at 490 nm and no mono-
mer fluorescence.[39] This result indicates that the pyrene
Figure 4. Structure of molecular beacon.
Next, we attempted to introduce biaryl unit 4 into the
stem moiety of the MB (Figure 4). We predicted that by
introducing 4 into the middle of the stem moiety, we can
realize a new type of MB that does not possess a quencher
and has two free ends (5Ј- and 3Ј-ends). We believed that a
target RNA could be detected from the monomer and exci-
mer fluorescence signal of 4 observed in its emission spec-
tra.
The sequences of the MBs and the corresponding target
RNA are shown in Table 1. We selected an mRNA of a
human CYP2C9 (position 1060–1090) as the target se-
quence. The functionality of ON 15 as a MB was studied
by carrying out fluorescence titration experiments in the
presence of fully complementary target RNA 16 (Fig-
ure 5a). The addition of RNA 16 (0.1–1.0 equiv.) to a solu-
tion containing ON 15 caused a decrease in excimer fluores-
cence intensity (around 480 nm) and an increase in the
monomer fluorescence intensity (around 390 nm). This re-
sult implies that ON 15 effectively functions as a MB.
Figure 3. Fluorescence intensity measurement of duplexes.
4766
www.eurjoc.org
© 2009 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 2009, 4763–4769

Oligonucleotides Containing Novel Fluorescent Biaryl Units
by the electron ionization (EI) method with a JEOL JMS-700/GI
instrument. Thin-layer chromatography was carried out on Merck
coated plates 60F254. Silica gel column chromatography was carried
out on Wakogel C-300.
1-[3,5-Bis(hydroxymethyl)phenyl]naphthalene (3): A solution of 3,5-
bis(tert-butyldimethylsilyloxymethyl)phenylboronic acid (1.00 g,
2.44 mmol)[38] in THF/H2O (5:1, 12 mL) was added to a solution
of 1-iodonaphthalene (0.62 g, 2.44 mmol) and PdCl2(dppf)·CH2Cl2
(0.122 g, 0.149 mmol) in THF/H2O (5:1, 12 mL). NaOH (2 ,
3.66 mL) was added to the mixture, and this mixture was stirred at
65 °C for 24 h. The mixture was partitioned between EtOAc and
H2O. The organic layer was washed with aqueous NaHCO3 (satu-
rated) and brine, dried (Na2SO4), and concentrated. The residue
was dissolved in THF (7.3 mL). TBAF (1  in THF, 7.3 mL) was
added to the solution, and the mixture was stirred at room tem-
perature for 1 h. The solvent was evaporated in vacuo, and the
resulting residue was purified by column chromatography (SiO2,
2% MeOH in CHCl3) to give 3 (0.545 g, 84%). UV (MeOH): λ (ε,
Lmol–1 cm–1) = 222 (53000), 290 (10000) nm. 1H NMR (400 MHz,
[D6]DMSO): δ = 8.00–7.27 (m, 10 H, HAr), 5.25 (t, J = 5.8 Hz, 2
H, OH), 4.58 (d, J = 5.8 Hz, 4 H, CH2) ppm. 13C NMR (100 MHz,
[D6]DMSO): δ = 143.2, 140.4, 140.1, 134.0, 131.4, 128.8, 128.0,
127.3, 126.7, 126.4, 126.0, 125.9, 124.2, 63.5 ppm. HRMS (EI):
calcd. for C18H16O2 264.1150; found 264.1146. C18H16O2·1/10H2O
(266.12): calcd. C 81.24, H 6.14; found C 80.96, H 6.13.
Figure 5. Fluorescence intensity measurement of MB.
