Tail-labelling of DNA probes using modified deoxynucleotide triphosphates and terminal deoxynucleotidyl tranferase. Application in electrochemical DNA hybridization and protein-DNA binding assays

Article abstract of DOI:10.1039/c0ob00856g

A simple approach to DNA tail-labelling using terminal deoxynucleotidyl transferase and modified deoxynucleoside triphosphates is presented. Amino- and nitrophenyl-modified dNTPs were found to be good substrates for this enzyme giving 3′-end stretches of

Full text of DOI:10.1039/c0ob00856g

View Article Online / Journal Homepage / Table of Contents for this issue
Organic &
Biomolecular
Chemistry
Dynamic Article Links
Cite this: Org. Biomol. Chem., 2011, 9, 1366
www.rsc.org/obc
PAPER
Tail-labelling of DNA probes using modified deoxynucleotide triphosphates
and terminal deoxynucleotidyl tranferase. Application in electrochemical
DNA hybridization and protein-DNA binding assays
a
b
a
a
a
b
ˇ
Petra Hora´kova´, Hana Mac´ıcˇkova´-Cahova´, Hana Pivonˇkova´, Jan Spacˇek, Ludeˇk Havran, Michal Hocek*
and Miroslav Fojta*a
Received 9th October 2010, Accepted 11th November 2010
DOI: 10.1039/c0ob00856g
A simple approach to DNA tail-labelling using terminal deoxynucleotidyl transferase and modified
deoxynucleoside triphosphates is presented. Amino- and nitrophenyl-modified dNTPs were found to be
good substrates for this enzyme giving 3¢-end stretches of different lengths depending on the nucleotide
and concentration. 3-Nitrophenyl-7-deazaG was selected as the most useful label because its dNTP was
efficiently incorporated by the transferase to form long tail-labels at any oligonucleotide. Accumulation
of many nitrophenyl tags per oligonucleotide resulted in a considerable enhancement of voltammetric
signals due to the nitro group reduction, thus improving the sensitivity of electrochemical detection of
the tail-labelled probes. We demonstrate a perfect discrimination between complementary and
non-complementary target DNAs sequences by tail-labelled hybridization probes as well as the ability
of tumour suppressor p53 protein to recognize a specific binding site within tail-labelled DNA
substrates, making the methodology useful in electrochemical DNA hybridization and DNA-protein
interaction assays.
and on the efficiency of incorporation of the given nucleotide.
We focused the present study on incorporation of redox active
aminophenyl- and nitrophenyl-modified dNTPs.5
Introduction
Base-modified nucleic acids are of great current interest due
to applications in chemical biology, bioanalysis, catalysis or
nanotechnology and material science.1 Recently we2 and others3
have developed polymerase incorporations of base-functionalized
deoxynucleoside triphosphates (dNTPs) for enzymatic prepara-
tion of labelled DNA. We succeeded in the use of this approach for
redox labelling of DNA by ferrocene,4 amino- and nitrophenyl,5
or Ru/Os(bpy)36 tags useful for electrochemical detection and for
attachment of reactive aldehyde functions7 for further modifica-
tion. The polymerase incorporation (either by primer extension
or PCR) needs a template strand for specific incorporations of
the modified dNTPs. However, for many applications, a simple
end labelling by one or more modified nucleotides is sufficient.
Therefore, we report here on an efficient technique of DNA tail
labelling based on terminal deoxynucleotidyl transferase (TdT)
that attaches nucleotides at the 3¢-OH terminus of DNA using
dNTPs as substrates.8 A single-stranded primer can thus easily
by extended by a homonucleotide (when a single dNTP is used)
stretch, the length of which depends on the dNTP/primer ratio
Results and discussion
Synthesis and incorporation of labelled nucleotides with TdT
All eight combinations of NH2- and NO2Ph-modified dNTPs
(dNNH2TP and dNNO2TP, where N = 7-deazaA, 7-deazaG, C, U)
were prepared by the aqueous Suzuki–Miyaura cross-coupling
of the corresponding halogenated dNTPs with 3-amino- or 3-
nitrophenylboronic acid (Scheme 1). The modified dGXTPs were
new compounds, while the other nucleotides were reported earlier.5
All these dNXTPs were tested as substrates for for TdT. In
general, longer labelled tails were created with 7-substituted 7-
deazaguanines than with 5-substituted pyrimidines, but remark-
able differences in length distributions of the products were
observed also within these two groups (Fig. 1B,i). The dCXTPs
gave products elongated by 1 to 5 nucleotides, with most intense
bands corresponding to 2–3 extra nucleotides. For dUXTPs the
mean length of the labelled tail was 4–5 nucleotides and the
maximum length of the tail was ~14 nucleotides. The most intense
band observed for TdT reaction with dAXTPs corresponded to one
nucleotide attached, but the products were rather polydisperse
in lengths, reaching several tens of extra nucleotides. The most
facile synthesis of long labelled tails was exhibited, under the given
conditions, by dGXTPs (see below).
