Small molecule modifiers of MicroRNA miR-122 function for the treatment of hepatitis C Virus infection and hepatocellular carcinoma

Article abstract of DOI:10.1021/ja910275u

MicroRNAs are a recently discovered new class of important endogenous regulators of gene function. Aberrant regulation of microRNAs has been linked to various human diseases, most importantly cancer. Small molecule intervention of microRNA misregulation h

Full text of DOI:10.1021/ja910275u

Published on Web 05/19/2010
Small Molecule Modifiers of MicroRNA miR-122 Function for
the Treatment of Hepatitis C Virus Infection and
Hepatocellular Carcinoma
Douglas D. Young,‡ Colleen M. Connelly,‡ Christoph Grohmann, and
Alexander Deiters*
Department of Chemistry, North Carolina State UniVersity, Raleigh, North Carolina 27695
Received December 4, 2009; E-mail: alex_deiters@ncsu.edu
Abstract: MicroRNAs are a recently discovered new class of important endogenous regulators of gene
function. Aberrant regulation of microRNAs has been linked to various human diseases, most importantly
cancer. Small molecule intervention of microRNA misregulation has the potential to provide new therapeutic
approaches to such diseases. Here, we report the first small molecule inhibitors and activators of the liver-
specific microRNA miR-122. This microRNA is the most abundant microRNA in the liver and is involved in
hepatocellular carcinoma development and hepatitis C virus (HCV) infection. Our small molecule inhibitors
reduce viral replication in liver cells and represent a new approach to the treatment of HCV infections.
Moreover, small molecule activation of miR-122 in liver cancer cells selectively induced apoptosis through
caspase activation, thus having implications in cancer chemotherapy. In addition to providing a new approach
for the development of therapeutics, small molecule modifiers of miR-122 function are unique tools for
exploring miR-122 biogenesis.
Introduction
hepatocellular carcinomas can be removed completely using
surgery.8 Transfection of miR-122 into cancer cells induced
MicroRNAs (miRNAs) are single-stranded noncoding RNAs
of 21-23 nucleotides. They are a recently discovered class of
gene regulators that function by binding the 3′ untranslated
regions of specific target mRNAs leading to gene inactivation
by repression of mRNA transcription or induction of mRNA
degradation.1-3 MicroRNAs are transcribed from the genome
and undergo several post-transcriptional processing steps via a
dedicated microRNA pathway. It is estimated that 1000 miRNAs
exist in humans, controlling approximately 30% of all genes,
and thus are involved in almost every genetic pathway and many
human pathologies, e.g. cancer, heart disease, and viral infec-
tion.4
MicroRNA miR-122 is a liver specific miRNA and the most
abundant miRNA in the liver.5 It was discovered that miR-122
is greatly down-regulated in hepatocellular carcinoma (HCC).
Identified targets of miR-122 in primary liver carcinomas and
the HCC cell lines Hep3B and HepG2 are cyclin G1 (CCNG1)
and Bcl-w, an antiapoptotic Bcl-2 family member.6,7 HCC is a
primary cancer of the liver, and it is the third largest cause of
cancer-related death behind only lung and colon cancers.8
Treatment options of HCC and prognosis are usually poor (with
a median survival time of 3 to 6 months), as only 10-20% of
apoptosis and led to reduced cell viability.9,10 Consequentially,
the induction of apoptosis in malignant hepatocytes through the
activation of miR-122 expression represents a potential treatment
for HCC.
The liver-specific miR-122 is also necessary for hepatitis C
virus (HCV) replication and infectious virus production through
interaction with the viral genome.11-14 HCV infection is one
of the major causes of chronic liver disease, including cirrhosis
and liver cancer and is therefore the most common indication
for liver transplantation. The role of miR-122 in HCV replication
suggests that it could be an excellent target for antiviral therapy,
since knock-down of miR-122 results in a dramatic decrease
(6) Fornari, F.; Gramantieri, L.; Ferracin, M.; Veronese, A.; Sabbioni,
S.; Calin, G. A.; Grazi, G. L.; Giovannini, C.; Croce, C. M.; Bolondi,
L.; Negrini, M. Oncogene 2008, 27, 5651–5661.
(7) Gramantieri, L.; Ferracin, M.; Fornari, F.; Veronese, A.; Sabbioni,
S.; Liu, C. G.; Calin, G. A.; Giovannini, C.; Ferrazzi, E.; Grazi, G. L.;
Croce, C. M.; Bolondi, L.; Negrini, M. Cancer Res. 2007, 67, 6092–
6099.
