Development of Dimethylisoxazole-Attached Imidazo[1,2- a]pyridines as Potent and Selective CBP/P300 Inhibitors

Article abstract of DOI:10.1021/acs.jmedchem.0c02232

The use of epigenetic bromodomain inhibitors as anticancer therapeutics has transitioned from targeting bromodomain extraterminal domain (BET) proteins into targeting non-BET bromodomains. The two most relevant non-BET bromodomain oncology targets are cyc

Full text of DOI:10.1021/acs.jmedchem.0c02232

pubs.acs.org/jmc
Article
Development of Dimethylisoxazole-Attached
Imidazo[1,2‑a]pyridines as Potent and Selective CBP/P300 Inhibitors
Alex Muthengi,○ Virangika K. Wimalasena,○ Hailemichael O. Yosief,○ Melissa J. Bikowitz,○
Logan H. Sigua, Tingjian Wang, Deyao Li, Zied Gaieb, Gagan Dhawan, Shuai Liu, Jon Erickson,
Rommie E. Amaro, Ernst Schönbrunn,* Jun Qi,* and Wei Zhang*
Cite This: J. Med. Chem. 2021, 64, 5787−5801
Read Online
sı
*
Metrics & More
Article Recommendations
Supporting Information
ACCESS
ABSTRACT: The use of epigenetic bromodomain inhibitors as
anticancer therapeutics has transitioned from targeting bromodo-
main extraterminal domain (BET) proteins into targeting non-BET
bromodomains. The two most relevant non-BET bromodomain
oncology targets are cyclic AMP response element-binding protein
(CBP) and E1A binding protein P300 (EP300). To explore the
growing CBP/EP300 interest, we developed a highly efficient two-
step synthetic route for dimethylisoxazole-attached imidazo[1,2-
a]pyridine scaffold-containing inhibitors. Our efficient two-step
reactions enabled high-throughput synthesis of compounds
designed by molecular modeling, which together with structure−
activity relationship (SAR) studies facilitated an overarching
understanding of selective targeting of CBP/EP300 over non-
BET bromodomains. This led to the identification of a new potent and selective CBP/EP300 bromodomain inhibitor, UMB298
(compound 23, CBP IC50 72 nM and bromodomain 4, BRD4 IC50 5193 nM). The SAR we established is in good agreement with
literature-reported CBP inhibitors, such as CBP30, and demonstrates the advantage of utilizing our two-step approach for inhibitor
development of other bromodomains.
(KAT), which acetylates and recruits histone and nonhistone
proteins.
INTRODUCTION
■
Bromodomains (BRDs) are epigenetic reader domains that
selectively recognize acetyl-lysine residues found in histone and
nonhistone proteins and function in transcriptional regula-
tion.1−3 Failure to regulate these protein reader modules can
result in a broad range of diseases such as cancer and
inflammatory and cardiovascular diseases. As a result, they are
pursued as attractive targets for developing therapeutic agents
for the treatment of different disease conditions.4,5 Although
much progress has been made in the development bromodo-
main extraterminal domain (BET) bromodomain small-
molecule inhibitors, some of which are undergoing human
clinical trials for various diseases,1,2 selective and potent non-
BET bromodomain inhibitors and their use in biological studies
are still limited. Out of the 57 non-BET bromodomains, the
cyclic AMP response element binding protein (CBP)
bromodomain, which was once considered to have “medium
druggability”, has generated recent interest in oncology
applications, and three new double-digit nanomolar inhibitors
have been developed.6−8 Additionally, CBP has a paralogue that
conducts similar activity, called the E1A binding protein (EP300
or P300), both of which are multidomain proteins containing
BRD and other domains, such as lysine acetyl transferase
Overview of the Role of CBP/EP300 in Diseases. The
BRD of CBP/EP300 selectively recognizes acetylated lysine
residues, in contrast to the KAT domain, which acetylates lysine
residues on both histone tails and signature tumor transcription
factors, such as p53 and c-MYC.9−12 There are eight acetylation
sites on p53, of which K382 is necessary for coactivator (CBP
and TRRAP) recruitment, which importantly results in a p53
stabilizing conformation change and therefore active p53 and
activation of proapoptotic genes.13,14 The CBP/P300 bromo-
domains have been linked to disorders like acute myeloid
leukemia (AML) and inflammatory and neurodegenerative
diseases.15,16 Recently, Olzscha and co-workers also demon-
strated that CBP/P300 bromodomains are required for protein
aggregation, which disturbs proteostasis by impairing the
ubiquitin proteasome system (UPS) and protein translation,
Received: December 23, 2020
Published: April 19, 2021
https://doi.org/10.1021/acs.jmedchem.0c02232
© 2021 American Chemical Society
J. Med. Chem. 2021, 64, 5787−5801
5787

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
Figure 1. Reported potent CBP inhibitors.
Scheme 1. Two-Step Synthesis of Imidazo[1,2-a]pyridine-Based CBP/P300 Inhibitors; Reaction Conditions: (a) Sc(OTf)3,
CH2Cl2/MeOH (3:1), μw, 100 °C, 40 min 90−95%; (b) 3,5-Dimethylisoxazole-4-boronic Acid Pinacol Ester, PdCl2 (dppf)·
CH2Cl2, K2CO3 DME/H2O (2:1), μw, 120 °C, 40 min, 89−93%
leading to decreased cell viability.17 Overall, CBP/EP300 are
considered the most promising non-BET bromodomain targets
for cancer and other pathological conditions.8 Therefore, this
study was aimed at developing a novel strategy to discover
potent and selective CBP inhibitors for use as chemical probes to
provide further insights into CBP/EP300-disease pathogenesis.
Inhibitors Targeting the Bromodomain of CBP/EP300.
According to the structural genomics consortium (SGC)
requirement, a chemical probe should possess inhibitory activity
at less than 100 nM concentration (IC50 < 100 nM), with
selectivity greater than 30-fold toward other proteins (>30-fold)
and cellular activity at ∼1 μM concentration.18,19 To better
understand and investigate the biological function of CBP
bromodomains, a number of CBP inhibitors have been reported
with submicromolar to nanomolar inhibitory activity against the
bromodomain of CBP or P300, including CBP30,10 R-2,20 PF-
CBP1,9,21 TPO146,22 CPI-637,23 GNE-272,24 and GNE-78125
(Figure 1). Most of these compounds are prepared through
multistep synthesis with low overall yields, which hampers
further optimization of the compounds to improve their
biological activity.10 We have recently reported a two-step
synthesis of dimethylisoxazole-attached imidazo[1,2-a]pyridine
BET inhibitors.26 Overall, we envisioned that we could employ
the optimized two-step synthetic route toward developing new
CBP/EP300 inhibitors in conjunction with structure−activity
relationship (SAR) studies to generate lead compounds.
Additionally, the methods can be further extended to the
development of inhibitors targeting other bromodomains.
RESULTS AND DISCUSSION
■
Analysis of the chemical structures of reported CBP inhibitors
revealed that potent inhibitors contain two important
components. The first is an acetyl-lysine mimic motif (blue
unit in the structures shown in Figure 1) such as 3,5-
dimethylisoxazole, and the second is an appendix portion
outside the binding pocket, such as 3-chloro-4-methoxyphe-
nethyl and ethylmorpholinyl motifs, which can engage in
additional interactions with the protein outside the binding
pocket. This analysis inspired us to use our modified
multicomponent reaction (MCR) to assemble a substituted
imidazo[1,2-a]pyridine scaffold followed by the introduction of
a binding motif through the Suzuki coupling (Scheme 1).26
By utilizing our highly efficient synthesis involving three-
component Groebke−Blackburn−Bienayme (GBB)27−29 reac-
tions followed by the Suzuki coupling reaction,26,30 we
generated a set of molecules with different binding motifs
linked to the imidazo[1,2-a]pyridine scaffold in two steps. These
compounds were assessed for their binding activity against the
5788
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
c
Table 1. Structure−Activity Relationship (SAR) on the Imidazo[1,2-a]pyridine Scaffold
a
IC50 (μM)
BRD4
>50
b
compound
R1
adamantyl
adamantyl
cyclohexyl
t-butyl acetyl
2,2,4-trimethylpentyl
R2
R3
CBP
selectivity
1
2
3
4
Me
Me
H
H
H
Me
16.09 0.76
2.21 0.43
14.19 0.81
1.17 0.05
16.33 0.53
0.028 0.04
>3
>23
>4
3
>3
3,5-dimethylisoxazolyl
3,5-dimethylisoxazolyl
3,5-dimethylisoxazolyl
Me
>50
>50
2.95 0.04
>50
7.94 0.22
5
CBP30
>100
a
All IC50 values are reported as means of values from at least four determinations. AlphaScreen assay with the isolated CBP (using biotinylated
H3K56ac peptide)34 or BRD4 bromodomain (with biotinylated JQ1).31 Selectivity is defined by [BRD4(1) IC50 (μM)/CBP IC50 (μM)]. Bold
b
c
indicates the most active compound.
Scheme 2. Synthesis of Biotinylated-CBP/P300 Bromodomain Binder for AlphaScreening Assay Development
CBP bromodomain utilizing an AlphaScreen assay using
biotinylated peptide and recombinant CBP bromodomain as
assay partners (Table 1) and against bromodomain 4 (BRD4) in
our previously developed BRD4 AlphaScreen assay.31 Overall,
AlphaScreen showed that the compounds exhibited selective
micromolar inhibitory activity against the CBP bromodomain,
over BRD4. Significantly improved potency and selectivity were
seen when the known strong acetylated-lysine mimetic (3,5-
dimethylisoxazole) substituent group32,33 was introduced at the
R2 position (Table 1). Previous studies showed that 3,5-
dimethylisoxazole acts as an acetyl lysine mimic, where the
isoxazole oxygen forms a hydrogen-bonding interaction with the
Asn1168 amide moiety, while the isoxazole nitrogen points
toward one of the water molecules that bridges with
Tyr1125.10,26 Interestingly, compound 4 exhibited modest
inhibitory activity against CBP and BRD4 with IC50 values of
1.17 and 2.96 μM, respectively. These promising data indicated
that our strategy could facilitate SAR studies to fine-tune the
potency and selectivity in a high-throughput manner.
Encouraged by these results, we decided to fully explore the
CBP inhibitor design and development using the imidazo[1,2-
a]pyridine scaffold as the core (Table 1).
While the peptide-based AlphaScreen assay can assess
compound activity, the performance of this assay is not robust
due to the limited stability of the peptide used. We therefore
developed a novel small-molecule-based AlphaScreen assay for
CBP and EP300 bromodomain using biotinylated probe C
(Scheme 2) with recombinant proteins (Figure 2). Since the
bromodomains of EP300 and CBP have greater than 95%
homology, we utilized the CBP bromodomain to represent both
CBP and EP300 bromodomains. This probe compound was
derivatized from compound 2 shown in Table 1 guided by the
cocrystal structure of CBP30 with CBP (PDB ID: 4NR7)
reported in the literature. In this assay, biotinylated compound C
was utilized as a novel probe to evaluate the competitive
displacement by our series of CBP bromodomain inhibitors.
Purified His-tagged CBP or EP300 bromodomains bound to
nickel beads and biotinylated compound C bound to
Streptavidin beads were brought into close proximity to one
another upon probe binding to the protein. Upon excitation, the
beads created an emission due to their proximity, which was
disrupted by competitive binding by our bromodomain
inhibitors, displacing the probe, allowing for a dose−response
binding curve to be extrapolated. To optimize the assay
5789
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
Figure 3. Docked poses of compounds 3 (cyan) and 4 (orange) in CBP
(PDBs: 4NR7).
the appending group and increase the binding interactions with
R1173 on the CBP bromodomain outside the binding pocket
(Table 2). We synthesized compounds by introducing a two-
carbon linker between the core structure and the 4-
methoxyphenyl group. The extension of the phenyl group in
compounds 7 and 8 led to improved potency and selectivity
compared to compound 4, suggesting that the flexibility we
introduced allows the R3 position to contribute additional
interactions with the target site. Usually, the two-carbon linker’s
flexibility allows the R3 position to contribute additional
interactions with the active site. Compound 6 is an exception
that may be due to a different binding mode/preferred
orientation of compound 6 in the drug−receptor complex.
The lifetime of the drug−receptor complex is a dynamic process.
This can also be explained by the duration of time that the drug−
receptor complex persists, i.e., residence timemaybe it readily
dissociates from their target receptor. We continued to explore
whether this improved potency and selectivity could apply to
other acetyl lysine mimics. By taking advantage of our two-step
synthesis, other warheads like 3-methyl-3,4-dihydroquinazolin-
2(1H)-one (compound 9), 3-methyl-2H-indazole (compound
10), and 3-methyl-3a,7a-dihydrobenzo[d]isoxazole (compound
11) were introduced to the core via Suzuki coupling. These
warheads, however, showed a greater than 10-fold loss in
inhibitory activity against CBP (Table 2). This is due to the
difference in the moieties’ size, and the induced fit is different.