aInstitute of Biophysics, v.v.i., Academy of Sciences of the Czech Republic,
Kralovopolska 135, CZ-612 65, Brno, Czech Republic. E-mail: fojta@ibp.cz;
Fax: (+420) 541211293
bInstitute of Organic Chemistry and Biochemistry, v.v.i., Academy of Sciences
of the Czech Republic; Gilead Sciences & IOCB Research Center, Flemingovo
nam. 2, CZ-16610, Prague 6, Czech Republic. E-mail: hocek@uochb.cas.cz;
Fax: (+420) 220183559
1366 | Org. Biomol. Chem., 2011, 9, 1366–1371
This journal is
The Royal Society of Chemistry 2011
©

View Article Online
Table 1 Synthetic ONs used in this work
Acronym
Sequence (5¢→3¢)
prim-15
GAATTCGATATCAAG
prim-18A20 (A)20AGGCATGGGCGGCATGGG-3¢
target Aa
probe Aa
target Ba
probe Ba
PGM1b
CAGGCACAAACACGCACCTCA(A)20
GAGGTGCGTGTTTGTGCCTG
GGATGGGCCTCCGGTTCATGA(A)20
CCTACCCGGAGGCCAAGTACT
GACGGTATCGATAAGAGGCATGTCTAGGCATGTCT-
CTTGATATCGAATTC
noCONb
GACGGTATCGATAAGGCATCATAGCGCATCATA-
GCCTTGATATCGAATTC
a Sequences derived from two regions of TAp53 gene encompassing
mutation hotspots in codons 273 (target A and probe A) and 248 (target
B and probe B).9 The (A)20 adaptors are used for attachment of the
targets at magnetic beads in the DNA hybridization experiments.10 b Top
strands of PGM1 and noCON 50-mer duplexes used in the protein-DNA
binding experiments. PGM1 comprises an optimized binding site for the
p53 protein11 (bold), noCON is a non-specific control.
Scheme 1 Synthesis of dGNO2TP and dGNH2TP and structures of other
dNTPs used in the study (reported earlier in ref. 5).
Electrochemical analysis of tail-labelled ONs
Previously it was shown5 that DNA labelled with nitrophenyl A, C
and U conjugates yields irreversible four-electron (per nitro group)
reduction detectable at carbon electrodes. Here we measured
voltammetric responses for products of the TdT reactions of
various ON substrates (in Fig. 2 shown for prim-18A20, isolated
after the TdT extension from the reaction mixture using magnetic
beads bearing d(T)25 stretches, see Scheme 2A), with dGNO2TP
at mercury (HMDE), mercury meniscus-modified solid amalgam
(m-AgSAE)12 and pyrolytic graphite (PGE) electrodes.13 Cyclic
voltammogram of unextended ON primers (Fig. 2, black curve)
displayed two current signals corresponding to redox processes
of natural nucleobases, a cathodic peak CA at ~ -1.5 V (due to
A and C) and a peak G at -0.25 V (due to guanine).13 For the
product of the tailing reaction, another distinct cathodic peak
appeared at -0.50 V suggesting an efficient incorporation of the
GNO2 electroactive tags (peak NO2; red curve in Fig. 2). Current
Fig. 1 (A) Scheme of end- or tail-labelling of an ON probe with an
electroactive marker GNO2 using dGNO2TP and TdT. (B) Denaturing PAGE
of products of TdT-catalyzed extension of 32P-labelled prim-15 ON: (i),
reactions with dNNH2TP and dNNO2TP (200 mM); (ii), reactions with
dGNO2TP at concentrations given in the figure; P, primer; E, long extended
products.
For further experiments we chose dGNO2TP with respect to
(a) facile TdT extension, and (b) favourable electrochemical
properties of the nitro group that undergoes multi-electron
electrochemical reduction at mercury- or carbon based electrodes
(see below).
The TdT extension reactions were performed with several
primer oligonucleotides (ONs; see Table 1) which gave basically
the same results as shown in Fig. 1B,ii for the prim-15 ON. For
7 mM primer and 10 mM dGNO2TP, the ON was extended by 0–
5 nucleotides. For 25 mM dGNO2TP, the main product contained
4 extra nucleotides which was close to the dNTP/primer molar
ratio. For dGNO2TP concentrations between 50 and 100 mM, the
mean lengths of the products were outside the region of efficient
separation in the 15% polyacrylamide gel (marked by E in Fig. 1B),
and for 250 mM dGNO2TP, a considerable portion of the radioactive
material was unable to enter the gel. In all cases, certain amount
of the relatively short extension products was detected (even in the
high excesses of the dGNO2TP), which was consistent with the non-
processive mechanism of the TdT tailing reactions.8 Essentially
the same behavior was observed with other ON substrates used in
this work (Table 1).
