Synthesis and biological evaluation of (1,2,4)triazole[4,3-a]pyridine derivatives as potential therapeutic agents for concanavalin A-induced hepatitis

Article abstract of DOI:10.1016/j.ejmech.2019.06.025

A series of (1,2,4)triazole[4,3-a]pyridine (TZP) derivatives have been designed and synthesized. Compound 8d was identified as having the most potent inhibitory activity on NO release in response to lipopolysaccharide (LPS) stimulation and inhibition of the migration induced by MCP-1 protein on RAW264.7 macrophages. Based on the screening data, an immunofluorescence assay and a real-time qPCR assay were conducted, indicating that compound 8d suppressed NF-κB p65 translocation and expression of inflammatory genes by concanavalin A (Con A)-induced RAW264.7 macrophages. More importantly, 8d also exhibited potent efficacy, alleviating Con A-induced hepatitis by downregulating the levels of plasma alanine transaminase (ALT), aspartate transaminase (AST) and inflammatory infiltration in a mouse autoimmune hepatitis (AIH) model. In addition, the flow cytometry (FCM) data showed that compound 8d inhibited the accumulation of MDSCs in the liver of Con A-induced mice. These findings raise the possibility that compound 8d might serve as a potential agent for the treatment of AIH.

Full text of DOI:10.1016/j.ejmech.2019.06.025

Accepted Manuscript
Synthesis and biological evaluation of (1,2,4)triazole[4,3-a]pyridine derivatives as
potential therapeutic agents for concanavalin A-induced hepatitis
Yaojie Shi, Qianqian Wang, Juan Rong, Jing Ren, Xuejiao Song, Xiaoli Fan, Mengyi
Shen, Yong Xia, Ningyu Wang, Zhihao Liu, Quanfang Hu, Tinghong Ye, Luoting Yu
PII:
S0223-5234(19)30550-1
DOI:
https://doi.org/10.1016/j.ejmech.2019.06.025
EJMECH 11428
Reference:
To appear in: European Journal of Medicinal Chemistry
Received Date: 22 April 2019
Revised Date: 28 May 2019
Accepted Date: 8 June 2019
Please cite this article as: Y. Shi, Q. Wang, J. Rong, J. Ren, X. Song, X. Fan, M. Shen, Y. Xia, N.
Wang, Z. Liu, Q. Hu, T. Ye, L. Yu, Synthesis and biological evaluation of (1,2,4)triazole[4,3-a]pyridine
derivatives as potential therapeutic agents for concanavalin A-induced hepatitis, European Journal of
Medicinal Chemistry (2019), doi: https://doi.org/10.1016/j.ejmech.2019.06.025.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT
Synthesis and biological evaluation of (1,2,4)triazole[4,3-a]pyridine
derivatives as potential therapeutic agents for concanavalin
A-induced hepatitis
a,1
a,1
a
a
Yaojie Shi , Qianqian Wang , Juan Rong , Jing Ren , Xuejiao
b
c
c
a
d
Song , Xiaoli Fan , Mengyi Shen , Yong Xia , Ningyu Wang ,
Zhihao Liu a, Quanfang Hu a, Tinghong Ye a,*, Luoting Yu a,*
a Laboratory of Liver Surgery, State Key Laboratory of Biotherapy and Cancer Center, West China
Hospital, Sichuan University and Collaborative Innovation Center of Biotherapy, Chengdu,
Sichuan, 610041, China.
b
Research Center for Public Health & Preventive Medicine, West China School of Public Health
& Healthy Food Evaluation Research Center/No.4 West China Teaching Hospital, Sichuan
University, Chengdu, Sichuan, 610041, China.
c
Division of Digestive Diseases, West China Hospital, West China Medical School, Sichuan
University, Chengdu, 610041, China.
d School of Life Science and Engineering, Southwest JiaoTong University, Chengdu, Sichuan,
611756, China.
*
Corresponding author. State Key Laboratory of Biotherapy, West China Hospital, Sichuan
University and Collaborative Innovation Center of Biotherapy, Chengdu, Sichuan, 610041, China.
E-mail:yeth1309@scu.edu.cn; yuluot@scu.edu.cn; Fax: +86 28 8516 4060; Tel: +86 28 8516
4063.
1 These authors contribute equally to this work.
Highlights
A series of new (1,2,4)triazole[4,3-a]pyridine derivatives were synthesized.
8d suppressed NF-κB p65 translocation and expression of inflammatory genes.
Preliminary mechanisms of anti-inflammatory action were discovered.
8d could be a lead compound as AIH therapeutic agent.

ACCEPTED MANUSCRIPT
Abstract
A series of (1,2,4)triazole[4,3-a]pyridine (TZP) derivatives have been designed and synthesized.
Compound 8d was identified as having the most potent inhibitory activity on NO release in
response to lipopolysaccharide (LPS) stimulation and inhibition of the migration induced by
MCP-1 protein on RAW264.7 macrophages. Based on the screening data, an immunofluorescence
assay and a real-time qPCR assay were conducted, indicating that compound 8d suppressed
NF-κB p65 translocation and expression of inflammatory genes by concanavalin A (Con
A)-induced RAW264.7 macrophages. More importantly, 8d also exhibited potent efficacy,
alleviating Con A-induced hepatitis by downregulating the levels of plasma alanine transaminase
(ALT), aspartate transaminase (AST) and inflammatory infiltration in a mouse autoimmune
hepatitis (AIH) model. In addition, the flow cytometry (FCM) data showed that compound 8d
inhibited the accumulation of MDSCs in the liver of Con A-induced mice. These findings raise the
possibility that compound 8d might serve as a potential agent for the treatment of AIH.
Keywords: triazole[4,3-a]pyridine anti-inflammatory AIH
1. Introduction
Inflammation is part of the complex biological response of body tissues to infection and injury
and is a protective response involving the recruitment of immune systems and molecular
mediators to eliminate the initial cause of cell injury1. Prolonged activation of the immune system
is associated with activation of inducible NO synthase (iNOS) and the release of pro-inflammatory
cytokines, such as nitric oxide (NO) and tumor necrosis factor-alpha (TNF-α), which play an
important role in inflammation cascades. The excessive inflammatory activation or deregulation of
mechanisms of the subsequent removal of inflammatory cells from the inflammatory
microenvironment may underlie a vast variety of diseases, including autoinflammatory diseases,
inflammatory bowel disease2, 3, rheumatoid arthritis and autoimmune hepatitis (AIH) 4.
AIH is a chronic autoimmune liver disease with an unknown pathogenesis where the body's
immune system attacks liver cells, causing the liver to be inflamed. It was first described by Jan
Waldenström and Henry Kunkel independently in the early 1950s5. Although AIH by definition is
a chronic disease that may lead to cirrhosis, hepatocellular carcinoma (HCC), and/or death, it is
characterized by elevated transaminase levels and a mixed histological infiltrate of plasma cells
and lymphocytes. Sustained immunosuppressive therapy with a high dose of prednisolone with or
without azathioprine is the standard therapy6 for alleviating liver inflammation and fibrosis and to
induce remission (a decrease in serum aminotransferase) and prevent liver decompensation4.

ACCEPTED MANUSCRIPT
Long-term treatment with prednisolone may cause cosmetic changes such as weight gain, acne,
moon face, and severe side effects including osteopenia and malignancy7, 8. The most common
side effects of azathioprine are cytopenia, nausea, arthralgia, fever, and skin rash, and some
patients may even develop severe side effects such as cholestatic hepatitis, pancreatitis,
opportunistic infections and bone marrow suppression7, 8. Although some patients remain in
remission after drug treatment is withdrawn, most require long-term maintenance therapy.
Additionally, many patients are not responsive to standard treatment or fail to achieve a remission,
and therefore, there is an urgent need for novel and perhaps a small molecules-based approach to
AIH. Con A-induced model is a typical animal model for investigating T-cell and macrophage
dependent hepatitis in mice, which closely mimics the pathogenesis mechanisms and pathological
changes of patients, and provides a valuable tool for rapidly assessing novel therapeutic
approaches for AIH9.
NO is a gaseous signaling molecule that plays an important role in various physiological
12
processes10 especially in inflammation11,
. Since the identification of NO as an
endothelium-derived endogenous messenger responsible for vascular smooth muscle relaxation13,
14, there has been a burst of research into this key messenger. A large body of evidence supports
the direct role of NO in inflammation15 and tissue injury. In addition, the number of researchers
who have delved into understanding how NO regulates tumor immunology16, allergy and
autoimmunity17 has increased in the past decade. NO modulates transcription/translation indirectly
by affecting signaling pathways, such as mitogen activated protein kinase, phosphatidylinositol-3
kinase, G-protein18 and NF-kappa B19.
Overproduction of NO by iNOS generally destroys functional normal tissues during
inflammation. Alterations in NO synthesis by endogenous systems can influence these
inflammatory processes20 and macrophages are the most representative iNOS-expressing innate
immune cells21. These findings suggest that evaluating the NO releasing level may be a promising
method for screening of anti-inflammation agent/compounds. In our continued concern about new
potential small molecules that can be used as anti-inflammation agents, screening of our small
molecule library was carried out, leading to the discovery of compound 3b (Figure 1), which is a
triazolopyridine derivative. The triazolopyridines have been identified as one of the promising
scaffolds in medicinal chemistry, which possess a wide range of biological activities, such as p38
inhibitors22-25, c-Met inhibitors26, protein tyrosine kinase modulators27 and dipeptidyl peptidase IV
inhibitors28.