The distance between the key/critical hydrogen-bond acceptors
of the acetylated lysine mimic and the imidazopyridine core
increases, leading to a decrease in the hydrogen-bonding affinity.
Compounds 10 and 11 displayed greater than 15-fold increase
in the inhibitory activity against BRD4 (Table 2). This result
reinforced our interest in using 3,5-dimethylisoxazole as the
warhead for CBP bromodomain inhibitor development. We
next explored the R1 position by introducing different polar and
hydrophobic groups. Use of the cyclohexyl group at R1 while
maintaining a methoxy group at R3 led to a potent and selective
inhibitor, compound 16, with CBP and BRD4 inhibitory
potencies of 0.159 and 6.59 μM, respectively (Table 2). When
t-butyl (compounds 13 and 18) and adamantyl (compound 14)
groups were introduced at the R1 position, the CBP inhibitory
activity decreased by >5-fold, while the use of 4-ethyl-
morpholinyl (compound 15) and isopropyl (compound 17)
led to roughly a 2- and 3-fold decrease in potency, respectively
(Table 2). Unfortunately, use of benzyl groups for R1,
Figure 2. Development of small-molecule-based CBP/P300 AlphaS-
creening assays.
condition, we systematically titrated both ligand (C) and protein
(His-CBP) against each other at varying concentrations in the
presence of 20 ng/mL Streptavidin donor beads and 20 ng/mL
nickel acceptor beads. As these are standard α bead
concentrations, this two-dimensional (2D) titration is per-
formed to yield an optimal AlphaScreen signal. Because we are
forming a ternary complex in this AlphaScreen reaction, there is
an optimal “hook point” concentration that correlates with the
optimal signal.31 We titrated both the compounds ranging from
10 μM to 5 nM and found that Compound C was able to
generate this characteristic hook point at 10 nM ligand
concentration and 50 nM His-tagged CBP protein concen-
tration. We further confirmed that the signal intensity of the
small-molecule-probe-based assay is similar to that of the
peptide-based assay. The small-molecule-probed-based assay
performs more consistently compared to the peptide-based
assay and is used for IC50 assessment for establishing SAR.
To have a better understanding of the observed potency and
selectivity, we utilized molecular modeling to explore the
binding modes of our imidazo[1,2-a]pyridine inhibitor
compound 4 (UMB278) with CBP using the cocrystal structure
of CBP30 with the CBP bromodomain (Figure 3). The isoxazole
of compound 4 showed critical hydrogen bonding with N1168,
mimicking the acetylated lysine interaction observed between
CBP and its substrate. We observed extra hydrogen bonds
around imidazo[1,2-a]pyridine with surrounding crystallo-
graphic water molecules that might also contribute favorably
to binding activity. Thus, we decided to maintain 3,5-
dimethylisoxazole as a warhead and imidazo[1,2-a]pyridine as
a scaffold because they are responsible for the improved
inhibitory activity of our inhibitors. We noticed that the solvent-
accessible methoxyphenyl group might contribute to the low
affinity of the molecules since the planarity of the bond between
the benzimidazole and benzene groups might prohibit the
molecules from forming cation−π interactions with R1173.
Thus, we explored the effect of modifying the two appendix
groups R1 and R3 (Table 2).
Based on our hypothesis, we introduced a rotatable bond
between methoxyphenyl and imidazo[1,2-a]pyridine to extend
5790
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
c d
,
Table 2. Structure−Activity Relationship on Compound 7 Analogues
a
IC50 (μM)
b
compound
R1
R2
R3
CBP
7.828
0.718 0.042
0.507 0.045
8.12 0.96
8.02 0.06
>50
1.88 0.03
0.95 0.02
0.923 0.012
0.46 0.09
0.159 0.021
0.29 0.01
BRD4
>50
7.43 1.18
3.38 0.63
7.55 0.56
0.51 0.01
3.02 0.51
2.77 0.08
5.63 0.31
7.11 0.31
3.42 0.01
6.59 0.05
10.09 0.21
>50
6.48 0.41
17.92 1.21
8.46 0.55
7.94 0.45
10.1 0.55
selectivity
6
t-butyl acetyl
cyclohexyl
adamantyl
cyclohexyl
cyclohexyl
cyclohexyl
2,2,4-trimethylpentyl
t-butyl
adamantyl
4-ethylmorpholinyl
cyclohexyl
isopropyl
a
a
a
c
b
d
a
a
a
a
a
a
a
a
a
a
a
H
H
H
H
H
H
H
H
OMe
OMe
OMe
OMe
OMe
OEt
OPr
OMe
OMe
>6
10
7
1
0.06
7 (UMB276)
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
CBP30
0.06
1
6
8
7
41
34
>21
30
28
4
t-butyl
2.33 0.60
cyclohexyl
cyclohexyl
benzyl
0.214 0.009
0.633 0.006
1.92 0.12
1.60 0.21
0.077 0.011
4-chlorobenzyl
5
>100
a
All IC50 values are reported as means of values from at least two determinations. AlphaScreen assay with the isolated CBP (with compound C) or
b
BRD4 (with biotinylated JQ1) bromodomain. Selectivity is defined by [BRD4(1) IC50 (μM)/CBP IC50 (μM)] for the consistency mentioned.
c
d
The IC50 of compound 4 with CBP is measured using the biotinylated-peptide-based AlphaScreen assay as in Table 1. Bold indicates the most
active compound.
compounds 21 and 22, led to a 10-fold decrease in the CBP
inhibitory potency (Table 2). At the same time, we observed
that compound 16 exhibited a 5-fold increase in the CBP
inhibitory potency compared to compound 7, which lacks an
electron-donating group, p-methoxy, on the aryl ring.
Subsequently, we assessed the impact of different alkyl groups
at the R3 position (Table 2). The ethoxy group (compound 19)
showed a subtle decrease in potency against the CBP
bromodomain compared to compound 16, while the
introduction of the propyloxyl group (compound 20) caused a
∼4-fold decrease in potency (Table 2). Therefore, the p-
methoxy group on the aryl ring was retained as it proved to be
important for the increased CBP inhibitory activity without
compromising selectivity (41-fold) against BRD4.
Molecular docking confirmed that the presence of an
electron-donating group, p-methoxy, on the aryl ring further
reinforces the cation−π interactions of the CBP inhibitor with
the Arg1173 of the CBP bromodomain (Figure 4). Additionally,
the hydrophobic methyl in the methoxy group of compound 16
stabilizes solvent-accessible hydrophobic residues on the protein
side (PRO1106, Val1174, and Phe1177). Compound 16
exhibited improved binding affinity to CBP compared to
compounds 3, 4, and 7 (Figures 3 and 4).
Figure 4. Docked poses of compounds 7 (UMB276, green) and 16
(UMB295, yellow) in CBP. PDBs (4NR7 for CBP).
introducing substituent group(s) on the phenyl ring of the p-
methoxyphenyl group as well as by changing the distance
between the phenyl ring and imidazo[1,2-a]pyridine (Table 3).
First, we hypothesized that the introduction of a halogen group
could further improve the potency against CBP by promoting
electrostatic interactions with the target and also increase
lipophilicity of the compound, consistent with previous
Our highly efficient two-step synthesis allowed us to quickly
explore the SAR around the core of compound 16 by
5791
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
c
Table 3. Structure−Activity Relationship on Compound 19 Analogues
a
IC50 (μM)
b
compound
R1
cyclohexyl
cyclohexyl
cyclohexyl
n
Y
X
CBP
BRD4
selectivity
16 (UMB295)
23 (UMB298)
2
2
1
3
2
2
2
2
3
2
2
2
3
OMe
OMe
OMe
OMe
OMe
OEt
OiPr
OEt
OMe
OEt
H
Cl
H
H
H
H
H
Cl
Cl
0.16 0.02
6.59 0.05
5.19 0.02
11.22 1.01
12.33 1.11
>50
>50
>50
>50
24.53 2.33
>50
41
72
2
0.072 0.002
6.07 0.04
4.95 0.41
20.89 2.08
38.49 7.12
>50
2.53 0.09
8.96 0.91
20.46 2.24
0.75 0.06
3.51 0.08
>50
24
25
26
27
28
29
30
31
32
33
34
cyclohexyl
3
2,2,4-trimethylpentyl
2,2,4-trimethylpentyl
2,2,4-trimethylpentyl
cyclohexyl
cyclohexyl
2,2,4-trimethylpentyl
cyclohexyl
>2
>1
1
20
3
>2
8
6
Cl
OMe
OMe
OMe
OMe
OMe
H
6.21 0.46
22.64 0.28
>50
isopropyl
2,2,4-trimethylpentyl
1
a
All IC50 values are reported as means of values from at least two determinations. AlphaScreen assay with the isolated CBP (with compound C) or
b
BRD4 (with biotinylated JQ1) bromodomain. Selectivity is defined by [BRD4(1) IC50 (μM)/CBP IC50 (μM)] for the consistency mentioned.
c
Bold indicates the most active compound.
Figure 5. Docking pose of compound 23. (A) Docked poses of compound 23 (UMB298) (magenta) in CBP. (B) Docked poses of compounds 7
(UMB276) (green), 16 (UMB295) (yellow), and 23 (UMB298) (magenta) in BRD4. Water molecules are denoted W, and residues are denoted by
their three-letter amino acid code and their residue number in their respective PDBs (4NR7 for CBP and 5BT4 for BRD4). Hydrogen bonds between
the molecule and surrounding residues and water are shown with red lines.
reports.10 Indeed, introduction of an m-chloro group at the aryl
ring resulted in a more potent and selective CBP inhibitor,
compound 23, CBP IC50 72 nM and BRD4 IC50 5193 nM,
which was 2-fold more potent than compound 16. Additionally,
compound 23 displayed 72-fold selectivity for CBP over BRD4
as a selective CBP inhibitor (Table 3). Notably, we discovered
that the distance between the phenyl ring and the imidazo[1,2-
a]pyridine is also important, as evidenced by the large impact on
potency seen with different linker lengths. Reducing the length
of the linker to methylene (compound 24 compared to
compound 16) or increasing the length (compounds 25 and
30 compared to compound 23) led to a loss of CBP inhibitory
activity while maintaining BRD4 activity (less than 2-fold).
Therefore, we identified the optimal linker for this scaffold and
the importance of introducing the chloro-methoxyphenyl group.
In this compound series, cyclohexyl was the optimal group for
R1, while other groups led to a loss of activity (compounds 26−
28 and 34 (Table 3)). Since an electron-donating moiety was
well-tolerated on the aryl group connecting the linker
(compound 23), we decided to introduce two hydrogen-bond
acceptors, m- and p-methoxy groups. Surprisingly, the CBP
inhibitory potency was lost by ∼10-fold, with insignificant
change in the BRD4 activity (compound 32) (Table 3),
indicating that the m-chloro group was important for improved
activity of compound 23. Similarly, use of isopropyl for R1,
compound 33, led to 49- and 4-fold loss in CBP and BRD4
inhibitory activities, respectively (Table 3).
5792
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
Figure 6. Comparison of the cocrystal structure of compound 23 with CBP30. (A) Crystal structures of CBP30 bound to CBP (left, PDB ID: 4NR7)
and (B) BRD4 (right, PDB ID: 5BT4). Water molecules are denoted W, and residues are denoted by their three-letter amino acid code. Hydrogen
bonds among the molecule, surrounding residues, and water are shown with red lines. (C) Compound 23 (UMB298) (yellow) bound to the KAc site
of CBP (gray) (PDB ID: 7KPY). H-bonds with Asn1168 (magenta) and water molecules (cyan) are indicated as black dotted lines. The inset shows
the 2Fo-Fc electron density of the inhibitor. (D) Schematic presentation of H-bonding (black dotted lines) and hydrophobic van der Waals
interactions (green wiggle lines) of UMB298 with KAc site residues. Arg1173 appears to establish cation−π interactions with the
chloromethoxybenzene ring.
Figure 7. Potency and selectivity profiling. (A). Tabulated temperature shift values of compounds 7, 16, 23, and CBP30 with CBP (bromodomain),
EP300 (bromodomain), and BRD4(BD1). (B). BROMOSCAN data on compounds 7, 16, and 23 against 34 bromodomains. (C). Kd value of
compounds 16, 23, and biotinylated probe compound C toward CBP, EP300, and BRD4 (BD1) determined by BromoELECT. All Kd values are
measured in duplicates following the standard protocol developed by Eurofins.
