Design and synthesis of O-GlcNAcase inhibitors via 'click chemistry' and biological evaluations

Article abstract of DOI:10.1016/j.carres.2011.03.026

Protein O-GlcNAcylation has been shown to play an important role in a number of biological processes, including regulation of the cell cycle, DNA transcription and translation, signal transduction, and protein degradation. O-GlcNAcase (OGA) is responsible for the removal of O-linked β-N-acetylglucosamine (O-GlcNAc) from serine or threonine residues, and thus plays a key role in O-GlcNAc metabolism. Potent OGA inhibitors are useful tools for studying the cellular processes of O-GlcNAc, and may be developed as drugs for the treatment neurodegenerative diseases. In this study, Cu(I)-catalyzed 'Click' cycloaddition reactions between glycosyl azides and alkynes were exploited to generate inhibitory candidates of OGA. Enzymatic kinetic screening revealed that compound 7 was a potent competitive inhibitor of human O-GlcNAcase (K_i = 185.6 μM). Molecular docking simulations of compound 7 into CpOGA (Clostridium perfringens OGA) suggested that strong π-π stacking interaction between the compound and W490 considerably contributed to improving the inhibitory activity. Crown Copyright

Full text of DOI:10.1016/j.carres.2011.03.026

Carbohydrate Research 346 (2011) 1083–1092
Contents lists available at ScienceDirect
Carbohydrate Research
journal homepage: www.elsevier.com/locate/carres
Design and synthesis of O-GlcNAcase inhibitors via ‘click chemistry’ and
biological evaluations
Tiehai Li a, Lina Guo a, Yan Zhang a, Jiajia Wang a, Zhonghua Li a, Lin Lin a, Zhenxing Zhang a, Lei Li a,
a,
a,b,c,
Jianping Lin a, Wei Zhao a, , Jing Li , Peng George Wang
⇑
⇑
⇑
a College of Pharmacy, Nankai University, Tianjin 300071, PR China
b State Key Laboratory of Elemento-organic Chemistry, Nankai University, Tianjin 300071, PR China
c Departments of Biochemistry and Chemistry, The Ohio State University, Columbus, OH 43210, USA
a r t i c l e i n f o
a b s t r a c t
Article history:
Protein O-GlcNAcylation has been shown to play an important role in a number of biological processes,
including regulation of the cell cycle, DNA transcription and translation, signal transduction, and protein
degradation. O-GlcNAcase (OGA) is responsible for the removal of O-linked b-N-acetylglucosamine (O-
GlcNAc) from serine or threonine residues, and thus plays a key role in O-GlcNAc metabolism. Potent
OGA inhibitors are useful tools for studying the cellular processes of O-GlcNAc, and may be developed
as drugs for the treatment neurodegenerative diseases. In this study, Cu(I)-catalyzed ‘Click’ cycloaddition
reactions between glycosyl azides and alkynes were exploited to generate inhibitory candidates of OGA.
Enzymatic kinetic screening revealed that compound 7 was a potent competitive inhibitor of human O-
Received 15 December 2010
Received in revised form 3 March 2011
Accepted 15 March 2011
Available online 21 March 2011
Keywords:
O-GlcNAcase
Inhibitor
GlcNAcase (Ki = 185.6
fringens OGA) suggested that strong
erably contributed to improving the inhibitory activity.
Crown Copyright Ó 2011 Published by Elsevier Ltd. All rights reserved.
