Synthetic approach to stop-codon scanning mutagenesis

Article abstract of DOI:10.1021/ja106894g

A general combinatorial mutagenesis strategy using common dimethoxytrityl-protected mononucleotide phosphoramidites and a single orthogonally protected trinucleotide phosphoramidite (Fmoc-TAG; Fmoc = 9-fluorenylmethoxycarbonyl) was developed to scan a gene with the TAG amber stop codon with complete synthetic control. In combination with stop-codon suppressors that insert natural (e.g., alanine) or unnatural (e.g., p-benzoylphenylalanine, Bpa) amino acids, a single DNA library can be used to incorporate different amino acids for diverse purposes. Here, we scanned TAG codons through part of the gene for a model four-helix bundle protein, Rop, which regulates the copy number of ColE1 plasmids. Alanine was incorporated into Rop for mapping its binding site using an in vivo activity screen, and subtle but important differences from in vitro gel-shift studies of Rop function are evident. As a test, Bpa was incorporated using a Phe14 amber mutant isolated from the scanning library. Surprisingly, Phe14Bpa-Rop is weakly active, despite the critical role of Phe14 in Rop activity. Bpa is a photoaffinity label unnatural amino acid that can form covalent bonds with adjacent molecules upon UV irradiation. Irradiation of Phe14Bpa-Rop, which is a dimer in solution like wild-type Rop, results in covalent dimers, trimers, and tetramers. This suggests that Phe14Bpa-Rop weakly associates as a tetramer in solution and highlights the use of Bpa cross-linking as a means of trapping weak and transient interactions.

Full text of DOI:10.1021/ja106894g

ARTICLE
pubs.acs.org/JACS
Synthetic Approach to Stop-Codon Scanning Mutagenesis
Lihua Nie, Jason J. Lavinder, Mohosin Sarkar, Kimberly Stephany, and Thomas J. Magliery*
Departments of Chemistry and Biochemistry, The Ohio State University, 100 West 18th Avenue, Columbus, Ohio 43210, United States
S Supporting Information
b
ABSTRACT: A general combinatorial mutagenesis strategy
using common dimethoxytrityl-protected mononucleotide
phosphoramidites and a single orthogonally protected trinu-
cleotide
phosphoramidite
(Fmoc-TAG;
Fmoc
=
9-fluorenylmethoxycarbonyl) was developed to scan a gene
with the TAG amber stop codon with complete synthetic
control. In combination with stop-codon suppressors that insert
natural (e.g., alanine) or unnatural (e.g., p-benzoylphenylala-
nine, Bpa) amino acids, a single DNA library can be used to
incorporate different amino acids for diverse purposes. Here, we scanned TAG codons through part of the gene for a model four-
helix bundle protein, Rop, which regulates the copy number of ColE1 plasmids. Alanine was incorporated into Rop for mapping its
binding site using an in vivo activity screen, and subtle but important differences from in vitro gel-shift studies of Rop function are
evident. As a test, Bpa was incorporated using a Phe14 amber mutant isolated from the scanning library. Surprisingly, Phe14Bpa-Rop
is weakly active, despite the critical role of Phe14 in Rop activity. Bpa is a photoaffinity label unnatural amino acid that can form
covalent bonds with adjacent molecules upon UV irradiation. Irradiation of Phe14Bpa-Rop, which is a dimer in solution like wild-
type Rop, results in covalent dimers, trimers, and tetramers. This suggests that Phe14Bpa-Rop weakly associates as a tetramer in
solution and highlights the use of Bpa cross-linking as a means of trapping weak and transient interactions.
’ INTRODUCTION
introduced a binomial mutagenesis method in which alanine was
substituted for the wild-type amino acid by a single base change.2
Therefore, it is straightforward to make alanine mutations with a
probability of 0.5. This method produces a library that only
contains the wild type and alanine mutants. However, most of the
mutants have multiple alanine substitutions, and there are only
seven amino acids that can be mutated with this method.
Shotgun scanning was developed by Weiss and Sidhu3 to provide
a high-throughput alternative to traditional alanine scanning for
mapping of the binding energy contributions of residues in
protein-protein interfaces (hot spots4). The core of this method
is the synthesis of the positions of interest using degenerate
codons that include both Ala and the wild-type residue, using
online mixing to produce stoichiometric mixtures of phosphor-
amidites at each nucleotide position. However, as there are not
one-nucleotide differences between codons for all amino acids
and Ala, some positions are varied to up to four amino acids
(e.g., CG/AG/G is the closest match for Ala and Gln, but also
codes for Pro and Glu). Without the use of a second set of
diluted phosphoramidites, this method also produces clones
with multiple mutations (more than N/2, depending on
how many of the N sites code for two or four amino acids).
Using dimethoxytrityl (DMT)-protected trinucleotide phos-
phoramidite synthons that correspond directly to the amino
acid codons needed is the most direct route to control
mutagenesis.5-7 However, this is quite expensive, and no
High-throughput sequencing, structural genomics, computa-
tional biology, and parallel approaches to protein interactions
have transformed the pace at which we can understand the
structure, function, and associations of a gene product. However,
the detailed understanding of the function of any one protein,
even if the structure is known, is still difficult and laborious.
Alanine scanning mutagenesis remains the workhorse technol-
ogy to estimate which protein side chains are critical for enzy-
matic activity, interactions, folding, and structure. Modern
methods of site-directed mutagenesis and gene synthesis have
greatly expanded the throughput of mutagenic scanning experi-
ments, but for most laboratories this is still a laborious and time-
consuming step.
A number of technologies have been introduced to speed up
scanning mutagenesis, but they are often limited by the type,
frequency, or specificity of mutation or by requiring a great deal
more organic synthesis on an ongoing basis than is at the disposal
of most molecular biologists. The ideal scanning library would
offer production of variants with only the probe amino acid (e.g.,
Ala) or the wild-type amino acid at each position, a controllable
number of mutations per gene (typically one), control of the
possible locations for scanning and applicability to both large and
small proteins, a minimal number of unique synthetic reagents,
and compatibility with automated methods. Chatellier et al. have
demonstrated a split-and-pool method which splits the resin for
DNA synthesis into two columns where the wild-type codon and
an alanine codon are synthesized separately, but mixing and
splitting the resin requires manual intervention.1 Gregoret et al.
Received: August 2, 2010
Published: March 31, 2011
r
2011 American Chemical Society
6177
dx.doi.org/10.1021/ja106894g J. Am. Chem. Soc. 2011, 133, 6177–6186
|

Journal of the American Chemical Society
ARTICLE
commercially available DNA synthesizer has 20 additional
ports for the full complement of trinucleotides.
library of TAG mutations. However, in contrast to Shortle or
Soberon, only a single Fmoc trinucleotide phosphoramidite
(Fmoc-TAG) is required, and we report its synthesis and
application for the first time.
Alanine is not the only plausible residue for scanning; other
types of systematic scans can augment traditional alanine scan-
ning data. For example, Pal et al. have used their shotgun scanning
method for “homologue scanning”, mutating to a related amino
acid instead of Ala, which reveals a hot spot different from that in
pure Ala scanning (for example, it can reveal the function of Ala
residues).8 Cysteine scanning is a common method for under-
standing the topology of membrane proteins and provides a way
to label proteins, albeit often not uniquely unless the protein
naturally contains no Cys residues. One solution to this problem
is instead to scan the protein with unnatural amino acids.