(8) Parkin, D. M.; Bray, F.; Ferlay, J.; Pisani, P. Ca-Cancer J. Clin.
2005, 55, 74–108.
(9) Bai, S.; Nasser, M. W.; Wang, B.; Hsu, S. H.; Datta, J.; Kutay, H.;
Yadav, A.; Nuovo, G.; Kumar, P.; Ghoshal, K. J. Biol. Chem. 2009,
284, 32015–27.
‡ These authors contributed equally to this work.
(1) Pillai, R. S.; Bhattacharyya, S. N.; Filipowicz, W. Trends Cell. Biol.
2007, 17, 118–126.
(10) Lin, C. J.; Gong, H. Y.; Tseng, H. C.; Wang, W. L.; Wu, J. L. Biochem.
Biophys. Res. Commun. 2008, 375, 315–320.
(11) Lanford, R. E.; Hildebrandt-Eriksen, E. S.; Petri, A.; Persson, R.;
Lindow, M.; Munk, M. E.; Kauppinen, S.; Orum, H. Science 2010,
327, 198–201.
(2) Chan, S. P.; Slack, F. J. RNA Biol. 2006, 3, 97–100.
(3) Filipowicz, W. Cell 2005, 122, 17–20.
(4) Esquela-Kerscher, A.; Slack, F. J. Nat. ReV. Cancer 2006, 6, 259–
269.
(12) Norman, K. L.; Sarnow, P. J. Virol. 2010, 84, 666–670.
(13) Jopling, C. L.; Yi, M.; Lancaster, A. M.; Lemon, S. M.; Sarnow, P.
Science 2005, 309, 1577–1581.
(5) Chang, J.; Nicolas, E.; Marks, D.; Sander, C.; Lerro, A.; Buendia,
M. A.; Xu, C.; Mason, W. S.; Moloshok, T.; Bort, R.; Zaret, K. S.;
Taylor, J. M. RNA Biol. 2004, 1, 106–113.
(14) Jopling, C. L.; Norman, K. L.; Sarnow, P. Cold Spring Harb. Symp.
Quant. Biol. 2006, 71, 369–376.
9
7976 J. AM. CHEM. SOC. 2010, 132, 7976–7981
10.1021/ja910275u  2010 American Chemical Society

Small Molecule Modifiers of MicroRNA miR-122
A R T I C L E S
multicloning site) is not affected. The signal-to-background ratio
is 9.0 and the statistical parameter Z′ is 0.66, demonstrating a
robust assay.20 The variation between plates and from day-to-
day is ∼10% and, therefore, fairly small.
Discovery of miR-122 Inhibitors and Activators. The
psiCHECK-miR122 vector was then employed in a small
molecule screen in Huh7 cells to discover modifiers of miR-
122 function. Specifically, an increase in the relative Renilla
luciferase signal indicates a miR-122 inhibitor, while a reduction
in the luciferase signal indicates a miR-122 activator. The
Diversity Set II (1364 compounds) from the NCI Developmental
Therapeutics Program was screened in a 96-well format using
Huh7 cells containing the psiCHECK-miR122 reporter. Cells
were exposed to the small molecules (10 µM), and the relative
luciferase signal was measured after 48 h using a Dual
Luciferase Assay Kit (Promega). Gratifyingly, we discovered
the compounds 1 (NSC 158959) and 2 (NSC 5476), which
induce a 773 ( 38% and 1251 ( 125% increase in the relative
luciferase signal (Figures 2 and 3).
The identity and purity (>95%) of 1 and 2 was confirmed by
NMR and mass spectrometry. Both compounds were re-assayed
in triplicate with both the psiCHECK-miR122 vector and the
psiCHECK-control vector (no miRNA target sequence), con-
firming their activity as miR-122 inhibitors and validating that
they do not increase the luciferase signal in a non-miRNA
specific fashion (Supporting Figure S2). Both small molecules
were also assayed with our previously described miRNA-21
reporter in HeLa cells (Supporting Figure S3),17 and no activity
was found, suggesting that they are not general inhibitors of
the miRNA pathway but display a degree of specificity for miR-
122.