lM). Molecular docking simulations of compound 7 into CpOGA (Clostridium per-
‘Click chemistry’
p–p
stacking interaction between the compound and W490 consid-
1. Introduction
brain, tau is hyperphosphorylated and underglycosylated at same
Ser/Thr site as Thr231 and Ser396.12
The covalent attachment of
a
single N-acetylglucosamine
The hydrolytic cleavage of O-GlcNAc from O-GlcNAcylated pro-
teins is catalyzed by O-GlcNAcase (OGA). OGA contains two dis-
crete domains: an N-terminal glycoside hydrolase domain and a
C-terminal domain with histone acetyltransferase activity
(Fig. 1).13 According to primary sequence similarity, the N-terminal
domain is classified into the glycoside hydrolase family 84 (http://
www.cazy.org/),14 OGA uses a catalytic mechanism involving sub-
strate-assisted catalysis that relies on the involvement of the 2-
acetamido group of the substrate to form a transient oxazoline
intermediate (Fig. 2).15–17 Asp174 and Asp175 have been identified
as two key residues of human OGA involved in the de-GlcNAcyla-
tion.16,18 In the first step, Asp174 directs and polarizes the 2-acet-
amido group to act as a nucleophile and form the oxazoline
intermediate. Meanwhile, Asp175 acts as a general acid to facilitate
departure of the aglycone leaving group. The following step is
nearly the microscopic reverse of the first step. Asp174 facilitates
departure of the 2-acetamido group, while Asp175 acts as a general
base, promoting the attack of one molecule of water to yield the b-
hemiacetal product.16 Since O-GlcNAcylation is directly regulated
by OGA, modulation of O-GlcNAc levels with small molecule inhib-
itors of OGA is a useful strategy to probe the role of this O-GlcNA-
cylation in a range of cellular processes. PUGNAc (Fig. 3) a
nanomolar inhibitor of OGA (Ki = 46 nM), was recently reported
by Vocadlo and co-workers.15 However, PUGNAc lacked selectivity
moiety onto serine or threonine residues of proteins via a b-O-gly-
cosidic linkage is termed the O-GlcNAc modification (O-GlcNAcyla-
tion). O-GlcNAcylation was discovered 26 years ago by Torres and
Hart,1 and it is one of the most common post-translational modifi-
cations related to cellular regulation and signal transduction.1–3 So
far, more than 1000 proteins involved in cellular processes (trans-
porting, transcription, cell shaping, cell signaling and apoptosis4–6
)
have been identified to be O-GlcNAcylated. These proteins include
nuclear pore proteins, cytoskeletal proteins, transcription factors,
oncogenic proteins, tumor suppressor proteins and so on. It has
been demonstrated that O-GlcNAcylation plays a significant role
in many fundamental cellular processes, and its dysregulation con-
tributes to the etiology of cardiovascular diseases, type-2 diabetes,
cancer, and neurological disorders.7–10 Especially, O-GlcNAcylation
is closely related to Alzheimer’s disease (AD). Many AD-associated
proteins are modified by O-GlcNAc and phosphorylation, including
tau, neurofilaments, and beta-amyloid precursor protein (APP).11
Hyperphosphorylated tau accumulates into insoluble paired heli-
cal filaments, which is a major characteristic of AD. In the diseased
⇑
Corresponding authors. Tel./fax: +86 22 23507760 (W.Z.).
E-mail addresses: wzhao@nankai.edu.cn (W. Zhao), Jinglink@nankai.edu.cn (J.
Li), pwang@nankai.edu.cn (P.G. Wang).
0008-6215/$ - see front matter Crown Copyright Ó 2011 Published by Elsevier Ltd. All rights reserved.
doi:10.1016/j.carres.2011.03.026

1084
T. Li et al. / Carbohydrate Research 346 (2011) 1083–1092
Figure 1. Sketch map of OGA.
Figure 2. The proposed catalytic mechanism of OGA uses substrate-assisted catalysis involving a two-step double-displacement mechanism via forming a transient oxazoline
intermediate.
cess to an enormous variety of five-membered heterocycles.25
The Cu(I)-catalyzed [3+2] azide–alkyne cycloaddition reaction to
generate triazole is the most useful member of this family. It pro-
vides an expedient method to connect azides and alkynes in high
yields under mild conditions.26,27 Moreover, the triazole moiety
usually has favorable physicochemical properties, which are capa-
ble of interacting with the biological targets through hydrogen
bonding, dipole–dipole, and
p-stacking interactions. This reaction
has become a powerful tool in generating combinatorial li-
braries,28,29 and increasing the application of bioconjugation, dis-
covery of the lead compound and optimization of the lead
compound.30,31 For example, recently, a click-based library of pro-
tein tyrosine phosphatase (PTP) inhibitor candidates was prepared
via copper(I)-assisted ‘click chemistry’, in which a compound with
an IC50 value of 4.7 l
M against PTP1B was screened out.32 Rossi
and Basu prepared 1-glycosyl-4-phenyl triazoles via this reaction,
some of which can inhibit the activity of certain glycosidases.33
Poulsen and co-workers generated a novel class of carbonic anhy-
drase inhibitors that were glycoconjugate benzene sulfonamides
prepared by ‘click-tailing’.34 Lee identified a potent and highly
Figure 3. Some previously reported inhibitors of O-GlcNAcase.