ACCEPTED MANUSCRIPT
Figure 1. Structure of Compound 3b.
We focused our attention on the (1,2,4)triazole[4,3-a]pyridine (TZP) motif owing to the
(1,2,4)triazole core structure being able to serve as a suitable hydrogen bonding acceptor, which is
thought to be essential for its pharmacological activity. In the current study, we designed and
prepared the derivatives of TZP depicted in Scheme 1. Considering the potential toxicity of nitro
compounds, we reduced the nitro group at the 8-position of TZP for substitution with different
materials. Structure-activity relationship (SAR) optimization of substituents at the C-6 and C-8
positions of the TZP core resulted in the identification of compound 8d as a potent inhibitor of NO
release evoked by LPS and the expression of TNF-α, IFN-γ, IL-6 and IL-10 cytokine mRNAs
induced by Con A in RAW264.7 macrophages.
Scheme 1. Synthesis of TZP Derivatives.
Reagents and conditions: (i) N2H4·H2O, 1,4-dioxane, reflux, 1 h; (ii) trimethyl orthoacetate,
1,4-dioxane, reflux, 1 h; (iii) substituted boric acid, Pd(dppf)2Cl2, Na2CO3, 1,4-dioxane/H2O,
90 °C, 4–6 h; (iv) Fe, NH4Cl, THF/EtOH/H2O, 90 °C, 1 h; (v) substituted boric acid or borate,
Pd(dppf)2Cl2, Na2CO3, 1,4-dioxane/H2O, 90 °C, 4–6 h; (vi) acetyl chloride or cyclohexane
carboxylic acid chloride or cyclobutane carboxylic acid chloride, K2CO3, DCM, 0 °C-rt; (viii)
ethanesulfonyl chloride, Et3N or pyridine, DCM, 0 °C-rt; and (viii) aromatic acid chloride,
pyridine, DCM, 0 °C-rt.

ACCEPTED MANUSCRIPT
2. Results and discussion
2.1 Chemistry
The synthesis of TZP derivatives is depicted in Scheme 1. The key intermediate
6-bromo-3-methyl-[1,2,4]triazolo[4,3-a]pyridin-8-amine (4) for the preparation was synthesized
from 5-bromo-2-chloro-3-nitropyridine that was treated with hydrazine hydrate in 1,4-dioxane.
Then, the crude product 2 was heated to reflux in the presence of trimethyl orthoacetate to produce
compound 3, which was directly reduced by Fe/NH4Cl to the target compound 4. Subsequently,
substituted boric acid or borate with bromopyridine 4 under standard Suzuki-Miyaura coupling
conditions provided intermediate 5 in good yield. Amidation or sulfonylation gave target
compounds 6a–q, 7a–k, and 8a–f in excellent yield. The characterization of individual target
compounds can be found in the Supporting Information. Individual compounds with a purity
of >95% were used for the subsequent experiments.
2.2 Biology evaluation
2.2.1 Measurement of NO production in murine RAW264.7 macrophages upon LPS
stimulation
Macrophages are important effector cells in the inflammatory response process and respond to
pathogenic agents by synthesizing NO from iNOS. The NO production inhibitory activities of the
TZP derivatives at a concentration of 20 µM were measured in RAW264.7 macrophages after
lipopolysaccharide (LPS) treatment. The ability (relative amount of NO compared to LPS %) of
the tested compounds to reduce NO release is summarized in Tables 1–3 and Figure 2. As shown
in Table 1 and Figure 1, NO production in LPS-stimulated RAW264.7 macrophages was
suppressed by compounds 6a–q after 24 h incubation. Among them, when R2 is methyl, 6j with
2,5-disubstituted in the R1 benzene ring, exhibited remarkable inhibitory activity against
LPS-induced RAW264.7 macrophages NO production with an relative amount of 27.05±0.34%.
The above results indicated that the introduction of 5-chloro in R1 increased its activity. In
addition, replacement of the 2-benzyloxy in R1 (6j) with 2-alkoxy, including methoxy (6k), ethoxy
(6l), and propoxy (6m), slightly decreased the inhibitory activity. However, 6m shows a
comparable activity with 6j. Thus, we can make a statement that phenoxy and alkoxy are needed
for the inhibitory activity of the TZP derivatives of compounds 6a–q. With the introduction of
cyclohexyl in R2, compounds 6p–q showed less potency than 3b. In addition, comparing the
activities of compound 6o with 2-methoxypyridine in R1 and 6a–g, the results shown in Table 1
indicate that the aromatic heterocyclic ring in R1 is compatible with the activity.
Table 1. NO release relative amount of compounds 6a–q

ACCEPTED MANUSCRIPT
relative amount of NO
compared to LPS %
44.71±1.19
48.41±1.04
83.06±6.16
42.36±0.59
55.30±0.34
64.96±4.09
49.52±3.52
42.40±0.01
49.03±1.12
27.05±0.34
58.83±3.15
32.07±2.49
49.05±2.37
65.85±3.74
54.04±3.91
37.80±1.44
49.99±1.61
26.74±0.57
96.06±1.40
Compound
R1
R2
6a
6b
6c
6d
6e
6f
Ph
o-Cl-phenyl
Me
Me
o-F-phenyl
Me
o-CF3-phenyl
Me
m-OMe-phenyl
m-NHSO2Et-phenyl
m-OCF3-phenyl
4-morpholinomethyl-phenyl
1,1'-biphenyl-2-yl
2-benzyloxy-5-Cl-phenyl
2-OMe-5-Me-phenyl
2-OEt-5-Me-phenyl
5-Cl-2-propoxy-phenyl
2-OEt-4-F-phenyl
2-methoxypyridine
2-OEt-5-F-phenyl
2-methoxypyridine
-
Me
Me
6g
6h
6i
Me
Me
Me
6j
Me
6k
6l
Me
Me
6m
6n
6o
6p
6q
3b
LPS
Me
Me
Me
cyclohexyl
cyclohexyl
-
-
-
In consideration that sulfonamide is an important pharmacophore having attractive
pharmacological properties, compounds 7a–k were rapidly synthesized by using ethanesulfonyl
chloride reacting with intermediate 5. As shown in Table 2, most of the synthesized TZP analogues
showed inhibitory potency except 7e. Among them, 7b and 7j showed significant inhibitory
activities of NO production, especially 7j that showed better activity than 3b. Compared with 6j
and 7j, this further indicated that 2,5-disubstituted in the R1 benzene ring is important for the
activity. However, when compared with the activities of bulky group-substituted derivatives,
including compounds 7f, and 7g, the results suggested that a bulky group is not an optimal group

ACCEPTED MANUSCRIPT
for the development of an inhibitory activity on NO release. Similarly, comparing compounds 6o
and 7a–d, the results indicated that an aromatic heterocyclic ring in R1 is compatible with the
activity.
Table 2. NO release relative amount of compounds 7a–k
relative amount of NO
Compound
R1
R3
compared to LPS %
44.44±0.71
27.18±1.22
41.19±1.23
58.67±2.88
152.42±4.59
62.68±1.13
72.57±6.33
45.48±3.49
34.85±0.83
26.01±0.62
49.93±0.86
26.74±0.57
102.81±1.90
7a
7b
7c
7d
7e
7f
Ph
Et
Et
Et
Et
Et
Et
Et
Et
Et
Et
Et
m-CF3-phenyl
m-NHSO2Et-phenyl
o-CF3-phenyl
o-Cl-phenyl
1,1'-biphenyl-2-yl
2-benzyloxy-phenyl
2-OMe-5-Me-phenyl
2-OEt-4-F-phenyl
2-benzyloxy-5-Cl-phenyl
2-methoxypyridine
7g
7h
7i
7j
7k
3b
LPS
-
-
On the basis of the above results, eight TZP analogues 8a–f were synthesized by replacing the
R2 by benzene rings with different substitutions. Consistent with the above SAR analysis,
2,5-substituted in R1 is the optimal group for the activity as shown in Table 3 (8d–f). Among them,
compound 8d with a 5-F-2-OMe-phenyl group at the R1-moiety and p-OEt group at the R4-moiety
exhibited better activity than 3b with relative amount of 28.01±0.29%. It is also worth mentioning
that p-substituted in R4 is advantageous for the inhibitory activity, such as 8d with p-OEt
substituted. In contrast, o-substituted in R4 is disadvantageous for the inhibitory activity, such as
8c with o-F substituted.
Table 3. NO release relative amount of compounds 8a–f

ACCEPTED MANUSCRIPT
relative amount of
NO compared to
LPS %
Compound
R1
R4
8a
8b
8c
p-Cl-phenyl
p-Cl-phenyl
p-F
42.88±0.58
30.98±2.39
77.73±1.20
28.01±0.29
61.96±2.76
32.06±1.37
26.74±0.57
99.19±2.17
m-CF3
5-Cl-2-propoxy-phenyl
5-F-2-OMe-phenyl
5-F-2-OMe-phenyl
5-F-2-OMe-phenyl
-
o-F
8d
8e
p-OEt
2,6-diF
8f
4-benzyloxy-2-Cl
3b
LPS
-
-
-
Figure 2. Inhibition of NO release by compounds 6a–q, 7a–k and 8a–f
RAW264.7 cells were pretreated with compounds 6a–q for 1 h, incubated with LPS (1 µg/mL) for
another 23 h, NO release was measured using Griess Reagent assay (*** p<0.001, ** p<0.01).
2.2.2 Measurement of inhibition of the migration of RAW264.7 macrophages induced by
MCP-1 protein
Macrophage migration ability plays an essential role and is a prerequisite for their participation in
immune and inflammatory responses29. Monocyte chemotactic protein-1 (MCP-1), also known as
chemokine (C-C motif) ligand 2 (CCL2), appears to be an important component of the recruitment
of macrophages to inflammatory lesions30. Deregulated migration of macrophages has been
implicated in a variety of human disorders, such as chronic inflammation, neurodegenerative
disease and tumor metastasis29. To evaluate the inhibitory effects of TZP derivatives on

ACCEPTED MANUSCRIPT
MCP-1-mediated chemotactic responses, we conducted chemotactic migration assays to
investigate the effects of synthetic compounds on the migration of RAW264.7 cells. Given the
structures of the different series, we chose representative compounds that had striking inhibitory
activities on NO release relative amount, shown in Figure 3. AS60524031, an established PI3Kγ
inhibitor, was used as the reference agent and has been proven to ameliorate Con A-induced liver
injury in a murine model32.
O
O
S
NH
O
NO2
N
NH
N
N
N
N
Cl
N
H
N
N
O
N
F
N
S
O
O
O
compound 3b
compound 6p
compound 7l
O
O
F3C
NH
NH
O
N
N
N
HN
O
F
N
N
O
N
N
S
N
Cl
O
compound 8d
compound 8b
AS605240
Figure 3. Structures of representative TZP derivatives and AS605240.
As illustrated in Figure 4, the tested compounds showed different inhibitory effects on cell
migration at a concentration of 20 µM. Interestingly, compound 6p, that only showed a mild NO
release inhibitory activity, has an excellent inhibitory rate against MCP-1 mediated chemotaxis. In
contrast to that, compound 7l, which showed an outstanding NO release inhibitory activity, had a
much lower activity on RAW264.7 macrophages chemotaxis.
Among these derivatives, compound 8d showed the most potent and better activity than that of
AS605240, with inhibitory rate of 52.59±7.39% and 40.55±6.05 (P<0.001), respectively.
Compound 8d also exhibited an effective inhibition activity on the LPS stimulated RAW264.7
macrophages NO release inhibitory activity. Due to these results, 8d is quite worthy of undergoing
further biological assays to identify if it could be a potential agent for AIH treatment.