Fig. 2 Ex situ cyclic voltammograms (CV) measured at HMDE for
prim-18A20 ON after TdT-catalyzed extension reaction with 75 mM
dGNO2TP (red) and negative control (no TdT added; black). Insets: CV
measured at HMDE (i) or m-AgSAE (ii), and square wave voltammograms
measured at PGE (iii) with TdT extension products obtained for 25 mM
(red curves) or 10 mM (black) dGNO2TP and for the negative control (blue).
This journal is
The Royal Society of Chemistry 2011
Org. Biomol. Chem., 2011, 9, 1366–1371 | 1367
©

View Article Online
Fig. 3 (A) Dependence of the peak NO2 (see Fig. 2) area on dGNO2TP
concentration used for the TdT extension of prim-18A20 (for 0.8 mM ON).
(B) Dependence of the peak NO2 area on the labelled ON concentration
(for prim-18A20 TdT extension of 0.8 mM ON in the presence of 100 mM
dGNO2TP; concentrations in the graph were reached by dilution of the
reaction product).
curve for products of TdT extension of prim-18A20 with 100 mM
dGNO2TP, exhibiting linearity at least between 2 and 240 nM of
the tail-labelled DNA.
Scheme 2 (A) TdT extension and magnetic separation of prim-18A20 ON
followed by voltammetric analysis. The ON involves an A20 stretch at its
5¢-end. After the TdT reaction, the products are captured from the reaction
mixture at magnetic beads covered with Tn ONs (MBT), followed by sep-
aration, washing and release of the labelled ONs which are thus ready for
ex situ voltammetric analysis. (B) Sandwich DNA hybridization at MBT
with a tail-labelled reporter probe. Target ON possessing the An adaptor is
captured at the beads, followed by hybridization with the complementary
probe. Separation, washing, dissociation and voltammetric detection are
performed as above.
Examples of bioanalytical applications
The TdT tail-labelled ONs were further tested in simple
model bioassays. In particular, we were interested whether ON
probes/substrates with long chemically modified overhangs retain
their biorecognition features such as sequence-specific DNA hy-
bridization or DNA-protein recognition, and whether these events
are detectable by simple electrochemical assays. For this purpose,
we prepared tail GNO2-labelled reporter probes (RP) for magnetic
beads-based sandwich hybridization assays10 (Fig. 4A) and DNA
signals of the GNO2 labels in products extended in the presence
of various dGNO2TP concentrations were compared for different
working electrodes (inset in Fig. 2). Using the HMDE (panel i),
a symmetrical peak NO2 was obtained for 10 mM dGNO2TP per
0.7 mM ON (corresponding to incomplete labelling of the 38-mer
prim-18A20 with one or few GNO2 moieties, Fig. 1B). A distinct
(albeit less well developed) peak NO2 was observed for the same
extension product with the m-AgSAE as well (panel ii), while its
response at the PGE was rather poor (panel iii). Longer extension
products (bearing about 4 GNO2 tags per ON, obtained for 25 mM
dGNO2TP) yielded well defined signals at all electrode types (Fig. 2).
The mercury-based electrodes thus offered a higher sensitivity of
the GNO2 tags detection, but using longer labelled tails, carbon
electrodes can be used owing to the signal amplification.
Areas of the peak NO2 increased with increasing concentration
of dGNO2TP in the TdT reaction mixture about linearly up to 75 mM
and levelled off for higher dNTP concentrations (Fig. 3A). Such
behaviour displayed correlation between the signal intensity and
the labelled tail (as assessed by the PAGE analysis, Fig. 1B) in the
former region and revealed limitations of the signal amplification
through further extension of the ON. Fig. 3B shows calibration
Fig. 4 Sandwich DNA hybridization assay at magnetic beads with (GNO2
tail-labelled reporter probes. Left: results for target A; right: results for
target B. For procedure, see Scheme 2B.
)
n
1368 | Org. Biomol. Chem., 2011, 9, 1366–1371
This journal is
The Royal Society of Chemistry 2011
©

View Article Online
substrates for immunoprecipitation binding experiments with
tumour suppressor protein p5314 (Fig. 3B).
the same but unlabelled DNA only a weak signal at a potential by
50 mV more negative was detected (black). The latter signal was
probably due to certain amount of protein released from the beads
which was adsorbed at the electrode and yielded a characteristic
peak due to cysteine thiol groups (this assumption was supported
through measurements with free p53 protein, not shown). For the
Hybridization experiments were performed with target se-
quences derived from two TAp53 gene regions (Table 1). Both
target ONs comprised dA20 adaptors for immobilization at
magnetic beads bearing dT25 strands (MBT). The target strands
were captured at the MBT and subsequently hybridized with one of
the tail-labelled RPs, of which one was complementary to the given
target and the other non-complemetary. After magnetic separation
and washing of the beads, the hybridized DNA was recovered by
thermal treatment and determined by adsorptive transfer stripping
(AdTS) cyclic voltammetry (CV) at the HMDE (Scheme 2B).