The docking model provided the explanation to this
improvement. Introduction of the halogen group (m-Cl) in
compound 23 further stabilizes the solvent-accessible environ-
ment around the aryl group and R1173 (Figure 5A), thus
improving the binding affinity. Analysis of the binding poses of
compound 23 or CBP30 with CBP showed no clear difference
5793
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
Figure 8. Cellular activity of CBP/EP300 inhibitors in multiple myeloma cell lines. (A) Dose-proportional effect of CBP30 and compound 23
(UMB298) (5 days) on MOLM13 cellular viability as approximated by ATP-dependent luminescence (means standard error of the mean, SEM, n =
4). (B) Immunoblot of MYC, β-actin, H2K27ac, and H3 following 2 h of incubation with dimethyl sulfoxide (DMSO) or the indicated concentrations
of CBP30 or compound 23 (UMB298) in MOLM13 cells. (C) Quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis of
transcript levels of MYC after a 2 h treatment of MOLM13 cells with DMSO, 3.0 μM CBP30, or 3.0 μM UMB298. Values represent three biologic
replicate means SEM. *P = 0.01−0.05; **P = 0.001− 0.01; ***P = 0.0001−0.001; ****P < 0.0001. (D) Immunoblot of MYC, IRF4 following 24 h
incubation with DMSO or 2.5 μM CBP30, compound 23 (UMB298), compound 10, and compound 11 in MM.1S cells. β-actin is used as the loading
control.
between the benzimidazole of CBP30 and the imidazopyridine
of compound 23 (Figure 6A,B). The low affinity for BRD4 of the
three compounds is due to the methyl (in the OMe group) and
cyclohexyl groups being completely solvent-exposed in BRD4
(Figure 5B). R1173 in CBP anchors the ethylene linker in
compounds 7, 16, and 23 by forming cation−π interactions with
the aryl group. However, R1173 is replaced by D145 in BRD4.
This amino acid difference abolishes the receptor’s ability to
form cation−π interactions with molecules in the binding pocket
of BRD4 and rationalizes the selectivity that emerges for
compounds 7, 16, and 23. Overall, the docking analyses of
compounds 4, 7, 16, and 23 with CBP and BRD4
bromodomains were consistent with the binding affinities
obtained in our biochemical assays.
Excitingly, we obtained the cocrystal structure of compound
23 (UMB298) with the bromodomain of CBP (Figure 6C,D).
As expected from our docking model, the crystal structure
confirmed that the 1,3-dimethylisoxazole ring acted as an acetyl
lysine mimetic to interact with the conserved Asn1168. The
fused imidazo[1,2-a]pyridine core showed the same orientation
as CBP30 (Figure 6A) and extended the chloro, methoxyl
phenyl group into the pocket formed by Arg1173 and Phe1177,
as predicted by docking. This extension further explains the CBP
selectivity we observed with our lead molecule 23 and confirms
the accuracy of our docking model.
potency. Further profiling using BROMOSCAN against 34
bromodomains at 1 μM compound concentration showed
promising binding and selectivity values for the three
compounds, with compound 23 having a better binding and
selectivity compared to compounds 7 and 16 (Figure 7B and
Table S1). The binding affinity (Kd) values of compounds 16
and 23 were further confirmed by BromoELECTSM with CBP,
EP300, and BRD4 (BD1). We observed similar binding trends
and comparable selectivity to our AlphaScreen data.
We next evaluated the cellular activity of our lead molecule 23
in the AML cell line MOLM13 and several multiple myeloma
lines in comparison with CBP30. Compound 23 inhibited
MOLM13 and MM cell growth with IC50 values similar to
CBP30 (Figures 8A and S2). These compounds can inhibit
leukemia cell growth at high concentrations as described in the
literature, where the CBP/EP300 bromodomain inhibitor alone
has limited effect on blocking CBP/EP300 functions.18,35 We
further investigated on-target inhibition of our compounds by
checking the impact of bromodomain inhibition on H3K27ac
and Myc expression levels. Treatment with compound 23
reduced the H3K27ac level similar to CBP30 and caused MYC
depletion as a signature of CBP inhibition in AML (Figure 8B).
The MYC-level reduction was further confirmed by reverse
transcription-polymerase chain reaction (RT-PCR) experi-
ments (Figure 8C). To confirm whether compound 23 exerted
MYC deletion through on-target CBP/EP300 inhibition, we
assessed the effect of the selective CBP inhibitor (CBP30 and
compound 23) for their effect on IRF4/MYC function in the
multiple myeloma cell line (MM.1S)36 using compounds 10 and
11, selective toward BRD4 as the negative control. We observed
that the IRF4/MYC axis was perturbed by CBP30 and
compound 23 at similar levels but not with the BRD4 inhibitor
as we expected (Figure 8D).36 Compound 23 showed similar
but slightly weaker cellular activity compared to CBP30, which
Selectivity Assessment and Cellular Activity. To further
confirm the selectivity observed in our biochemical assay, we
utilized differential scanning fluorometry (DSF) to measure the
binding of compounds with BRD4 BD1 (the first bromodomain
of BRD4), the CBP bromodomain, and the EP300 (P300)
bromodomain (Figures S1 and 7A). Compound 7 showed very
modest activity toward BRD4 but was more active against CBP
and EP300. Compounds 16 and 23 showed greater selectivity
than the known inhibitor, CBP30, with a slightly reduced
5794
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
by NMR and liquid chromatography−mass spectrometry (LC−MS).
matches the binding activities we observed in biochemical
assays. Thus, the core we built with our GBB reaction can
produce the EP300/CBP inhibitors with good cellular activity.
1H NMR (400 MHz) and 13C NMR spectra (101 MHz) were recorded
on Agilent NMR spectrometers. The chemical shifts were reported in
parts per million (ppm), and the residual solvent peak was used as an
internal reference: proton (chloroform δ 7.26) and carbon (chloroform
δ 77.0). Multiplicities were indicated as follows: s (singlet), d (doublet),
t (triplet), q (quartet), m (multiplet), dd (doublet of doublet), and br s
(broad singlet). Coupling constants were reported in hertz (Hz). LC−
MS was performed on an Agilent 2100 LC with a 6130 quadruple mass
spectrometer (MS), and a C18 column (5.0 μm, 6.0 mm × 50 mm) was
used for separation. The mobile phases were MeOH and H2O, both
containing 0.01% trifluoroacetic acid. A linear gradient of 50:50 (v/v)
MeOH/H2O to 100% MeOH was used over 7.0 min at a flow rate of 0.7
mL/min. The chromatograms were detected at UV wavelengths 210,
254, and 365 nm. Low-resolution mass spectra were recorded in APCI
(atmospheric pressure chemical ionization). The microwave reactions
were performed on a Biotage Initiator 8 system equipped with an
infrared (IR) sensor (external surface sensor) to monitor the reaction
temperature. Flash chromatography separation was performed on the
YAMAZEN AI-580 system with Agela silica gel (12 or 20 g, 230−400
μm mesh) cartridges. Some of the final products were purified using an
Agela HP-100 pre-LC system with a Venusil PrepG C18 column (10
μm, 120 Å, 21.2 mm × 250 mm). HRMS was analyzed by RP-LC−MS:
1 μL of each sample was combined and 500 mL of optima-grade MeCN
(0.1% formic acid) and 500 mL of optima-grade H2O (0.1% formic
acid) were added to the mixture. This mixture was then diluted by
another factor of 10 with a 75/25 mixture of the optima-grade MeCN
and H2O. Then, 1 mL (10 fmol of each on the column) of this mixture
was analyzed by RP-LC−MS. The mass analyzer was Orbitrap.
Synthesis of Biotinylated-CBP/P300 Bromodomain Binder C.
5-(4-(4-(3-(Cyclohexylamino)-6-(3,5-dimethylisoxazol-4-yl)-
imidazo[1,2-a]pyridin-2-yl)phenyl)piperazin-1-yl)-5-oxopentanoic
Acid (Compound B). To the solution of A (20.0 mg, 0.0394 mmol) and
N,N-diisopropylethylamine (DIPEA) (13.2 μL, 0.0788 mmol) in
dichloromethane (DCM) (2 mL) was added glutaric anhydride (6.74
mg, 0.0591 mmol) at room temperature. The mixture was stirred at
room temperature for 4 h and then purified via ISCO (MeOH/DCM =
0−15%) to afford B as a colorless oil (18.0 mg, 78% yield). MS: m/z (M
+ 1)+: 585.27.
5-(4-(4-(3-(Cyclohexylamino)-6-(3,5-dimethylisoxazol-4-yl)-
imidazo[1,2-a]pyridin-2-yl)phenyl)piperazin-1-yl)-5-oxo-N-(15-
oxo-19-((4S)-2-oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl)-
4,7,10-trioxa-14-azanonadecyl)pentanamide (Compound C). To a
solution of B (18.0 mg, 0.031 mmol), N-(13-amino-4,7,10-
trioxatridecanyl)-D-biotinamide (CAS #183896-00-6) (13.8 mg,
0.031 mmol), and HATU (23.6 mg, 0.062 mmol) in dimethylforma-
mide (DMF) (1 mL) was added DIPEA (10.4 mL, 0.062 mmol) at
room temperature for 1 h. After workup of the reaction, the residue was
purified by high performance liquid chromatography (HPLC) (0.1%
TFA/MeCN) to afford C (3.5 mg, 11% yield). MS: m/z (M + 1)+:
1013.61.
Representative Procedure for the Three-Component Re-
action. A 10 mL microwave reaction tube was charged with 4-
bromopyridin-2-amine (1 mmol, 1 equiv), aldehyde, e.g., 3-(3-chloro-
4-methoxyphenyl)propanal (1.2 mmol, 1.2 equiv), isocyanide, e.g.,
cyclohexylisocyanide (1 mmol, 1 equiv), and Sc(OTf)3 (0.08 mmol,
0.08 equiv) in 2 mL of 3:1 CH2Cl2/MeOH (Scheme 1). The reaction
mixture was heated under microwave irradiation at 100 °C for 40 min.
The mixture was concentrated and purified by flash chromatography
eluted with 20% EtOAc in hexane to provide the product as a yellow
solid (95−97%).
CONCLUSIONS
■
Developing potent inhibitors that can disrupt protein−protein
interactions remains a challenging but attractive task for drug
development.37 In this work, we developed an effective synthetic
method to assemble the core of a panel of potent bromodomain
inhibitors. Our two-step synthesis involved the Groebke−
Blackburn−Bienayme (GBB) reaction27−29 to build the core
and decorate the core with various functional groups and
different appendix groups in a relatively high-throughput
manner. The Suzuki coupling installed the acetyl lysine mimetic
with a high overall yield (>90%). The approach generated a
broad spectrum of compounds with different potencies and
selectivities against CBP over BRD4. In parallel, we established a
computational model that explains the observed potency and
selectivity. The model provided valuable information, which
aided the rational design of novel potent and selective inhibitors.
More importantly, this model and the related explanation have
been further confirmed by the cocrystal structure of our lead
molecule compound 23 with the CBP bromodomain. The lead
compound 23 built upon the imidazo[1,2-a]pyridine scaffold
with optimization on other parts (R1−3) of the molecule showed
comparable potency and selectivity with other reported CBP
inhibitors in biochemical and cellular assays. Compared to the
synthetic approaches previously employed for the synthesis of
reported CBP inhibitors, our method is simple and resource-
efficient, allowing quick and comprehensive SAR studies.
Compound 23 qualifies to be used to assist in the interrogation
of the biological roles of this protein in diseases. More
importantly, we envision that our novel and effective approach
can be utilized for bromodomain inhibitor development
targeting other bromodomains outside the BET and CBP/
EP300 families.
EXPERIMENTAL SECTION
■
Chemistry. The synthesis of the imidazo[1,2-a]pyridine scaffold-
based CBP inhibitors was done in two steps: three-component
reaction27−29 followed by the Suzuki coupling.30,38 Synthesis of
compound 23 involved a multicomponent reaction by combining 4-
bromopyridin-2-amine, 3-(3-chloro-4-methoxyphenyl)propanal, and
cyclohexylisocyanide under microwave irradiation for 40 min. This
was followed by the Suzuki coupling of the intermediate with 3,5-
dimethylisoxazole-4-boronic acid pinacol ester. Both steps had yields
and produced the final product with an overall good yield. It is a green
synthesis with high overall yield as well as atom- and step-economy.
Previously, the Brennan group reported CBP30, a potent and selective
CBP inhibitor (CBP, IC50 = 79 nM), with a selectivity window of 40-
fold against BRD4.9 It contains a benzimidazole scaffold.9 The synthesis
of CBP30 involved five steps through a linear or multistep synthesis,
leading to a low overall yield of about 4%.9 In this study, an imidazo[1,2-
a]pyridine scaffold was used, with substituent groups around the
imidazo[1,2-a]pyridine scaffold varied by use of different aldehydes,
isocyanides, and also warheads as acetyl lysine mimic, 3,5-
dimethylisoxazole, 3-methyl-2H-indazole, 3-methyl-3a,7a-
dihydrobenzo[d]isoxazole, and 3-methyl-3,4-dihydroquinazolin-
2(1H)-one to obtain a panel of compounds (Scheme 1). The
synthesized compounds were screened for their inhibitory activity
against CBP and BRD4 using the AlphaScreen assay to obtain IC50
values.