Methodology developed in the Schultz group currently enables
the insertion of approximately 70 different unnatural amino acids
in bacteria and yeast, providing chemical analogues, biophysical
probes such as fluorophores, unique reactive handles such as
ketones, and photoactivatable amino acids such as photo-cross-
linkers.9 Indeed, incorporation of the photoaffinity label p-ben-
zoylphenylalanine (Bpa)10-12 has helped elucidate protein bind-
ing partners. Kauer et al. first synthesized Bpa and incorporated it
into a 17-residue calmodulin binding peptide by solid-phase
peptide synthesis.13 Schultz and co-workers incorporated Bpa
into Escherichia coli catabolite activator protein (CAP) by using
stop-codon suppression. The mutant CAP (CAP-K26Bpa)
formed a covalent complex with a DNA fragment containing
the consensus operator sequence upon UV irradiation.14 Re-
cently, Mapp and colleagues have trapped the interaction of Gal4
and Gal80 with Bpa incorporation in yeast.15
Unnatural amino acids are inserted by engineered aminoacyl-
tRNA synthetases (aaRSs) that uniquely acylate an engineered
tRNA that decodes a four-base codon or, more commonly, the
amber stop codon, TAG.16 In addition, natural and engineered
suppressor tRNAs can be used to insert 13 different amino acids
in response to TAG (Ala, Cys, Ser, Leu, Glu, Gln, Tyr, Lys, Gly,
His, Phe, Pro, Arg).17 Thus, a library of amber stop-codon
mutants is a very flexible one, in that it encodes a library of over
80 natural and unnatural amino acids by coexpression of the
suppressing tRNA (and aaRS for unnatural amino acids). The
TAG stop codon is the least used in E. coli and yeast, and good
though variable suppression efficiencies around 25% are typical.
Here we demonstrate a DNA synthetic method of generating
in-frame libraries of amber stop-codon variants of a gene. A single
unique synthetic reagent is necessary for this method, a TAG
trinucleotide phosphoramidite with base-labile 50-hydroxyl pro-
tection (9-fluorenylmethoxycarbonyl, Fmoc), and it is fully
incorporable into standard, automated DNA synthesis on a
common commercially available apparatus with no manual
intervention. The rate of mutagenesis can be controlled simply
by dilution of the Fmoc-TAG, and because the method is
synthetic, the possible sites of mutagenesis are set explicitly.
Our method is inspired by the work of Shortle and Soberon,
who have exploited the orthogonality of standard DMT-pro-
tected mononucleotide phosphoramidites and Fmoc-protected
mono-, di-, and trinucleotide phosphoramidites.18-22 They have
demonstrated that DMT removal from the 50-hydroxyl group by
trichloroacetic acid (TCA) is compatible with mild base (e.g.,
1,8-diazabicyclo[5.4.0]undec-7-ene, DBU) and moreover that
DBU does not deprotect any of the commonly used nucleobase
protection of the exocyclic amines. This orthogonal protection
enables the insertion of TAG after any number of DMT-
protected couplings, which allows one to make an in-frame
To demonstrate the utility of this method, we generated a
small library of in-frame TAG mutants of the gene for the four-
helix bundle protein Rop, which modulates the copy number of
ColE1 plasmids by binding to RNAs involved in plasmid
replication.23 Using an alanine suppressor tRNA and in vivo
screen for Rop function, our study broadly confirms the conclu-
sions of a previous in vitro site-directed alanine scanning study of
Rop, although subtle but important differences are seen from the
previous in vitro gel-shift results. One of the TAG mutants in the
library was at the codon for Phe14, which is known to be critical
for Rop function. Replacement of Phe14 with Bpa using un-
natural amino acid suppression resulted in a surprising amount of
activity for that variant. Moreover, when the purified protein was
irradiated, covalent dimers, trimers, and tetramers were isolated,
even though Rop is thought to be a dimer in solution. These
results suggest that weak tetramers of Rop (or at least the
Phe14Bpa mutant of Rop) are also present in solution and
highlight the utility of Bpa cross-linking for elucidating weak and
transient interactions.
’ EXPERIMENTAL SECTION
Synthesis of 50-O-(9-Fluorenylmethoxycarbonyl)thymi-
dine (1, Fmoc-T). This compound was synthesized by following the
method of Lehmann.24 Thymidine (50 mmol, 12.1 g) was dissolved in
100 mL of anhydrous pyridine. The solution was cooled to 0 °C on ice.
Fmoc-Cl (51 mmol, 13.2 g) was added to the solution as a powder under
magnetic stirring. The solvent was removed by rotary evaporation 30
min later. The mixture was dissolved in CH2Cl2 and purified by flash
column chromatography with a gradient of CH3OH (0-4%, v/v) in
CH2Cl2. Fmoc-T (11.19 g, 24.1 mmol) was obtained as a white powder.
Yield: 48%. (See the Supporting Information for full 1H, 13C, and 31
P
NMR data, as appropriate, and mass spectrometric characterization of
the compounds synthesized in this study.)
Synthesis of 50-[50-O-(9-Fluorenylmethoxycarbonyl)thy-
midin-30-yl o-chlorophenyl phosphate]-6N-benzoyldeoxy-
adenosine (3, Fmoc-TA). Previously dried 1,2,4-triazole (32 mmol,
2.2 g) was dissolved in 80 mL of dry THF, and freshly distilled
triethylamine (30.96 mmol, 4 mL) was added to the solution by syringe.
2-Chlorophenyl dichlorophosphate (15.48 mmol, 2.5 mL) was added to
the mixture dropwise through a syringe under stirring. Ten minutes
later, this solution was poured into a flask that contained previously dried
Fmoc-T (5.6 mmol, 2.6 g), and the mixture was heated to 40 °C with an
oil bath. The reaction was monitored by the disappearance of Fmoc-T
from TLC within 2 h (a less polar spot than Fmoc-T can sometimes be
observed). The solution was then cooled to room temperature and
poured into a flask that contained previously dried 6N-benzoyldeox-
yadenosine (7.9 mmol, 2.8 g), followed by addition of 1-methylimida-
zole (10 mmol, 0.8 mL) with a syringe. The reaction was completed 2 h
later. After removal of the solvent THF, the mixture was dissolved in
CH2Cl2 and washed with water. The organic phase was concentrated
and subjected to flash column chromatography with a gradient of
CH3OH (0-7%) in CH2Cl2 for elution. A white gum (3 g) was
obtained after removal of the solvent. Yield: 53.6%. (See the Supporting
Information for NMR and MS data.)
Synthesis of 50-[50-[50-O-(9-Fluorenylmethoxycarbonyl)
thymidin-30-yl o-chlorophenyl phosphate]-6N-benzoyl-
deoxyadenosin-30-yl o-chlorophenyl phosphate]-2N-iso-
butyryldeoxyguanosine (4, Fmoc-TAG). This compound was
6178
dx.doi.org/10.1021/ja106894g |J. Am. Chem. Soc. 2011, 133, 6177–6186

Journal of the American Chemical Society
ARTICLE
synthesized with the same procedure described for the Fmoc-TA. Fmoc-
TA (8.9 mmol, 8.8 g) and 2N-isobutyryldeoxyguanosine (18.1 mmol,
6.11 g) were used as starting materials. A gradient of CH3OH (0-9%) in
CH2Cl2 was used as elution for flash column chromatography. A white
gum (5.1 g) was obtained after removal of the solvent. Yield: 33.7%. (See
the Supporting Information for NMR and MS data.)