We next examined the ability of the MB to discriminate
a single-base mismatch in the target RNA. RNA 17 con-
tains one base mismatch in the middle of the strand. Fig-
ure 5b shows the emission spectra of the solution contain- 1-[3-(4,4Ј-Dimethoxytrityloxymethyl)-5-(hydroxymethyl)phenyl]-
naphthalene (8): A mixture of 3 (0.545 g, 2.05 mmol) and DMTrCl
(0.909 g, 2.68 mmol) in pyridine (10 mL) was stirred at room tem-
perature for 4 h. The mixture was partitioned between CHCl3 and
aqueous NaHCO3 (saturated). The organic layer was washed with
brine, dried (Na2SO4), and concentrated. The residue was purified
by column chromatography (SiO2, 6% MeOH in CHCl3) to give 8
(0.429 g, 37%). 1H NMR (400 MHz, CDCl3): δ = 7.86–6.75 (m, 23
H, HAr), 4.74 (s, 2 H), 4.23 (s, 2 H), 3.74 (s, 6 H, OCH3) ppm. 13C
NMR (100 MHz, [D6]DMSO): δ = 158.4, 145.2, 143.3, 140.0,
139.8, 139.0, 135.9, 133.7, 131.0, 129.9, 128.7, 128.2, 127.9, 127.1,
127.0, 126.9, 126.8, 126.6, 126.2, 125.9, 125.5, 124.3, 113.5, 86.2,
65.3, 63.1, 55.3 ppm. C39H34O4·6/5H2O (588.30): calcd. C 79.62, H
6.24; found C 79.57, H 6.31.
ing hybrids of ON 15 and RNA 16 or ON 15 and RNA 17.
Ratios of fluorescence intensities of the excimer to mono-
mer emission (I390nm/I480nm) of ON 15/RNA 16 and ON 15/
RNA 17 hybrids were 2.3 and 1.1, respectively. Thus, it can
be concluded that ON 15 as a MB can effectively discrimi-
nate a single-base mismatch in a 31mer RNA.
Conclusions
In the present study, ONs containing biaryl units 3 and
4 composed of naphthalene and pyrene moieties were syn-
thesized, and their properties were studied. The thermal de-
naturation of the synthesized duplexes revealed that incor-
poration of biaryl unit 3 or 4 into the duplex structures
enhanced their thermal and thermodynamic stabilities. Bi-
aryl unit 4 formed an excimer in the duplexes. The inten-
sities of the emissions of the duplexes increased with in-
creasing number of units 4. These results indicate that the
presence of the benzene–phosphate backbone ensures that
the aromatic chromophores are suitably arrayed in the du-
plexes. Further, we succeeded in the detection of a single-
base mismatch in RNA by using the ON containing 4 as a
MB. Thus, biaryl compounds 3 and 4 effectively function-
1-[3-{[(2-Cyanoethoxy)(N,N-diisopropylamino)phosphanyl]oxymeth-
yl}-5-(4,4Ј-dimethoxytrityloxymethyl)phenyl]naphthalene (9): A mix-
ture of 8 (0.43 g, 0.759 mmol), N,N-diisopropylethylamine
(0.48 mL, 2.75 mmol), and chloro(2-cyanoethoxy)(N,N-diisopro-
pylamino)phosphane (0.35 mL, 1.57 mmol) in THF (7 mL) was
stirred at room temperature for 1 h. The mixture was partitioned
between CHCl3 and aqueous NaHCO3 (saturated). The organic
layer was washed with brine, dried (Na2SO4), and concentrated.
The residue was purified by column chromatography (a neutralized
SiO2, EtOAc) to give 9 (0.513 g, 88 %). 31P NMR (160 MHz,
CDCl3): δ = 149.0 ppm.
1-[3,5-Bis(hydroxymethyl)phenyl]pyrene (4): A solution of 3,5-bis-
alize the ONs. Further studies to develop applications of (tert-butyldimethylsilyloxymethyl)phenylboronic acid (1.00 g,
2.44 mmol) in THF/H2O (5:1, 24 mL) was added to a solution of
1-bromopyrene (0.686 g, 2.44 mmol) and PdCl2(dppf)·CH2Cl2
(0.122 g, 0.149 mmol) in THF/H2O (5:1, 12 mL). NaOH (2 ,
3.66 mL) was added to the mixture, and this mixture was stirred at
65 °C for 48 h. The mixture was partitioned between EtOAc and
H2O. The organic layer was washed with aqueous NaHCO3 (satu-
rated) and brine, dried (Na2SO4), and concentrated. The residue
was dissolved in THF/CH2Cl2 (1:1, 45 mL). TBAF (1  in THF,
1.14 mL) was added to the solution, and the mixture was stirred at
room temperature for 1 h. The solvent was evaporated in vacuo,
biaryl compounds to nanodevices are currently being con-
ducted in our laboratory.