selective inhibitor of human a-1,3-fucosyltransferase by screening
and did not cross the blood brain barrier.15,19 GlcNAcstatin (Fig. 3)
has been found to be an extremely potent inhibitor of a bacterial
homolog of OGA from Clostridium perfringens (Ki = 4.6 pM).20 Sub-
sequently, Dorfmueller found that GlcNAcstatin showed a Ki value
of 4.4 nM toward human OGA, and it also displayed 125-fold selec-
tivity for human OGA over b-hexosaminidase A and b-hexosamin-
idase B (Hex A and B, Ki = 550 nM). In addition, GlcNAcstatin was
shown to be a cell-permeant compound that modulated O-GlcNA-
cylation levels within the cells by inhibiting human OGA.21 NAG-
thiazoline (Fig. 3), which has an obvious geometric resemblance
to the oxazoline intermediate, has been found to be a potent inhib-
itor of OGA (Ki = 70 nM) by virtue of its geometric mimicry of the
transition state.15,22 Unfortunately, NAG-thiazoline lacked selectiv-
ity and therefore perturbed multiple cellular processes. In order to
improve the selectivity of NAG-thiazoline, NButGT (Fig. 3), which
was generated by varying the bulk of the thiazoline substituent,
displayed 800-fold selectivity for human OGA (Ki = 600 nM) over
Hex A and B.15,23 Although this inhibitor had reasonable potency
and good selectivity, it had limited chemical stability in the solu-
tion over extended periods of a few days to weeks.15,23 Thiamet-
G (Fig. 3) has been identified as a potent inhibitor of OGA
(Ki = 21 nM), which displayed exquisite 37,000-fold selectivity for
OGA over Hex A and B.23 Moreover, Thiamet-G was highly stable
and effective in cell culture with an EC50 of 30 nM for increasing
O-GlcNAc levels in PC12 rat pheochromocytoma cells.23
a GDP-triazole library synthesized via ‘click chemistry’.35 Herein,
we described a rapid parallel synthesis of a small triazole-linked
carbohydrate library via ‘click chemistry’. Subsequent screening
and evaluation revealed a potent inhibitor of human OGA.
2. Results and discussion
2.1. Synthesis of inhibitory candidates via ‘click chemistry’
Glycosyl azide (Scheme 1, compound 3c) was a key intermedi-
ate for the synthesis of glycosyl triazoles through the Cu(I)-cata-
lyzed [3+2] azide–alkyne cycloaddition reaction. 2-Acetamido-2-
deoxy-D-glucose (1c) was chosen as the starting material, which
was reacted with acetyl chloride to afford 3,4,6-tri-O-acetyl-2-
acetamido-2-deoxy-a-D-glucopyranosyl chloride (2c) in a yield
of 72%.36 Subsequently, the desired glycosyl azide (3c) was pre-
pared by nucleophilic substitution of compound 2c with sodium
Huisgen 1,3-dipolar cycloadditions24 are exergonic fusion pro-
cesses that connect two unsaturated reactants and afford fast ac-
Scheme 1. Reagents and conditions: (a) AcCl (12 equiv), rt, 24 h, 72%; (b)
Bu4NHSO4 (1 equiv), NaHCO3 (satd), CH2Cl2, NaN3 (3 equiv), rt, 1 h, 59%.