Cloning of the Rop Library to the pAClacAflIII Vector. The
synthetic DNA oligonucleotides were extended to a double-stranded
cassette with a partially complementary oligonucleotide: gtaaagctca
tcagcgtggt cgtgaagcga ttcacagata tctgcctgtt catccgcgtc cagctcgttg
agtttctcta aaagcgttaa tgtctgactt ctg. The product was amplified by PCR
with 50 primer 50-cacacaggaa acacgtatg-30 and 30 primer sequence 50-
ataatggcac ctcaatgatg atgatggtga tgtcctccga ggttttcacc gtcatctccg
aaacgcgcga ggcaagaacg gtaaagctca tcagcgtgg-30. After purification, these
PCR products were digested and ligated into the pAClacAflIII vector at
BanI and AflIII sites (pAClacAflIII is a derivative of pAClac25 with an
AflIII site introduced for improved library cloning). The ligation product
was transformed into DH10B E. coli and grown on LB agar containing
kanamycin. After incubation overnight at 37 °C, the colonies were then
spotted onto fresh LB kanamycin agar for colony sequencing (Genewiz
Inc., South Plainfield, NJ).
Constructing the pMRH6sup3 Vector. A polycistronic sup-
pression cassette was constructed by amplification of the alaW amber
suppressor tRNA sequence from pAC-Ala(AS)26 using three sets of
oligonucleotides shown in the Supporting Information. The three sets of
tRNA with a proK promoter and terminator sequence were amplified
sequentially, digested, and ligated at internal BsmAI and EarI sites, and
the final three-piece ligation product was gel purified, PCR amplified to
append PstI and BglII sites, and cloned into the pMRH6 vector at PstI
and BglII restriction sites (pMRH6 is a derivative of pMR10127 designed
for easy cloning of Rop variants with a TEV-cleavable N-terminal 6ꢀHis
fusion).
Cloning the Rop-TAG Variants into the pMRH6sup3 Vector
for lac or T7 Expression and Phenotypic Screening. Each of
the six Rop-TAG mutants identified by sequencing from pACT7lac were
PCR amplified with the lac promoter and terminator sequences and
cloned into the pMRH6sup3 vector at the BstEII and XbaI sites. For T7
expression of the six Rop-TAG mutants, each was PCR amplified to
append AflIII and BamHI sites and cloned into pMRH6sup3 at the AflIII
and BamHI sites. Due to the presence of an additional AflIII site in the
sup3 cassette of the pMRH6sup3 vector, the cloning required first PCR
amplifying and ligating the vector fragment between the two AflIII sites
to the Rop-TAG gene(s). This two-piece ligation product was then
cloned into pMRH6sup3 to produce the final constructs.
Activity Screening of the Rop-Ala Variants with GFP
Fluorescence. The pMRH6sup3 plasmid containing the Rop-TAG
gene and the pUCBADGFPuv plasmid25 were cotransformed into
DH10B cells previously lysogenized with the DE3 phage, which were
grown on LB agar with kanamycin and ampicillin. After incubation at
37 °C, a single clone from each variant was restreaked onto LB agar
containing 0.0005% arabinose, kanamycin, and ampicillin. Rop-AV28
and a null linker were also cloned into the pMRH6sup3 vector as positive
and negative controls, respectively. The plates were incubated at 42 °C
for about 16 h. The fluorescence of the colonies was viewed under
365 nm UV light.
Synthesis of 50-[50-[50-O-(9-Fluorenylmethoxycarbonyl)
thymidin-30-yl o-chlorophenyl phosphate]-6N-benzoyldeoxy-
adenosin-30-yl o-chlorophenyl phosphate]-2N-isobutyryl-
deoxyguanosin-30-yl O-Cyanoethyl N,N-Diisopropylphosphor-
amidite (5, Fmoc-TAG Phosphoramidite). The Fmoc-TAG (1
mmol, 1.5 g) was dried by coevaporation with anhydrous THF (5 mL)
three times and dissolved in 10 mL of this solvent. N,N-Diisopropylethyl-
amine (4.2 mmol, 0.73 mL) was added by syringe under argon protection
and magnetic stirring, followed by syringe addition of 2-cyanoethyl N,N-
diisopropylchlorophosphoramidite (3 mmol, 0.67 mL) dropwise. Half an
hour later, the solvent was removed by rotary evaporation, and the mixture
was then dissolved in CH2Cl2 which contained 8% (v/v) pyridine. The
compound was purified with flash column chromatography; 8% pyridine in
CH2Cl2 was used for elution. After removal of the solvent, the gum was
dissolved in CH2Cl2 and precipitated with n-hexane three times. A white
powder (0.7 g, 0.412 mmol) was obtained. Yield: 41.2%. (See the
Supporting Information for NMR and MS data.)
Synthesis of p-Benzoylphenylalanine (Bpa). We adapted this
from the method of DeGrado.13 We synthesized the Bpa without
purification of the intermediate product. Only the final product Bpa
was purified by washing the solid with acetone and cold water sequen-
tially. 4-Methylbenzophenone (9.65 g, 49 mmol), azobisisobutyronitrile
(AIBN; 410 mg, 2.5 mmol), and N-bromosuccinimide (NBS; 8.9 g, 50
mmol) were dissolved in 300 mL of CH3CN. The solution was heated to
reflux for about 2 h. The acetonitrile solvent was removed by rotary eva-
poration. The solid mixture containing the product 4-(bromomethyl)
benzophenone, was redissolved in 300 mL of ethyl acetate and washed with
saturated NaHCO3 solution and water sequentially. The roughly purified
product was then dissolved in 300 mL of acetone, and diethyl acetamido-
malonate (10.9 g, 50 mmol), K2CO3 (13.8 g, 100 mmol), and KI (0.83 g,
0.005 mmol) were added to the solution for the coupling reaction. The
solution was heated to reflux overnight. The solid was filtered away. The
acetone solution contained the coupling product. After the acetone was
removed, the solid product was dissolved in 50 mL of 8 M HCl. The
solution was heated to reflux for about 20 h for hydrolysis. The target
product Bpa was precipitated out by neutralizing the solution with 8 M
NaOH. Bpa precipitated when the solution was cooled. This was filtered
and washed with acetone and cold water. (See the Supporting Information
for NMR and MS data.)
DNA Synthesis and Purification. We synthesized the DNA
oligonucletides using an ABI Applied Biosystems 392 DNA/RNA
synthesizer with most reagents from Glen Research. The DNA sequence
50-GAGATATACATATGGCTAGCC-30 was synthesized from 30 to 50
with a 50 μmol C column (the first C was attached to the resin) using
standard methods. DMT-A, -G, -C, and -T at 0.05 M were placed on
ports 1-4, and Fmoc-TAG phosphoramidite at 0.05 M was on port 5.
DBU at 0.1 M was on port 10 for deprotecting the Fmoc group. DBU
was only directed into the column at the third cycle after Fmoc-TAG was
mixed into the column (Figure 3). For the Rop library synthesis, 0.026,
0.038, and 0.05 M concentrations of Fmoc-TAG phosphoramidite were
used in three different syntheses. The synthesized oligonucleotides were
combined together for PCR amplification.