ACCEPTED MANUSCRIPT
Figure 4. Inhibitory effect of compounds on migration of RAW264.7 macrophages induced
by MCP-1. The migration of RAW264.7 cells were analyzed using a chemotactic migration assay.
A. Cells were photographed after compounds (20 µM) treatment for 3 h (n=3). B. The
quantification results for the chemotactic migration assay. Five different areas of migrated cells
were counted for each well (n = 3; * P<0.05 versus control group, *** P<0.001 versus control
group).
2.2.3 Compound 8d suppresses NF-κB p65 translocation
Transcription factor NF-κB signaling is pivotal in the induction of inflammatory responses and
the production of inflammatory cytokines33. When NF-κB activation is induced by stimulus (Con
A or LPS), IκB is phosphorylated and degraded, which leads to the release of the NF-κB p65
subunit from the cytoplasm, followed by translocation to the nucleus, where it binds to target
promoters and turns on the transcription of inflammatory genes including TNF-α and IL-6.
Herein, the effect of compound 8d on NF-κB p65 subunit nuclear translocation was determined
by an immunofluorescence assay. As shown in Figure 5, the NF-κB subunit p65 was almost
exclusively observed in the cytoplasm in the un-stimulated RAW264.7 macrophages. After
stimulation with Con A (0.6 µM) or LPS (1 µg/mL) for 2 h, most cytoplasmic p65 translocated
into the nucleus (green dots in the blue nucleus). In compound 8d (concentration were indicated

ACCEPTED MANUSCRIPT
on Figure 5 A and C) treated cells, nuclear localization of p65 was significantly reduced on a
dose-dependent manner, suggesting that compound 8d inhibited p65 translocation from the
cytoplasm to nuclei. In all, these results suggest that the anti-inflammatory activity of compound
8d may be closely associated with its inhibitory effects on NF-κB pathways.
Figure 5. Compound 8d exhibited potent inhibitory effects on nuclear translocation of p65
in Con A-stimulated RAW264.7 macrophages. Cells were treated with Con A for 2 h followed
by compound 8d (1 µM) for another 22 h. The subcellular localization of p65 was determined by
immunofluorescence. A. C. Photographs were taken using a laser-scanning confocal microscope.
B. D. The quantification of nuclear translocation of p65 (≥5 foci) presented in each group was
compared (** P<0.01).
2.2.4 Effect of compound 8d on the expression of inflammatory genes in Con A-induced
RAW264.7 macrophages
The inflammatory signaling of Con A-induction results in the production of a variety of
cytokines, chemokines, and inflammation mediators. To evaluate whether the inhibitory effect on
inflammatory response caused by compound 8d occurs at the transcriptional level, the mRNA
expression of inflammatory genes (various cytokines) such as IFN-γ, IL-6, IL-10 and TNF-α in
RAW264.7 macrophages were measured with real-time quantitative PCR. As shown in Figure 6,
upregulated cytokine gene expression triggered by Con A was blocked by compound 8d.
Furthermore, the mRNA expression levels in macrophages of TNF-α, IFN-γ, IL-6, and IL-10 were
decreased by compound 8d at 1 µM.

ACCEPTED MANUSCRIPT
Figure 6. Compound 8d regulates mRNA expression of various cytokines, including TNF-α,
IFN-γ, IL-6 and IL-10. RAW 264.7 macrophages were pretreated with Con A for 2 h followed by
compound 8d (1 µM) for another 22 h. The results are normalized to the reference gene GAPDH,
and the values shown are mean ± SD (n=5, *p < 0.05; **p < 0.01).
2.2.5 Cytotoxicity Assay
The cytotoxicity of all synthesized compounds was evaluated in LO2 cells by MTT assay after 24
h of treatment. As observed from Figure 7, all compounds (20 µM) showed no obvious
cytotoxicity on LO2 cells.
Figure 7. Effect of compounds on the viability of the human normal liver cell line LO2. The
effect of all synthesized compounds on cell viability was estimated by MTT assay.
2.2.6 Effect of compound 8d on a Con A-induced AIH mouse model in vivo
The anti-inflammatory activity of compound 8d was determined in a Con A-induced AIH
mouse model9, 34. As shown in Figure 8, compared with the normal control mice, the mice injected
with Con A (20 mg/kg) developed AIH as characterized by elevated levels of serum alanine
transaminase (ALT) and aspartate transaminase (AST). After intraperitoneal administration of
compound 8d (100 mg/kg), the serum levels of ALT and AST were significantly decreased at 12 h
after Con A injection. Compound 8d significantly reduced the activity levels of ALT and AST by
65.39% and 52.52%, respectively, compared with the model group (p < 0.01). The results
indicated that treatment with compound 8d ameliorated the severity of AIH caused by Con A.

ACCEPTED MANUSCRIPT
Figure 8. The levels of liver transaminase after Con A administration. Alanine
aminotransferase (ALT), aspartate transaminase (AST). Values are mean ± SD. (n=5, ** p < 0.01).
2.2.7 Histological Examination of the Liver
Histological features have prominent roles in the diagnosis and treatment of AIH35, 36. Thus, a
liver biopsy and HE staining assay is necessary for investigating whether compound 8d impaired
recruitment of macrophages to the liver tissue. As shown in Figure 9, dramatic inflammatory cell
infiltration around the central vein areas, massive hepatocytes necrosis, and disordered hepatic
sinusoid structures were observed in Con A-treated mice. Furthermore, administration of
compound 8d decreased the necrosis of hepatocytes. The effects of compound 8d on the
infiltration of CD4+ T cells, F4/80+ macrophages and CD11b+ cells in the livers were determined.
Figure 8 shows that the numbers of CD4+ T cells, F4/80+ macrophages and CD11b+ cells increased
significantly in the livers after Con A injection, but could be returned to basal levels by compound
8d treatment. We inferred from these results that 8d had significant hepatoprotective effects in the
Con A-induced AIH model.

ACCEPTED MANUSCRIPT
Figure 9. Hematoxylin and eosin (H&E) staining and expression profiling of CD4+, F4/80+
and CD11b+ cells in livers.
2.2.8 The influence of compound 8d on the MDSCs population frequency/flow cytometry
Myeloid-derived suppressor cells (MDSCs) play a key role in immune responses during AIH.
Therefore, we assessed the MDSCs in the liver after Con A treatment with or without compound
8d. We used the Gr-1 and CD11b antibodies to identify MDSCs. As illustrated in Figure 10 A,
after intravenous injection (i.v.) of Con A, there was a significant accumulation of
myeloid-derived suppressor cells (MDSCs) in the liver in Con A treatment mice compared to
normal control mice (Figure 10 A). In more detail, MDSCs in the saline group were 4.46% while
MDSCs in the Con A group reached 11.31%, and the difference was statistically significant (p <
0.05).
Moreover, further analysis indicated that the administration of compound 8d at 100 mg/kg
decreased the percentage of MDSCs to 8.39% (Figure 10 B) and thus inhibited the accumulation
of MDSCs in the liver.

ACCEPTED MANUSCRIPT
Figure 10. Compound 8d inhibited the accumulation of macrophages in the liver of mice
stimulated by Con A. Bars show the mean ± SD (n=5, * p < 0.05, *** p < 0.001).
3. Conclusion
In summary, with the aim of finding compounds with efficient anti-inflammatory activity,
forty-one TZP derivatives were synthesized. The results of the initial evaluation showed that some
compounds exhibited effective NO release inhibitory activity. Among them,
4-ethoxy-N-(6-(5-fluoro-2-methoxyphenyl)-3-methyl-[1,2,4]triazolo[4,3-a]pyridin-8-yl)benzamid
e (compound 8d) showed the most potent inhibitory activity on the migration of RAW264.7
macrophages and the NO release inhibitory activity. The preliminary mechanism of its
anti-inflammatory action indicated that the compound could significantly suppress the expression
of TNF-α, IFN-γ, IL-6 and IL-10 and the production of NO through affecting the NF-κB signaling
pathway. In addition, compound 8d ameliorated the severity of AIH in a Con A-induced mouse
model.
4. Experimental section
4.1 Chemistry
4.1.1. General
Chemical reagents of analytical grade were purchased from Shanghai Bidepharmatech Ltd.,
Shanghai, PRC. The reactions were monitored by thin layer chromatography (TLC) on precoated
1
silica GF254 plates under UV light at 254 and 365 nm. H NMR spectra were recorded on a
Ⅲ
Brucker AM-400 AVANCE (400 MHz) spectrometer with CDCl3 and DMSO-d6 as the solvent.
MS spectra were recorded on a Waters Q-TOF (ESI). Individual compounds with a purity of >95%
(Dionex UltiMate 3000) were used for subsequent experiments.
4.1.2. General Procedure for the Synthesis of Intermediate 4
To a suspension of 5-bromo-2-chloro-3-nitropyridine (compound 1, 42 mmol) in 1,4-dioxane
(50 mL) at room temperature was added hydrazine hydrate (98% in water) (84 mmol). The
reaction mixture was stirred at 110 °C for 1 h. Upon completion (judged by TLC), the reaction
mixture was allowed to cool at room temperature and the solvent was evaporated. After that, water
(100 mL) was added and the reaction mixture was extracted with ethyl acetate (100 mL × 3). The
combined organic phase was washed with brine (100 mL), dried over sodium sulfate and
evaporated under reduced pressure. The crude product was used for the next step without further
purification37.