T. Li et al. / Carbohydrate Research 346 (2011) 1083–1092
1085
azide in the presence of tetrabutylammonium hydrogen sulfate,
CH2Cl2 and a saturated aqueous solution of NaHCO3.37
Compounds 8–16 connected with different heterocyclic
groups were prepared as outlined in Scheme 3. The synthesis be-
gan with commercially available mono-iodo substituted hetero-
cyclic compounds (8a, 9a, 12a, 13a, and 14a) or mono-bromo
substituted heterocyclic compounds (10a, 11a, 15a, and 16a).
TMS-protected alkynes (8b–16b) were obtained in high yields
(83–89%) via a Sonogashira coupling reaction using trimethylsi-
lylacetylene, Pd(PPh3)4, CuI and Et3N.41 Compounds 8b–16b were
treated with tetrabutylammonium fluoride to give deprotected
alkynes,42 to which the glycosyl azide (3c) was connected via
Cu(I)-catalyzed cycloaddition reaction (20 mol % of CuSO4 and
40 mol % of sodium ascorbate, 1:1 tert-butyl alcohol–water).
The resulting triazoles (8c–16c)38 were finally deprotected to
generate triazole-linked carbohydrates with various heterocyclic
groups (8–16).
Triazole-linked carbohydrates were then synthesized as outlined
in Scheme 2. When using catalytic conditions described by Sharpless
and co-workers,30 the triazole-forming reaction was found to be
sluggish, even at elevated temperatures. However, when using
20 mol % of CuSO4 and 40 mol % of sodium ascorbate in the presence
of 1:1 tert-butyl alcohol–water, the triazole formation proceeded
smoothly under very mild conditions in high yields (72–92%).38
Reaction of glycosyl azide (3c) and alkyne (1a–7a, 1a–5a were com-
mercially available, 6a and 7a were synthesized in our group39,40) in
the ratio of 1:1.2 was complete with approximate 8 h of vigorous
stirring (detected by TLC) to form triazoles (1b–7b). Finally, com-
pounds 1b–7b were deprotected employing sodium methoxide in
dry methanol to give triazole-linked carbohydrates (1–7).
Scheme 2. Reagents and conditions: (a) RCCH (1.2 equiv), 1:1 H2O/t-BuOH, sodium ascorbate (0.4 equiv), CuSO4 (0.2 equiv), rt, overnight, 72–92%; (b) CH3OH, CH3ONa,
30 min, Dowex-50 (H+), 90–96%.
Scheme 3. Reagents and conditions: (a) Pd(PPh3)4 (0.05 equiv), CuI (0.1 equiv), trimethylsilylacetylene (3 equiv), Et3N, DMF, rt, 18 h, 83–89%; (b) (i) TBFA (1.2 equiv), THF, rt,
30 min; (ii) 1:1 H2O/t-BuOH, glycosyl azide (1 equiv), sodium ascorbate (0.4 equiv), CuSO4 (0.2 equiv), rt, overnight, 72–92%; (c) CH3OH, CH3ONa, 30 min, Dowex-50 (H+), 92–
96%.