After the DNA was synthesized with the last DMT group on, the resin
was resuspended in 1 mL of concentrated ammonium hydroxide in a
tube with a screw cap. The solution was heated to 55 °C for 12 h. The
ammonium hydroxide solution containing the DNA was then subject to
an oligonucleotide purification column (OPC) by following the proto-
col from Glen Research Co.
Cloning and Expression of F14Bpa. The F14Bpa gene with a
C-terminal 6ꢀHis tag was cloned into a pET15b vector using restriction
sites NcoI and BamHI. A pSup-BpaRS-6TRN29 vector harboring the stop
codon suppressor tRNA was cotransformed into BL21(DE3) cells for
expression of F14Bpa. Bpa was added to 2YT media to a final concentra-
tion of 2 mM. IPTG (0.1 mM) was used for the induction at OD600 ≈ 0.8.
The cells were harvested after incubation at 30 °C for 18 h. The protein
was purified by Ni-NTA agarose (Qiagen) using standard methods.
Gel Filtration Chromatography Analysis of the Rop
Variants. Four proteins were mixed as standards: albumin (65 kDa),
carbonic anhydrase (29 kDa), cytochrome c (12 kDa), and aprotinin
(6.5 kDa). The mobile-phase buffer was 40 mM phosphate buffer (pH
6.4) and 200 mM NaCl. All Rop variants and the standard mixtures were
chromatographed under the same conditions (0.4 mL min-1) with a
Superdex 75 10/300 GL column (GE Healthcare).
6179
dx.doi.org/10.1021/ja106894g |J. Am. Chem. Soc. 2011, 133, 6177–6186

Journal of the American Chemical Society
ARTICLE
Figure 1. Synthesis of Fmoc-TAG phosphoramidite: (i) Fmoc-Cl, pyridine, room temperature; (ii) triazole, 2-chlorophenyl dichlorophosphate,
triethylamine, THF, 40 °C; (iii) 6N-benzoyldeoxyadenosine, NMI, THF, room temperature; (iv) triazole, 2-chlorophenyl dichlorophosphate,
triethylamine, THF, 40 °C; (v) 2N-isobutyryldeoxyguanosine, NMI, THF, room temperature; (vi) 2-cyanoethyl N,N-diisopropylchlorophosphor-
amidite, N,N-diisopropylamine, THF, room temperature.
Incorporation of Unnatural Amino Acid Bpa into Rop and
Screening the Activity of Rop with GFPuv Fluorescence. To
coexpress F14Bpa-Rop with GFPuv, we recloned the F14Bpa-Rop gene
together with the T7 promoter into the pSup-BpaRS-6TRN vector at
the PstI restriction site. This pSup-RopF14Bpa plasmid and the pUC-
BADGFPuv vector were cotransformed into DH10B(DE3) cells. The
cells were grown on LB agar with ampicillin and chloramphenicol. Rop-
AV and a null linker were cotransformed into DH10B(DE3) cells with
pUCBADGFPuv vector as positive and negative controls, respectively.
The cells were grown on LB agar with ampicillin and kanamycin. After
incubation at 37 °C overnight, a single clone from each variant was
streaked onto LB agar containing ampicillin, 2 mM Bpa, 10 μM IPTG,
and 0.0005% arabinose. The plate was incubated at 42 °C for 16 h. The
fluorescence of the clones was visualized with 365 nm UV excitation.
couplingreaction and removing the DMT with TCA afterward has
been debated. Protecting the 30-OH on the nucleotide with DMT
avoids a 30-30 coupling reaction; however, the deprotecting
reagent, TCA, is deleterious to purine bases and introduces other
byproducts while decreasing the overall yield. We elected not to
protect the 30-OH group. The synthesis of Fmoc-TAG phosphor-
amidite is described in Figure 1. We found it was important to
produce an intermediate phosphorylation reagent, (2-chlorophen-
yl)phosphoroditriazolide, in situ by titrating 2-chlorophenyl
dichlorophosphate into triazole and triethylamine. The advantage
of (2-chlorophenyl)phosphoroditriazolide is that, after the first
triazolide is replaced by Fmoc-T, the reactivity of the second
triazolide is decreased, and N-methylimidazole (NMI) is needed
as a nucleophile catalyst for its substitution by 6N-benzoyldeoxy-
adenosine. Therefore, the chance of coupling two Fmoc-T
moieties decreases. The lower reactivity of the second triazolide
also favors nucleophilic attack from the primary 50-OH over the
secondary 30-OH on 6N-benzoyldeoxyadenosine. Therefore, the
main coupling product is 50-30 even without protecting the 30-
OH of 6N-benzoyldeoxyadenosine. The small amount of 30-30
coupling product can be easily removed by chromatography
because it migrates faster than the 30-50 coupling product on
the normal phase. We also found that increasing the reaction
temperature to 40 °C at 30-phosphorylation steps (ii and iv in
Figure 1) decreases the reaction time from 4-5 to about 1.5 h.
’ RESULTS
Synthesis of Fmoc-TAG Phosphoramidite. The synthesis of
the Fmoc-TAG phosphoramidite has not been described, but
other Fmoc-trinucleotide phosphoramidites (TNPs) and many
DMT-TNPs have been reported.5,19,22 Gaytan et al. have synthe-
sized 20 Fmoc-trinucleotide phosphoramidites which code for the
20 natural amino acids.22 The synthesis of Fmoc-trinucleotide
phosphoramidites has suffered from low yields and low purity. The
value of protecting the 30-OH on the nucleotide with DMT during
6180
dx.doi.org/10.1021/ja106894g |J. Am. Chem. Soc. 2011, 133, 6177–6186

Journal of the American Chemical Society
ARTICLE
Figure 2. Digestion with NheI of PCR products synthesized with Fmoc-
TAG phosphoramidite or commercially from standard methods.
Synthesis of a Single DNA Oligonucleotide with Fmoc-
TAG Phosphoramidite. To adapt the Fmoc-TAG phosphor-
amidite to standard automated DNA synthesis, we made some
small changes to the DNA synthesizer and its program. The
standard ABI 392 DNA/RNA synthesizer has eight ports for
nucleobase phosphoramidites. Therefore, it is easy for the Fmoc-
TAG phosphoramidite to use one port and leave the other seven
ports for DMT-mononucleotide phosphoramidites. The Fmoc
deprotecting reagent, 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU),
was used on port 10, which is usually used for concentrated
ammonium hydroxide to cleave the oligonucleotide from the
column after synthesis. A new function, “10 to column”, was
added to the DNA synthesis program when DBU was needed for
deprotecting the Fmoc group. We combined the final cleavage
and total deprotecting steps by suspending the resins into 55 °C
concentrated ammonium hydroxide for 12 h after the DNA
oligonucleotide was synthesized. Here, the DNA was synthesized
with the last DMT group on for later purification.