Representative Procedure for the Suzuki Reaction. To a
solution of Groebke−Blackburn−Bienayme reaction adduct (1 mmol,
1 equiv), 3,5-dimethylisoxazole-4-boronic acid pinacol ester (1.2 mmol,
1.2 equiv), K2CO3 (2.0 mmol, 2.0 equiv), and Pd(dppf)Cl2·CH2Cl2
(0.08 mmol, 0.08 equiv 8% mol) in 2 mL of 2:1 DME/H2O were heated
under microwave irradiation at 120 °C for 40 min (Scheme 1). The
mixture was concentrated and purified by flash chromatography eluted
with 30% EtOAc in hexane to provide the desired product in 90−97%
yield.
General Synthetic Information. Chemicals and solvents were
purchased from commercial suppliers and used as received. All of the
compounds used for the biological assay were >95% pure as determined
5795
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
N-((3s,5s,7s)-Adamantan-1-yl)-2-(4-methoxyphenyl)-5,7-
dimethylimidazo[1,2-a]pyridin-3-amine (1, 91% Yield). 1H NMR
(400 MHz, CDCl3) δ 7.76−7.69 (m, 2H), 7.15 (s, 1H), 6.97−6.93 (m,
2H), 6.27 (s, 1H), 3.86 (s, 3H), 3.49 (s, 1H), 2.93 (s, 3H), 2.32 (s, 3H),
1.52−1.40 (m, 6H), 1.35−1.25 (m, 2H), 0.97−0.87 (m, 2H). 13C NMR
(101 MHz, CDCl3) δ 158.76, 143.62, 136.03, 134.63, 129.72, 128.69,
116.43, 113.96, 113.60, 56.62, 55.57, 55.23, 42.97, 36.25, 29.64, 20.96,
20.89. HRMS (ESI-Orbitrap) m/z: (M + H)+ calcd for C26H31N3O
402.25454, found 402.2545.
126.02, 125.72, 123.51, 116.21, 115.23, 111.86, 59.50, 56.77, 35.84,
31.94, 31.78, 30.54, 29.22, 11.84, 11.04. HRMS (ESI-Orbitrap) m/z:
(M + H)+ calcd for C28H36N4O 445.29674, found 445.2967.
N-(tert-Butyl)-7-(3,5-dimethylisoxazol-4-yl)-2-phenethylimidazo-
[1,2-a]pyridin-3-amine (13, 89% Yield). 1H NMR (400 MHz, CDCl3)
δ 8.17 (dd, J = 7.1, 1.0 Hz, 1H), 7.37 (dd, J = 1.7, 0.9 Hz, 1H), 7.31−
7.27 (m, 2H), 7.22−7.18 (m, 3H), 6.64 (dd, J = 7.1, 1.7 Hz, 1H), 3.49
(s, 1H), 3.10−3.07 (m, 4H), 2.48 (s, 3H), 2.34 (s, 3H), 1.15 (s, 9H).
13C NMR (101 MHz, CDCl3) δ 165.73, 158.51, 142.09, 141.81, 141.11,
N-((3s,5s,7s)-Adamantan-1-yl)-7-(3,5-dimethylisoxazol-4-yl)-2-
(4-methoxyphenyl)imidazo[1,2-a]pyridin-3-amine (2, 90% Yield).
1H NMR (400 MHz, CDCl3) δ 8.31 (d, J = 8.0 Hz, 1H), 7.91−7.88 (m,
128.55, 128.44, 126.01, 125.80, 123.44, 116.18, 111.88, 110.78, 55.37,
35.82, 30.94, 30.29, 24.85, 11.83, 11.03. HRMS (ESI-Orbitrap) m/z:
(M + H)+ calcd for C24H28N4O 389.24415, found 389.2441.
2H), 7.71 (dd, J = 5.8, 3.3 Hz, 1H), 7.53 (dd, J = 5.7, 3.3 Hz, 1H), 7.00−
6.96 (m, 2H), 3.88 (s, 3H), 3.49 (s, 1H) 2.49 (s, 3H), 2.35 (s, 3H),
1.45−1.39 (m, 3H), 1.37−1.28 (m, 12H). 13C NMR (101 MHz,
CDCl3) δ 167.76, 159.02, 158.31, 147.09, 144.52, 141.71, 139.80,
132.41, 130.88, 129.26, 128.79, 123.56, 116.50, 113.71, 112.14, 56.66,
55.25, 43.91, 38.70, 36.13, 30.34, 29.66, 28.91, 23.72, 22.99, 14.07,
11.87, 10.96. HRMS (ESI-Orbitrap) m/z: (M + H)+ calcd for
C29H32N4O2 469.26036, found 469.2604.
N-((3s,5s,7s)-Adamantan-1-yl)-7-(3,5-dimethylisoxazol-4-yl)-2-
(4-methoxyphenethyl)imidazo[1,2-a]pyridin-3-amine (14, 87%
1
Yield). H NMR (400 MHz, CDCl3) δ 8.23 (dd, J = 7.1, 0.9 Hz,
1H), 7.36 (dd, J = 1.8, 1.0 Hz, 1H), 7.14−7.10 (m, 2H), 6.85−6.81 (m,
2H), 6.64 (dd, J = 7.1, 1.7 Hz, 1H), 3.79 (s, 3H), 3.50 (s, 1H), 3.04 (td, J
= 3.2, 1.8 Hz, 4H), 2.48 (s, 3H), 2.35 (s, 3H), 1.67−1.58 (m, 15H). 13C
NMR (101 MHz, CDCl3) δ 158.54, 157.88, 134.22, 129.48, 123.54,
116.11, 113.83, 111.82, 55.44, 55.29, 43.92, 43.87, 36.18, 34.88, 30.62,
29.66, 11.87, 11.07. HRMS (ESI-Orbitrap) m/z: (M + H)+ calcd for
C31H36N4O2 497.29166, found 497.2917.
N-Cyclohexyl-7-(3, 5-dimethylisoxazol-4-yl)-2-(4-
1
methoxyphenyl)imidazo[1,2-a]pyridin-3-amine (3, 89% Yield). H
N-Cyclohexyl-7-(3, 5-dimethylisoxazol-4-yl)-2-(4-
methoxyphenethyl)imidazo[1,2-a]pyridin-3-amine (16, 90% Yield).
1H NMR (400 MHz, CDCl3) δ 8.04 (dd, J = 7.0, 0.9 Hz, 1H), 7.36 (dd,
NMR (400 MHz, CDCl3) δ 8.15 (d, J = 8.0 Hz, 1H), 8.00 (s, 1H), 7.72
(d, J = 3.3 Hz, 1H), 7.54−7.52 (m, 2H), 7.41 (dd, J = 1.7, 0.9 Hz, 1H),
7.03−6.99 (m, 2H), 3.87 (s, 3H), 3.00 (t, J = 10.2 Hz, 1H), 2.48 (s,
3H), 2.35 (s, 3H), 1.68 (dd, J = 12.2, 6.1 Hz, 4H), 1.46−1.39 (m, 6H).
13C NMR (101 MHz, CDCl3) δ 167.75, 165.76, 158.55, 144.63, 141.26,
132.40, 130.87, 128.77, 128.26, 124.30, 122.69, 116.62, 113.99, 112.47,
56.95, 55.27, 38.69, 30.32, 28.90, 23.71, 22.97, 14.05, 10.95. HRMS
(ESI-Orbitrap) m/z: (M + H)+ calcd for C25H28N4O2 417.22907,
found 417.2291.
2-(4-Methoxyphenyl)-5,7-dimethyl-N-(2,4,4-trimethylpentan-2-
yl)imidazo[1,2-a]pyridin-3-amine (5, 92% Yield). 1H NMR (400
MHz, CDCl3) δ 7.70−7.68 (m, 1H), 7.67 (d, J = 2.2 Hz, 1H), 7.15 (s,
1H), 6.98−6.95 (m, 2H), 6.28 (s, 1H), 3.85 (s, 3H), 3.49 (s, 1H), 2.91
(s, 3H), 2.31 (s, 3H), 1.45 (s, 2H), 0.95 (s, 9H), 0.77 (s, 6H). 13C NMR
(101 MHz, CDCl3) δ 158.88, 143.68, 135.93, 134.64, 130.86, 129.87,
128.77, 124.29, 116.44, 113.68, 60.55, 56.22, 55.26, 31.83, 30.33, 28.33,
22.98, 20.77, 14.05. HRMS (ESI-Orbitrap) m/z: (M + H)+ calcd for
C24H33N3O 380.27019, found 380.2702.
N-Cyclohexyl-7-(3,5-dimethylisoxazol-4-yl)-2-phenethylimidazo-
[1,2-a]pyridin-3-amine (7, 88% Yield). 1H NMR (400 MHz, CDCl3) δ
8.22 (dd, J = 7.1, 0.9 Hz, 1H), 7.37 (dd, J = 1.7, 0.9 Hz, 1H), 7.29 (dd, J
= 7.9, 6.7 Hz, 2H), 7.23−7.19 (m, 3H), 6.64 (dd, J = 7.1, 1.7 Hz, 1H),
3.14−3.04 (m, 4H), 3.50 (1H), 2.48 (s, 3H), 2.35 (s, 3H), 1.66 (d, J =
2.8 Hz, 6H), 1.59 (d, J = 22.3 Hz, 4H), 0.91 (dt, J = 9.7, 7.3 Hz, 1H). 13C
NMR (101 MHz, CDCl3) δ 165.70, 158.51, 142.13, 141.76, 141.19,
128.57, 128.41, 125.98, 125.67, 123.53, 122.93, 116.10, 115.25, 111.80,
68.12, 55.40, 43.90, 36.17, 30.39, 29.64, 24.86, 11.84, 11.04. HRMS
(ESI-Orbitrap) m/z: (M + H)+ calcd for C26H30N4O 415.2480, found
415.2499.
J = 1.7, 0.9 Hz, 1H), 7.13−7.09 (m, 2H), 6.85−6.81 (m, 2H), 6.65 (dd,
J = 7.0, 1.7 Hz, 1H), 3.79 (s, 3H), 3.49 (s, 1H), 3.02 (dtd, J = 11.8, 5.9,
1.7 Hz, 4H), 2.47 (s, 3H), 2.34 (s, 3H), 1.81−1.66 (m, 5H), 1.27−1.09
(m, 6H). 13C NMR (101 MHz, CDCl3) δ 165.68, 158.53, 157.89,
141.21, 139.34, 134.13, 129.47, 125.36, 122.62, 116.37, 115.31, 113.81,
112.15, 57.20, 55.26, 34.91, 34.22, 30.21, 25.72, 24.83, 11.81, 11.01.
HRMS (ESI-Orbitrap) m/z: (M + H)+ calcd for C27H32N4O2
445.26036, found 445.2605.
7 - ( 3 , 5 -D i m e t h y l is o x a z o l- 4 - y l ) - N- i s o p ro p y l- 2 - ( 4 -
methoxyphenethyl)imidazo[1,2-a]pyridin-3-amine (17, 88% Yield).
1H NMR (400 MHz, CDCl3) δ 8.25 (d, J = 7.1 Hz, 1H), 8.16 (s, 1H),
7.11 (dd, J = 7.0, 1.3 Hz, 1H), 7.08−7.04 (m, 2H), 6.83−6.79 (m, 2H),
4.27−4.15 (m, 1H), 3.78 (s, 3H), 3.49 (s, 1H), 3.15 (q, J = 8.2, 7.6 Hz,
2H), 3.09 (dd, J = 9.6, 6.4 Hz, 2H), 2.55 (s, 3H), 2.38 (s, 3H), 1.05 (s,
3H), 1.03 (s, 3H). 13C NMR (101 MHz, CDCl3) δ 167.47, 158.35,
157.86, 137.33, 133.98, 132.14, 129.59, 126.49, 123.42, 116.40, 114.13,
113.52, 112.59, 55.32, 49.71, 38.68, 33.93, 27.25, 23.22, 12.12, 11.09.
HRMS (ESI-Orbitrap) m/z: (M + H)+ calcd for C24H28N4O2
405.22907, found 405.2291.
N-Cyclohexyl-7-(3, 5-dimethylisoxazol-4-yl)-2-(4-
ethoxyphenethyl)imidazo[1,2-a]pyridin-3-amine (19, 90% Yield).