1086
T. Li et al. / Carbohydrate Research 346 (2011) 1083–1092
2.2. Evaluation of the inhibitory activity
Molecular docking simulations were applied to investigate the
binding mode of the most potent inhibitor (compound 7) into
the enzyme-active sites. bacterial enzyme (C. perfringens
Percent inhibition assays of human OGA toward triazoles 1–16
were performed as preliminary screenings (Table 1). The results
showed that triazole 1 bearing a completely hydrophobic pentyl
group and triazole 2 bearing completely hydrophilic hydroxy-
methyl group showed very weak inhibitory potency; triazoles 3,
5, 6, and 7 with benzene rings displayed strong inhibitory poten-
A
OGA, CpOGA) bearing the highest sequence homology with hu-
man OGA was selected for the docking study since there is no
human OGA crystal structure available.43 Figure 5(A) showed
the best docked pose obtained for compound 7 using CpOGA
structure 2J62. The sugar moiety of the inhibitor was shown to
occupy the active site of the enzyme, establishing hydrogen-
bond interactions mainly with residues D401, N396, D297, and
D298. The pyranose ring adopted a 4E envelope conformation
which was similar to the PUGNAc complex.43 D298, the catalytic
acid, formed a strong hydrogen bond with a nitrogen atom of
the triazole ring. The substituted group of the triazole ring with
cies, which suggested that
p–p stacking interaction contributing
to improving the inhibitory activity; triazoles 4, 8–16 bearing het-
erocyclic groups showed general inhibition activities, which may
result from heteroatoms of heterocyclic groups forming unfavor-
able H-bonds with certain important residues to have an effect
on p–p stacking interaction. Obviously, compound 7 was the stron-
gest inhibitor against human OGA among all of the synthesized tri-
azoles. Subsequently, a Lineweaver–Burk plot of the velocity of 4-
a big conjugated
forming a strong
p
p–p
-system stretched away from the active site,
stacking interaction with the solvent-ex-
methylumbelliferyl
2-acetamido-2-deoxy-b-D-glucopyranoside
posed W490, which made the inhibitor productively contact
with the enzyme. Figure 5(B–D) showed the best docked pose
obtained for compounds 3, 4, and 10 using CpOGA structure
2J62. D298, the catalytic acid, did not form a strong hydrogen
bond with a nitrogen atom of the triazole ring in compounds
3, 4, and 10 against CpOGA structure 2J62. Although compounds
(4MU-GlcNAc) hydrolysis by OGA in the presence of various con-
centrations of compound 7 indicated the mode of enzyme inhibi-
tion (Fig. 4). It was obvious that compound 7 acted as a potent
and competitive inhibitor of human OGA, with Ki = 185.6
addition, inhibition of hexosaminidase A was also evaluated, giving
a Ki of 232.0 M. Unfortunately, this compound did not show selec-
lM. In
l
3, 4, and 10 formed a
stacking interaction was weaker than that of compound 7
with W490 by virtue of the large conjugated -system of com-
p–p stacking interaction with W490, the
tivity for human OGA over hexosaminidase A.
p–p
p
pound 7. In addition, the binding energies of 7, 3, 4, and 10 with
CpOGA calculated by Autodock 4.2 indicated that compound 3
showed 2.55 kcal/mol higher binding energy than that of com-
pound 7, compound 10 showed 0.57 kcal/mol higher than that
of compound 3, compound 4 showed 0.38 kcal/mol higher than
that of compound 10. The computational binding energies were
consistent with the order of inhibitory activity (compound
7 > compound 3 > compound 10 > compound 4).
Table 1
Inhibition activities of 1H-1,2,3-triazole derivatives (1 mM) over OGA
Compound
Inhibitiona (%)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
0.5
3.5
57.8
12.4
55.0
37.4
81.3
50.1
57.4
37.3
42.1
48.1
46.9
44.4
44.5
39.1
3. Conclusions
In summary, the synthesis of glycosyl triazoles by a Cu(I)-cata-
lyzed ‘click’ cycloaddition reaction between glycosyl azides and al-
kynes was well-suited for rapid generation of combinatorial
libraries. Herein we have described the synthesis and screening
of compounds generated by this method. It was noteworthy that
compound 7 was identified as a potent and competitive inhibitor
a
Values were the averages of at least three experiments. Errors were in the range
of human OGA, with Ki = 185.6
ing results suggested that strong
l
M. Moreover, the molecular dock-
stacking interaction with
of 0.2–3% of the reported value.
p–p
W490 considerably contributed to improving the inhibitory activ-
ity. Compound 7 may be used as a valuable tool to investigate the
role of O-GlcNAcylation in cellular biology.
4. Experimental
4.1. Chemistry
All reagents were purchased from commercial sources and were
used without further purification. All solvents were available com-
mercially dried or were freshly dried and distilled prior to use.