To validate the DNA synthesized with the Fmoc-TAG phos-
phoramidite, we synthesized a 21-mer DNA oligonucleotide, 50-
GAGATATACATATGGCTAGCC, containing an NheI restric-
tion site (underlined sequence). The TAG in this DNA sequence
(bold) was synthesized from the Fmoc-TAG phosphoramidite;
the rest of the sequence was assembled from standard DMT-
mononucleotide phosphoramidites. This DNA oligonucleotide
was used as a forward primer for a PCR reaction, and a forward
primer with the same sequence was purchased from Sigma
Genosys as a positive control. Both of these forward primers
were used separately to amplify a 119 bp fragment by PCR using
the same reverse primer. It is important to realize that every
molecule of PCR product contains the primer. As shown in
Figure 2, lanes 2 and 4, a 119 bp fragment was amplified
successfully by using both primers, indicating the synthesized
primer annealed to DNA and was extended by polymerase as well
as the standard primer. The PCR products were further digested
with the NheI restriction enzyme to confirm the TAG codon
existed in both DNA sequences. In lanes 3 and 5, it can be seen
that the DNA was digested completely and produced a 104 bp
fragment, demonstrating that the trinucleotide TAG was suc-
cessfully incorporated into the DNA sequence and was recog-
nized by the restriction enzyme.
Figure 3. Scheme of DNA library synthesis with Fmoc-TAG trimer and
DMT monomers.
followed by two cycles of standard DNA synthesis with only the
DMT protecting group being removed by TCA to complete the
synthesis of the wild-type codon. At the end of the third cycle, TCA
and DBU were introduced into the column sequentially to remove
both the DMT and Fmoc protecting groups. The resin then
contained a mixture of DNAs with the wild-type and TAG codons
in the same frame. The oligonucleotide could then be extended
with another TAG codon insertion at any target position by
repeating these three cycles. Notably, if the TAG were protected
with DMT, further rounds of extension after TCA deprotection
would yield genes in a mix of frames.
In principle, the ratio of products with TAG versus wild-type
codons at each position and therefore the number of TAG
codons in the whole gene can be controlled by adjusting the
ratio of Fmoc-TAG to DMT-MNP (mononucleotide phos-
phoramidite). For example, if one wishes to scan the TAG
through 10 positions, using 1/10 as much Fmoc-TAG would
result in a 1:10 ratio of TAG to wild-type codon and an average of
one TAG codon per clone. However, in reality, the Fmoc-TAG
and the DMT-MNPs do not react equally. We tested the
reactivity of Fmoc-TAG phosphoramidite against each DMT-
MNP. The same concentrations of Fmoc-TAG phosphoramidite
and DMT-MNP were mixed online and delivered to a column
with an adenosine attached to the resin. The Fmoc-TAG and the
DMT-MNP then competitively reacted with the adenosine and
generated a mixture of dimer (XA) and tetramer (TAGA)
products. The mixtures were analyzed by HPLC after being
cleaved from the column and deprotected by concentrated
ammonium hydroxide (Supporting Information Figures S18-
S21). The reactivity of Fmoc-TAG against the DMT-MNPs was
calculated by comparing the peak areas at 260 nm adjusted for
the extinction coefficient (see the Supporting Information).
From Figure 4, it can be seen that the reactivity of Fmoc-TAG
Synthesis of the Rop Library with Fmoc-TAG Phosphor-
amidite. The purpose of the Fmoc-TAG phosphoramidite is to
synthesize a DNA scanning library. The synthesis of a DNA library
with Fmoc-TAG phosphoramidite and DMT-mononucleotide
phosphoramidites is described in Figure 3. Three cycles were used
to synthesize each codon. In the first cycle, the Fmoc-TAG
phosphoramidite and the DMT-protected mononucleotide coding
for the wild-type amino acid were mixed online and delivered to the
column at the same time to introduce the TAG mutation. This was
6181
dx.doi.org/10.1021/ja106894g |J. Am. Chem. Soc. 2011, 133, 6177–6186

Journal of the American Chemical Society
ARTICLE
Figure 4. Reactivity of Fmoc-TAG phosphoramidite compared to
DMT-mononucleotide phosphoramidite. The reactivity of each
DMT-mononucleotide was normalized to 100% (dark gray bar) com-
pared to that of Fmoc-TAG (light gray bar).
is ∼20% of that of the DMT-mononucleotides, presumably due
to the steric bulk. Consequently, about 5-fold more Fmoc-TAG
is needed to achieve equal reactivity with the mononucleotides.
To validate the usage of Fmoc-TAG phosphoramidite in DNA
library synthesis, we synthesized an 80 nt DNA library corre-
sponding to the gene for Rop with TAG codon substitution at 10
different sites near the 50 end of the gene: T2, K3, Q4, K6, T7, L9,
N10, M11, R13, F14 (see Figure 5a). The oligonucleotide library
was extended and amplified by PCR and cloned into a vector for
screening. Of 30 sequenced clones, 27% had no TAG mutations,
60% had one TAG, 7% had two TAGs, and 7% had three TAGs.
This is most consistent with a binomial distribution with an
average 10% insertion rate for TAG at each site, which is the
optimum for single insertions with 10 sites. We found that using
fresh reagents and extending the DMT and Fmoc deprotection
times from 3 to 6 s per cycle helped reduce insertions and
deletions in the sequences. From this small selection of clones, six
unique single TAG mutants were found.
Figure 5. Alanine scanning the Rop binding site. (a) Ten residues were
targeted for mutagenesis (see the text), which are color-coded red for no
activity for the Ala mutant (see panel b), orange for weak activity, blue
for significant activity, and gray for not observed in the small library.
Rendered from PDB entry 1ROP using PyMOL. (b) The cellular
fluorescence in the positive pUCBADGFPuv Rop screening strain is
shown for each mutant. Ala (lac), for example, means an Ala codon
appears in the gene and it is expressed from the lac promoter. The
absolute amount of fluorescence depends on the suppression level and
promoter strength, but the relative levels are consistent for each set. At
the bottom, cells with wild-type Rop or a linker under each promoter are
shown. The pMRH6sup3 plasmid containing different Rop variant
genes and plasmid pUCBADGFPuv were cotransformed into DH10B-
(DE3) cells, and the cells were spotted on an LB agar plate supplemen-
ted with 0.0005% arabinose, kanamycin, and ampicillin and grown for 16
h at 42 °C. The fluorescence was visualized under 365 nm UV light. The
colonies shown were all grown on the same agar plate.
Alanine Scanning Rop. To validate the biological relevance of
the TAG-scanned Rop library, we constructed an alanine suppres-
sion plasmid that allows in vivo phenotypic alanine scanning of the
TAG mutants. The alanine suppression construct from Miller
et al.17,26 was assembled by PCR into a polycistron containing
three tRNAAla(CUA) genes in a manner similar to that of Schultz
et al.29 The final polycistronic cassette was then cloned into a
pMR101-based vector (pMRH6). To test the TAG suppression
efficiency of this pMRH6sup3 construct, the vector was trans-
formed into a CSH108 strain30 carrying a chromosomal argE(Am)
marker and episomal lacZ8(Am) marker that allows genetic
selection and blue/white screening for amber suppression. On
minimal media plates containing kanamycin and X-gal, blue
colonies appeared after two days of growth at 37 °C. However,
CSH108 without the pMRH6sup3 plasmid (i.e., negative control)
formed no colonies. The long incubation time is a result of slow
suppression-dependent growth of this strain on minimal media. On
LB plates containing kanamycin and X-gal, blue colonies appeared
after overnightgrowthat37°C while the negative control, CSH108
without the pMRH6sup3 plasmid, had only white colonies.