1H NMR (400 MHz, CDCl3) δ 8.05 (dd, J = 7.0, 1.0 Hz, 1H), 7.37 (dd,
J = 1.7, 0.9 Hz, 1H), 7.11−7.07 (m, 2H), 6.83−6.78 (m, 2H), 6.66 (dd,
J = 7.0, 1.7 Hz, 1H), 4.01 (q, J = 7.0 Hz, 2H), 3.49 (s, 1H), 3.07−2.97
(m, 4H), 2.74−2.62 (m, 1H), 2.47 (s, 3H), 2.34 (s, 3H), 1.80−1.68 (m,
4H), 1.40 (t, J = 7.0 Hz, 3H), 1.26−1.12 (m, 6H). 13C NMR (101 MHz,
CDCl3) δ 165.68, 158.51, 157.24, 141.16, 139.26, 133.95, 129.44,
125.41, 125.39, 122.62, 116.31, 115.29, 114.41, 112.18, 63.39, 57.19,
34.92, 34.20, 30.16, 25.71, 24.81, 14.88, 11.80, 11.00. HRMS (ESI-
Orbitrap) m/z: (M + H)+ calcd for C28H34N4O2 459.27601, found
459.2760.
2-(3-Chloro-4-methoxyphenethyl)-N-cyclohexyl-7-(3,5-dimethy-
lisoxazol-4-yl)imidazo[1,2-a]pyridin-3-amine (23, 90% Yield). 1H
NMR (400 MHz, CDCl3) δ 8.05 (dd, J = 7.0, 1.0 Hz, 1H), 7.36 (dd, J =
1.7, 0.9 Hz, 1H), 7.23 (d, J = 2.2 Hz, 1H), 7.04 (dd, J = 8.3, 2.2 Hz, 1H),
6.83 (d, J = 8.4 Hz, 1H), 6.66 (dd, J = 7.0, 1.7 Hz, 1H), 3.87 (s, 3H),
3.49 (s, 1H), 3.08−2.97 (m, 4H), 2.66−2.52 (m, 1H), 2.48 (s, 3H),
2.34 (s, 3H), 1.80−1.69 (m, 4H), 1.28−1.11 (m, 6H). 13C NMR (101
MHz, CDCl3) δ 165.70, 158.50, 153.24, 141.27, 138.97, 135.23,
130.19, 127.75, 125.53, 122.64, 122.07, 116.37, 115.27, 112.23, 112.00,
57.24, 56.15, 34.47, 34.23, 29.74, 25.70, 24.81, 11.80, 11.00. HRMS
(ESI-Orbitrap) m/z: (M + H)+ calcd for C27H31N4O2Cl 479.22139,
found 479.2216.
N-((3s,5s,7s)-Adamantan-1-yl)-7-(3,5-dimethylisoxazol-4-yl)-2-
1
phenethylimidazo[1,2-a]pyridin-3-amine (8, 90% Yield). H NMR
(400 MHz, CDCl3) δ 8.04 (d, J = 7.9 Hz, 1H), 7.71 (dd, J = 5.7, 3.3 Hz,
1H), 7.39 (s, 1H), 7.29 (d, J = 6.8 Hz, 1H), 7.24−7.18 (m, 3H), 6.66
(dd, J = 7.0, 1.7 Hz, 1H), 3.09 (d, J = 7.0 Hz, 2H), 3.07−3.02 (m, 2H),
2.71 (s, 1H), 2.47 (s, 3H), 2.34 (s, 3H), 1.74 (dd, J = 22.8, 7.9 Hz, 4H),
1.45−1.30 (m, 6H), 1.15 (t, J = 10.1 Hz, 5H). 13C NMR (101 MHz,
CDCl3) δ 165.71, 158.51, 142.03, 141.17, 139.08, 132.40, 130.86,
128.77, 128.59, 128.41, 126.03, 125.54, 122.62, 116.32, 112.25, 57.15,
38.69, 35.84, 34.19, 29.93, 28.90, 25.70, 24.81, 22.97, 14.05, 11.00.
HRMS (ESI-Orbitrap) m/z: (M + H)+ calcd for C30H34N4O
467.28109, found 467.2811.
7-(3,5-Dimethylisoxazol-4-yl)-2-phenethyl-N-(2,4,4-trimethyl-
pentan-2-yl)imidazo[1,2-a]pyridin-3-amine (12, 89%). 1H NMR
(400 MHz, CDCl3) δ 8.17 (dd, J = 7.1, 1.0 Hz, 1H), 7.36 (dd, J = 1.7,
0.9 Hz, 1H), 7.32−7.27 (m, 2H), 7.24−7.17 (m, 3H), 6.65 (dd, J = 7.1,
1.7 Hz, 1H), 3.49 (s, 1H), 3.13−3.05 (m, 4H), 2.48 (s, 3H), 2.34 (s,
3H), 1.59 (s, 2H), 1.14 (s, 6H), 1.07 (s, 9H). 13C NMR (101 MHz,
CDCl3) δ 165.72, 158.52, 142.09, 141.86, 141.32, 128.53, 128.44,
N-Cyclohexyl-7-(3,5-dimethylisoxazol-4-yl)-2-(3-(4-
methoxyphenyl)propyl)imidazo[1,2-a]pyridin-3-amine (25, 89%
5796
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
Yield). 1H NMR (400 MHz, CDCl3) δ 8.06 (dd, J = 7.0, 1.0 Hz, 1H),
7.35 (dd, J = 1.7, 0.9 Hz, 1H), 7.15−7.11 (m, 2H), 6.86−6.81 (m, 2H),
6.66 (dd, J = 7.0, 1.7 Hz, 1H), 3.79 (s, 3H), 3.49 (s, 1H), 2.79 (q, J = 4.0,
3.5 Hz, 1H), 2.76−2.70 (m, 2H), 2.67 (t, J = 7.5 Hz, 2H), 2.46 (s, 3H),
2.32 (s, 3H), 2.11 (tt, J = 8.8, 6.8 Hz, 2H), 1.84−1.71 (m, 4H), 1.24 (s,
2H), 1.20−1.14 (m, 4H). 13C NMR (101 MHz, CDCl3) δ 165.69,
158.54, 157.71, 141.17, 139.92, 134.13, 129.37, 125.31, 124.95, 122.53,
116.39, 115.33, 113.70, 112.20, 57.21, 55.26, 34.57, 34.22, 30.94, 26.46,
25.74, 24.85, 11.78, 10.99. HRMS (ESI-Orbitrap) m/z: (M + H)+ calcd
for C28H34N4O2 459.27601, found 459.2761.
7-(3,5-Dimethylisoxazol-4-yl)-2-(4-methoxyphenethyl)-N-(2,4,4-
trimethylpentan-2-yl)imidazo[1,2-a]pyridin-3-amine (26, 91%
Yield). 1H NMR (400 MHz, CDCl3) δ 8.18 (d, J = 7.0 Hz, 1H), 7.38
(s, 1H), 7.11−7.07 (m, 2H), 6.85−6.80 (m, 2H), 6.65 (dd, J = 7.1, 1.6
Hz, 1H), 3.79 (s, 3H), 3.04 (s, 3H), 2.48 (s, 3H), 2.46−2.35 (m, 1H),
2.35 (s, 3H), 2.32−2.20 (m, 1H), 1.25 (s, 2H), 1.14 (s, 6H), 1.08 (s,
9H). 13C NMR (101 MHz, CDCl3) δ 13C NMR (101 MHz, cdcl3) δ
165.74, 158.50, 157.87, 134.08, 129.43, 123.83, 123.51, 116.11, 115.20,
113.82, 111.92, 59.50, 56.77, 55.21, 34.92, 31.93, 31.86, 31.77, 30.73,
29.23, 24.85, 11.85, 11.04. HRMS (ESI-Orbitrap) m/z: (M + H)+ calcd
for C29H38N4O2 475.30732, found 475.3073.
2-(3-Chloro-4-ethoxyphenethyl)-7-(3,5-dimethylisoxazol-4-yl)-N-
(2,4,4-trimethylpentan-2-yl)imidazo[1,2-a]pyridin-3-amine (31,
91% Yield). 1H NMR (400 MHz, CDCl3) δ 8.18 (dd, J = 7.1, 1.0 Hz,
1H), 7.35 (dd, J = 1.6, 0.9 Hz, 1H), 7.20 (d, J = 2.1 Hz, 1H), 6.98 (dd, J
= 8.3, 2.2 Hz, 1H), 6.81 (d, J = 8.4 Hz, 1H), 6.65 (dd, J = 7.1, 1.7 Hz,
1H), 4.08 (q, J = 7.0 Hz, 2H), 3.35 (s, 1H), 3.03 (s, 4H), 2.48 (s, 3H),
2.46−2.36 (m, 1H), 2.34 (s, 3H), 1.61 (s, 2H), 1.46 (t, J = 7.0 Hz, 3H),
1.14 (s, 6H), 1.09 (s, 9H). 13C NMR (101 MHz, CDCl3) δ 165.74,
158.51, 152.69, 141.88, 141.04, 135.13, 130.16, 127.60, 125.83, 123.79,
123.52, 122.58, 116.20, 115.22, 113.41, 111.93, 64.76, 59.56, 56.82,
34.58, 31.94, 31.80, 30.41, 29.26, 14.77, 11.85, 11.04. HRMS (ESI-
Orbitrap) m/z: (M + H)+ calcd for C30H40N4O2Cl 524.29182, found
524.2918.
2-(3,4-Dimethoxyphenethyl)-7-(3,5-dimethylisoxazol-4-yl)-N-
1
isopropylimidazo[1,2-a]pyridin-3-amine (33, 92% Yield). H NMR
(400 MHz, CDCl3) δ 8.06 (d, J = 7.0 Hz, 1H), 7.38 (s, 1H), 6.78 (q, J =
8.2 Hz, 2H), 6.67 (d, J = 11.2 Hz, 2H), 4.22 (t, J = 6.0 Hz, 1H), 3.86 (s,
3H), 3.77 (s, 3H), 3.49 (s, 1H) 3.18 (h, J = 6.1 Hz, 2H), 2.47 (s, 3H),
2.33 (s, 3H), 1.48−1.37 (m, 2H), 1.06 (d, J = 6.3 Hz, 6H). 13C NMR
(101 MHz, CDCl3) δ 167.75, 165.70, 158.49, 148.73, 147.29, 141.27,
139.51, 134.63, 130.88, 128.78, 125.56, 122.61, 120.25, 116.32, 111.96,
111.20, 55.95, 55.71, 49.62, 38.70, 30.34, 28.91, 23.45, 14.06, 10.96.
HRMS (ESI-Orbitrap) m/z: (M + H)+ calcd for C25H30N4O3
435.23964, found 435.2397.
7-(3,5-Dimethylisoxazol-4-yl)-2-(4-ethoxyphenethyl)-N-(2,4,4-tri-
methylpentan-2-yl)imidazo[1,2-a]pyridin-3-amine (27, 90% Yield).
1H NMR (400 MHz, CDCl3) δ 8.17 (dd, J = 7.1, 0.9 Hz, 1H), 7.37 (dd,
7-(3,5-Dimethylisoxazol-4-yl)-2-(3-(4-methoxyphenyl)propyl)-N-
(2,4,4-trimethylpentan-2-yl)imidazo[1,2-a]pyridin-3-amine (34,
91% Yield). 1H NMR (400 MHz, CDCl3) δ 8.23 (d, J = 7.1 Hz, 1H),
8.10 (s, 2H), 7.11 (d, J = 8.5 Hz, 2H), 6.82 (d, J = 8.6 Hz, 2H), 3.78 (s,
3H), 3.49 (s, 1H), 2.76 (dd, J = 8.8, 6.6 Hz, 2H), 2.65 (t, J = 7.2 Hz,
2H), 2.48 (s, 3H), 2.34 (s, 3H), 2.15 (p, J = 7.5 Hz, 2H), 1.61 (s, 2H),
1.11 (s, 6H), 1.08 (s, 9H). 13C NMR (101 MHz, CDCl3) δ 167.76,
165.96, 157.73, 134.21, 133.85, 132.42, 130.89, 129.48, 129.37, 128.79,
123.51, 113.72, 67.75, 59.68, 56.77, 38.88, 38.70, 31.92, 31.78, 30.56,
29.14, 23.97, 22.97, 14.07, 11.10. HRMS (ESI-Orbitrap) m/z: (M +
H)+ calcd for C30H40N4O2 489.32297, found 489.3229.
BRD4 AlphaScreen Assay. BRD4 (BD1) assays were performed
with minimal modifications from the manufacturer’s protocol
(PerkinElmer). All reagents were diluted in 50 mM 4-(2-hydrox-
yethyl)-1-piperazineethanesulfonic acid (HEPES), 150 mM NaCl,
0.1% w/v bovine serum albumin (BSA), 0.01% w/v Tween-20, pH 7.5
and allowed to equilibrate to room temperature prior to addition to
plates. After the addition of α beads to master solutions, all subsequent
steps were performed under low light conditions. A 2× solution of
components with final concentrations of His-BRD4 at 40 nM, Ni-
coated acceptor beads at 25 μg/mL, and 20 nM biotinylated JQ1(S)
was added in 10 μL to 384-well plates (AlphaPlate-384, PerkinElmer).