Reactions were monitored by thin-layer chromatography (TLC)
using silica gel GF254 plates under detection of short-wave UV fluo-
rescence (k 254 nm) or by staining with 10% phosphomolybdic acid
in EtOH and heating. Column chromatography was conducted
using silica gel (200–300 mesh) with EtOAc and petroleum ether
(PE, 60–90 °C) or CH2Cl2 and MeOH as eluent. 1H NMR spectra were
recorded with a Bruker AV 400 spectrometer at 400 MHz, and 13C
NMR spectra were recorded with either a Bruker AV 400 spectrom-
eter at 100 MHz or a Bruker AV 300 spectrometer at 75 MHz. Sol-
vents were either CDCl3, DMSO-d6 or CD3OD, and chemical shifts
Figure 4. Inhibition Lineweaver–Burk plot of OGA toward compound 7 at concen-
trations of 0, 50, 75, and 100 lM.

T. Li et al. / Carbohydrate Research 346 (2011) 1083–1092
1087
Figure 5. The best docked pose of compounds 7, 3, 4, and 10 against CpOGA structure 2J62.
were reported in d (ppm) from an internal standard of TMS (d 0.00).
Coupling constants are reported in hertz. High-resolution electro-
spray-ionization mass spectra (HRESIMS) were obtained on a Var-
ian QFT-ESI mass spectrometer.
4.1.2.1. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pyranosyl)-4-pentyl-1,2,3-triazole (1b). A white solid (92%,
Rf 0.63, 5:1 EtOAc–PE). 1H NMR (400 MHz, DMSO-d6): d 0.86 (t, J
6.8 Hz, 3H), 1.24–1.32 (m, 4H), 1.53–1.60 (m, 5H), 1.95 (s, 3H),
2.00 (s, 3H), 2.01 (s, 3H), 2.58–2.61 (m, 2H), 4.05 (dd, J 2.0 Hz, J
12.4 Hz, 1H), 4.15 (dd, J 4.8 Hz, J 12.4 Hz, 1H), 4.22 (ddd, J 2.0 Hz,
J 4.8 Hz, J 10.0 Hz, 1H), 4.55–4.62 (m, 1H), 5.08 (t, J 10.0 Hz, 1H),
5.33 (t, J 10.0 Hz, 1H), 6.03 (d, J 10.0 Hz, 1H), 8.01 (s, 1H), 8.05 (d,
J 9.2 Hz, 1H); 13C NMR (100 MHz, DMSO-d6): d 13.78, 20.21,
20.35, 20.45, 21.80, 22.22, 24.76, 28.34, 30.52, 52.03, 61.78,
68.08, 72.42, 73.31, 84.60, 120.47, 147.03, 169.24, 169.29, 169.53,
169.97; HRESIMS: calcd for [C21H32N4O8+Na]+ m/z 491.2112,
found, m/z 491.2117.
4.1.1. 3,4,6-Tri-O-acetyl-2-acetamido-2-deoxy-b-D-
glucopyranosyl azide (3c)
3,4,6-Tri-O-acetyl-2-acetamido-2-deoxy-a-D-glucopyranosyl
chloride36 (4.0 g, 10.9 mmol) was dissolved in CH2Cl2 (40 mL), and
a solution of sodium azide (2.2 g, 32.7 mmol) in satd aq NaHCO3
(40 mL) was added. Tetrabutylammonium hydrogen sulfate
(3.7 g, 10.9 mmol) was added, and the reaction mixture was stirred
at room temperature for l h. TLC (2:1 EtOAc–PE) indicated the for-
mation of a product (Rf 0.34) with complete consumption of the
starting material (Rf 0.50). The organic layer was washed with
water (100 mL), dried over Na2SO4, filtered, and concentrated in
vacuum. The residue was purified by column chromatography
(1:1 EtOAc–PE) to yield 3c (2.4 g, 59%) as a white solid. 1H NMR
(400 MHz, CDCl3): d 1.99 (s, 3H), 2.04 (s, 3H), 2.05 (s, 3H), 2.11
(s, 3H), 3.84 (ddd, J 2.0 Hz, J 4.8 Hz, J 10.0 Hz, 1H), 3.91–3.98 (m,
1H), 4.18 (dd, J 2.0 Hz, J 12.4 Hz, 1H), 4.28 (dd, J 4.8 Hz, J 12.4 Hz,
1H), 4.83 (d, J 9.2 Hz, 1H), 5.11 (t, J 9.6 Hz, 1H), 5.30 (t, J 9.6 Hz,
1H), 6.24 (d, J 9.2 Hz, 1H); 13C NMR (100 MHz, CDCl3): d 20.53,
20.58, 20.67, 23.12, 53.95, 61.96, 68.31, 72.16, 73.79, 88.31,
169.33, 170.70, 170.74, 170.80; HRESIMS: calcd for [C14H20N4O8+-
Na]+ m/z 395.1173, found, m/z 395.1176.