Experimental Section
General Remarks: NMR spectra were recorded at 400 MHz (1H)
and 100 MHz (13C) with a Jeol JNM-AL400 instrument and are
reported in ppm downfield from tetramethylsilane. The coupling
constants (J) are expressed in Hertz. Mass spectra were obtained
Eur. J. Org. Chem. 2009, 4763–4769
© 2009 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
4767

Y. Ueno, S. Komatsuzaki, K. Takasu, S. Kawai, Y. Kitamura, Y. Kitade
FULL PAPER
and the resulting residue was purified by column chromatography
(SiO2, 6–9 % MeOH in CHCl3) to give 4 (0.416 g, 54 %). UV
(MeOH): λ (ε, L mol–1 cm–1) = 202 (51100), 243 (43400), 277
(36400), 342 (27600) nm. 1H NMR (400 MHz, [D6]DMSO): δ =
8.36–7.43 (m, 12 H, HAr), 5.31 (t, J = 5.9 Hz, 2 H, OH), 4.64 (d,
J = 5.9 Hz, 4 H, CH2) ppm. 13C NMR (100 MHz, [D6]DMSO): δ
= 142.9, 140.0, 137.7, 131.1, 130.6, 130.2, 127.8, 127.7, 127.6, 127.5,
126.8, 126.6, 125.5, 125.1, 125.0, 124.9, 124.3, 124.2, 123.9,
63.1 ppm. HRMS (EI) calcd. for C24H18O2 338.1307; found
338.1312. C24H18O2·1/5H2O (342.00): calcd. C 84.29, H 5.42; found
C 84.21, H 5.37.
mass, 6566.7. ON 13: calculated mass, 6762.2; observed mass,
6764.1. ON 14: calculated mass, 6633.2; observed mass, 6634.2. ON
15: calculated mass, 10042.7; observed mass, 10041.5.
Thermal Denaturation Study: The solution containing the duplex
in a buffer comprising 10 m sodium phosphate (pH 7.0) and 0.1 
NaCl was heated at 95 °C for 3 min, cooled gradually to an appro-
priate temperature, and then used for the thermal denaturation
study. The thermal-induced transition of each mixture was moni-
tored at 260 nm with a spectrophotometer. The sample temperature
was increased by 0.5 °Cmin–1. The thermodynamic parameters of
the duplexes on duplex formation were determined by calculations
based on the slope of a 1/Tm vs. ln(CT/4) plot, where CT (2, 4, 6,
10, 16, 26, 44, 70, 120, and 200 µ) is the total concentration of
single strands.
1-[3-(4,4Ј-Dimethoxytrityloxymethyl)-5-(hydroxymethyl)phenyl]pyr-
ene (12): A mixture of 4 (0.41 g, 1.21 mmol) and DMTrCl (0.46 g,
1.36 mmol) in pyridine (10 mL) was stirred at room temperature
for 4 h. The mixture was partitioned between CHCl3 and aqueous
NaHCO3 (saturated). The organic layer was washed with brine,
dried (Na2SO4), and concentrated. The residue was purified by col-
umn chromatography (SiO2, 2–9 % MeOH in CHCl3) to give 4
(0.113 g, 28 %) and 12 (0.448 g, 58 %). 1H NMR (400 MHz,
CDCl3): δ = 8.62–6.82 (m, 25 H, HAr), 4.84 (s, 2 H, CH2), 4.33 (s,
2 H, CH2), 3.77 (s, 6 H, OCH3) ppm. 13C NMR (100 MHz,
CDCl3): δ = 158.5, 145.0, 141.4, 141.1, 139.9, 137.5, 136.2, 131.5,
131.0, 130.6, 130.1, 129.1, 128.7, 128.5, 128.2, 127.9, 127.6, 127.5,
127.4, 127.4, 126.8, 126.0, 125.3, 125.1, 125.0, 124.9, 124.8, 124.6,
124.5, 113.1, 86.5, 65.6, 65.5, 55.2 ppm. C45H36O4·4/5H2O (655.18):
calcd. C 82.49, H 5.78; found C 82.49, H 5.92.