To validate the activity of 1, a structure-activity relationship
study was undertaken by synthesizing various analogues (Figure
2). Replacement of the halogens with an acetyl (1a) or a nitro
group (1b) at the 4-position of 1 or their removal (1d), resulted
in small activity changes between 5.7 and 6.7 RLU. However,
replacement of the halogens with methoxy groups at the 3- and
4-position (1c) led to a complete loss of activity. Modification
of the naphtyl group was much less tolerated, since replacement
with a larger anthracenyl (1e) or a methylene naphtyl group
(1f) led to virtually complete loss of miR-122 inhibitory activity.
The same is true for the smaller phenyl (1g), p-aminophenyl
(1h), or p-iodophenyl (1i) substituents. Similar changes of the
naphtyl ring in the miR-122 inhibitor 1a also led to complete
loss of activity (1j-1l). Methylation of the amide NH was also
not tolerated (1m).
The structure-activity relationship of the second, more potent
miR-122 inhibitor 2 was also further investigated (Figure 3).
Attempts to structurally simplify the trans-decahydroquinoline
motif by replacing it with piperidine (2a) or dihydroquinoline
(2b) led to a loss of activity. Activity was maintained in the
case of aniline (2c) but was lost through installation of a p-amino
group (2d). The simple sulfonamide 2e showed a 50% reduced
activity which was then gradually improved almost to the level
of the parent compound 2 by installing carbon chains of
increasing length, from methyl (2f), propyl (2g), allyl (2h), and
propargyl (2i), to hexyl (2j). The acylation of the NH group of
any of the miR-122 inhibitors shown in Figure 3 with
CO2CH2CH3 led to a complete abrogation of activity (data not
shown).
Figure 1. MicroRNA miR-122 assay. (a) The developed luciferase reporter
can detect the presence of a functional mature miR-122 through repression
of the luciferase signal. (b) Small molecules are assayed for their ability to
alleviate the suppression by inhibition of miR-122, thus inducing luciferase
expression.
of HCV RNA in human liver cells,13,14 without any toxic effects
in mice and primates.11,15,16
The discovery of small molecule modifiers of miR-122 will
validate this miRNA as a new therapeutic target. Recently, we
reported the first small molecule inhibitors of miRNA function,
specifically miR-21 function.17 These compounds displayed
specificity for miR-21 and induced a reduction of both mature-
miR-21 and primary-miR-21 levels. Additionally, the small
molecule enoxacin has been demonstrated to be a general
activator of both the siRNA and miRNA pathways,18 presum-
ably through promoting the processing and loading of siRNAs/
miRNAs into RISCs by facilitating the interaction between TAR
RNA-binding protein and RNAs.
Results and Discussion
Assay Development. We developed an miRNA small mol-
ecule modifier screen for miR-122 based on the psiCHECK-2
(Promega) reporter plasmid. This construct expresses both
Renilla luciferase and firefly luciferase, allowing for the
normalization of the signal to account for differential cellular
viability (an advantage over our previous reporter constructs17).
The miR-122 target sequence was inserted downstream of the
Renilla luciferase gene, between the PmeI and SgfI restriction
sites (Supporting Information). Thus, the presence of mature
miR-122 will lead to a decrease in the Renilla luciferase signal
(Figure 1a). The ability to detect endogenous miR-122 was
validated by transfecting the generated psiCHECK-miR122
construct into Huh7 and HeLa cells. After a 24 h incubation,
the cells were assayed using a Dual Luciferase Assay Kit
(Promega). Huh7 cells have previously been demonstrated to
express high levels of miRNA-122,15 whereas miR-122 is not
expressed in HeLa cells.19 The psiCHECK-miR122 reporter
verified these results by displaying a >15-fold reduced luciferase
signal in Huh7 cells, in contrast to HeLa cells (Supporting Figure
S1) and, thus, is a cellular sensor for miR-122 expression. The
luciferase signal is readily restored upon the cotransfection with
a miR-122 antagomir, suggesting that the reporter can be
employed in the discovery of miR-122 inhibitors (Figure 1b).
Moreover, a psiCHECK-control reporter (containing an empty
(15) Esau, C.; Davis, S.; Murray, S. F.; Yu, X. X.; Pandey, S. K.; Pear,
M.; Watts, L.; Booten, S. L.; Graham, M.; McKay, R.; Subramaniam,
A.; Propp, S.; Lollo, B. A.; Freier, S.; Bennett, C. F.; Bhanot, S.;
Monia, B. P. Cell Metab. 2006, 3, 87–98.