ACCEPTED MANUSCRIPT
To a solution of compound 2 (10 mmol) in 1,4-dioxane (50 mL) was added trimethyl
orthoacetate (100 mmol) at room temperature. The reaction mixture was heated to reflux for about
1 hour, at which time TLC indicated near complete consumption of the starting material
compound 2. The solvent was removed by rotary evaporation. The residue was diluted with DCM
and water. The aqueous layer was extracted twice with DCM. The combined organic layers were
dried over Na2SO4 and concentrated by rotary evaporation. The crude mixture was subjected to
column chromatography (PE:EtOAc = 6:1~1:1) to afford the product compound 3 as a yellow
solid (82% yield, two steps)38.
To a solution of compound 3 (5 mmol) in EtOH (5 mL) and THF (5 mL) containing ammonium
chloride (10 mmol) and H2O (2 mL) was added Fe powder (10 mmol) in portion with rapid
stirring at 50 °C. The temperature of the reaction was then raised to 100 °C. After 1 hour, the
reaction was filtered, and the residual iron was washed with EtOAc. The organic layers were then
washed with water and brine, dried over Na2SO4, and concentrated in vacuo to provide the aniline
product compound 4 (86% yield) that was sufficiently pure to carry on to the next step39.
4.1.3. General Procedure for the Preparation of 3b
A mixture of compound 3 (4 mmol), (3-(ethylsulfonamido)phenyl)boronic acid (4.8 mmol),
[1,1'-Bis(diphenylphosphino)ferrocene]dichloropalladium(II) (5 mol %), and sodium carbonate
(12 mmol) in 1,4-dioxane (10 mL) and water (5 mL) was heated under nitrogen conditions (90 ° C,
6 h). After cooling to ambient temperature, the reaction mixture was filtered and concentrated. The
residue was partitioned between water and dichloromethane. The organic layer was separated and
purified by flash chromatography to get compound 3b (78%).
3b: Light yellow powder, 78% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 9.01 (d, J = 1.7
Hz, 1H), 8.72 (d, J = 1.7 Hz, 1H), 7.57 – 7.50 (m, 2H), 7.44 – 7.39 (m, 1H), 7.35 – 7.30 (m, 1H),
6.94 (s, 1H), 3.22 (q, J = 7.4 Hz, 2H), 2.74 (s, 3H), 1.43 (t, J = 7.4 Hz, 3H). ESI-HRMS m/z:
362.0923, [M+1] +, calcd for C15H15N5O4S: 361.0845.
4.1.4. General Procedure for the Preparation of 6a–q
A
mixture of compound
4
(2 mmol), boric acids or borates (2.4 mmol),
[1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (5 mol %), and sodium carbonate (6
mmol) in 1,4-dioxane (8 mL) and water (4 mL) was heated under nitrogen conditions (90 °C, 6 h).
After cooling to ambient temperature, the reaction mixture was filtered and concentrated. The
residue was partitioned between water and dichloromethane. The aqueous layer was extracted with
dichloromethane three additional times. The combined organic layers were washed with saturated

ACCEPTED MANUSCRIPT
aqueous sodium chloride, dried over anhydrous sodium sulfate, filtered, and concentrated. The
residue was purified by flash chromatography to provide compounds 5a–q.
We added acetyl chloride or cyclohexanecarboxylic acid chloride or cyclobutanecarbonyl
chloride (1.5 mmol) dropwise to a solution of each individual compound 5a–q (1 mmol),
anhydrous dichloromethane (5 mL) and potassium carbonate (1.5 mmol) at 0 °C under stirring.
The mixture was stirred at room temperature for 1 h until TLC showed the reaction was complete.
The reaction mixture was diluted with dichloromethane and washed with water. The organic
extract was dried, concentrated and purified by column chromatography using silica gel to
produce the compounds 6a–t as off white solids40.
6a: White powder, 87% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.74 (d, J = 1.6 Hz, 1H),
8.39 (d, J = 1.6 Hz, 1H), 8.32 (s, 1H), 7.64 – 7.57 (m, 2H), 7.48 (t, J = 7.4 Hz, 2H), 7.44 – 7.39 (m,
1H), 2.62 (s, 3H), 2.32 (s, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 170.19, 162.43, 160.10, 143.68, 137.79, 130.18,
129.02, 126.00, 119.76, 119.59, 116.95, 24.14, 14.21. ESI-HRMS m/z: 267.1246, [M+1] +, calcd
for C15H14N4O: 266.1168.
6b: Off-white powder, 69% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.57 (s, 1H), 8.56 (d,
J = 1.5 Hz, 1H), 8.29 (d, J = 1.5 Hz, 1H), 7.50 (m, 1H), 7.38 (m, 3H), 2.61 (s, 3H), 2.30 (s, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 169.26, 162.92, 143.94, 135.68, 133.04, 131.51,
130.23, 129.71, 127.16, 126.38, 125.53, 122.08, 117.97, 24.61, 14.30. ESI-HRMS m/z: 301.0864,
[M+1] +, calcd for C15H13ClN4O: 300.0778.
6c: Off-white powder, 76% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.67 (s, 1H), 8.45 (s,
1H), 8.44 (t, J = 1.4 Hz, 1H), 7.51 (m, 1H), 7.39 (m, 1H), 7.27 (m, 1H), 7.19 (m, 1H), 2.62 (s, 3H),
2.31 (s, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 169.24, 162.99, 159.74 (d, J = 249.8 Hz), 143.96,
130.65 (d, J = 2.9 Hz), 130.10 (d, J = 8.3 Hz), 125.92, 124.77 (d, J = 3.9 Hz), 122.70, 121.93 (d, J
= 5.5 Hz), 116.96, 116.49, 116.27, 24.65, 14.32. ESI-HRMS m/z: 285.1155, [M+1] +, calcd for
C15H13FN4O: 284.1073.
1
6d: Yellow powder, 72% yield. H NMR (400 MHz, Chloroform-d, δ ppm) 8.53 (s, 1H), 8.47 (s,
1H), 8.18 (s, 1H), 7.79 (d, J = 7.6 Hz, 1H), 7.60 (d, J = 7.4 Hz, 1H), 7.56 (d, J = 7.9 Hz, 1H), 7.41
(d, J = 7.4 Hz, 1H), 2.62 (s, 3H), 2.29 (s, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 169.24, 162.94, 143.97, 137.57, 135.97, 132.46,
131.74, 128.60, 127.68 (q, J = 265.7 Hz), 126.49, 126.42, 125.38, 121.40, 117.50, 24.61, 14.32.
ESI-HRMS m/z: 335.1121, [M+1] +, calcd for C16H13F3N4O: 334.1041.

ACCEPTED MANUSCRIPT
6e: White powder, 79% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.78 (d, J = 1.4 Hz, 1H),
8.39 (d, J = 1.4 Hz, 1H), 7.39 (t, J = 7.9 Hz, 1H), 7.32 (m, 1H), 7.18 (m, 1H), 7.12 (t, J = 2.2 Hz,
1H), 6.96 (m, 1H), 3.88 (s, 3H), 2.60 (s, 3H), 2.31 (s, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 170.19, 162.43, 160.10, 143.68, 137.79, 130.18,
129.02, 126.00, 119.76, 119.59, 116.95, 113.79, 112.88, 55.32, 24.04, 14.06. ESI-HRMS m/z:
297.1353, [M+1] +, calcd for C16H16N4O2: 296.1273.
6f:
White powder, 82% yield.1H NMR (400 MHz, Chloroform-d, δ ppm) 8.75 (d, J = 1.6 Hz, 1H),
8.71 (s, 1H), 8.41 (d, J = 1.6 Hz, 1H), 7.72 (ddd, J = 7.9, 1.8, 1.1 Hz, 1H), 7.61 (t, J = 7.8 Hz, 1H),
7.52 (t, J = 1.9 Hz, 1H), 7.37 (ddd, J = 8.0, 2.2, 1.1 Hz, 1H), 3.76 (q, J = 7.4 Hz, 2H), 2.62 (s, 3H),
2.33 (s, 3H), 1.51 (t, J = 7.4 Hz, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 171.21, 169.70, 163.11, 144.00, 138.84, 136.97,
130.74, 129.69, 128.82, 128.49, 127.07, 126.48, 120.02, 115.61, 49.43, 25.12, 24.62, 14.25, 8.21.
ESI-HRMS m/z: 374.1302, [M+1] +, calcd for C17H19N5O3S: 373.1209.
6g:
Brown powder, 72% yield.1H NMR (400 MHz, Chloroform-d, δ ppm) 8.74 (d, J = 1.6 Hz, 1H),
8.56 (s, 1H), 8.39 (d, J = 1.6 Hz, 1H), 7.51 (m, 2H), 7.44 (m, 1H), 7.29 (m, 1H), 2.61 (s, 3H), 2.33
(s, 3H).
13C NMR (101 MHz, DMSO-d6, δ ppm) 170.68, 163.01, 149.45, 144.79, 139.16, 131.60, 127.03,
126.48, 125.58, 121.35, 120.83, 120.57 (q, J = 257.4 Hz), 119.94, 116.18, 24.37, 14.48.
ESI-HRMS m/z: 351.1067, [M+1] +, calcd for C16H13F3N4O2: 350. 0991.
6h:
White powder, 65% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.73 (d, J = 1.6 Hz, 1H),
8.42 (s, 1H), 8.38 (d, J = 1.6 Hz, 1H), 7.57 (m, 2H), 7.45 (d, J = 8.1 Hz, 2H), 3.74 (m, 4H), 3.57 (s,
2H), 2.61 (s, 3H), 2.49 (t, J = 4.6 Hz, 4H), 2.31 (s, 3H).
13C NMR (101 MHz, DMSO-d6, δ ppm) 170.62, 162.72, 144.54, 138.39, 135.44, 130.17, 127.17,
127.14, 126.92, 120.49, 116.44, 66.67, 62.44, 53.65, 24.41, 14.49. ESI-HRMS m/z: 366.1927,
[M+1] +, calcd for C20H23N5O2: 365.1852.
6i: White powder, 67% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.32 (s, 1H), 7.89 (d, J =
0.84 Hz, 1H), 7.47 (m, 4H), 7.25 (m, 1H), 7.22 (m, 2H), 7.18 (m, 2H), 2.54 (s, 3H), 2.29 (s, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 168.90, 162.59, 149.83, 143.44, 141.15, 140.53,
135.50, 130.85, 130.72, 129.68, 125.26, 128.61, 128.53, 128.30, 127.79, 126.99, 125.30, 122.09,
118.42, 24.57, 14.29. ESI-HRMS m/z: 343.1563, [M+1] +, calcd for C21H18N4O: 342.4020.
6j: White powder, 87% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.66 (d, J = 1.5 Hz, 1H),
8.38 (d, J = 1.5 Hz, 1H), 8.34 (s, 1H), 7.36 (d, J = 2.7 Hz, 1H), 7.33 (m, 4H), 7.28 (m, 2H), 6.95
(d, J = 8.8 Hz, 1H), 5.11 (s, 2H), 2.60 (s, 3H), 2.30 (s, 3H).