The six unique TAG mutations corresponding to residues 2, 3,
6, 10, 11, and 14, and wild-type Rop, were cloned into
pMRH6sup3 by PCR amplification of the genes along with a
flanking lac promoter and terminator from the pAClac clones.
These cassettes were then cloned into the XbaI/BstEII sites of
pMRH6sup3 to allow lac expression of the Rop gene on the same
p15A-based suppression plasmid. Magliery and Regan developed
a cell-based screen for Rop function based on the expression of
GFP from a ColE1 plasmid whose copy number is regulated by
Rop.25 Briefly, Rop significantly down-regulates that copy num-
ber of pUC-type ColE1 plasmids, particularly at 42 °C. Expres-
sion of GFP under the araBAD promoter along with the AraC
regulator from a pUC plasmid results in strong cellular fluores-
cence with Rop activity and nonfluorescent cells without Rop
activity at a particular concentration of arabinose. By transform-
ing Rop variants into DH10B(DE3) containing the ColE1
reporter plasmid pUCBADGFPuv, we could screen for the
in vivo activity of each alanine variant on the basis of GFP
fluorescence. The fluorescence phenotypes suggested K3A,
M11A, and F14A are inactive, while T2A, K6A, and N10A
exhibited varying levels of fluorescence above the background.
However, the levels of fluorescence of the three active variants
were significantly below that of the positive control, wt-Rop,
which we speculated might be due to suppression efficiency.
As a control, we mutated the six residues to alanine site
specifically (using an Ala codon) and expressed them under
6182
dx.doi.org/10.1021/ja106894g |J. Am. Chem. Soc. 2011, 133, 6177–6186

Journal of the American Chemical Society
ARTICLE
the lac promoter as a positive control. At the same time, we also
expressed the TAG variants under a much stronger T7 promoter.
These parallel screening contexts are shown in Figure 5b. The
same qualitative pattern of cellular fluorescence is evident in each
case, with the overall fluorescence being highest with the TAG-
T7 constructs followed by the Ala codon-lac constructs and
then the TAG-lac constructs. In all cases, the F14A mutant is
completely inactive, indicating that the Phe14 is essential for
binding as previously reported.23 The K3A and M11A mutants
show much lower levels of fluorescence in each context, indicat-
ing that although these residues play critical roles in binding,
mutating them to alanine does not completely ablate Rop
function. Interestingly, these in vivo phenotypes do not exactly
match previous Ala scanning gel-shift results.23 For example, N10
was identified as critical for binding, but here we see significant
in vivo activity from N10A. Differences between the gel-shift and
in vivo assays have been noted before.25 For example, several
variants in which large portions of the Rop core were replaced
with Ala and Leu residues showed wild-type-like binding to small
stem loops in vitro but no activity in vivo.
Incorporation of an Unnatural Amino Acid into Rop. One
advantage of stop-codon scanning is that the same DNA library
can be used to incorporate different natural or unnatural amino
acids by using different stop-codon suppressors. For proof of
principle, we incorporated a photoaffinity label unnatural amino
acid, Bpa, into Rop at the F14 position. The benzophenonyl
moiety can be excited to a diradical state by UV light, which can
readily insert into C-H bonds, resulting in a covalent linkage.
The Bpa used here was synthesized and used as a racemic mixture.
As the alanine scanning result indicated, F14 is very important
for RNA binding. We wanted to determine the in vivo activity of
F14Bpa-Rop using the same fluorescence screening as in alanine
scanning. A cysteine-free Rop mutant including the T7 promoter
was cloned into the Bpa suppression vector, pSup-BpaRS-6TRN,
for compatibility with the Rop screening plasmid. The expression
of F14Bpa-Rop from this construct was confirmed by small-scale
culture. An active cysteine-free Rop variant, Rop-AV,28 and a
linker gene were used as positive and negative controls. This
C38A C52V mutant of Rop was used as a background to remove
any confusion in cross-linking experiments caused by oxidative
dimerization.28 Little cellular fluorescence is observed for the
F14Bpa mutant (Figure 6a). It is also possible to examine the
copy number of the ColE1 plasmid directly by preparation of the
pUCBADGFPuv DNA. The pUCBADGFPuv plasmid level
from F14Bpa is less than that of the negative control but much
higher than that of the active Rop positive control (Figure 6b).
This result confirmed that F14 is very important for Rop
function, but it also suggests that low-level activity is possible
with F14Bpa mutation.
Figure 6. F14Bpa-Rop activity screening. (a) Fluorescence of clones
containing the negative control, positive control, and F14Bpa. The
plasmids were cotransformed into DH10B(DE3). The cells were grown
for 16 h at 42 °C on LB agar supplemented with 2 mM Bpa, 0.0005%
arabinose, 10 μM IPTG, and ampicillin. The fluorescence was visualized
under 365 nm UV light. (b) Plasmid miniprep from the same number of
cells of the negative control, positive control, and F14Bpa. The plasmid
was digested with NcoI.
1ROP crystallographic evidence for wild-type Rop.31-33 The
UV-irradiated F14Bpa-Rop produced a new peak corresponding
approximately to tetramers.
To rule out that the tetramerization of Rop is simply caused by
nonspecific covalent cross-linking, we performed the UV irradia-
tion both with an excess of BSA and in vivo by irradiating whole
cells before purifying the F14Bpa-Rop via its C-terminal 6ꢀHis
tag. In the presence of BSA, the formation of covalent dimers,
trimers, and tetramers was evident in quantities comparable to
those in the absence of BSA, and only a small amount of cross-
linked BSA is visible. Likewise, the formation of dimers, trimers,
and tetramers, but not higher oligomers, is evident from in vivo
cross-linking, where the total protein concentration is very high,
upward of 200 mg mL-1
.
These experiments do not necessarily imply that wild-type Rop
also weakly tetramerizes; it is possible that the F14Bpa mutation
causes or enhances tetramer formation. Although somewhat
beyond the scope of the present study, we also performed
formaldehyde cross-linking of wild-type Rop and F14Bpa-Rop
at concentrations comparable to UV irradiation conditions, with
and without BSA (see the Supporting Information). Under these
conditions, oligomers as high as hexamers are visible by SDS-
PAGE, and trimers and higher appear to be diminished somewhat
in the presence of BSA for wild-type Rop but not F14Bpa-Rop.
Significant cross-linking of BSA, even alone, is evident under these
conditions. These results suggest that the F14Bpa mutation may
be enhancing the formation of tetramers, but they do not
definitively rule in or out the formation of wild-type Rop tetra-
mers. Further studies based on this intriguing result are under way.
As shown in Figure 7b, the two F14 residues from the two
monomers lie near the dimer interface, so we speculated we
might be able to capture the dimer covalently upon irradiation.