Plates were spun down at 150g, after which 100 nL of the compound in
DMSO from stock plates was added by pin-transfer using a Janus
workstation (PerkinElmer). The streptavidin-coated donor beads (25
μg/mL final) were added in the same manner as the previous solution,
in a 2× solution of 10 μL volume. Following this addition, plates were
sealed with foil to prevent light exposure and evaporation. The plates
were spun down again at 150g. Plates were incubated at room
temperature for 1 h and then read on an Envision 2104 (PerkinElmer)
using the manufacturer’s protocol.
J = 1.7, 0.9 Hz, 1H), 7.12−7.03 (m, 2H), 6.86−6.77 (m, 2H), 6.65 (dd,
J = 7.1, 1.7 Hz, 1H), 4.01 (q, J = 6.9 Hz, 2H), 3.49 (s, 1H), 3.03 (s, 4H),
2.48 (s, 3H), 2.34 (s, 3H), 1.58 (s, 2H), 1.41 (t, J = 7.0 Hz, 3H), 1.13 (s,
6H), 1.07 (s, 9H). 13C NMR (101 MHz, CDCl3) δ 165.75, 158.53,
157.26, 141.77, 133.95, 129.43, 123.87, 123.53, 116.13, 115.22, 114.42,
111.91, 63.36, 59.51, 56.78, 34.96, 31.94, 31.79, 30.77, 29.24, 14.90,
11.86, 11.05. HRMS (ESI-Orbitrap) m/z: (M + H)+ calcd for
C30H40N4O2 489.32297, found 489.3228.
7-(3,5-Dimethylisoxazol-4-yl)-2-(4-isopropoxyphenethyl)-N-
(2,4,4-trimethylpentan-2-yl)imidazo[1,2-a]pyridin-3-amine (28,
89% Yield). 1H NMR (400 MHz, CDCl3) δ 8.17 (dd, J = 7.0, 1.0 Hz,
1H), 7.38 (dd, J = 1.7, 0.9 Hz, 1H), 7.08−7.04 (m, 2H), 6.82−6.78 (m,
2H), 6.65 (dd, J = 7.1, 1.7 Hz, 1H), 4.50 (p, J = 6.1 Hz, 1H), 3.49 (s,
1H), 3.03 (d, J = 2.0 Hz, 4H), 2.48 (s, 3H), 2.34 (s, 3H), 1.59 (s, 2H),
1.33 (d, J = 6.1 Hz, 6H), 1.13 (s, 6H), 1.07 (s, 9H). 13C NMR (101
MHz, CDCl3) δ 165.74, 158.52, 156.16, 141.79, 141.27, 133.91,
129.44, 125.77, 123.85, 123.52, 116.12, 115.82, 115.23, 111.89, 75.00,
69.80, 59.49, 56.79, 34.96, 31.94, 31.77, 30.70, 29.21, 24.86, 22.10,
11.85, 11.04. HRMS (ESI-Orbitrap) m/z: (M + H)+ calcd for
C31H42N4O2 503.33862, found 503.3388.
2-(3-Chloro-4-ethoxyphenethyl)-N-cyclohexyl-7-(3,5-dimethyli-
soxazol-4-yl)imidazo[1,2-a]pyridin-3-amine (29, 91% Yield). 1H
NMR (400 MHz, CDCl3) δ 8.05 (dd, J = 7.1, 1.0 Hz, 1H), 7.36 (dd,
J = 1.7, 0.9 Hz, 1H), 7.22 (d, J = 2.2 Hz, 1H), 7.01 (dd, J = 8.3, 2.2 Hz,
1H), 6.82 (d, J = 8.4 Hz, 1H), 6.66 (dd, J = 7.0, 1.7 Hz, 1H), 4.08 (q, J =
7.0 Hz, 2H), 3.49 (s, 1H), 3.07−2.96 (m, 4H), 2.53 (d, J = 14.2 Hz,
1H), 2.48 (s, 3H), 2.34 (s, 3H), 1.82−1.69 (m, 4H), 1.45 (t, J = 7.0 Hz,
3H), 1.32−1.04 (m, 6H). 13C NMR (101 MHz, CDCl3) δ 165.71,
158.52, 152.70, 141.28, 139.04, 135.15, 130.19, 127.68, 125.50, 125.31,
122.65, 122.57, 116.40, 115.30, 113.44, 112.23, 64.80, 57.25, 34.54,
34.25, 29.78, 25.73, 24.83, 14.77, 11.82, 11.02. HRMS (ESI-Orbitrap)
m/z: (M + H)+ calcd for C28H33N4O2Cl 493.23704, found 493.2371.
2-(3-(3-Chloro-4-methoxyphenyl)propyl)-N-cyclohexyl-7-(3,5-di-
methylisoxazol-4-yl)imidazo[1,2-a]pyridin-3-amine (30, 90% Yield).
1H NMR (400 MHz, CDCl3) δ 8.07 (dd, J = 7.0, 1.0 Hz, 1H), 7.34 (s,
1H), 7.22 (d, J = 2.1 Hz, 1H), 7.07 (dd, J = 8.4, 2.1 Hz, 1H), 6.85 (d, J =
8.4 Hz, 1H), 6.66 (dd, J = 7.0, 1.6 Hz, 1H), 3.88 (s, 3H), 3.49 (s, 1H),
2.74 (d, J = 7.4 Hz, 2H), 2.65 (t, J = 7.5 Hz, 2H), 2.46 (s, 3H), 2.45−
2.40 (m, 1H), 2.32 (s, 3H), 2.11 (q, J = 7.8 Hz, 2H), 1.46−1.25 (m,
4H), 1.23−1.14 (m, 6H). 13C NMR (101 MHz, CDCl3) δ 165.68,
158.53, 153.08, 141.23, 139.82, 135.33, 130.19, 127.61, 125.34, 124.91,
122.54, 122.03, 116.44, 115.33, 112.22, 111.98, 106.09, 57.19, 56.19,
34.37, 34.27, 30.75, 26.46, 25.74, 24.86, 11.79, 10.99. HRMS (ESI-
Orbitrap) m/z: (M + H)+ calcd for C28H33N4O2Cl 493.23704, found
493.2370.
BRD4(1) and CBP AlphaScreen Assays. Assays were performed
with minor modifications from the manufacturer’s protocol (Perki-
nElmer). All reagents were diluted in an AlphaScreen buffer (50 mM
HEPES, 150 mM NaCl, 0.01% v/v Tween-20, 0.1% w/v BSA, pH 7.4).
After addition of α beads to master solutions, all subsequent steps were
performed under low light conditions. A 2× solution of components
with final concentrations of His-BRD4(1) at 20 nM or His-CBP at 50
nM, Ni-coated acceptor bead at 10 μg/mL, biotinylated-JQ at 10 nM or
biotinylated peptide at 100 nM or Compound C at 10 nM was added in
10 μL to 384-well plates (AlphaPlate-384, PerkinElmer) using an
EL406 liquid handler (Biotek). Plates were spun down at 1000 rpm. A
10-point 1: sqrt(10) serial dilution of compounds in DMSO was
prepared at 200x the final concentration. Then, 100 nL of the
compound from these stock plates was added by pin-transfer using a
Janus workstation (PerkinElmer). A 2× solution of streptavidin-coated
5797
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
donor beads with a final concentration of 10 μg/mL was added in a 10
μL volume. The plates were spun down again at 1000 rpm and sealed
with foil to prevent light exposure and evaporation. The plates were
then incubated at room temperature for 1 h and read on an Envision
2104 (PerkinElmer) using the manufacturer’s protocol. IC50 values
were calculated using a four-parameter logistic curve in Prism 6
(GraphPad Software) after normalization to DMSO-treated negative
control wells.
Crystallization and X-ray Crystallography. Crystallization
experiments were performed at 19 °C. Purified cleaved CBP BRD
was subjected to screening campaigns across different precipitants using
a mosquito crystallization robot (TP Labtech) in 96-well sitting drop iQ
plates. CBP (10 mg/mL) was incubated with 2 mM UMB289 and 5%
DMSO on ice for 30 min prior to addition of the precipitant in ratios
1:2, 1:1, and 2:1 per condition. X-ray-grade crystals grew from 0.1 M
Bis-Tris pH 5.5, 25% w/v poly(ethylene glycol) 3,350. For data
collection, crystals were cryoprotected using a precipitant supple-
mented with 25% ethylene glycol and flash-frozen in liquid nitrogen. X-
ray diffraction data were collected at −180 °C using beamline GMCA
23ID-D of the Advanced Photon Source at Argonne National
Laboratories. Data were reduced and scaled with XDS.40 PHASER41
was employed for molecular replacement using PDB entry 4NR7 as the
search model. Refinement was carried out with PHENIX,41 and model
building was performed with Coot.42 The initial inhibitor model was
generated with ligand restraints from eLBOW of the PHENIX suite.
The profiling data and the Kd data are generated by Eurofins using
BromoMAXSM and BromoKdELECTSM services.
Molecular Docking Experiments. All steps for the docking
̈
experiments in this study were performed using the Schrodinger 2018-3
suite (Small-Molecule Drug Discovery Suite 2018-3: Maestro,
̈
Schrodinger, LLC, New York, NY, 2018). CBP (PDB ID: 4NR7)
and BRD4 (PDB ID: 5BT4) were first processed to extract individual
protein chains and remove the cocrystallized ligand using the
split_structures.py command lines while keeping all crystal waters.
Both structures were processed using the protein prep wizard command
line.29,30 This step adds hydrogen atoms, assigns bond orders using
CCD, caps termini, assigns protonation states using PROPKA with pH
of 7, optimizes hydrogen bonds, and runs a restrained minimization of
the full protein. The receptor grids were then generated for a 25 Å × 25
Å × 25 Å outer box and a 15 Å × 15 Å × 15 Å inner box centered at the
centroid of pocket residues 6 Å away from the protein’s respective
cocrystallized ligand. CBP’s pocket includes residues 1106, 1109−
1111, 1113, 1115, 1120, 1122, 1125, 1164, 1167, 1168, 1173, 1174, and
1177, and BRD4’s pocket includes residues 79−89, 91, 92, 94, 97, 101,
105, 106, 132, 133, 135−140, 144, 145−147, 149, and 150. Smiles
strings of compounds 3, 4, 7, 16, 23, and CBP30 were generated using
the BindingDB39 molecular drawing tool. All molecules were converted
to mae files using the structconvert command and processed using the
̈
Figures were prepared using PyMOL (Schrodinger). Data collection
and refinement statistics are shown in Supporting Information Table
S2. The coordinates and structure factors of the CBP−UMB298
(compound 23) complex have been deposited in the PDB (accession
code 7KPY).
Western Blots. MOLM13 cells were seeded in 6-well plates at 1 ×
106 cells/well and treated with DMSO, 3.0 μM CBP30, or 3.0 μM
compound 23 for 2 h. Total protein was extracted from cells using the
RIPA buffer (Abcam) supplemented with the Halt Protease Inhibitor
Cocktail (Millipore-Sigma). Samples were loaded to Invitrogen Bolt
Bis-Tris Plus gels (ThermoFisher Scientific) and transferred to
Invitrolon PVDF membranes (ThermoFisher Scientific) using the
Invitrogen Bolt wet-gel Transfer Device. Immunodetection was
performed with standard techniques. The following primary and
secondary antibodies were used: anti-MYC, β-actin, H3 (Cell Signaling
Technology), anti-H3K27ac (abcam), and IRDye secondary antibodies
at the concentration recommended by the manufacturer.
Real-Time qPCR. Cells were treated with DMSO, 3.0 μM CBP30,
or 3.0 μM compound 23 for 2 h, and total RNA was isolated using the
RNeasy kit (Qiagen). Three biological replicates were performed for
each condition. cDNA was synthesized using the Tetro cDNA synthesis
kit (Thomas Scientific), and real-time qPCR was performed using the
PowerUp SYBR Green Master Mix (Life Technologies) on Applied
Biosystems ViiA 7 Real-Time PCR System (Applied Biosystems). The
f o l l o w i n g p r i m e r s w e r e u t i l i z e d : M Y C . F
̈
ligprep command to add explicit hydrogen atoms using the Schrodinger
2018-3 suite. All generated ligands were docked into the pockets of both
receptors using Glide with extra-precision docking and default
parameters to generate 10 poses for each ligand−receptor complex.
The top poses from each ligand were selected for analysis. The PDBs
were chosen because their cocrystallized ligands were from the same
chemical series, and the top poses resulted in very similar binding
modes of the shared chemical moiety. As mentioned in the Methods
section, PDB codes 4NR7 and 5BT4 were used for CBP and BRD4,
respectively. We also added the PDB codes to the figure legends for
further clarity. Figure 6 shows molecular graphics of the cocrystallized
PDBs 4NR7 and 5BT4.
5 ′ G G C T C C T G G C A A A A G G T C A ,
M Y C . R
5′CTGCGTAGTTGTGCTGATGT, GAPDH.F 5′CTGGGCTA-
CACTGAGCACC, and GAPDH.R 5′AAGTGGTCGTTGAGGG-
CAATG. Reactions were carried out in triplicate, and expression levels
were normalized to GAPDH.