ACCEPTED MANUSCRIPT
13C NMR (101 MHz, Chloroform-d, δ ppm) 169.12, 162.76, 154.31, 144.73, 136.18, 130.54,
129.27, 128.60, 128.00, 127.84, 127.14, 126.35, 125.43, 124.25, 122.15, 117.86, 114.49, 100.00,
70.99, 24.61, 14.31. ESI-HRMS m/z: 407.1273, [M+1] +, calcd for C22H19ClN4O2: 406.1197.
6k: White powder, 85% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.69 (d, J = 1.6 Hz, 1H),
8.53 (s, 1H), 8.45 (d, J = 1.5 Hz, 1H), 7.20 (d, J = 2.3 Hz, 1H), 7.14 (dd, J = 8.5, 2.2 Hz, 1H), 6.89
(d, J = 8.3 Hz, 1H), 4.07 (q, J = 6.9 Hz, 2H), 2.60 (s, 3H), 2.34 (s, 3H), 2.30 (s, 3H), 1.37 (t, J =
7.0 Hz, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 169.20, 162.45, 153.80, 131.31, 130.28, 129.97,
125.61, 125.38, 125.15, 122.20, 118.71, 112.54, 64.25, 24.61, 20.48, 14.77, 14.27. ESI-HRMS
m/z: 325.1658, [M+1] +, calcd for C17H18ClN4O2:324.1586.
6l: White powder, 88% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.69 (d, J = 1.5 Hz, 1H),
8.53 (s, 1H), 8.45 (d, J = 1.5 Hz, 1H), 7.19 (d, J = 2.2 Hz, 1H), 7.14 (dd, J = 7.9, 2.1 Hz, 1H), 6.89
(d, J = 8.3 Hz, 1H), 4.06 (q, J = 7.0 Hz, 2H), 2.60 (s, 3H), 2.34 (s, 3H), 2.30 (s, 3H), 1.37 (t, J =
7.0 Hz, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 169.22, 162.44, 153.79, 143.65, 131.31, 130.28,
129.97, 125.61, 125.37, 125.15, 122.20, 118.76, 112.53, 64.25, 24.60, 20.48, 14.77, 14.26.
ESI-HRMS m/z: 325.1658, [M+1] +, calcd for C18H20N4O2: 324.1586.
6m: White powder, 82% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.69 (d, J = 1.6 Hz,
1H), 8.53 (s, 1H), 8.45 (d, J = 1.5 Hz, 1H), 7.20 (d, J = 2.3 Hz, 1H), 7.14 (dd, J = 8.5, 2.2 Hz, 1H),
6.89 (d, J = 8.3 Hz, 1H), 4.07 (q, J = 6.9 Hz, 2H), 2.60 (s, 3H), 2.34 (s, 3H), 2.30 (s, 3H), 1.37 (t, J
= 7.0 Hz, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 169.01, 162.82, 154.74, 141.03, 130.35, 129.20,
127.27, 125.76, 125.31, 124.25, 122.20, 117.82, 113.55, 70.50, 24.66, 22.39, 14.35, 10.58.
ESI-HRMS m/z: 359.1278, [M+1] +, calcd for C18H19ClN4O2: 358.1197.
6n: White powder, 77% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.64 (d, J = 1.5 Hz, 1H),
8.38 (d, J = 1.5 Hz, 1H), 8.35 (s, 1H), 7.33 (dd, J = 8.4, 6.6 Hz, 1H), 6.74 (m, 2H), 4.08 (q, J = 7.0
Hz, 2H), 2.61 (s, 3H), 2.30 (s, 3H), 1.41 (t, J = 7.0 Hz, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 169.09, 162.63(d, J = 254.5 Hz), 157.16, 157.06,
143.72, 131.56, 131.46, 125.21, 124.79, 121.95, 118.32, 107.43 (d, J = 21.5 Hz), 100.44, 64.48,
24.66, 14.50, 14.32. ESI-HRMS m/z: 329.1411, [M+1] +, calcd for C17H17FN4O2: 328.1336.
6o: Off-white powder, 77% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.75 (s, 1H), 8.69 (d,
J = 1.5 Hz, 1H), 8.56 (d, J = 1.5 Hz, 1H), 8.21 (dd, J = 4.9, 1.8 Hz, 1H), 7.73 (dd, J = 7.4, 1.8 Hz,
1H), 7.02 (dd, J = 7.4, 4.9 Hz, 1H), 4.01 (s, 3H), 2.61 (s, 3H), 2.3 (s, 3H).

ACCEPTED MANUSCRIPT
13C NMR (101 MHz, Chloroform-d, δ ppm) 169.55, 162.76, 160.72, 146.75, 143.77, 138.66,
125.72, 123.54, 122.39, 119.75, 117.66, 117.29, 53.74, 29.69, 14.19. ESI-HRMS m/z: 298.1301,
[M+1] +, calcd for C15H15N5O2: 297.1226.
6p: White powder, 65% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.67 (d, J = 1.4 Hz, 1H),
8.39 (d, J = 1.4 Hz, 1H), 8.26 (s, 1H), 7.35 (dd, J = 8.3, 6.7 Hz, 1H), 6.72 (ddd, J = 10.2, 7.6, 4.0
Hz, 2H), 4.07 (q, J = 7.0 Hz, 2H), 2.61 (s, 3H), 2.40 (tt, J = 11.7, 4.1 Hz, 1H), 2.01 (d, J = 12.9 Hz,
2H), 1.86 (d, J = 11.8 Hz, 2H), 1.73 (d, J = 10.0 Hz, 2H), 1.56 (d, J = 11.7 Hz, 2H), 1.40 (t, J =
7.0 Hz, 3H), 1.29 (m, 2H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 175.93, 162.67, 159.94 (d, J = 247.4 Hz), 157.01,
143.96, 131.91, 124.60, 121.75, 118.02, 117.82, 100.57, 100.29, 99.98, 64.49, 46.44, 29.58 (2C),
25.62, 25.58 (2C), 14.52, 14.36. ESI-HRMS m/z: 397.2042, [M+1] +, calcd for C22H25F3N4O2:
396.1962.
6q: White powder, 69% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.72 (d, J = 1.6 Hz, 1H),
8.58 (d, J = 1.6 Hz, 1H), 8.49 (s, 1H), 8.20 (dd, J = 4.9, 1.9 Hz, 1H), 7.75 (dd, J = 7.4, 1.9 Hz, 1H),
7.00 (dd, J = 7.3, 5.0 Hz, 1H), 4.01 (s, 3H), 2.61 (s, 3H), 2.44 (m, 1H), 2.01 (m, 3H), 1.86 (m, 2H),
1.72 (m, 1H), 1.60 (m, 2H), 1.37 (m, 2H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 175.67, 162.84, 160.68, 146.66, 143.95, 138.68,
125.88, 123.36, 122.27, 119.79, 117.25, 53.75, 46.32, 29.56 (2C), 25.58 (2C), 14.28. ESI-HRMS
m/z: 366.1926, [M+1] +, calcd for C22H25F3N4O2: 365.1852.
4.1.5. General Procedure for the Preparation of 7a–k
A
mixture of compound
4
(2 mmol), boric acids or borates (2.4 mmol),
[1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (5 mol %), and sodium carbonate (6
mmol) in 1,4-dioxane (8 mL) and water (4 mL) was heated under nitrogen conditions (90 °C, 6 h).
After cooling to ambient temperature, the reaction mixture was filtered and concentrated. The
residue was partitioned between the water and dichloromethane. The aqueous layer was extracted
with dichloromethane three additional times. The combined organic layers were washed with
saturated aqueous sodium chloride, dried over anhydrous sodium sulfate, filtered, and
concentrated. The residue was purified by flash chromatography to provide compounds 5a–k.
To a cold (0 °C) stirred solution of each individual compound 5a–k (1 mmol) in dry
dichloromethane (5 mL) was added pyridine (1.5 mmol) followed by ethanesulfonyl chloride (1.5
mmol). The reaction mixture was stirred at room temperature. Upon completion (TLC), the
reaction mixture was evaporated to dryness under vacuum. The residue was diluted with H2O (20
mL) and dichloromethane (20 mL). The organic layer was washed with H2O and brine, and the