4.1.2.2. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pyranosyl)-4-hydroxymethyl-1,2,3-triazole (2b).
A white
solid (72%, Rf 0.14, 5:1 EtOAc–PE). 1H NMR (400 MHz, DMSO-d6):
d 1.66 (s, 3H), 2.01 (s, 3H), 2.06 (s, 3H), 2.08 (s, 3H), 4.11 (dd, J
2.0 Hz, J 12.4 Hz, 1H), 4.20 (dd, J 5.2 Hz, J 12.4 Hz, 1H), 4.29 (ddd,
J 2.0 Hz, J 5.2 Hz, J 10.0 Hz, 1H), 4.56 (s, 2H), 4.63–4.70 (m, 1H),
5.16 (t, J 9.6 Hz, 1H), 5.41 (t, J 10.0 Hz, 1H), 6.15 (d, J 10.0 Hz,
1H), 8.15 (d, J 9.2 Hz, 1H), 8.19 (s, 1H); 13C NMR (75 MHz, DMSO-
d6): d 20.23, 20.36, 20.46, 22.31, 52.03, 54.82, 61.80, 68.03, 72.45,
73.32, 84.59, 121.38, 148.14, 169.30, 169.39, 169.56, 169.99; HRE-
SIMS: calcd for [C17H24N4O9+Na]+ m/z 451.1435, found, m/z
451.1439.
4.1.2. General procedure for the synthesis of compounds 1b–7b
4.1.2.3. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
A
mixture of the glycosyl azide (1.0 equiv) and alkyne
pyranosyl)-4-phenyl-1,2,3-triazole (3b).
A white solid (90%,
(1.2 equiv) was suspended in 1:1 tert-butyl alcohol–water. A solu-
tion of sodium ascorbate (0.4 equiv) in water and CuSO4 (0.2 equiv)
in water were successively added. The bright-yellow suspension
was stirred vigorously at room temperature until the reaction
was completed (detected by TLC). The mixture was evaporated un-
der reduced pressure, and the resultant residue was purified by
flash chromatography to yield pure material.
Rf 0.61, 5:1 EtOAc–PE). 1H NMR (400 MHz, DMSO-d6): d 1.60 (s,
3H), 1.97 (s, 3H), 2.01 (s, 3H), 2.03 (s, 3H), 4.09 (dd, J 2.0 Hz, J
12.4 Hz, 1H), 4.18 (dd, J 5.2 Hz, J 12.4 Hz, 1H), 4.29 (ddd, J 2.0 Hz,
J 5.2 Hz, J 10.0 Hz, 1H), 4.63–4.71 (m, 1H), 5.12 (t, J 10.0 Hz, 1H),
5.40 (t, J 10.0 Hz, 1H), 6.15 (d, J 10.0 Hz, 1H), 7.37 (t, J 7.2 Hz,
1H), 7.46–7.49 (m, 2H), 7.83–7.85 (m, 2H), 8.13 (d, J 9.2 Hz, 1H),
8.86 (s, 1H); 13C NMR (100 MHz, DMSO-d6): d 20.73, 20.87, 20.98,

1088
T. Li et al. / Carbohydrate Research 346 (2011) 1083–1092
22.77, 52.74, 62.21, 68.47, 72.75, 73.82, 85.36, 120.68, 125.64,
128.65, 129.46, 130.66, 146.95, 169.85, 169.96, 170.06, 170.51;
HRESIMS: calcd for [C22H26N4O8+Na]+ m/z 497.1643, found, m/z
497.1648.