The results perfectly correlated with complementarity between
the target and RP sequences (Fig. 4): when target A was first
immobilized at the MBT followed by hybridization with the
complementary probe A, a strong peak NO2 was observed,
which was however absent when the non-complementary probe
B was applied. When analogous hybridization experiments were
performed with target B, positive hybridization signal (peak NO2)
was observed for probe B and negative for probe A (Fig. 4). The
peak Greflected presenceand abundanceofguanineresidues inthe
target and/or complementary probe strands (compare nucleotide
sequences in Table 1).
Protein-DNA binding experiments were conducted according
to the scheme depicted in Fig. 5. Immune complex of the p53
protein with the Bp53-10.1 antibody (Ab) was first formed in
solution to which the labelled DNA substrate was subsequently
added, followed by incubation to allow the p53-DNA binding.
The Ab-p53-DNA complexes were captured at magnetic beads
covered with protein G. After magnetic separation, the labelled
DNA substrate was recovered through salt-induced dissociation
of the p53-DNA complex and analyzed voltammetrically. Two
types of DNA substrates were used: one comprising a specific
binding site of the p53 protein (PGM1) and the other lacking such
site (noCON). As shown in Fig. 5, a well defined peak NO2 was
obtained for the labelled PGM1 substrate (red curve), while for
G
NO2 tail-labelled noCON substrate, the intensity of peak NO2 was
about 4-times lower (blue), compared to the same signal obtained
for the specific PGM1 substrate.
Conclusions
In this paper we present a facile tail-labelling of DNA probes using
TdT enzyme and a modified dNTP. Unlike classical primer exten-
sion or PCR, the labelling by TdT does not require template strand
and therefore it is a general method for 3¢-end-labelling of virtually
any DNA. Different modified dNXTPs gave tail-labels of different
length depending on the nucleobase, label and concentration of
the nucleotide. Long GNO2 tails were efficiently attached to specific
ON sequences rendering them electrochemical activity of the ni-
trogroup and making them sensitively detectable by simple ex situ
voltammetric measurements. Tail-labelled hybridization probes
showed perfect discrimination between complementary and non-
complementary target DNAs. The p53 protein-DNA binding
experiments revealed reasonable distinction between sequence-
specific and non-specific DNA substrates, as well as relatively weak
interference of the protein electrochemical activity in the peak
NO2 measurements. Thus, both hybridization probes and protein
binding substrates with long GNO2 tails retained their biomolecular
recognition properties. To improve the protein binding specificity,
particularly to minimize the extent of non-specific protein-DNA
binding, more work (focused on e.g., optimization of the tail
lengths, choice of optimum labels, etc.) is required which is matter
of our ongoing study.
Experimental section
Suzuki cross-coupling reactions of 7-I-7-deaza-dGTP with
3-aminophenylboronic and 3-nitrophenylboronic acid
General procedure. Water–acetonitrile mixture (2 : 1, 0.5 ml)
was added through septum to an argon purged vial containing
halogenated dNTP (0.042 mmol), 3-aminophenylboronic acid
hydrochloride (14.6 mg, 0.084 mmol) or 3-nitrophenylboronic
acid (14 mg, 0.084 mmol), Cs2CO3 (68.5 mg, 0.21 mmol). After
dissolving of the solids, a solution of Pd(OAc)2 (1 mg, 0.0042
mmol) and TPPTS (12 mg, 0.021 mmol) in water–acetonitrile
(2 : 1, 0.3 ml) was added and the mixture was stirred and heated up
to 120 ◦C for 30 min. Products were isolated from crude reaction
mixture by HPLC on C18 column with the use of linear gradient
of 0.1 M TEAB (triethylammonium bicarbonate) in H2O to 0.1 M
TEAB in H2O–MeOH (1 : 1) as eluent, followed by HPLC on
POROS (Applied Biosystems) with the use of gradient of H2O
to 400 mM TEAB to separate out the diphosphate dertivative.
Several co-distillations with water and conversion to sodium salt
(Dowex 50 W X 8 in Na+cycle) form followed by freeze drying
from water gave white solid products in purity ca. 75% (impurity:
ca 25% of the corresponding nucleoside diphosphate).
Fig. 5 MBIP assay for p53-DNA binding using (GNO2
) tail-labelled
n
DNA substrates: left, scheme of the procedure. The antibody-p53-DNA
complex was formed in solution, followed by capture at magnetic beads
covered with protein G (specifically binding the antibody; MBG). After
separation, DNA was dissociated from the complex by heating at high salt
and analyzed by ex situ CV at HMDE. Right: sections of voltammograms
obtained for PGM1 ON (red curve) comprising a specific p53 binding
sequence and non-specific noCON ON (blue); black curve corresponds to
the same experiment with unlabelled PGM1.