ACCEPTED MANUSCRIPT
combined extracts were dried over Na2SO4, filtered and concentrated under reduced pressure, then
purified by flash chromatography on silica gel to give the desired compounds41.
1
7a: Light yellow powder, 68% yield. H NMR (400 MHz, Chloroform-d, δ ppm) 8.44 (d, J = 1.5
Hz, 1H), 7.87 (d, J = 1.5 Hz, 1H), 7.57 (m, 2H), 7.50 (m, 2H), 7.44 (m, 1H), 3.24 (q, J = 7.4 Hz,
2H), 2.61 (s, 3H), 1.43 (t, J = 7.4 Hz, 3H).
13C NMR (101 MHz, DMSO-d6, δ ppm) 163.24, 146.23, 136.21, 129.66 (2C), 128.70, 127.41
(2C), 127.10, 126.20, 122.32, 119.80, 47.62, 14.63, 8.61. ESI-HRMS m/z: 317.1073, [M+1] +,
calcd for C15H16F3N4O2S: 316.0994.
7b: White powder, 54% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.39 (d, J = 1.5 Hz, 1H),
7.79 (d, J = 1.5 Hz, 1H), 7.44 (d, J = 6.6 Hz, 2H), 7.32 (s, 1H), 7.21 (m, 1H), 3.18 (q, J = 7.4 Hz,
2H), 2.52 (s, 3H), 1.35 (t, J = 7.4 Hz, 3H).
13C NMR (101 MHz, DMSO-d6, δ ppm) 163.50, 149.46, 146.46, 138.65, 131.61, 126.62, 126.27,
125.44, 123.08, 120.96, 120.58 (q, J = 257.3 Hz), 120.16, 119.67, 47.67, 14.63, 8.59. ESI-HRMS
m/z: 385.0944, [M+1] +, calcd for C16H15F3N4O2S: 384.0868.
7c: White powder, 59% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.46 (d, J = 1.5 Hz, 1H),
7.84 (d, J = 1.5 Hz, 1H), 7.45 (m, 2H), 7.34 (d, J = 8.0 Hz, 2H), 7.31 (s, 1H), 3.24 (m, 4H), 2.60 (s,
3H), 1.43 (q, J = 7.5 Hz, 6H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 163.67, 144.52, 138.10, 137.78, 130.64, 127.61,
125.65, 123.55, 120.87, 119.87, 118.69, 115.53, 47.14, 46.43, 29.70, 14.31, 8.27. ESI-HRMS m/z:
424.1116, [M+1] +, calcd for C15H17N5O3S: 423.1035.
7d: Yellow powder, 61% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.22 (s, 1H), 7.81 (d, J
= 7.8 Hz, 1H), 7.60 (td, J = 15.1, 13.5, 7.4 Hz, 3H), 7.41 (d, J = 7.5 Hz, 1H), 3.23 (q, J = 7.4 Hz,
2H), 2.62 (s, 3H), 1.41 (t, J = 7.3 Hz, 3H).
13C NMR (101 MHz, DMSO-d6, δ ppm) δ163.38, 145.96, 135.83, 133.27, 133.09, 129.61, 126.79,
126.74, 125.84, 125.59, 125.43, 124.38 (q, J = 258.9 Hz), 123.69, 123.67, 123.01, 120.61, 120.47,
120.46, 47.40, 14.56, 8.53. ESI-HRMS m/z: 385.0944, [M+1] +, calcd for C16H15F3N4O2S:
384.0868.
7e: White powder, 74% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.25 (d, J = 1.5 Hz, 1H),
7.64 (d, J = 1.4 Hz, 1H), 7.45 (ddt, J = 7.1, 5.0, 3.5 Hz, 1H), 7.31 (m, 3H), 3.19 (q, J = 7.4 Hz,
2H), 2.54 (s, 3H), 1.36 (t, J = 7.4 Hz, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 162.50, 143.21, 134.12, 131.98, 130.34, 129.35,
129.00, 126.36, 125.17, 123.97, 121.64, 116.19, 45.87, 28.68, 13.24. ESI-HRMS m/z: 351.0712,
[M+1] +, calcd for C15H15ClN4O2S: 350.0621.

ACCEPTED MANUSCRIPT
7f: Light yellow powder, 52% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.24 (s, 1H), 7.54
(m, 5H), 7.25 (m, 6H), 3.40 (m, 2H), 2.58 (s, 3H), 1.19 (t, J = 7.3 Hz, 3H).
13C NMR (101 MHz, DMSO-d6, δ ppm) 162.98, 144.99, 140.81, 140.72, 135.49, 131.33, 131.17,
129.95 (2C), 129.23, 128.85 (2C), 128.42, 127.77, 127.47, 125.33, 123.39, 120.02, 46.36, 14.50,
8.40. ESI-HRMS m/z: 393.1383, [M+1] +, calcd for C21H20N4O2S: 392.1307.
7g: White powder, 46% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.40 (d, J = 1.4 Hz, 1H),
7.85 (d, J = 1.4 Hz, 1H), 7.34 (m, 7H), 7.09 (m, 2H), 5.11 (s, 2H), 2.98 (q, J = 7.4 Hz, 2H), 2.59 (s,
3H), 1.26 (t, J = 7.4 Hz, 4H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 163.21, 155.83, 144.15, 136.44, 130.78, 130.08,
128.65 (2C), 128.08, 127.55 (2C), 125.63, 122.44, 121.53, 117.78, 112.92, 70.66, 46.13, 14.30,
8.36. ESI-HRMS m/z: 423.1492, [M+1] +, calcd for C22H22N4O3S: 422.1413.
7h: White powder, 56% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.45 (d, J = 1.5 Hz, 1H),
7.83 (d, J = 1.4 Hz, 1H), 7.18 (m, 2H), 6.91 (d, J = 8.3 Hz, 1H), 3.82 (s, 3H), 3.23 (q, J = 7.4 Hz,
2H), 2.60 (s, 3H), 2.35 (s, 3H), 1.42 (t, J = 7.4 Hz, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 163.23, 154.40, 144.22, 131.10, 130.55, 130.32,
125.16, 124.69, 124.43, 123.01, 118.28, 111.42, 55.70, 46.60, 20.47, 14.31, 8.35. ESI-HRMS m/z:
361.1331, [M+1] +, calcd for C17H20N4O3S: 360.1256.
7i: White powder, 62% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.31 (d, J = 1.5 Hz, 1H),
7.76 (d, J = 1.5 Hz, 1H), 7.23 (dd, J = 8.4, 6.6 Hz, 1H), 6.73 – 6.63 (m, 2H), 4.00 (q, J = 7.0 Hz,
2H), 3.16 (q, J = 7.4 Hz, 2H), 2.53 (s, 3H), 1.35 (td, J = 7.2, 3.2 Hz, 6H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 163.79 (d, J = 249.1 Hz), 163.32, 157.14 (d, J = 10.0
Hz), 144.28, 131.35 (d, J = 10.1 Hz), 124.74, 124.41, 122.67, 121.04 (d, J = 3.4 Hz), 118.22,
107.54 (d, J = 21.6 Hz), 100.45 (d, J = 25.8 Hz), 64.44, 46.64, 14.50, 14.30, 8.33. ESI-HRMS m/z:
379.1241, [M+1] +, calcd for C17H19FN4O3S: 378.1162.
7j: White powder, 55% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.36 (d, J = 1.4 Hz, 1H),
7.77 (d, J = 1.4 Hz, 1H), 7.33 (m, 7H), 7.00 (d, J = 9.5 Hz, 1H), 5.08 (s, 2H), 2.97 (q, J = 7.4 Hz,
2H), 2.60 (s, 3H), 1.27 (t, J = 7.2 Hz, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 163.41, 154.43, 135.95, 130.40, 129.63, 128.72,
128.26, 127.55, 127.20, 126.41, 124.62, 124.32, 122.45, 116.96, 114.25, 71.07, 46.23, 14.33, 8.35.
ESI-HRMS m/z: 457.1099, [M+1] +, calcd for C22H21ClN4O3S: 456.1023.
7k: White powder, 59% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.58 (d, J = 1.5 Hz, 1H),
8.23 (dd, J = 5.0, 1.9 Hz, 1H), 7.88 (d, J = 1.5 Hz, 1H), 7.70 (dd, J = 7.4, 1.9 Hz, 1H), 7.03 (dd, J
= 7.4, 5.0 Hz, 1H), 4.01 (s, 3H), 3.24 (q, J = 7.4 Hz, 2H), 2.61 (s, 3H), 1.42 (t, J = 7.4 Hz, 3H).