(16) Elmen, J.; Lindow, M.; Schutz, S.; Lawrence, M.; Petri, A.; Obad,
S.; Lindholm, M.; Hedtjarn, M.; Hansen, H. F.; Berger, U.; Gullans,
S.; Kearney, P.; Sarnow, P.; Straarup, E. M.; Kauppinen, S. Nature
2008, 452, 896–899.
(17) Gumireddy, K.; Young, D. D.; Xiong, X.; Hogenesch, J. B.; Huang,
Q.; Deiters, A. Angew. Chem., Int. Ed. 2008, 47, 7482–7484.
(18) Shan, G.; Li, Y.; Zhang, J.; Li, W.; Szulwach, K. E.; Duan, R.; Faghihi,
M. A.; Khalil, A. M.; Lu, L.; Paroo, Z.; Chan, A. W.; Shi, Z.; Liu,
Q.; Wahlestedt, C.; He, C.; Jin, P. Nat. Biotechnol. 2008, 26, 933–
940.
(19) Cheng, A. M.; Byrom, M. W.; Shelton, J.; Ford, L. P. Nucleic Acids
Res. 2005, 33, 1290–1297.
(20) Zhang, J. H.; Chung, T. D.; Oldenburg, K. R. J. Biomol. Screening
1999, 4, 67–73.
9
J. AM. CHEM. SOC. VOL. 132, NO. 23, 2010 7977

A R T I C L E S
Young et al.
Figure 2. Discovered small molecule inhibitor 1 of miR-122 and preliminary structure-activity investigation. The numbers in parentheses represent relative
luciferase units (RLU) normalized to a DMSO control, and the standard deviation is derived from three independent assays.
Figure 3. Discovered small molecule inhibitor 2 of miR-122 and preliminary structure-activity investigation. The numbers in parentheses represent relative
luciferase units (RLU) normalized to a DMSO control, and the standard deviation is derived from three independent assays.
Compared to healthy liver tissue, miR-122 is reduced by
∼85% in the HCC cell line Huh7 and by 99.5% in the HCC
cell lines HepG2 and Hep3B.5,10 Thus, the screening results
were also analyzed for a further reduction in the relative Renilla
luciferase signal, since this could reveal small molecules that
would activate miR-122 function in Huh7 cells. Several
compounds were identified and reassayed in triplicate with both
the psiCHECK-miR122 vector and the psiCHECK-control
vector. Compound 3 (NSC 308847; Figure 4) was found to be
an activator of miR-122, inducing a 7-fold reduction of the
Renilla luciferase signal (0.11 ( 0.02 RLU). No effect of 3 on
miR-21 controlled luciferase activity17 was observed in HeLa
cells, indicating that 3 is not a general activator of the miRNA
pathway, in contrast to the small molecule enoxacin,18 but shows
specificity toward miR-122 activation. The molecule’s identity
Figure 4. Discovered small molecule activator 3 of miR-122 and
and purity (>95%) were confirmed by both NMR and MS
analysis.
Structural modifications of the miR-122 activator 3 (Figure
preliminary structure-activity investigation. The numbers in parentheses
represent relative luciferase units (RLU) normalized to a DMSO control,
and the standard deviation is derived from three independent assays.
4) were performed. Removal of the NH2 group (3a) displayed
retention of activity; however, replacement with a nitro group
(3b) completely abrogated miR-122 activation. The removal of
both N-methyl groups (3c) and substitution of the ethylamino
group with a proton (3d) led to an increasing loss of activity.
Other modifications of that group, e.g. with a methylcarboxylate
9
7978 J. AM. CHEM. SOC. VOL. 132, NO. 23, 2010

Small Molecule Modifiers of MicroRNA miR-122
A R T I C L E S
(Figure 6),21 indicating a down-regulation to 22% and 3% for
1 and 2, respectively. Thus, the miR-122 inhibitors 1 and 2 seem
to be targeting the transcription of the miRNA gene into primary
miRNA, rather than other components of the miRNA pathway.