This journal is
The Royal Society of Chemistry 2011
Org. Biomol. Chem., 2011, 9, 1366–1371 | 1369
©

View Article Online
7-(3-Nitrophenyl)-9-(2¢-deoxy-b-D-erythro-pentofuranosyl)-7-
deazaguanine-5¢-O-triphosphate (dGNO2TP). Yield 14%, pu-
rity 75% (impurity: 25% of the corresponding nucleoside
diphosphate). MS(ESI-): 648 (40, M+Na+-1), 546 (100, M-
PO3H2-1), HRMS: for C17H18N5O15NaP3 calculated 647.9910
TdT-catalyzed tail-labelling of ONs
If not stated otherwise in the text, the reaction mixtures containe,
per 10 mL-sample, 4 U of TdT and (a) 0.7 mM ON, 200 mM dNTP
(prim-15 labeling for PAGE - Fig. 1); (b) 0.8 mM ON, 100 mM
dGNO2TP (prim-18A20 labeling for electrochemical measurements-
Fig. 2); (c) 1.5 mM probe A or probe B, 100 mM dGNO2TP
(labelling of reporter probes, Fig. 3A); or (c) 1.5 mM of ss ONs
forming PGM1 or noCON duplexes, 250 mM dGNO2TP (labelling
of DNA substrates for DNA-protein binding, Fig. 3B). Reactions
were conducted at 37 ◦C for 60 min. For polyacrylamide gel
electrophoresis (PAGE, Fig. 1) experiments, prim-15 was 32P-
prelabeled at its 5¢ end. For electrochemical analysis of the tail-
labelled ONs, prim-18A20 containing (A)20 stretches at its 5¢ ends
was used and the extended products were purified using magnetic
beads MBT.10
found 647.9908. 1H NMR (499.8 MHz, D2O, pD = 7.1, refdioxane
=
3.75 ppm): 2.43 (ddd, 1H, Jgem = 14.0, J2¢b,1¢ = 6.2, J2¢b,3¢ = 3.0, H-2¢b);
2.71 (ddd, 1H, Jgem = 14.0, J2¢a,1¢ = 7.8, J2¢a,3¢ = 6.5, H-2¢a); 4.14, 4.18
(2 ¥ m, 2 ¥ 1H, H-5¢); 4.21 (m, 1H, H-4¢); 4.76 (overlapped with
HDO signal, H-3¢); 6.47 (dd, 1H, J1¢2¢ = 7.8, 6.2, H-1¢); 7.40 (s, 1H,
H-8); 7.59 (t, 1H, J5,4 = J5,6 = 8.1, H-5-C6H4NO2); 8.08 (bd, 1H,
J6,5 = 8.1, H-6-C6H4NO2); 8.11 (dd, 1H, J4,5 = 8.1, J4,2 = 2.0, H-4-
C6H4NO2); 8.70 (t, 1H, J2,4 = J2,6 = 2.0, H-2-C6H4NO2). 13C NMR
(125.7 MHz, D2O, pD = 7.1, refdioxane = 69.3 ppm): 40.85 (CH2-2¢);
68.35 (d, JC,P = 7.0, CH2-5¢); 73.96 (CH-3¢); 85.67 (CH-1¢); 87.78
(d, JC,P = 9.7, CH-4¢); 100.53 (C-5); 120.04 (CH-8); 121.72 (C-7);
124.07 (CH-4-C6H4NO2); 125.82 (CH-2-C6H4NO2); 132.07 (CH-
5-C6H4NO2); 136.82 (CH-6-C6H4NO2); 137.60 (C-1-C6H4NO2);
150.48 (C-3-C6H4NO2); 155.08 (C-4); 155.67 (CH-2); 163.76 (C-
Denaturing PAGE
6). 31P (1H dec.) NMR (202.3 MHz, D2O, pD = 7.1, refphosphate buffer
2.35 ppm): -21.27 (b, Pb); -10.29 (d, J = 18.8, Pa ); -6.62 (b, Pg ).
=
The TdT tail-labelled products were mixed with loading buffer
(80% formamide, 10 mM EDTA, 1 mg mL-1 xylene cyanol, 1 mg
mL-1 bromphenol blue) and subjected to electrophoresis in 15%
denaturing gel containing 1 ¥ TBE buffer (pH 8) and 7 M urea at 25
W for 50 min. Gels were dried, autoradiographed and visualized
using Phosphorimager Storm.