Protein Expression and Purification. The expression plasmid for
CBP BRD was purchased from Addgene (#38977) and transformed
into Escherichia coli BL21 (DE3)-RIL cells, grown at 37 °C in an LB
medium (Fisher Scientific) containing carbenicillin and chloramphe-
nicol. At OD600 of 0.6, the culture was cooled down to 18 °C and
induced with 0.1 mM IPTG. After 18 h growth, the culture was
harvested by centrifugation at 6000g for 25 min and stored at −80 °C.
Harvested cell pellets were resuspended in 50 mM Na/K phosphate
buffer (pH 7.4) containing 100 mM NaCl, 40 mM imidazole, 0.01% w/
v lysozyme, and 0.01% v/v Triton X-100 at 4 °C for 1 h, subjected to
sonication, and the lysate was clarified by centrifugation (30 000g for 45
min at 4 °C). CBP BRD was purified by FPLC at 4 °C using columns
and chromatography materials from GE Healthcare. The lysate was
subjected to an immobilized Ni2+ affinity chromatography column
equilibrated with 50 mM Na/K phosphate buffer (pH 7.4) containing
100 mM NaCl and 40 mM imidazole using a gradient from 40 to 500
mM imidazole. Fractions containing the target protein were combined
and incubated overnight with TEV protease at 4 °C, and the cleaved
His6-tag was removed by a second Ni2+ affinity column. CBP was
purified to homogeneity by size-exclusion chromatography using
Superdex 75 in elution buffer 50 mM HEPES/100 mM NaCl/1 mM
DTT (pH 7.5). CBP BRD eluted as a monomer and was of
crystallization-grade quality (>95% purity as determined by sodium
dodecyl sulfate polyacrylamide gel electrophoresis, SDS-PAGE).
Protein was concentrated to 11 mg/mL; aliquots were flash-frozen in
liquid N2 and stored at −80 °C.
Cell Viability. Cells were seeded in 384-well plates (ThermoFisher
Scientific) at 500 cells/well, and transfer of serial prediluted compounds
(100 nL) was performed using a Janus workstation (PerkinElmer). The
CellTiter-Glo Luminescent cell viability assay was used to determine
the cell viability. Luminescent signals were read on 2104 EnVision
Multilabel Plate Readers (PerkinElmer) after a 5 day incubation. Data
were normalized to the DMSO control, and the IC50 values were
determined via the nonlinear regression curve fit using GraphPad Prism
9.
Statistical Analysis. Prism 9 software was used to process the data.
Student’s t-test was applied to compare compound-induced changes to
respective controls. A P value of less than 0.05 was chosen as a threshold
for statistical significance.
ASSOCIATED CONTENT
* Supporting Information
■
sı
The Supporting Information is available free of charge at
https://pubs.acs.org/doi/10.1021/acs.jmedchem.0c02232.
Molecular formula strings (CSV)
BromoSCAN, differential scanning fluorometry (DSF),
and cellular activity data of compounds 7, 16, and 23;
5798
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
Medicine, University of South Florida, Tampa, Florida 33612,
United States; orcid.org/0000-0003-4985-3461
Logan H. Sigua − Department of Cancer Biology, Dana-Farber
Cancer Institute, Boston, Massachusetts 02215, United States
Tingjian Wang − Department of Cancer Biology, Dana-Farber
Cancer Institute, Boston, Massachusetts 02215, United States
Deyao Li − Department of Cancer Biology, Dana-Farber Cancer
Institute, Boston, Massachusetts 02215, United States
Zied Gaieb − Department of Chemistry & Biochemistry,
University of California, LA Jolla, California 92093, United
States
Gagan Dhawan − Department of Biomedical Science, Acharya
Narendra Dev College, University of Delhi, Delhi, New Delhi
110019, India; orcid.org/0000-0001-7492-225X
Shuai Liu − Center for Green Chemistry and Department of
Chemistry, University of Massachusetts Boston, Boston,
Massachusetts 02125, United States
crystallographic data collection and refinement statistics
of compound 23; 1H NMR and 13C NMR of
representative compounds; and HPLC traces of com-
pounds 7, 16, and 23 (PDF)
Homology (docking) models of BRD4_5BT4_Cpd7
(UMB276) (PDB)
Homology (docking) models of BRD4_5BT4_Cpd-16
(UMB295) (PDB)
Homology (docking) models of BRD4_5BT4_Cpd-23
(UMB298) (PDB)
Homology (docking) models of CBP_4NR7_Cpd-3
(UMB274) (PDB)
Homology (docking) models of CBP_4NR7_Cpd-4
(UMB278) (PDB)
Homology (docking) models of CBP_4NR7_Cpd-7
(UMB276) (PDB)
Homology (docking) models of CBP_4NR7_Cpd-16
(UMB295) (PDB)
Jon Erickson − Center for Green Chemistry and Department of
Chemistry, University of Massachusetts Boston, Boston,
Massachusetts 02125, United States
Rommie E. Amaro − Department of Chemistry & Biochemistry,
University of California, LA Jolla, California 92093, United
States; orcid.org/0000-0002-9275-9553
Homology (docking) models of CBP_4NR7_Cpd-23
(UMB298) (PDB)
Cocrystallographic data of compound 23 (UMB298)
(PDB)
Complete contact information is available at:
Accession Codes
https://pubs.acs.org/10.1021/acs.jmedchem.0c02232
The PDB accession code for the cocrystal structure of the CBP
bromodomain liganded with compound 23 (UMB298) is 7KPY.
Authors will release the atomic coordinates upon article
publication.
Author Contributions
○A.M., V.K.W., H.O.Y., and M.J.B. contributed equally to this
work.
AUTHOR INFORMATION
Corresponding Authors
Author Contributions
All authors have given approval to the final version of the
manuscript.
■
Ernst Schönbrunn − Drug Discovery Department, Moffit
Cancer Center, Tampa, Florida 33612, United States;
Department of Molecular Medicine, USF Morsani College of
Medicine, University of South Florida, Tampa, Florida 33612,
United States; orcid.org/0000-0002-3589-3510;
Phone: +1 (813) 745-4703; Email: Ernst.Schonbrunn@
moffitt.org; Fax: +1 (813) 745-6748
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
We acknowledge undergraduate student Francesca Corsini for
her assistance with compound synthesis and Dr. Jason Evans for
HRMS analysis of some samples. We also thank Eurofins for
their expedite service on the Kd and selectivity evaluation. This
work was supported by National Institutes of Health U54 grant
CA156732 (W.Z.), National Cancer Institute (NCI) grants
P01-CA066996-19, U54HD093540-03, P50-CA100707-15
(J.Q.), and P30-CA076292 (E.S.), and Alex’s Lemonade Stand
Foundation Innovation Award (J.Q.).
Jun Qi − Department of Cancer Biology, Dana-Farber Cancer
Institute, Boston, Massachusetts 02215, United States;
Department of Medicine, Harvard Medical School, Boston,
Massachusetts 02115, United States; Phone: +1 (617) 632-
6629; Email: jun_qi@dfci.harvard.edu; Fax: +1(617) 582-
7370
Wei Zhang − Center for Green Chemistry and Department of
Chemistry, University of Massachusetts Boston, Boston,
Massachusetts 02125, United States; orcid.org/0000-
0002-6097-2763; Phone: +1 (617) 287-6147;
Email: wei2.zhang@umb.edu
ABBREVIATIONS USED
■
BET, bromodomain and extraterminal domain; BRD4,
bromodomain 4; CREBBP or CBP, cyclic AMP response
element binding protein; DSF, differential scanning fluorom-
etry; EP300 or P300, E1A binding protein P300; MCR,
multicomponent reaction; SAR, structure−activity relationship;
SGC, structural genomics consortium
Authors
Alex Muthengi − Center for Green Chemistry and Department
of Chemistry, University of Massachusetts Boston, Boston,
Massachusetts 02125, United States
Virangika K. Wimalasena − Department of Cancer Biology,
Dana-Farber Cancer Institute, Boston, Massachusetts 02215,
United States
Hailemichael O. Yosief − Center for Green Chemistry and
Department of Chemistry, University of Massachusetts Boston,
Boston, Massachusetts 02125, United States
Melissa J. Bikowitz − Drug Discovery Department, Moffit
Cancer Center, Tampa, Florida 33612, United States;
Department of Molecular Medicine, USF Morsani College of
REFERENCES
■
(1) Clegg, M. A.; Tomkinson, N. C. O.; Prinjha, R. K.; Humphreys, P.
G. Advancements in the development of non-BET bromodomain
chemical probes. ChemMedChem. 2019, 14, 362−385.
(2) Theodoulou, N. H.; Tomkinson, N. C.; Prinjha, R. K.;
Humphreys, P. G. Clinical progress and pharmacology of small
molecule bromodomain inhibitors. Curr. Opin. Chem. Biol. 2016, 33,
58−66.
5799
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
(3) Hewings, D. S.; Rooney, T. P.; Jennings, L. E.; Hay, D. A.;
Schofield, C. J.; Brennan, P. E.; Knapp, S.; Conway, S. J. Progress in the
development and application of small molecule inhibitors of
bromodomain-acetyl-lysine interactions. J. Med. Chem. 2012, 55,
9393−9413.
(19) Brown, P. J.; Mu
epigenetic targets. Future Med. Chem. 2015, 7, 1901−1917.
̈
ller, S. Open access chemical probes for
(20) Rooney, T. P.; Filippakopoulos, P.; Fedorov, O.; Picaud, S.;
Cortopassi, W. A.; Hay, D. A.; Martin, S.; Tumber, A.; Rogers, C. M.;
Philpott, M.; Wang, M.; Thompson, A. L.; Heightman, T. D.; Pryde, D.
C.; Cook, A.; Paton, R. S.; Muller, S.; Knapp, S.; Brennan, P. E.;
̈
(4) Filippakopoulos, P.; Knapp, S. Targeting bromodomains:
epigenetic readers of lysine acetylation. Nat. Rev. Drug Discovery
2014, 13, 337−356.
Conway, S. J. A series of potent CREBBP bromodomain ligands reveals
an induced-fit pocket stabilized by a cation-π interaction. Angew. Chem.,
Int. Ed. 2014, 53, 6126−6130.
(5) Smith, S. G.; Zhou, M. M. The Bromodomain: a new target in
emerging epigenetic medicine. ACS Chem. Biol. 2016, 11, 598−608.
(6) Vidler, L. R.; Brown, N.; Knapp, S.; Hoelder, S. Druggability
analysis and structural classification of bromodomain acetyl-lysine
binding sites. J. Med. Chem. 2012, 55, 7346−7359.
(7) Borah, J. C.; Mujtaba, S.; Karakikes, I.; Zeng, L.; Muller, M.; Patel,
J.; Moshkina, N.; Morohashi, K.; Zhang, W.; Gerona-Navarro, G.;
Hajjar, R. J.; Zhou, M. M. A small molecule binding to the coactivator
CREB-binding protein blocks apoptosis in cardiomyocytes. Chem. Biol.
2011, 18, 531−541.
(8) Cochran, A. G.; Conery, A. R.; Sims, R. J., 3rd. Bromodomains: a
new target class for drug development. Nat. Rev. Drug Discovery 2019,
18, 609−628.
(9) Denny, R. A.; Flick, A. C.; Coe, J.; Langille, J.; Basak, A.; Liu, S.;
Stock, I.; Sahasrabudhe, P.; Bonin, P.; Hay, D. A.; Brennan, P. E.;
Pletcher, M.; Jones, L. H.; Chekler, E. L. P. Structure-based design of
highly selective inhibitors of the CREB binding protein Bromodomain.
J. Med. Chem. 2017, 60, 5349−5363.
(10) Hay, D. A.; Fedorov, O.; Martin, S.; Singleton, D. C.; Tallant, C.;
Wells, C.; Picaud, S.; Philpott, M.; Monteiro, O. P.; Rogers, C. M.;
Conway, S. J.; Rooney, T. P.; Tumber, A.; Yapp, C.; Filippakopoulos,
(21) Chekler, E. L.; Pellegrino, J. A.; Lanz, T. A.; Denny, R. A.; Flick,
A. C.; Coe, J.; Langille, J.; Basak, A.; Liu, S.; Stock, I. A.; Sahasrabudhe,
P.; Bonin, P. D.; Lee, K.; Pletcher, M. T.; Jones, L. H. Transcriptional
profiling of a selective cREB Binding protein bromodomain inhibitor
highlights therapeutic opportunities. Chem. Biol. 2015, 22, 1588−1596.
(22) Popp, T. A.; Tallant, C.; Rogers, C.; Fedorov, O.; Brennan, P. E.;
Muller, S.; Knapp, S.; Bracher, F. Development of selective CBP/P300
̈
benzoxazepine bromodomain inhibitors. J. Med. Chem. 2016, 59,
8889−8912.