Surprisingly, the F14Bpa protein formed covalent dimers, tri-
mers, and tetramers upon irradiation with 365 nm UV light
(Figure 7c). No significant amounts of higher oligomers were
observed even upon extended irradiation (Figure S26, Support-
ing Information). We also analyzed the wild-type Rop, F14Bpa,
and UV-irradiated F14Bpa-Rop with FPLC gel filtration chro-
matography (Figure 7d). The F14Bpa-Rop and wild-type Rop
elute at the same volume, indicating they are the same size,
approximately as expected for a dimer. This is consistent with gel
filtration, analytical ultracentrifugation (AUC), and X-ray of
’ DISCUSSION
There are a number of methods to make mutational libraries
to probe the structure and function of a protein, including error-
prone PCR, cassette mutagenesis, binomial mutagenesis, and
shotgun scanning with alanine or homologues. All of these
methods have found important uses, but all also have some
drawbacks that led us to develop this method. Purely random
libraries require high-throughput screening of a large number of
clones, and certain mutations (such as those that require two or
6183
dx.doi.org/10.1021/ja106894g |J. Am. Chem. Soc. 2011, 133, 6177–6186

Journal of the American Chemical Society
ARTICLE
Figure 7. F14Bpa cross-linking of Rop. (a) Structures of Phe and Bpa. (b) The Rop dimer (1ROP) with the RNA-binding face toward the reader. Phe14
from each monomer (left and right) is shown in spheres. (c) SDS-PAGE of F14Bpa-Rop and wild-type Rop with increasing irradiation: lane 1, marker;
lane 2, F14Bpa-Rop; lane 3, F14Bpa-Rop with 30 min of UV irradiation; lane 4, F14Bpa-Rop with 120 min of UV irradiation; lane 5, F14Bpa-Rop in the
presence of an excess of BSA with 120 min of UV irradiation; lane 6, F14Bpa-Rop in intact E. coli with 30 min of UV irradiation; lane 7, F14Bpa-Rop in
intact E. coli with 120 min of UV irradiation; lane 8, marker; lane 9, Cys-free Rop; lane 10, Cys-free Rop with 120 min of UV irradiation. (d) Gel filtration
chromatography of wild-type Rop and F14Bpa-Rop with different UV irradiation times (0, 30, and 120 min).
three nucleotide changes) are very rare. Shotgun scanning has
proven very useful, but most clones contain multiple mutations,
and non-Ala mutations are common, complicating the analysis.
Moreover, these libraries are static, meaning that if you wish to
substitute another amino acid at each position, a new DNA
library must be synthesized.
Shortle and Soberon have previously described the synthesis
of Fmoc-protected mononucleotide and trinucleotide phosphor-
amidites, and DMT-protected trinucleotide phosphoramidites
are now commercially available. We have made some improve-
ments to the Fmoc-trinucleotide phosphoramidite synthesis
here, and we have reported the synthesis of the Fmoc-TAG
phosphoramidite for the first time, but the most important
innovation over the previous synthetic approaches is that only
a single synthesized reagent is necessary for this method. When
multiple novel phosphoramidites are required, it both increases
the cost and amount of labor and limits the compatibility with
commercially available DNA synthesizers.
We have demonstrated the flexibility of these libraries in
principle by showing both the scanning of alanine using an
available Ala suppressor tRNA(CUA)17 and the incorporation of
Bpa into one library member using the BpaRS/tRNA(CUA) pair
engineered by Schultz and colleagues.29 With proper vector
design, a single library could be scanned with over 80 natural
and unnatural amino acids simply by cotransformation into
different suppressor strains. Many amino acids can be scanned
in E. coli or yeast, making a wide range of in vivo screens and
display methods compatible for library sorting.
In contrast, our method gives complete control over which
residues are mutated via the oligonucleotide synthesis, and the
orthogonal protection strategy means that each position will be
varied only between the wild-type codon and the stop codon and
that all products will be in frame. The Fmoc-TAG phosphor-
amidite produces DNA that is replicated by DNA polymerase
and quantitatively cleaved by a restriction endonuclease. A
standard DNA synthesizer is easily modified to use the Fmoc-
TAG phosphoramidite with a single reagent change that does not
perturb the normal pattern of DMT-mononucleotide synthesis.
By carefully determining the reactivity ratio of Fmoc-TAG
phosphoramidite to the DMT-protected mononucleotide phos-
phoramidites, the mutagenesis rate of each clone can be con-
trolled and set to approximately 1 (specifically, a binomial
distribution with a maximum of 1). In this work we have
assembled a small library from one oligonucleotide with scanned
TAG mutations and three other homogeneous oligonucleotides,
essentially using inside-out PCR. Inside-out PCR34 and gene
assembly akin to the reassembly step of DNA shuffling35 can be
used to efficiently synthesize genes at least up to 1 kb in a single
step, enabling TAG scanning of larger proteins or sections of
proteins in a single library using our methodology.
While we were developing this method, Cropp and
colleagues also presented a molecular biology approach to
TAG scanning using a transposon-based method and a
selection step to ensure in-frame mutations.36 We believe that
this method and our method have complementary uses. For
very large genes where little is known about which residues
6184
dx.doi.org/10.1021/ja106894g |J. Am. Chem. Soc. 2011, 133, 6177–6186

Journal of the American Chemical Society
ARTICLE
to target, the transposon-based approach is appropriate. When
one has sufficient knowledge to target a subset of sites for
scanning (such as all surface positions), our synthetic method
is advantageous, particularly for genes below 1 kb where gene
assembly is facile.
primer sequences, plasmid maps, and gel filtration analysis.
This material is available free of charge via the Internet at
http://pubs.acs.org.
’ AUTHOR INFORMATION
Alanine scanning through the putative Rop RNA-binding site
in combination with an in vivo screen for Rop function both
broadly confirmed in vitro gel-shift data on Rop activity and at
the same time revealed subtle differences. In particular, residue
Phe14 was confirmed to be key to function, but other residues in
a “stripe” along the helix bearing Phe14 have somewhat different
results compared to in vitro findings.23 This is likely due in part to
the use of small (19 nt) model RNAs for the authentic (108 and
555 nt) inhibiting and priming RNAs of the ColE1 origin. This
illustrates that the ease of combining our amber codon scanning
method with in vivo screens in bacteria and yeast is an advantage.
It is notable, however, that there is evidence of lower expression
levels of the Ala mutants from TAG suppression than from
decoding an Ala codon from the same promoter, as expected.
This can be controlled by adjusting the strength of the promoter,
as we demonstrated here. It is likely that there will be instances
where poor suppression efficiency will result in a false-negative
phenotype in any method using TAG suppression, and proper
controls need to be constructed to interpret suppression screen-
ing results.
Corresponding Author
magliery@chemistry.ohio-state.edu
’ ACKNOWLEDGMENT
This work was supported by NIH Grant R01 GM083114 (to
T.J.M.) and by The Ohio State University. J.J.L. was an Ohio
State NIH CBIP fellow and a fellow of the Great Lakes Chapter
of the American Heart Association. K.S. was an Ohio State
Chemistry NSF REU fellow. We are grateful to Peter G. Schultz
for providing the BpaRS/tRNA(CUA) plasmids. The pAC-Ala-
(AS) plasmid and CSH108 strain were provided by the E. coli
Genetic Stock Center, Yale University. We thank Brandon
Sullivan for helpful suggestions on the manuscript.
’ REFERENCES
(1) Chatellier, J.; Mazza, A.; Brousseau, R.; Vernet, T. Anal. Biochem.
1995, 229, 282.
(2) Gregoret, L. M.; Sauer, R. T. Proc. Natl. Acad. Sci. U.S.A. 1993,
90, 4246.