7-(3-Aminophenyl)-9-(2¢-deoxy-b-D-erythro-pentofuranosyl)-
7-deazaguanine-5¢-O-triphosphate (dGNH2TP). Yield 23%, pu-
rity 75% (impurity: 25% of the corresponding nucleoside
diphosphate). MS(ESI-): 618 (30, M+Na+-1), 516 (100, M-
PO3H2-1), HRMS: for C17H20N5O13NaP3 calculated 618.0168
found 618.0165. 1H NMR (499.8 MHz, D2O, pD = 7.1, refdioxane
=
3.75 ppm): 2.39 (ddd, 1H, Jgem = 14.0, J2¢b,1¢ = 6.3, J2¢b,3¢ = 3.2, H-
2¢b); 2.69 (ddd, 1H, Jgem = 14.0, J2¢a,1¢ = 7.7, J2¢a,3¢ = 6.3, H-2¢a); 4.14,
Separation of modified ONs with MBT
4.18 (2 ¥ m, 2 ¥ 1H, H-5¢); 4.22 (m, 1H, H-4¢); 4.74 (dt, 1H, J3¢,2¢
=
The TdT tail-labelled products of prim-18A20 were captured at
MB via (A)20 adaptors. Then, 50 ml aliquots of the reaction
mixtures were added to the MBT (25 mL of the stock suspension
washed twice with 100 mL of 0.3 M NaCl, 10 mM Tris-HCl,
pH 7.4 - buffer H). The mixture was incubated on a shaker
for 30 min at 20 ◦C. Then the beads were washed three times
with 100 mL PBS (0.14 M NaCl, 3 mM KCl, 4 mM sodium
phosphate, pH 7.4) with 0.01% Tween20, three times with
100 mL of the buffer H and resuspended in deionized water
(50 mL). The labelled ONs were recovered by heating at 75 ◦C
for 2 min. Prior to the ex situ electrochemical measurements,
NaCl was added to the samples to reach final concentration of
0.3 M.
6.3, 3.2, J3¢,4¢ = 3.2, H-3¢); 6.47 (dd, 1H, J1¢2¢ = 7.7, 6.3, H-1¢); 6.80
(bd, 1H, J4,5 = 7.5, H-4-C6H4NH2); 7.21 (m, 2H, H-2,6-C6H4NH2);
7.24 (s, 1H, H-8); 7.26 (bt, 1H, J5,4 = J5,6 = 7.5, H-5-C6H4NH2).
13C NMR (125.7 MHz, D2O, pD = 7.1, refdioxane = 69.3 ppm):
40.81 (CH2-2¢); 68.34 (d, JC,P = 5.7, CH2-5¢); 73.98 (CH-3¢); 85.61
(CH-1¢); 87.72 (d, JC,P = 8.8, CH-4¢); 100.65 (C-5); 117.97 (CH-4-
C6H4NH2); 119.02 (CH-8); 119.11 (CH-2-C6H4NH2); 122.64 (CH-
6-C6H4NH2); 123.69 (C-7); 132.13 (CH-5-C6H4NH2); 137.19 (C-1-
C6H4NH2); 148.21 (C-3-C6H4NH2); 154.80 (C-4); 155.53 (CH-2);
163.75 (C-6). 31P (1H dec.) NMR (202.3 MHz, D2O, pD = 7.1,
refphosphate buffer = 2.35 ppm): -21.40 (t, J = 19.3, Pb); -10.35 (d, J =
19.3, Pa ); -6.68 (d, J = 19.3, Pg ).
Other material
DNA Hybridization at MBT
Synthetic oligonucleotides (ONs; Table 1) were purchased from
VBC genomics (Austria). Terminal deoxynucleotidyl transferase
(TdT) and T4 Polynucleotide kinase were purchased from New
England Biolabs, g-32P-ATP from MP Empowered Discovery
(USA), unmodified nucleoside triphosphates from Sigma (USA),
magnetic beads bearing oligo d(T)25 (MBT) and protein G-
coated magnetic beads (MBG) from Invitrogen (USA). Murine
anti-p53 monoclonal antibody Bp53-10.1 was obtained from the
Masaryk Memorial Cancer Institute (Brno, Czech Republic).
Wild type human full length p53 protein, expressed in E. coli
BL21/DE3 and purified as described previously,15 was kindly
donated by Dr Marie Bra´zdova´. Other chemicals wereofanalytical
grade.
Target ONs bearing A20 stretch (20 ml of 0.8 mM ON in solution
contaning 0.3 M NaCl) were captured on MBT (20 mL of the stock
suspension washed twice with 100 mL of buffer H). The mixture
was incubated on a shaker for 30 min at 20 ◦C. Subsequently, the
tail-labelled reporter probes (20 mL of unpurified TdT-reaction
mixture supplemented with NaCl to concentration of 0.3 M) were
added to the MBT, incubated on a shaker for 30 min at 20 ◦C. Then
the beads were washed three times with 100 mL PBS with 0.01%
Tween20, three times with 100 mL of the buffer H and resuspended
in deionized water (20 mL). The hybridized DNA was released by
heating at 75 ◦C for 2 min. Again, NaCl was added to each sample
to a final concentration of 0.3 M prior to the ex situ voltammetric
analysis.
1370 | Org. Biomol. Chem., 2011, 9, 1366–1371
This journal is
The Royal Society of Chemistry 2011
©

View Article Online
Immunoprecipitation assay of the p53-DNA binding with magnetic
beads
Notes and references
1 (a) M. Famulok, Curr. Opin. Mol. Ther., 2005, 7, 137–143; (b) M.