ACCEPTED MANUSCRIPT
13C NMR (101 MHz, Chloroform-d, δ ppm) 163.30, 160.65, 147.11, 144.20, 138.49, 125.12,
123.53, 123.11, 119.20, 117.75, 117.41, 53.80, 46.97, 14.10, 8.32. ESI-HRMS m/z: 348.1146,
[M+1] +, calcd for C15H17N5O3S: 347.1052.
4.1.6. General Procedure for the Preparation of 8a–f
A
mixture of compound
4
(2 mmol), boric acids or borates (2.4 mmol),
[1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium(II) (5 mol %), and sodium carbonate (6
mmol) in 1,4-dioxane (8 mL) and water (4 mL) was heated under nitrogen conditions (90 °C, 6 h).
After cooling to ambient temperature, the reaction mixture was filtered and concentrated. The
residue was partitioned between water and dichloromethane. The aqueous layer was extracted with
dichloromethane three additional times. The combined organic layers were washed with saturated
aqueous sodium chloride, dried over anhydrous sodium sulfate, filtered, and concentrated. The
residue was purified by flash chromatography to provide compounds 5a–f.
We added aromatic acid chloride (1.5 mmol) dropwise to a solution of each individual compound
5a–f (1 mmol), anhydrous dichloromethane (5 mL) and potassium carbonate (1.5 mmol) at 0 °C
under stirring. We stirred the mixture at room temperature for 1 h until TLC showed the reaction
was complete. The reaction mixture was diluted with dichloromethane and washed with water.
The organic extract was dried, concentrated and purified by column chromatography using silica
gel to give the compounds 8a–f as off-white solids40.
8a: White powder, 82% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 9.00 (s, 1H), 8.86 (d, J
= 1.7 Hz, 1H), 8.41 (d, J = 1.6 Hz, 1H), 8.05 (m, 2H), 7.58 (m, 2H), 7.48 (m, 2H), 7.23 (t, J = 8.6
Hz, 2H), 2.63 (s, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 129.91, 129.82, 129.42, 128.48, 119.80, 116.24,
116.02, 115.60, 14.39. ESI-HRMS m/z: 381.0927, [M+1] +, calcd for C20H14ClFN4O: 380.0840.
8b: White powder, 84% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 9.15 (s, 1H), 8.87 (d, J
= 1.7 Hz, 1H), 8.43 (d, J = 1.6 Hz, 1H), 8.31 (s, 1H), 8.20 (d, J = 7.8 Hz, 1H), 7.87 (d, J = 7.8 Hz,
1H), 7.69 (t, J = 7.9 Hz, 1H), 7.60 – 7.54 (m, 2H), 7.47 (d, J = 8.5 Hz, 2H), 2.63 (s, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 164.84, 163.27, 144.26, 135.00, 134.69, 134.54,
131.82, 131.49, 130.39, 129.57, 129.45, 129.09 (d, J = 3.6 Hz), 128.45, 126.83, 126.01, 125.98 (q,
J = 253.1 Hz), 124.70, 124.66, 120.12, 116.14, 14.35. ESI-HRMS m/z: 431.0883, [M+1] +, calcd
for C21H14ClF3N4O: 430.0808.
1
8c: White powder, 76% yield. H NMR (400 MHz, Chloroform-d, δ ppm) 9.55 (d, J = 14.6 Hz,
1H), 8.80 (d, J = 1.5 Hz, 1H), 8.47 (d, J = 1.5 Hz, 1H), 8.16 (td, J = 7.9, 1.9 Hz, 1H), 7.58 (q, J =

ACCEPTED MANUSCRIPT
6.9, 6.2 Hz, 1H), 7.41 (d, J = 2.6 Hz, 1H), 7.34 (m, 2H), 6.93 (d, J = 8.8 Hz, 1H), 3.97 (t, J = 6.5
Hz, 2H), 2.64 (s, 3H), 1.79 (q, J = 7.0 Hz, 2H), 0.96 (t, J = 7.4 Hz, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 172.39, 169.24, 156.72 (d, J = 260.1 Hz), 149.30,
137.40, 135.57, 130.23, 129.14, 128.25, 125.64, 123.91, 122.59, 121.73, 118.23, 114.62, 108.92,
99.98, 50.22, 24.26, 22.34, 10.53.. ESI-HRMS m/z: 439.1342, [M+1] +, calcd for C23H20ClFN4O2:
438.1259.
8d: White powder, 74% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.88 (s, 1H), 8.77 (d, J
= 1.5 Hz, 1H), 8.47 (d, J = 1.5 Hz, 1H), 7.97 (m, 2H), 7.18 (dd, J = 8.9, 3.1 Hz, 1H), 7.07 (m, 1H),
7.01 (t, J = 3.0, 2.0 Hz, 1H), 6.99 (t, J = 2.0, 3.0 Hz, 1H), 6.95 (dd, J = 9.1, 4.5 Hz, 1H), 4.13 (q, J
= 7.0 Hz, 2H), 3.84 (s, 3H), 2.63 (s, 3H), 1.47 (t, J = 7.0 Hz, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 165.58, 163.00, 163.33 (d, J = 253.9 Hz), 158.29,
152.81 (d, J = 2.1 Hz), 144.30, 129.31, 125.86, 125.80, 124.15, 122.27, 117.58, 117.48, 117.34,
115.60, 115.38, 114.57, 112.48, 112.40, 63.82, 56.26, 14.69, 14.40. ESI-HRMS m/z: 421.1675,
[M+1] +, calcd for C23H21FN4O3: 420.1598.
1
8e: White powder, 57% yield. H NMR (400 MHz, Chloroform-d, δ ppm) 8.87 (s, 1H), 8.80 (s,
1H), 8.52 (s, 1H), 7.47 (m, 1H), 7.19 (dd, J = 8.8, 3.1 Hz, 1H), 7.06 (m, 3H), 6.96 (dd, J = 9.0, 4.5
Hz, 1H), 3.85 (s, 3H), 2.61 (s, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 165.46, 161.86 (d, J = 243.2 Hz), 161.36, 159.06,
152.80, 137.54, 137.12, 132.82, 132.72, 132.62, 131.53 (d, J = 5.1 Hz), 131.31, 125.05, 124.13,
123.10, 118.45, 117.56, 117.32, 115.78, 115.55, 112.48 (d, J = 7.8 Hz), 112.19, 99.99, 56.25,
14.34. ESI-HRMS m/z: 413.1222, [M+1] +, calcd for C21H15F3N4O2: 412.1147.
8f: White powder, 71% yield. 1H NMR (400 MHz, Chloroform-d, δ ppm) 8.99 (s, 1H), 8.77 (d, J
= 1.5 Hz, 1H), 8.48 (d, J = 1.5 Hz, 1H), 8.09 (d, J = 8.0 Hz, 2H), 8.04 (d, J = 8.0 Hz, 1H), 7.98 (d,
J = 8.0 Hz, 2H), 7.36 (d, J = 8.0 Hz, 2H), 7.18 (dd, J = 8.8, 3.1 Hz, 1H), 7.03 (d, J = 4.0 Hz, 2H),
6.95 (dd, J = 9.1, 4.5 Hz, 1H), 5.16 (s, 2H), 3.84 (s, 3H), 2.63 (s, 3H).
13C NMR (101 MHz, Chloroform-d, δ ppm) 165.65, 163.71, 161.78 (d, J = 244.9 Hz), 162.94,
162.16 (d, J = 10.2 Hz), 136.18, 135.92, 132.85, 132.27, 129.40, 128.75 (2C), 128.72, 128.70,
128.35, 128.26, 128.24, 127.50 (2C), 125.82, 122.37, 121.50, 117.93, 114.98, 114.56, 70.30, 56.25,
14.33. ESI-HRMS m/z: 517.1445, [M+1] +, calcd for C28H22ClFN4O3: 516.1364.
4.2 Biology experiments
4.2.1. Reagents
Compound 8d was dissolved in dimethyl sulfoxide (DMSO) and stored at −20 °C.
3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT), PEG400, Con A and

ACCEPTED MANUSCRIPT
LPS were purchased from Sigma-Aldrich (St. Louis, MO, USA). 4',6-diamidino-2-phenylindole
(DAPI) was purchased from Beyotime (Shanghai, China). The primary antibody P65 was
purchased from Proteintech (Wuhan, China). PE-CD11b and FITC-Gr-1 conjugated antibodies
were obtained from BD Biosciences (San Diego, CA, USA). Rabbit polyclonal anti-CD4, rabbit
polyclonal anti-CD11b and rabbit polyclonal anti-F4/80 were purchased from Merck Millipore.
For the in vivo experiments, compound 8d was prepared in 40% (v/v) PEG 400 and 60% (v/v)
saline.
4.2.2. Cell lines and cell cultivation
RAW264.7 cells and human liver cells LO2 were purchased from the American Type Culture
Collection (ATCC, Rockville, MD, USA). Both of them were cultured in DMEM media
supplemented with 10% fetal bovine serum and 1% antibiotics (penicillin and streptomycin). Cells
were cultivated in a humidified environment with 5% CO2 at 37 °C.
4.2.3. Cell viability assay
The effect of all synthesized compounds on cell viability was estimated by an MTT assay. In brief,
LO2 cells (1.5–5 × 103) were seeded in 96-well plates and incubated overnight. After that,
compounds were used to treat the cells for 24 h. Then, 20 µL MTT (5 mg/mL) solution was added
to each well and incubated with the cells for 2–4 h at 37 °C. All of the medium was removed and
150 µL of DMSO was added for 10 min. The absorbance was measured at 570 nm using a Spectra
MAX M5 microplate spectrophotometer (Molecular Devices, CA, USA). Each experiment was
replicated three times.
4.2.4. Measurement of NO release
RAW264.7 cells (1 × 105/mL) were seeded in 96-well plates and incubated overnight. Then, the
cells were treated with the tested compounds for 1 h. Next, 1 µg/mL LPS was added for another 23
h. Briefly, the culture supernatants were harvested for measurement of NO production using the
Griess reagent (Beyotime, Shanghai, China) at an optical density of 540 nm.
4.2.5. Chemotaxis assay
RAW264.7 cells were starved for 3 h in serum-free medium. Transwell cell chambers
containing a polycarbonate filter were used in this assay. In the upper chamber, 200 µL of medium
that included RAW264.7 cells with 0.5% BSA and 20 µM compounds or DMSO were added.
Then, 600 µL DMEM medium with 200 ng/mL MCP-1 (R&D, USA) was added to the lower
chamber. After incubation at 37 °C for 3 h, nonmigratory cells were discarded from the upper
surface of the filter using a cotton swab. Then, the filters were washed in PBS three times. The
migrated cells were fixed with 4% paraformaldehyde for 1 h and stained with a 0.5% crystal violet
solution (Beyotime, Shanghai, China) for 15 min. We randomly selected visual fields and counted