Interestingly, the pri-miR-122 levels are reduced further than
the miR-122 levels in the presence of the small molecule
inhibitors. One explanation could be that in the presence of the
small molecule inhibitors the pri-miRNA processing to mature
miRNA is faster than the transcription of the miRNA gene. Up-
regulation of pri-miR-122 was observed in the presence of 3,
thus indicating that the repression of miR-122 expression in
hepatocellular carcinoma cells may be caused on the transcrip-
tional level. All compounds were additionally assessed by RT
PCR for miR-21, and within the error margin, no effect was
observed. This confirms the data obtained in the luciferase assays
and again suggests a degree of specificity of the small molecule
modifiers 1-3 for miR-122.
Figure 5. Luciferase assay dose response curves for compounds 1-3. The
insert shows only the activator 3. All assays were conducted in triplicate
and normalized to a DMSO control. Error bars represent standard deviations.
Reduction of Hepatitis C Virus Replication by miR-122
Inhibitors. The inhibition of miR-122 by antisense oligonucle-
otides (antagomirs) results in a reduction of HCV replication
in human liver cells (Huh7).11-14 A binding site for miR-122
was predicted to reside close to the 5′ end of the viral genome,
revealing a genetic interaction between miR-122 and the viral
RNA genome. Moreover, it has been shown that interferon ꢀ,
currently the most common HCV therapeutic (together with
interferon R), modulates the expression of several miRNAs
which have target sequences in the HCV genome.22 MicroRNA
miR-122 was the only down-regulated miRNA (by ∼80%), and
it was demonstrated that this down-regulation plays an important
role in the antiviral effects of interferon ꢀ against HCV. Due to
the efficient down-regulation of miRNA-122 by the small
molecule inhibitors 1 and 2, both compounds were tested for
their ability to inhibit HCV replication in Huh7 cells. The
pHtat2Neo/QR/KR/FV/SI plasmid (provided by Dr. Stanley
Lemon) was used to generate genotype 1a H77c RNA, which
was subsequently transfected into Huh7 cells.23 The cells were
then either transfected with a miR-122 antagomir (positive
control) or treated with compounds 1 and 2 (10 µM) or DMSO
(negative control). After 48 h, total RNA was isolated and HCV
RNA levels were measured by quantitative RT PCR (Figure
7). In agreement with previous reports, the antagomir reduced
HCV RNA levels to 20%.13,14 Moreover, the small molecule
miR-122 inhibitors 1 and 2 elicited a reduction in viral load to
48% and 47%, respectively. These results provide an opportunity
for the development of fundamentally new small molecule drugs
for the treatment of HCV infection. Since the compounds 1 and
2 target a critical host component at the miRNA-mRNA
host-pathogen interface, the virus will most likely not be able
to develop a resistance to those molecules or other miR-122
inhibitors.
Figure 6. RT PCR quantification of miR-122 and pri-miR-122 in Huh7
cells, and miR-21 in HeLa cells exposed to (A) inhibitors 1 and 2 (10 µM)
and (B) activator 3 (10 µM). All experiments were conducted in triplicate,
and the data was normalized to a DMSO control.
(3e), ethylhydroxy (3f), or a naphtyl group (3g), also induced a
complete loss of miR-122 activation.
A dose dependent response was established for all three
compounds, revealing EC50 values of 3 µM and 0.6 µM for the
inhibitors 1 and 2, respectively. The miR-122 activator 3
displayed an IC50 of 3 µM (Figure 5).
The activity of the small molecule modifiers was then
analyzed by quantitative RT PCR to measure their direct effects
on miR-122 expression levels in Huh7 cells. Cells were
incubated with 1-3 (10 µM) for 48 h, followed by total RNA
isolation (miR Premier miRNA Isolation Kit; Aldrich) and
quantification by RT PCR using TaqMan primers (Applied
Biosystems). The sulfonamide 2 elicited a 72% knock-down of
mature miR-122 levels relative to DMSO treated cells (Figure
6). The amide 1 displayed only a 45% knock-down, which is
consistent with the lower activity of 1 observed in the functional
assay. The small molecule activator 3 led to a 438% increase
in miR-122 expression levels.