Absorption Experiments: Absorption spectra (200–500 nm) were
obtained with a Beckman Coulter DU640 spectrophotometer fitted
with a temperature controller in quartz cuvettes with a path length
of 1.0 cm and a 3.0 µ duplex concentration in a buffer of 10 m
Tris-HCl (pH 7.2) containing 100 m NaCl.
Fluorescence Experiments: Steady-state fluorescence emission spec-
tra (370–670 nm) were obtained with a Shimadzu RF-5300PC spec-
trophotometer fitted with a temperature controller in quartz cu-
vettes with a path length of 1.0 cm and a concentration of strands
in Tm buffer of 3.0 µ. Spectra were recorded with use of excitation
slit of 3.0 nm and emission slit of 3.0 nm. The fluorescence quan-
tum yield (Φem) was determined by use of quinine as a reference
with the known Φem value of 0.58 (22 °C) in 0.1  H2SO4. The
quantum yield was calculated according to the following equation:
Φem(S)/Φem(R) = [I(S)/I(R)]ϫ[A(S)/A(R)]ϫ[n(S)2/n(R)2]. Here, Φem(S)
and Φem(R) are the fluorescence quantum yields of the sample and
the reference, respectively, I(S) and I(R) are the integrated fluores-
cence intensities of the sample and the reference, respectively, A(S)
and A(R) are the respective optical density of the sample and the
1-[3-{[(2-Cyanoethoxy)(N,N-diisopropylamino)phosphanyl]oxymeth-
yl}-5-(4,4Ј-dimethoxytrityloxymethyl)phenyl]pyrene (13): A mixture
of 12 (0.44 g, 0.687 mmol), N,N-diisopropylethylamine (0.565 mL,
3.24 mmol), and chloro(2-cyanoethoxy)(N,N-diisopropylamino)
phosphane (0.307 mL, 1.38 mmol) in THF (4 mL) was stirred at
room temperature for 1 h. The mixture was partitioned between
CHCl3 and aqueous NaHCO3 (saturated). The organic layer was
washed with brine, dried (Na2SO4), and concentrated. The residue
was purified by column chromatography (neutralized SiO2, 30%
acetone in EtOAc) to give 13 (0.539 g, 93%). 31P NMR (160 MHz,
CDCl3): δ = 149.3 ppm.
2
reference solutions at the wavelength of excitation, and n(S) and
2
n(R) are the values of the refractive index for the respective sol-
vents.
Supporting Information (see footnote on the first page of this arti-
cle): Graphical data of a 1/Tm vs. ln(CT/4) plot.
Oligonucleotide Synthesis: The synthesis was carried out with a
DNA/RNA synthesizer (Applied Biosystems Model 3400) by the
phosphoramidite method. In the case of the coupling of amidites
9 and 13, a 0.12  solution of amidite 9 or 13 in CH3CN and a
coupling time of 15 min were used. Deprotection of the bases and
phosphates was performed in concentrated NH4OH at 55 °C for
16 h. The oligonucleotides were purified by 20% PAGE containing
7  urea to give the highly purified oligonucleotides, ON 3 (28),
ON 4 (14), ON 5 (13), ON 6 (20), ON 7 (15), ON 8 (16), ON 9
(16), ON 10 (15), ON 11 (16), ON 12 (22), ON 13 (11), ON 14
(13), and ON 15 (14). The yields are indicated in parentheses as
OD units at 260 nm starting from 1.0 µmol scale. The extinction
coefficients of the oligonucleotides were calculated from those of
mononucleotides and dinucleotides according to the nearest-
neighbor approximation method.[49]
Acknowledgments
This study was supported by a Grant-in-Aid from PRESTO of JST
(Japan Science and Technology) and was also supported in part by
a Grant-in-Aid for Scientific Research (C) from the Japan Society
for the Promotion of Science (JSPS).
[1] R. T. Ranasinghe, T. Brown, Chem. Commun. 2005, 5487–5502.
[2] R. X.-F. Ren, N. C. Chaudhuri, P. L. Paris, S. Rumney, E. T.
Kool, J. Am. Chem. Soc. 1996, 118, 7671–7678.
[3] P. L. Paris, J. M. Langenhan, E. T. Kool, Nucleic Acids Res.