ACCEPTED MANUSCRIPT
and photographed the migrating cells under a light microscope. The standard deviation of the
average was calculated by three replicated chambers.
Inhibitory rates = 1 − N1/ (N1+N2)
N1 = the number of migratory cells; N2 = the number of nonmigratory cells; Eight different areas
of migrated cells were counted for each well (n = 3) and the inhibitory rates were expressed as the
mean±SD (p < 0.05).
4.2.6. Immunofluorescence assay
The concentration of Con A used in this study was in accordance with that previously
described42. RAW264.7 macrophages (2×104/well) were seeded in 24-well plates and incubated
overnight. Cells were pretreated with Con A or LPS for 2 h. Then, the cells were treated with
different concentration of compound 8d for another 22 h. Subsequently, the cells were washed
three times in PBS and fixed in 4% paraformaldehyde for 10 min and washed three times in PBS.
Then, the cells were penetrated with PBS solution containing 0.5% Triton X-100 for 10 min and
washed three times. After incubation with PBST containing 5% BSA and 0.05% Triton X-100
(blocking solution) for 30 min, the cells were incubated with primary antibody overnight at 4 °C.
Goat anti-rabbit secondary antibodies conjugated to FITC were used. Cell nuclei were stained with
DAPI. Photographs were taken using a laser-scanning confocal microscopy (Nikon).
4.2.7. Preparation of RNA and real-time PCR
The total RNA from liver tissues and RAW264.7 cells were isolated using Trizol reagent
(Thermo Fisher Scientific, Inc.). Total RNA (3 µg) was reverse transcribed to cDNA by using an
M5 First Strand cDNA Synthesis Kit (Mei5 Biotechnology, Beijing, China) according to the
manufacturer’ s protocol. Real-time PCRs were performed using SYBR Premix Ex Taq Ⅱ (Takara,
Kusatsu, Japan), and the conditions of this assay were performed as follows: 95 °C for 30 s, the
following 40 cycles including 95 °C for 5 s and 60 °C for 20 s. All PCR assays were performed in
triplicate. Expression of mRNA was normalized to GAPDH expression. The following primers
were used:
GAPDH: MF TTGCGACTTCAACAGCAACTC; MR GGTCTGGGATGGAAATTGTG,
TNF-α: MF GGCAGGTCTACTTTGGAGTCAT; MR CAGAGTAAAGGGGTCAGAGTGG,
IFN-γ: MF CAGCAACAGCAAGGCGAAA; MR CTGGACCTGTGGGTTGTTGAC,
IL-6: MF AACCACGGCCTTCCCTACTT; MR TTGGGAGTGGTATCCTCTGTGA,
IL-10: MF GATGCCCCAGGCAGAGAA; MR CACCCAGGGAATTCAAATGC
4.2.8. Flow cytometry
Single-cell suspensions of livers were made by mechanical and enzymatic dispersion as
described previously43. Briefly, red blood cells were lysed and washed twice using PBS. The

ACCEPTED MANUSCRIPT
single-cell suspensions of the liver were acquired by mechanical disruption and 1 mg/mL
collagenase I digestion. Then, 1×106 freshly prepared cells were suspended in 100 µL of PBS and
stained with different combinations of fluorochrome-coupled antibodies for CD11b and Gr-1. The
cells were collected by FCM, and the data were analyzed by FlowJo software.
4.2.9. Animals
All animal experiments complied with the National Institutes of Health guide for the care and
use of laboratory animals (NIH Publications No. 8023, revised 1978). Six to eight weeks old
female BALB/c mice (HFK bioscience CO., LTD, Beijing, China) were used in this study. The
mice were housed in an SPF environment. The experiments were approved and conducted in
accordance with the Animal Care and Use Committee of Sichuan University. This model was
established as previously described9. The mice were randomly divided into three groups: control
(pathogen-free saline), Con A (20 mg/kg) and compound 8d (100 mg/kg). The control group mice
were administered pathogen-free saline by intravenous injection and the Con A group were given
Con A 20 mg/kg followed by the administered solvent (40% (v/v) PEG 400 and 60% (v/v) saline)
by intraperitoneal injection. The compound 8d group mice were given Con A 20 mg/kg followed
by the administered 8d (100 mg/kg). After 12 h, the mice were sacrificed and serum and liver
tissue were collected for subsequent experiments.
4.2.10. Liver function assessment
Blood samples were centrifuged at 3000 rpm for 10 min to collect the plasma. Levels of ALT
and AST were measured on an automatic analyzer (Hitachi Auto Analyzer 7170, Japan).
4.2.11. Histopathology and immunohistochemistry
Liver sections were fixed in 4% formalin, embedded in paraffin, dehydrated with 70% ethanol,
and cut into 4–5 µm slices. The slices were stained with hematoxylin and eosin (H&E) and
examined under a light microscope to analyze hepatic changes. In addition the liver tissue sections
were stained with primary antibodies (CD4, CD11b and F4/80). Images were taken using a
fluorescence microscope (Olympus, Tokyo, Japan).
4.2.12. Statistical analysis
Results are expressed as the mean values and standard deviation (SD) and were analyzed
statistically with analysis of variance (ANOVA), and differences between groups were assessed
with Tukey's method. A value of p < 0.05 was considered statistically significant.
Notes
The authors declare no competing financial interest.
Declarations of interest: none.
Acknowledgments

ACCEPTED MANUSCRIPT
The authors acknowledge the National Natural Science Foundation of China (No.81873580),
the Key Project of the Science & Technology Department of Sichuan Province (Grant No.
2017JY0071), the National S&T Major Special Project on Major New Drug Innovations
(2018ZX09201018), and 1.3.5 project for disciplines of excellence, West China Hospital, Sichuan
University (ZYJC18008).
Supplementary data
Supplementary data include 1HNMR and 13CNMR of the compounds described in this article.
References
1. Coussens, L. M.; Werb, Z., Inflammation and cancer. Nature 2002, 420 (6917), 860-7.
2. Baumgart, D. C.; Carding, S. R., Inflammatory bowel disease: cause and immunobiology. Lancet
2007, 369 (9573), 1627-40.
3. Xavier, R. J.; Podolsky, D. K., Unravelling the pathogenesis of inflammatory bowel disease.
Nature 2007, 448 (7152), 427-434.
4. Mieli-Vergani, G.; Vergani, D.; Czaja, A. J.; Manns, M. P.; Krawitt, E. L.; Vierling, J. M.;
Lohse, A. W.; Montano-Loza, A. J., Autoimmune hepatitis. Nat Rev Dis Primers 2018, 4, 18017.
5. Mackay, I. R., Historical reflections on autoimmune hepatitis. World J Gastroenterol 2008, 14
(21), 3292-300.
6. Wang, Q.; Yang, F.; Miao, Q.; Krawitt, E. L.; Gershwin, M. E.; Ma, X., The clinical
phenotypes of autoimmune hepatitis: A comprehensive review. J Autoimmun 2016, 66, 98-107.
7. Yeoman, A. D.; Longhi, M. S.; Heneghan, M. A., Review article: the modern management of
autoimmune hepatitis. Aliment Pharmacol Ther 2010, 31 (8), 771-87.
8. Liberal, R.; Krawitt, E. L.; Vierling, J. M.; Manns, M. P.; Mieli-Vergani, G.; Vergani, D.,
Cutting edge issues in autoimmune hepatitis. J Autoimmun 2016, 75, 6-19.
9. Ye, T. H.; Wang, T. T.; Yang, X. X.; Fan, X. L.; Wen, M. Y.; Shen, Y.; Xi, X. T.; Men,
R. T.; Yang, L., Comparison of Concanavalin a-Induced Murine Autoimmune Hepatitis Models. Cell
Physiol Biochem 2018, 46 (3), 1241-1251.
10. Fukumura, D.; Kashiwagi, S.; Jain, R. K., The role of nitric oxide in tumour progression. Nat
Rev Cancer 2006, 6 (7), 521-34.
11. Hofseth, L. J., Nitric oxide as a target of complementary and alternative medicines to prevent and
treat inflammation and cancer. Cancer Lett 2008, 268 (1), 10-30.
12. Lundberg, J. O. N.; Lundberg, J. M.; Alving, K.; Weitzberg, E., Nitric oxide and inflammation:
The answer is blowing in the wind. Nature Medicine 1997, 3 (1), 30-31.
13. Furchgott, R. F.; Zawadzki, J. V., The obligatory role of endothelial cells in the relaxation of
arterial smooth muscle by acetylcholine. Nature 1980, 288 (5789), 373-6.
14. Ignarro, L. J.; Buga, G. M.; Wood, K. S.; Byrns, R. E.; Chaudhuri, G., Endothelium-derived
relaxing factor produced and released from artery and vein is nitric oxide. Proc Natl Acad Sci U S A
1987, 84 (24), 9265-9.
15. Gobert, A. P.; Asim, M.; Piazuelo, M. B.; Verriere, T.; Scull, B. P.; de Sablet, T.;
Glumac, A.; Lewis, N. D.; Correa, P.; Peek, R. M., Jr.; Chaturvedi, R.; Wilson, K. T., Disruption
of nitric oxide signaling by Helicobacter pylori results in enhanced inflammation by inhibition of heme
oxygenase-1. J Immunol 2011, 187 (10), 5370-9.
16. Bonavida, B.; Garban, H., Nitric oxide-mediated sensitization of resistant tumor cells to apoptosis
by chemo-immunotherapeutics. Redox Biol 2015, 6, 486-94.
17. Crook, K. R.; Jin, M.; Weeks, M. F.; Rampersad, R. R.; Baldi, R. M.; Glekas, A. S.;
Shen, Y.; Esserman, D. A.; Little, P.; Schwartz, T. A.; Liu, P., Myeloid-derived suppressor cells
regulate T cell and B cell responses during autoimmune disease. J Leukoc Biol 2015, 97 (3), 573-82.
18. Marshall, H. E.; Merchant, K.; Stamler, J. S., Nitrosation and oxidation in the regulation of gene
expression. FASEB J 2000, 14 (13), 1889-900.
19. Peng, H. B.; Libby, P.; Liao, J. K., Induction and stabilization of I kappa B alpha by nitric oxide
mediates inhibition of NF-kappa B. J Biol Chem 1995, 270 (23), 14214-9.