Preliminary studies on the mode of action of the small
molecules 1-3 were conducted by investigating their interaction
with the miRNA oligonucleotide. Melting experiments were
performed, which demonstrated that the small molecule modi-
fiers do not seem to directly interact with the RNA (see
Supporting Information, Figures S5-S8). To further investigate
the mode of action of 1-3, the intracellular levels of the primary
miRNA were measured by quantitative RT PCR with primers
specifically designed to be unique to the pri-miR-122 sequence
Induction of Apoptosis in Hepatocellular Carcinoma Cells
by a miR-122 Activator. As discussed above, miR-122 is greatly
down-regulated in HCC compared to healthy liver tissue, thus
inducing an upregulation of the antiapoptotic miR-122 target
Bcl-w, which subsequently leads to a deactivation of caspase-3
and an enhanced viability of cancer cells.10 Treatment of HepG2
(21) Tsai, W. C.; Hsu, P. W.; Lai, T. C.; Chau, G. Y.; Lin, C. W.; Chen,
C. M.; Lin, C. D.; Liao, Y. L.; Wang, J. L.; Chau, Y. P.; Hsu, M. T.;
Hsiao, M.; Huang, H. D.; Tsou, A. P. Hepatology 2009, 49, 1571–
1582.
(22) Pedersen, I. M.; Cheng, G.; Wieland, S.; Volinia, S.; Croce, C. M.;
Chisari, F. V.; David, M. Nature 2007, 449, 919–922.
(23) Yi, M.; Lemon, S. M. J. Virol. 2004, 78, 7904–7915.
9
J. AM. CHEM. SOC. VOL. 132, NO. 23, 2010 7979

A R T I C L E S
Young et al.
selective apoptosis inducing effect in cells with pathologically
low levels of miR-122. Thus, a small molecule activator of miR-
122, like 3, has therapeutic relevance toward the selective
treatment of HCC.
Summary
We have discovered small molecule modifiers of the impor-
tant liver-specific microRNA miR-122 and demonstrated for the
first time that small molecule inhibitors and activators of miRNA
function have therapeutic potential. To achieve this, a reporter
system for the activation or inhibition of miR-122 function was
established and used for the screening of a small molecule
library. The identified miRNA modifiers 1-3 are not general
inhibitors or activators of the miRNA pathway but induce a
down- and up-regulation of miR-122. Further investigation into
their mode of action revealed that they act on the transcriptional
regulation of miR-122. Most importantly, aberrantly regulated
miR-122 is involved in the development of heptocellular
carcinoma (HCC), and miR-122 is a cellular component required
by the hepatitis C virus (HCV) for viral replication. We
demonstrated that our small molecule miR-122 inhibitor 2
inhibits HCV replication in liver cells, thus demonstrating a
fundamentally novel approach to the development of small
molecule therapeutics for HCV infection. Moreover, the small
molecule activator 3 induced an increased expression of the pro-
apoptotic miR-122 in the HCC cell line HepG2, leading to
increased caspase expression and reduced cell viability. These
small molecule miRNA activators and inhibitors represent
unique tools for the elucidation of miR-122 biogenesis and
regulation in healthy liver tissue and in HCC and have the
potential to provide new targets and lead structures for the
development of new chemotherapeutics.
Figure 7. Effects of miR-122 inhibitors 1 and 2 on HCV replication in
Huh7 cells. Both compounds led to a substantial reduction of viral RNA in
infected cells. Control experiments contain only 1% DMSO and no
compound. All experiments were conducted in triplicate.
Experimental Section
Reporter Plasmid Construction. The psiCHECK-2 plasmid (1
µg; Promega) was sequentially digested with SgfI (10 units, 50 µL
reaction; Promega) followed by PmeI (10 units; New England
Biolabs) and was gel purified. Insert DNA containing the miR122
binding site was purchased from IDT DNA (5′ CGCAGTA-
GAGCTCTAGTACAAACACCATTGTCACACTCCAGTTT 3′ and
5′ AAACTGGAGTGTGACAATGGTGTTTGTACTAGAGCT-
CTACTGCGAT 3′) and hybridized (90 °C, cooled to 4 °C over 5
min, then 4 °C for 60 min) and ligated with T4 ligase (200 units,
10 µL reaction, 1:10 vector/insert ratio; New England Biolabs) into
the digested psiCHECK-2 vector. Positive colonies were selected
by PCR colony screens, and the construction of the psiCHECK-
miR122 vector was confirmed by sequencing (sequencing primer:
5′ GCTAAGAAGTTCCCT 3′; IDT DNA).
Cell Culture. Experiments were performed using Huh7, HeLa,
and HeLa-miR-21-Luc cell lines cultured in Dulbecco’s Modified
Eagle Medium (DMEM; Hyclone) supplemented with 10% Fetal
Bovine Serum (FBS; Hyclone) and 2% penicillin/streptomycin (MP
Biomedicals) and maintained at 37 °C in a 5% CO2 atmosphere.