1998, 26, 3789–3793.
[4] J. Gao, S. Watanabe, E. T. Kool, J. Am. Chem. Soc. 2004, 126,
12748–12749.
MALDI-TOF/MS Analyses of Oligonucleotides: Spectra were ob-
tained with a time-of-flight mass spectrometer. ON 3: calculated
mass, 6492.1; observed mass, 6495.0. ON 4: calculated mass,
6394.1; observed mass, 6393.8. ON 5: calculated mass, 6507.2; ob-
served mass, 6500.1. ON 6: calculated mass, 6418.1; observed mass,
6423.6. ON 7: calculated mass, 6546.2; observed mass, 6548.2. ON
8: calculated mass, 6417.1; observed mass, 6420.4. ON 9: calculated
mass, 6564.2; observed mass, 6563.8. ON 10: calculated mass,
6466.1; observed mass, 6467.4. ON 11: calculated mass, 6651.2; ob-
served mass, 6653.2. ON 12: calculated mass, 6562.2; observed
[5] A. H. F. Lee, E. T. Kool, J. Am. Chem. Soc. 2006, 128, 9219–
9230.
[6] J. N. Wilson, Y. N. Teo, E. T. Kool, J. Am. Chem. Soc. 2007,
129, 15426–15427.
[7] Y. N. Teo, J. N. Wilson, E. T. Kool, J. Am. Chem. Soc. 2009,
131, 3923–3933.
[8] C. Verhagen, T. Bryld, M. Raunkjær, S. Vogel, K. Buchalová,
J. Wengel, Eur. J. Org. Chem. 2006, 2538–2548.
[9] T. S. Kumar, A. S. Madsen, M. E. Østergaard, J. Wengel, P. J.
Hrdlicka, J. Org. Chem. 2008, 73, 7060–7066.
4768
www.eurjoc.org
© 2009 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 2009, 4763–4769

Oligonucleotides Containing Novel Fluorescent Biaryl Units
[10]
[11]
[12]
[13]
[30] H. Bittermann, D. Siegemund, V. L. Malinovskii, R. Häner, J.
Am. Chem. Soc. 2008, 130, 15285–15287.
[31] K. Miyata, R. Mineo, R. Tamamushi, M. Mizuta, A. Ohkubo,
H. Taguchi, K. Seio, T. Santa, M. Sekine, J. Org. Chem. 2007,
72, 102–108.
[32] H. Asanuma, K. Shirasuka, T. Takarada, H. Kashida, M. Ko-
miyama, J. Am. Chem. Soc. 2003, 125, 2217–2223.
[33] H. Kashida, T. Fujii, H. Asanuma, Org. Biomol. Chem. 2008,
6, 2892–2899.
[34] J. Parsch, J. W. Engels, Helv. Chim. Acta 2000, 83, 1791–1808.
[35] N. J. Greco, Y. Tor, J. Am. Chem. Soc. 2005, 127, 10784–10785.
[36] S. V. Wegner, A. Okesli, P. Chen, C. He, J. Am. Chem. Soc.
2007, 129, 3474–3475.
[37] Y. Ueno, T. Kato, K. Sato, Y. Ito, M. Yoshida, T. Inoue, A.
Shibata, M. Ebihara, Y. Kitade, J. Org. Chem. 2005, 70, 7925–
7935.
[38] Y. Ueno, A. Kawamura, K. Takasu, S. Komatsuzaki, T. Kato,
S. Kuboe, Y. Kitamura, Y. Kitade, Org. Biomol. Chem. 2009,
7, 2761–2769.
[39] F. M. Winnik, Chem. Rev. 1993, 93, 587–614.
[40] S. Tyagi, F. R. Kramer, Nat. Biotechnol. 1996, 14, 303–308.
[41] S. Tyagi, D. P. Bratu, F. R. Kramer, Nat. Biotechnol. 1998, 16,
49–53.
E. B. Brauns, M. L. Madaras, R. S. Coleman, C. J. Murphy,
M. A. Berg, J. Am. Chem. Soc. 1999, 121, 11644–11649.
A. Okamoto, K. Kanatani, I. Saito, J. Am. Chem. Soc. 2004,
126, 4820–4827.