Famulok, J. S. Hartig and G. Mayer, Chem. Rev., 2007, 107, 3715–3743;
(c) A. Peracchi, ChemBioChem, 2005, 6, 1316–1322; (d) A. Condon,
Nat. Rev. Genet., 2006, 7, 565–575; (e) F. E. Alemdaroglu and A.
Herrmann, Org. Biomol. Chem., 2007, 5, 1311–1320; (f) U. Feldkamp
and C. M. Niemeyer, Angew. Chem., Int. Ed., 2006, 45, 1856–1876.
2 Recent review: M. Hocek and M. Fojta, Org. Biomol. Chem., 2008, 6,
2233–2241.
3 Recent examples: (a) T. Gourlain, A. Sidorov, N. Mignet, S. J. Thorpe,
S. E. Lee, J. A. Grasby and D. M. Williams, Nucleic Acids Res., 2001,
29, 1898–1905; (b) L. H. Thoresen, G.-S. Jiao, W. C. Haaland, M. L.
Metzker and K. Burgess, Chem.–Eur. J., 2003, 9, 4603–4610; (c) S.
Ja¨ger, G. Rasched, H. Kornreich-Leshem, M. Engeser, O. Thum and
M. Famulok, J. Am. Chem. Soc., 2005, 127, 15071–15082; (d) M.
Kuwahara, J. Nagashima, M. Hasegawa, T. Tamura, R. Kitagata,
K. Hanawa, S. Hososhima, T. Kasamatsu, H. Ozaki and H. Sawai,
Nucleic Acids Res., 2006, 34, 5383–5394; (e) A. Shoji, T. Hasegawa, M.
Kuwahara, H. Ozaki and H. Sawai, Bioorg. Med. Chem. Lett., 2007,
17, 776–779; (f) S. Obeid, M. Yulikow, G. Jeschke and A. Marx, Angew.
Chem., Int. Ed., 2008, 47, 6782–6785; (g) B. Holzberger and A. Marx,
Bioorg. Med. Chem., 2009, 17, 3653–3658; (h) V. Borsenberger and S.
Howorka, Nucleic Acids Res., 2009, 37, 1477–1485; (i) V. Borsenberger,
M. Kukwikila and S. Howorka, Org. Biomol. Chem., 2009, 7, 3826–
3835; (j) P. M. E. Gramlich, S. Warncke, J. Gierlich and T. Carell,
Angew. Chem., Int. Ed., 2008, 47, 3442–3444; (k) A. Baccaro and A.
Marx, Chem.–Eur. J., 2010, 16, 218–226.
(MBIP assay14) The p53 immune complexes were prepared by
mixing of Bp53-10.1 antibody16 with the protein at a molar ratio
of 16 : 1 in binding buffer (50 mM KCl, 5 mM Tris and 0.01%
Triton X-100, pH 7.6), followed by a 20-min incubation. Then,
approximately 200 ng of the tail-labelled duplexes (prepared by
annealing of equivalent amounts of tail-labelled and comple-
mentary strands, purified using QIAquick Nucleotide Removal
Kit, Qiagen) and 300 ng of scDNA pBSK(-) were mixed with
the given immune complex (p53 tetramer/scDNA molar ratio
was 2.5 : 1) and incubated in the binding buffer for 30 min on
ice. Magnetic beads MBG (12 ml of the stock suspension per
sample) were washed three times with 100 ml of the binding
buffer. The beads were separated from the supernatant using
magnetic particle concentrator. Then the binding reaction mixture
was added and incubated with the beads for 30 min at 10 ◦C
whilst shaking mildly. Finally, after triplicate washing with the
binding buffer, DNA was released from the MBG-confined p53
complexes through a 5-min incubation at 65 ◦C in 20 ml of
0.5 M NaCl.
4 P. Bra´zdilova´, M. Vra´bel, R. Pohl, H. Pivonˇkova´, L. Havran, M. Hocek
and M. Fojta, Chem.–Eur. J., 2007, 13, 9527–9533.
Electrochemical analysis
5 H. Cahova´, L. Havran, P. Bra´zdilova´, H. Pivonˇkova´, R. Pohl, M. Fojta
and M. Hocek,, Angew. Chem., Int. Ed., 2008, 47, 2059–2062.
The TdT tail-labelled products were analyzed by using ex situ
(adsorptive transfer stripping) cyclic voltammetry (AdTS CV)
using hanging mercury drop electrode (HMDE) or meniscus-
modified solid amalgam electrode17 (m-AgSAE, prepared and
treated as described18), or by ex situ square wave voltammetry
(AdTS SWV) using basal-plane pyrolytic graphite electrode (PGE;
prepared and treated as described19). DNA was accumulated
at the electrode surface from 5 mL aliquots containing 0.3 M
NaCl for 60 s. Then the electrode was rinsed by deionized
water and was placed into the electrochemical cell. CV settings:
initial potential 0.0 V, switching potential -1.85 V, final poten-
tial 0.0 V, scan rate 1 V s-1, step potential 5 mV, in 0.3 M
ammonium formate with 0.05 M sodium phosphate, pH 6.9 as
a supporting electrolyte. SWV settings: initial potential 0.5 V,
final potential -1.5 V, frequency 200 Hz, amplitude 25 mV, in
0.2 M acetate buffer, pH 5. The measurements were performed
at ambient temperature by using Autolab analyzer (Metrohm
Autolab, The Netherlands) in connection with VA-stand 663
(Metohm, Switzerland) in a three-electrode setup (with the
HMDE, mAgSAE or PGE as working electrode, Ag/AgCl/3 M
KCl as reference, and platinum wire as counter electrode). Baseline
correction of chosen curves was performed using GPES 4 software
(EcoChemie).