Hep2G cells were cultured in Eagle’s Minimum Essential Medium
(Hyclone) supplemented with 10% FBS (Hyclone) and 0.5 mM
sodium pyruvate.
Assessment of psiCHECK-miR122 Reporter System. Huh7
and HeLa cells were transfected at approximately 60% confluency
with either the psiCHECK-Control plasmid (the original psiCHECK-2
plasmid containing no known miRNA binding site) or the
psiCHECK-miR122 plasmid (0.5 µg) using X-tremGENE trans-
fection reagent (3:2 reagent/DNA ratio; Roche) in Opti-Mem media
(Invitrogen). All transfections were performed in triplicate for
statistical analysis. The cells were incubated at 37 °C for 4 h
followed by the replacement of transfection media with standard
DMEM growth media. After 48 h of incubation the media was
Figure 8. Effects of the miR-122 activator 3 on HepG2 cell viability. (A)
An increased caspase 3/7 level is observed in HepG2 cells due to activation
of the pro-apoptotic miR-122. This increase is more pronounced in HepG2
than Huh7 cells, due to the different basal miR-122 levels in both cell lines.
(B) The increase in caspase-3 activity leads to a loss of cellular viability in
HepG2 cells exposed to 3 (10 µM) relative to Huh7 cells. Control
experiments contain only 1% DMSO and no compound.
cells with the miR-122 activator 3 (10 µM) led to an ap-
proximate 20-fold increase in the activity of caspase-3 and -7
(Caspase-Glo 3/7, Promega), suggesting that the increased levels
of miR-122 are capable of inducing apoptosis. This enhanced
caspase activity led to a reduced cell viability of ∼20%
(CellTiter-Glo, Promega) (Figure 8), exceeding previously
reported reductions in cell viability due to lentiviral overex-
pression of miR-122 in HepG2 cells.10 The cell viability of Huh7
cells, which express 60-fold higher miR-122 levels than HepG2
levels, is only slightly affected by exposure to 3, suggesting a
9
7980 J. AM. CHEM. SOC. VOL. 132, NO. 23, 2010

Small Molecule Modifiers of MicroRNA miR-122
A R T I C L E S
removed, and cells were lysed and assayed with a Dual Luciferase
Assay Kit (Promega) using a Wallac VICTOR3V luminometer with
a measurement time of 1 s and a delay time of 2 s. The ratio of
Renilla to firefly luciferase expression was calculated for each of
the triplicates, the data were averaged, and standard deviations were
calculated (Supporting Figure S1).
Assay for Small Molecule Effectors of miR-122. Huh7 cells
were transfected with the psiCHECK-miR122 plasmid in 96-well
plates as previously described. After 4 h of incubation the
transfection media was removed and replaced with DMEM growth
media (100 µL) supplemented with 10 µM of the small molecules
(NCI Diversity Set II; 1% DMSO final concentration). Cells were
incubated for 48 h followed by analysis with a Dual Luciferase
Assay Kit (Promega) as previously described.
Quantitative Real Time PCR Analysis. Huh7 cells were
passaged into 6-well plates, grown to 60% confluency, and treated
with compounds 1-3 (10 µM) or DMSO (1% final DMSO
concentration). Each treatment was conducted in triplicate to ensure
statistical validity. Cells were then incubated at 37 °C for 48 h
(DMEM, 5% CO2). The media was removed, and cells were washed
with PBS buffer (2 × 2 mL, pH 7.4) followed by RNA isolation
with the mirPremier microRNA Isolation Kit (Aldrich). The RNA
was quantified using a Nanodrop ND-1000 spectrophotometer, and
10 ng of each RNA sample were reverse transcribed using the
TaqMan microRNA Reverse Transcription Kit (Applied Biosys-
tems) in conjunction with either the miR-122 or miR-21 TaqMan
RT primer (16 °C, 30 min; 42 °C, 30 min; 85 °C, 5 min).
Quantitative Real Time PCR was conducted with a TaqMan 2×
Universal PCR Master Mix and the appropriate TaqMan miRNA
assay (Applied Biosystems) on a BioRad MyiQ RT-PCR ther-
mocycler (1.3 µL RT PCR product; 95 °C, 10 min; followed by 40
cycles of 95 °C, 15 s; 60 °C, 60 s). Threshold cycles were used to
determine miRNA copy numbers, and the levels of miR-122 and
miR-21 were compared via determination of threshold cycle (Ct)
and conversion to copy number (copy number ) 10[(Ct - 37.4)/
-3.3]).24 The data were then normalized to the DMSO control.