A. Okamoto, K. Kanatani, I. Saito, J. Am. Chem. Soc. 2004,
126, 8364–8365.
K. Tainaka, K. Tanaka, S. Ikeda, K. Nishiza, T. Unzai, Y. Fuji-
wara, I. Saito, A. Okamoto, J. Am. Chem. Soc. 2007, 129,
4776–4784.
Y. Saito, Y. Shinohara, S. S. Bag, Y. Takeuchi, K. Matsumoto,
I. Saito, Tetrahedron 2009, 65, 934–939.
O. Köhler, D. V. Jarikote, O. Seitz, ChemBioChem 2005, 6, 69–
77.
L. Bethge, D. V. Jarikote, O. Seitz, Bioorg. Med. Chem. 2008,
16, 114–125.
K. Yamana, K. Nunota, H. Nakano, O. Sangen, Tetrahedron
Lett. 1994, 35, 2555–2558.
A. Mahara, R. Iwase, T. Sakamoto, T. Yamaoka, K. Yamana,
A. Murakami, Bioorg. Med. Chem. 2003, 11, 2783–2790.
N. Nakamura, Y. Murakami, K. Sasa, H. Hayashi, K. Yam-
ana, J. Am. Chem. Soc. 2008, 130, 6904–6905.
[14]
[15]
[16]
[17]
[18]
[19]
[42] S. Tyagi, S. A. E. Marras, F. R. Kramer, Nat. Biotechnol. 2000,
[20] M. Kosuge, M. Kubota, A. Ono, Tetrahedron Lett. 2004, 45,
18, 1191–1196.
3945–3947.
[43] P. Conlon, C. J. Yang, Y. Wu, Y. Chen, K. Martinez, Y. Kim,
N. Stevens, A. A. Marti, S. Jockusch, N. J. Turro, W. Tan, J.
Am. Chem. Soc. 2008, 130, 336–342.
[21] M. Kubota, A. Ono, Tetrahedron Lett. 2004, 45, 5755–5758.
[22] E. Mayer-Enthart, C. Wagner, J. Barbaric, H.-A. Wagenknecht,
Tetrahedron 2007, 63, 3434–3439.
[23] D. Baumstark, H.-A. Wagenknecht, Angew. Chem. Int. Ed.
2008, 47, 2612–2614.
[24] F. D. Lewis, L. Zhang, R. F. Kelley, D. McCamant, M. R. Was-
ielewski, Tetrahedron 2007, 63, 3457–3464.
[25] A. Zahn, C. J. Leumann, Chem. Eur. J. 2008, 14, 1087–1094.
[26] N. A. Grigorenko, C. J. Leumann, Chem. Eur. J. 2009, 15, 639–
645.
[44] K. Fujimoto, H. Shimizu, M. Inouye, J. Org. Chem. 2004, 69,
3271–3275.
[45] G. T. Hwang, Y. J. Seo, B. H. Kim, J. Am. Chem. Soc. 2004,
126, 6528–6529.
[46] K. A. Browne, J. Am. Chem. Soc. 2005, 127, 1989–1994.
[47] L. Wang, C. J. Yang, C. D. Medley, S. A. Benner, W. Tan, J.
Am. Chem. Soc. 2005, 127, 15664–15665.
[48] Y. Kim, C. J. Yang, W. Tan, Nucleic Acids Res. 2007, 35, 7279–
7287.
[27] Y. J. Seo, H. Rhee, T. Joo, B. H. Kim, J. Am. Chem. Soc. 2007,
129, 5244–5247.
[49] J. D. Puglisi, I. Tinoco Jr., in Methods in Enzymology (Eds.:
J. E. Dahlberg, J. N. Abelson), Academic Press, San Diego,
1989, vol. 180, pp. 304–325.
[28] J. H. Ryu, Y. J. Seo, G. T. Hwang, J. Y. Lee, B. H. Kim, Tetrahe-
dron 2007, 63, 3538–3547.
[29] F. Samain, V. L. Malinovskii, S. M. Langenegger, R. Häner,
Bioorg. Med. Chem. 2008, 16, 27–33.
Received: May 22, 2009
Published Online: July 22, 2009
Eur. J. Org. Chem. 2009, 4763–4769
© 2009 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
4769