The Phe14Bpa mutation in Rop led to two surprises. The first
was that it was at least weakly active in vivo. Previous studies have
shown that F14Y is deficient in binding to a model of the
substrate RNAs but able to bind similar RNAs with shortened
or elongated loops, and F14W is completely deficient in RNA
binding in vitro.23 Even F14H is significantly reduced in RNA
binding.37 Recent structures of Rop and the F14Y and W mutants
suggest that the larger indole ring promotes alternative confor-
mations that might explain its total lack of RNA binding.38
Apparently, some binding is still possible with the large benzo-
phenonyl moiety. Even more striking, though, was that the
irradiation of F14Bpa-Rop led to covalent dimers, trimers, and
tetramers, even in the presence of competitor proteins in vitro
and in vivo. The most straightforward interpretation of these data
is that F14Bpa-Rop weakly associates into dimers of dimers. Such
tetramers have never been observed in solution studies of wild-
type Rop, although some Rop core mutants form higher
oligomers.32 In contrast, when Chin et al. made Bpa mutants
of the GST dimer proximal and distal to the interface, dimer-
sized adducts were observed for the proximal mutant and no
adducts were observed for the distal one.11 By gel filtration, we
see only Rop-like dimers in solution for F14Bpa-Rop, and a
second peak presumably corresponding to tetramers grows in
upon irradiation. This study did not produce definitive evidence
about whether wild-type Rop also weakly tetramerizes, although
formaldehyde cross-linking suggests that the F14Bpa mutation
may at least enhance the tetramerization. Further studies on wild-
type Rop and the possible physiological significance of tetramer
formation are therefore warranted. This discovery highlights the
utility of Bpa cross-linking in the discovery of weak and transient
interactions.
(3) Weiss, G. A.; Watanabe, C. K.; Zhong, A.; Goddard, A.; Sidhu,
S. S. Proc. Natl. Acad. Sci. U.S.A. 2000, 97, 8950.
(4) Clackson, T.; Wells, J. A. Science 1995, 267, 383.
(5) Virnekas, B.; Ge, L.; Pluckthun, A.; Schneider, K. C.; Wellnhofer,
G.; Moroney, S. E. Nucleic Acids Res. 1994, 22, 5600.
(6) Kayushin, A. L.; Korosteleva, M. D.; Miroshnikov, A. I.; Kosch,
W.; Zubov, D.; Piel, N. Nucleic Acids Res. 1996, 24, 3748.
(7) Ono, A.; Matsuda, A.; Zhao, J.; Santi, D. V. Nucleic Acids Res.
1995, 23, 4677.
(8) Pal, G.; Fong, S. Y.; Kossiakoff, A. A.; Sidhu, S. S. Protein Sci.
2005, 14, 2405.
(9) Liu, C. C.; Schultz, P. G. Annu. Rev. Biochem. 2010, 79, 413.
(10) Chin, J. W.; Schultz, P. G. ChemBioChem 2002, 3, 1135.
(11) Chin, J. W.; Martin, A. B.; King, D. S.; Wang, L.; Schultz, P. G.
Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 11020.
(12) Chin, J. W.; Cropp, T. A.; Anderson, J. C.; Mukherji, M.; Zhang,
Z.; Schultz, P. G. Science 2003, 301, 964.
(13) Kauer, J. C.; Erickson-Viitanen, S.; Wolfe, H. R., Jr.; DeGrado,
W. F. J. Biol. Chem. 1986, 261, 10695.
(14) Lee, H. S.; Dimla, R. D.; Schultz, P. G. Bioorg. Med. Chem. Lett.
2009, 19, 5222.
(15) Majmudar, C. Y.; Lee, L. W.; Lancia, J. K.; Nwokoye, A.; Wang,
Q.; Wands, A. M.; Wang, L.; Mapp, A. K. J. Am. Chem. Soc. 2009,
131, 14240.
(16) Magliery, T. J. Med. Chem. Rev. 2005, 2, 21.
(17) Miller, J. H. Methods Enzymol. 1991, 208, 543.
(18) Sondek, J.; Shortle, D. Proc. Natl. Acad. Sci. U.S.A. 1992,
89, 3581.
(19) Gaytan, P.; Yanez, J.; Sanchez, F.; Mackie, H.; Soberon, X.
Chem. Biol. 1998, 5, 519.
(20) Gaytan, P.; Yanez, J.; Sanchez, F.; Soberon, X. Nucleic Acids Res.
2001, 29, E9.
(21) Gaytan, P.; Osuna, J.; Soberon, X. Nucleic Acids Res. 2002,
30, e84.
(22) Yanez, J.; Arguello, M.; Osuna, J.; Soberon, X.; Gaytan, P.
Nucleic Acids Res. 2004, 32, e158.
’ ASSOCIATED CONTENT
(23) Predki, P. F.; Nayak, L. M.; Gottlieb, M. B.; Regan, L. Cell 1995,
80, 41.
(24) Lehmann, C.; Xu, Y. Z.; Christodoulou, C.; Tan, Z. K.; Gait,
M. J. Nucleic Acids Res. 1989, 17, 2379.
S
Supporting Information. Additional procedural details,
b
spectroscopic characterization of synthetic products and inter-
mediates, analysis of Fmoc-TAG reactivity, oligonucleotide
6185
dx.doi.org/10.1021/ja106894g |J. Am. Chem. Soc. 2011, 133, 6177–6186

Journal of the American Chemical Society
ARTICLE
(25) Magliery, T. J.; Regan, L. Protein Eng., Des. Sel. 2004, 17, 77.
(26) Dorus, S.; Mimura, H.; Epstein, W. J. Biol. Chem. 2001,
276, 9590.
(27) Munson, M.; Predki, P. F.; Regan, L. Gene 1994, 144, 59.
(28) Hari, S. B.; Byeon, C.; Lavinder, J. J.; Magliery, T. J. Protein Sci.
2010, 19, 670.
(29) Ryu, Y.; Schultz, P. G. Nat. Methods 2006, 3, 263.
(30) Miller, J. H. Short Course in Bacterical Genetics; Cold Spring
Harbor Laboratory Press: Plainview, NY, 1992.
(31) Banner, D. W.; Kokkinidis, M.; Tsernoglou, D. J. Mol. Biol.
1987, 196, 657.
(32) Munson, M.; Balasubramanian, S.; Fleming, K. G.; Nagi, A. D.;
O’Brien, R.; Sturtevant, J. M.; Regan, L. Protein Sci. 1996, 5, 1584.
(33) Kresse, H. P.; Czubayko, M.; Nyakatura, G.; Vriend, G.; Sander,
C.; Bloecker, H. Protein Eng. 2001, 14, 897.
(34) Gao, X.; Yo, P.; Keith, A.; Ragan, T. J.; Harris, T. K. Nucleic
Acids Res. 2003, 31, e143.
(35) Stemmer, W. P. Nature 1994, 370, 389.
(36) Daggett, K. A.; Layer, M.; Cropp, T. A. ACS Chem. Biol. 2009,
4, 109.
(37) Christ, D.; Winter, G. Proc. Natl. Acad. Sci. U.S.A. 2003,
100, 13202.
(38) Struble, E. B.; Ladner, J. E.; Brabazon, D. M.; Marino, J. P.
Proteins 2008, 72, 761.
6186
dx.doi.org/10.1021/ja106894g |J. Am. Chem. Soc. 2011, 133, 6177–6186