The samples were also analyzed by real time PCR for the presence
of pri-miR-122 transcript using the previously described primers
(5′ GCTCTTCCCATTGCTCAAGATG 3′ and 5′ GTATGTAA-
CAACAGCATGTG 3′; IDT DNA) and iQ SYBR Green Supermix
for the real time PCR (95 °C, 3 min; followed by 40 cycles of 95
°C, 15 s; 60 °C, 60 s).21
in Opti-Mem media (Invitrogen). After a 4 h incubation at 37 °C,
the transfection media was removed and replaced with standard
growth media (2 mL) supplemented with 10 µM of 1 or 2 (1%
DMSO final concentration). All experiments were conducted in
triplicate for statistical validation. Cells were incubated for 48 h at
37 °C, followed by media removal and washing with PBS buffer
(2 × 2 mL, pH 7.4), followed by RNA isolation (mirPremier
microRNA Isolation Kit, Aldrich). Quantitative RT-PCR was then
performed as previously described using the general HCV RT-PCR
Primers (5′: CGGGAGAGCCATAGTGGTCTGCG 3′ and 5′
CTCGCAAGCACCCTATCAGGCAGTA 3′) and GADPH primers
(5′ TGCACCACCAACTGCTTAGC 3′ and 5′ GGCATGGACT-
GTGGTCATGAG 3′) as a standard control.
Effects of the miR-122 Activator on Caspase Activity. Both
HepG2 and Huh7 cells were passaged into a 96-well plate and
grown to 70% confluency. The media was then removed and
replaced with standard growth media supplemented with 3 (10 µM)
or a DMSO control (1% final DMSO concentration in all wells)
and incubated for 48 h at 37 °C. All incubations were conducted
in triplicate to ensure statistical validity. The media was removed
and cells were assayed with the Caspase-Glo 3/7 (Promega) kit
according to the manufacturers directions, and luminescence was
measured using a Wallac VICTOR3V luminometer with a measure-
ment time of 1 s and a delay time of 2 s.
Effects of miRNA Small Molecule Modifiers on Cell
Viability. HepG2 and Huh7 cells were passaged into a 96-well
plate and grown to 60% confluency. The media was then removed
and replaced with standard growth media supplemented with
increasing concentrations of the miR-122 small molecule modifiers
(0-20 µM; 1% final DMSO concentration) and incubated for 48 h
at 37 °C. Cellular viability was then assessed using a Cell-Titer
Glo Assay (Promega) according to the manufacturers directions,
and luminescence was measured using a Wallac VICTOR3V
luminometer with a measurement time of 1 s and a delay time of
2 s.
Acknowledgment. We thank Dr. Stanley Lemon (UTMB) for
providing the pHtat2Neo/QR/KR/FV/SI plasmid, and the NCI for
providing the Diversity Set II. We acknowledge financial support
from the Department of Chemistry at North Carolina State
University and the Teva USA Scholars Grants Program, adminis-
tered by the American Chemical Society Office of Research Grants.
D.D.Y. acknowledges a graduate research fellowship from the ACS
Medicinal Chemistry Division.
Effect of Small Molecule miR-122 Inhibitors on HCV
Replication. The pHtat2Neo/QR/KR/FV/SI plasmid (provided by
Dr. Stanley Lemon)23 was linearized using XbaI (10 units, 50 µL
reaction; New England Biolabs), followed by transcription with T7
RNA Polymerase (6 h, 37 °C) and purification on Microcon 10
columns. Huh7 cells were then grown to 60% confluency in a 6-well
plate and transfected with 1 µg of RNA using X-tremGENE
transfection reagent (Roche Applied Science, 3:2 reagent/RNA ratio)
Supporting Information Available: Additional experimental
details and supporting figures, synthetic protocols, and analytical
data of organic compounds. This material is available free of
charge via the Internet at http://pubs.acs.org.
(24) Medhurst, A. D.; Pangalos, M. N. Methods Mol. Med. 2003, 79, 229–
241.
JA910275U
9
J. AM. CHEM. SOC. VOL. 132, NO. 23, 2010 7981