ˇ
6 M. Vra´bel, P. Hora´kova´, H. Pivonˇkova´, L. Kalachova, H. Cernocka´,
ˇ
H. Cahova´, R. Pohl, P. Sebest, L. Havran, M. Hocek and M. Fojta,
Chem. Eur. J., 2009, 15, 1144–1154.
ˇ
7 V. Raindlova´, R. Pohl, M. Sanda and M. Hocek, Angew. Chem., Int.
Ed., 2010, 49, 1064–1066.
8 A. M. Michelson and S. H. Orkin, J. Biol. Chem., 1982, 257, 14773–
14782.
9 (a) M. Brazdova, T. Quante, L. Togel, K. Walter, C. Loscher, V. Tichy,
L. Cincarova, W. Deppert and G. V. Tolstonog, Nucleic Acids Res.,
2009, 37, 1486–00; (b) P. Horakova, E. Simkova, Z. Vychodilova, M.
Brazdova and M. Fojta, Electroanalysis, 2009, 21, 1723–1729.
10 (a) E. Palecek and M. Fojta, Talanta, 2007, 74, 276–290; (b) M. Fojta, P.
Kostecka, M. Trefulka, L. Havran and E. Palecek, Anal. Chem., 2007,
79, 1022–1029.
11 (a) H. Pivonkova, P. Sebest, P. Pecinka, O. Ticha, K. Nemcova, M.
Brazdova, E. B. Jagelska, V. Brazda and M. Fojta, Biochem. Biophys.
Res. Commun., 2010, 393, 894–899; (b) K. Nemcova, L. Havran, P.
Sebest, M. Brazdova, H. Pivonkova and M. Fojta, Anal. Chim. Acta,
2010, 668, 166–170.
12 B. Yosypchuk and J. Barek, Crit. Rev. Anal. Chem., 2009, 39, 189–203.
13 (a) E. Palecek and F. Jelen, in Electrochemistry of nucleic acids and
proteins. Towards electrochemical sensors for genomics and proteomics.,
ed. E. Palecek, F. Scheller and J. Wang, Elsevier, Amsterdam, 2005,
vol. 1, pp. 74–174; (b) M. Fojta, F. Jelen, L. Havran and E. Palecek,
Curr. Anal. Chem., 2008, 4, 250–262.
14 (a) H. Pivonkova, P. Sebest, P. Pecinka, O. Ticha, K. Nemcova, M.
Brazdova, E. B. Jagelska, V. Brazda and M. Fojta, Biochem. Biophys.
Res. Commun., 2010, 393, 894–899; (b) E. B. Jagelska, V. Brazda, P.
Pecinka, E. Palecek and M. Fojta, Biochem. J., 2008, 412, 57–63; (c) K.
Nemcova, L. Havran, P. Sebest, M. Brazdova, H. Pivonkova and M.
Fojta, Anal. Chim. Acta, 2010, 668, 166–170.
Acknowledgements
15 M. Brazdova, J. Palecek, D. I. Cherny, S. Billova, M. Fojta, P. Pecinka,
B. Vojtesek, T. M. Jovin and E. Palecek, Nucleic Acids Res., 2002, 30,
4966–4974.
16 S. Pospisilova, V. Brazda, J. Amrichova, R. Kamermeierova, E. Palecek
and B. Vojtesek, J. Immunol. Methods, 2000, 237, 51–64.
17 B. Yosypchuk and J. Barek, Crit. Rev. Anal. Chem., 2009, 39, 189–203.
18 R. Fadrna, K. Kucharikova-Cahova, L. Havran, B. Yosypchuk and M.
Fojta, Electroanalysis, 2005, 17, 452–459.
This work was supported by the Academy of Sciences of the
Czech Republic (Z4 055 0506, Z5 004 0507 and Z5 004 0702),
the Ministry of Education (LC06035, LC512), Grant Agency of
the Academy of Sciences of the Czech Republic (IAA400040901),
and by Gilead Sciences, Inc. (Foster City, CA, U. S. A.). The
authors thank Dr Marie Bra´zdova´ for donation of the p53
protein.
19 M. Fojta, L. Havran, R. Kizek and S. Billova, Talanta, 2002, 56, 867–
874.
This journal is
The Royal Society of Chemistry 2011
Org. Biomol. Chem., 2011, 9, 1366–1371 | 1371
©