̂
(23) Taylor, A. M.; Coté, A.; Hewitt, M. C.; Pastor, R.; Leblanc, Y.;
Nasveschuk, C. G.; Romero, F. A.; Crawford, T. D.; Cantone, N.;
Jayaram, H.; Setser, J.; Murray, J.; Beresini, M. H.; de Leon Boenig, G.;
Chen, Z.; Conery, A. R.; Cummings, R. T.; Dakin, L. A.; Flynn, E. M.;
Huang, O. W.; Kaufman, S.; Keller, P. J.; Kiefer, J. R.; Lai, T.; Li, Y.;
Liao, J.; Liu, W.; Lu, H.; Pardo, E.; Tsui, V.; Wang, J.; Wang, Y.; Xu, Z.;
Yan, F.; Yu, D.; Zawadzke, L.; Zhu, X.; Zhu, X.; Sims, R. J., 3rd;
Cochran, A. G.; Bellon, S.; Audia, J. E.; Magnuson, S.; Albrecht, B. K.
Fragment-based discovery of a selective and cell-active benzodiazepi-
none CBP/EP300 bromodomain Inhibitor (CPI-637). ACS Med.
Chem. Lett. 2016, 7, 531−536.
(24) Crawford, T. D.; Romero, F. A.; Lai, K. W.; Tsui, V.; Taylor, A.
M.; de Leon Boenig, G.; Noland, C. L.; Murray, J.; Ly, J.; Choo, E. F.;
Hunsaker, T. L.; Chan, E. W.; Merchant, M.; Kharbanda, S.; Gascoigne,
K. E.; Kaufman, S.; Beresini, M. H.; Liao, J.; Liu, W.; Chen, K. X.; Chen,
P.; Bunnage, M. E.; Muller, S.; Knapp, S.; Schofield, C. J.; Brennan, P. E.
̈
Discovery and optimization of small-molecule ligands for the CBP/
p300 bromodomains. J. Am. Chem. Soc. 2014, 136, 9308−9319.
(11) Dancy, B. M.; Cole, P. A. Protein lysine acetylation by p300/
CBP. Chem Rev. 2015, 115, 2419−2452.
̂
Z.; Conery, A. R.; Coté, A.; Jayaram, H.; Jiang, Y.; Kiefer, J. R.;
Kleinheinz, T.; Li, Y.; Maher, J.; Pardo, E.; Poy, F.; Spillane, K. L.;
Wang, F.; Wang, J.; Wei, X.; Xu, Z.; Xu, Z.; Yen, I.; Zawadzke, L.; Zhu,
X.; Bellon, S.; Cummings, R.; Cochran, A. G.; Albrecht, B. K.;
Magnuson, S. Discovery of a potent and selective in vivo probe (GNE-
272) for the bromodomains of CBP/EP300. J. Med. Chem. 2016, 59,
10549−10563.
(25) Romero, F. A.; Murray, J.; Lai, K. W.; Tsui, V.; Albrecht, B. K.;
An, L.; Beresini, M. H.; de Leon Boenig, G.; Bronner, S. M.; Chan, E.
W.; Chen, K. X.; Chen, Z.; Choo, E. F.; Clagg, K.; Clark, K.; Crawford,
T. D.; Cyr, P.; de Almeida Nagata, D.; Gascoigne, K. E.; Grogan, J. L.;
Hatzivassiliou, G.; Huang, W.; Hunsaker, T. L.; Kaufman, S.; Koenig, S.
G.; Li, R.; Li, Y.; Liang, X.; Liao, J.; Liu, W.; Ly, J.; Maher, J.; Masui, C.;
Merchant, M.; Ran, Y.; Taylor, A. M.; Wai, J.; Wang, F.; Wei, X.; Yu, D.;
Zhu, B. Y.; Zhu, X.; Magnuson, S. GNE-781, a highly advanced potent
and selective bromodomain inhibitor of cyclic adenosine mono-
phosphate response element binding protein, binding protein (CBP). J.
Med. Chem. 2017, 60, 9162−9183.
(26) McKeown, M. R.; Shaw, D. L.; Fu, H.; Liu, S.; Xu, X.; Marineau, J.
J.; Huang, Y.; Zhang, X.; Buckley, D. L.; Kadam, A.; Zhang, Z.;
Blacklow, S. C.; Qi, J.; Zhang, W.; Bradner, J. E. Biased multicomponent
reactions to develop novel bromodomain inhibitors. J. Med. Chem.
2014, 57, 9019−9127.
(27) Groebke, K.; Weber, L.; Mehlin, F. Synthesis of imidazo[1,2-a]
annulated pyridines, pyrazines and pyrimidines by a novel three-
component condensation. Synlett 1998, 1998, 661−663.
(28) Blackburn, C.; Guan, B.; Fleming, P.; Shiosaki, K.; Tsai, S.
Parallel synthesis of 3-aminoimidazo[1,2-a]pyridines and pyrazines by a
new three-component condensation. Tetrahedron Lett. 1998, 39,
3635−3638.
(12) Teufel, D. P.; Freund, S. M.; Bycroft, M.; Fersht, A. R. Four
domains of p300 each bind tightly to a sequence spanning both
transactivation subdomains of p53. Proc. Natl. Acad. Sci. U.S.A. 2007,
104, 7009−7014.
(13) Plotnikov, A. N.; Yang, S.; Zhou, T. J.; Rusinova, E.; Frasca, A.;
Zhou, M. M. Structural insights into acetylated-histone H4 recognition
by the bromodomain-PHD finger module of human transcriptional
coactivator CBP. Structure 2014, 22, 353−360.
(14) Mujtaba, S.; He, Y.; Zeng, L.; Yan, S.; Plotnikova, O.;
Sachchidanand; Sanchez, R.; Zeleznik-Le, N. J.; Ronai, Z.; Zhou, M.
M. Structural mechanism of the bromodomain of the coactivator CBP
in p53 transcriptional activation. Mol. Cell 2004, 13, 251−263.
(15) Wimalasena, V. K.; Wang, T.; Sigua, L. H.; Durbin, A. D.; Qi, J.
Using chemical epigenetics to target cancer. Mol. Cell 2020, 78, 1086−
1095.
(16) Ghosh, S.; Taylor, A.; Chin, M.; Huang, H. R.; Conery, A. R.;
Mertz, J. A.; Salmeron, A.; Dakle, P. J.; Mele, D.; Cote, A.; Jayaram, H.;
Setser, J. W.; Poy, F.; Hatzivassiliou, G.; DeAlmeida-Nagata, D.; Sandy,
P.; Hatton, C.; Romero, F. A.; Chiang, E.; Reimer, T.; Crawford, T.;
Pardo, E.; Watson, V. G.; Tsui, V.; Cochran, A. G.; Zawadzke, L.;
Harmange, J. C.; Audia, J. E.; Bryant, B. M.; Cummings, R. T.;
Magnuson, S. R.; Grogan, J. L.; Bellon, S. F.; Albrecht, B. K.; Sims, R. J.,
3rd; Lora, J. M. Regulatory T cell modulation by CBP/EP300
bromodomain inhibition. J. Biol. Chem. 2016, 291, 13014−13027.
(17) Olzscha, H.; Fedorov, O.; Kessler, B. M.; Knapp, S.; La Thangue,
N. B. CBP/p300 bromodomains regulate amyloid-like protein
aggregation upon aberrant lysine acetylation. Cell Chem. Biol. 2017,
24, 9−23.
(18) Giotopoulos, G.; Chan, W. I.; Horton, S. J.; Ruau, D.; Gallipoli,
P.; Fowler, A.; Crawley, C.; Papaemmanuil, E.; Campbell, P. J.;
Göttgens, B.; Van Deursen, J. M.; Cole, P. A.; Huntly, B. J. The
epigenetic regulators CBP and p300 facilitate leukemogenesis and
represent therapeutic targets in acute myeloid leukemia. Oncogene
2016, 35, 279−89.
(29) Bienaymé, H.; Bouzid, K. A new heterocyclic multicomponent
reaction for the combinatorial synthesis of fused 3-aminoimidazoles.
Angew. Chem., Int. Ed. 1998, 37, 2234−2237.
(30) Suzuki, A. Cross-coupling reactions of organoboranes: an easy
way to construct C-C bonds (Nobel Lecture). Angew. Chem., Int. Ed.
2011, 50, 6722−6737.
5800
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801

Journal of Medicinal Chemistry
pubs.acs.org/jmc
Article
(31) Roberts, J. M.; Bradner, J. E. A bead-based proximity assay for
BRD4 ligand discovery. Curr. Protoc. Chem. Biol. 2015, 7, 263−278.
(32) Seal, J.; Lamotte, Y.; Donche, F.; Bouillot, A.; Mirguet, O.;
Gellibert, F.; Nicodeme, E.; Krysa, G.; Kirilovsky, J.; Beinke, S.;
McCleary, S.; Rioja, I.; Bamborough, P.; Chung, C.-W.; Gordon, L.;
Lewis, T.; Walker, A. L.; Cutler, L.; Lugo, D.; Wilson, D. M.;
Witherington, J.; Lee, K.; Prinjha, R. K. Identification of a novel series of
BET family bromodomain inhibitors: binding mode and profile of I-
BET151 (GSK1210151A). Bioorg. Med. Chem. Lett. 2012, 22, 2968−
2972.
(33) Chaidos, A.; Caputo, V.; Gouvedenou, K.; Liu, B.; Marigo, I.;
Chaudhry, M. S.; Rotolo, A.; Tough, D. F.; Smithers, N. N.; Bassil, A.
K.; Chapman, T. D.; Harker, N. R.; Barbash, O.; Tummino, P.; Al-
Mahdi, N.; Haynes, A. C.; Cutler, L.; Le, B.; Rahemtulla, A.; Roberts, I.;
Kleijnen, M.; Witherington, J. J.; Parr, N. J.; Prinjha, R. K.; Karadimitris,
A. Potent antimyeloma activity of the novel bromodomain inhibitors I-
BET151 and I-BET762. Blood 2014, 123, 697−705.
(34) Filippakopoulos, P.; Picaud, S.; Mangos, M.; Keates, T.; Lambert,
̈
J.-P.; Barsyte-Lovejoy, D.; Felletar, I.; Volkmer, R.; Muller, S.; Pawson,
T.; Gingras, A.-C.; Arrowsmith; Cheryl, H.; Knapp, S. Histone
recognition and large-scale structural analysis of the human
bromodomain family. Cell 2012, 149, 214−231.
(35) He, Z. X.; Wei, B. F.; Zhang, X.; Gong, Y. P.; Ma, L. Y.; Zhao, W.
Current development of CBP/p300 inhibitors in the last decade. Eur. J.
Med. Chem. 2020, 209, No. 112861.
(36) Conery, A. R.; Centore, R. C.; Neiss, A.; Keller, P. J.; Joshi, S.;
Spillane, K. L.; Sandy, P.; Hatton, C.; Pardo, E.; Zawadzke, L.; Bommi-
Reddy, A.; Gascoigne, K. E.; Bryant, B. M.; Mertz, J. A.; Sims, R. J.
Bromodomain inhibition of the transcriptional coactivators CBP/
EP300 as a therapeutic strategy to target the IRF4 network in multiple
myeloma. eLife 2016, 5, No. e10483.
(37) Galdeano, C.; Ciulli, A. Selectivity on-target of bromodomain
chemical probes by structure-guided medicinal chemistry and chemical
biology. Future Med. Chem. 2016, 8, 1655−1680.
(38) Lu, Y.; Zhang, W. Microwave-assisted synthesis of a 3-
aminoimidazo[1,2-a]-pyridine/pyrazine library by fluorous multi-
component reactions and subsequent cross-coupling reactions. QSAR
Comb. Sci. 2004, 23, 827−835.
(39) Gilson, M. K.; Liu, T.; Baitaluk, M.; Nicola, G.; Hwang, L.;
Chong, J. BindingDB in 2015: A public database for medicinal
chemistry, computational chemistry and systems pharmacology. Nucleic
Acids Res. 2016, 44, D1045−1053.
(40) Kabsch, W. Integration, scaling, space-group assignment and
post-refinement. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2010, 66,
133−144.
(41) Afonine, P. V.; Grosse-Kunstleve, R. W.; Chen, V. B.; Headd, J. J.;
Moriarty, N. W.; Richardson, J. S.; Richardson, D. C.; Urzhumtsev, A.;
Zwart, P. H.; Adams, P. D. phenix.model_vs_data: a high-level tool for
the calculation of crystallographic model and data statistics. J. Appl.
Crystallogr. 2010, 43, 669−676.
(42) Emsley, P.; Lohkamp, B.; Scott, W. G.; Cowtan, K. Features and
development of Coot. Acta Crystallogr., Sect. D: Biol. Crystallogr. 2010,
66, 486−501.
5801
https://doi.org/10.1021/acs.jmedchem.0c02232
J. Med. Chem. 2021, 64, 5787−5801