4.1.3. General procedure for the synthesis of compounds 8b–
16b
A mixture of 8a–16a (1.0 equiv), CuI (0.1 equiv) and Pd(PPh3)4
(0.05 equiv) in Et3N and DMF was degassed with Ar. Trimethylsilyl-
acetylene (2.0 equiv) was then added and the solution was stirred
for 18 h at room temperature under an Ar atmosphere. TLC analysis
showed complete conversion of starting material to a major product.
The reaction mixture was then cooled to room temperature, diluted
with Et2O, washed twice with satd aq NH4Cl, dried over Na2SO4, fil-
tered, and concentrated in vacuum. The crude product was purified
by silica gel column chromatography to yield pure material.
4.1.2.4. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pyranosyl)-4-pyridyl-1,2,3-triazole (4b).
A pale-yellow so-
lid (88%, Rf 0.35, 5:1 EtOAc–PE). 1H NMR (400 MHz, DMSO-d6):
d 1.61 (s, 3H), 1.97 (s, 3H), 2.01 (s, 3H), 2.03 (s, 3H), 4.09 (dd,
J 2.0 Hz, J 12.4 Hz, 1H), 4.17 (dd, J 5.2 Hz, J 12.4 Hz, 1H), 4.27
(ddd, J 2.0 Hz, J 5.2 Hz, J 10.0 Hz, 1H), 4.71–4.78 (m, 1H), 5.17
(t, J 9.6 Hz, 1H), 5.39 (t, J 10.0 Hz, 1H), 6.18 (d, J 10.0 Hz, 1H),
7.38 (dd, J 4.8 Hz, J 6.4 Hz, 1H), 7.90–7.94 (m, 1H), 8.04 (d, J
8.0 Hz, 1H), 8.14 (d, J 9.2 Hz, 1H), 8.63 (d, J 8.0 Hz, 1H), 8.84
(s, 1H); 13C NMR (100 MHz, DMSO-d6): d 20.23, 20.37, 20.46,
22.26, 52.11, 61.83, 68.05, 72.30, 73.46, 84.97, 119.60, 122.08,
123.25, 137.26, 147.34, 149.35, 149.68, 169.33, 169.49, 169.59,
170.02; HRESIMS: calcd for [C21H25N5O8+Na]+ m/z 498.1595,
found, m/z 498.1599.
4.1.3.1. 5-((Trimethylsilyl)ethynyl)uracil (8b).
A pale-yellow
solid (86%, Rf 0.42, 10:1 CH2Cl2–MeOH). 1H NMR (400 MHz, DMSO-
d6): d 0.18 (s, 9H), 7.80 (s, 1H), 11.36 (br s, 2H); 13C NMR (100 MHz,
DMSO-d6): d 0.01, 96.56, 96.89, 98.30, 146.77, 150.40, 162.54; HRE-
SIMS: calcd for [C9H12N2O2Si+H]+ m/z 209.0741, found, m/z
209.0741.
4.1.3.2. 3-((Trimethylsilyl)ethynyl)-7-azaindole (9b).
A
4.1.2.5. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pale-yellow solid (85%, Rf 0.33, 2:1 PE–EtOAc). 1H NMR
(400 MHz, CDCl3): d 0.29 (s, 9H), 7.19 (dd, J 4.8 Hz, J 7.6 Hz, 1H),
7.62 (s, 1H), 8.09 (dd, J 1.2 Hz, J 7.6 Hz, 1H), 8.37 (dd, J 1.2 Hz, J
4.8 Hz, 1H); 13C NMR (100 MHz, CDCl3): d 0.38, 95.90, 97.20,
98.03, 116.70, 121.78, 129.10, 129.90, 143.37, 148.03; HRESIMS:
calcd for [C12H14N2Si+H]+ m/z 215.0999, found, m/z 215.1001.
pyranosyl)-4-(phenylcarbamoyl)-1,2,3-triazole
(5b).
A
pale-yellow solid (86%, Rf 0.43, 5:1 CH2Cl2–MeOH). 1H NMR
(400 MHz, DMSO-d6): d 1.61 (s, 3H), 1.96 (s, 3H), 2.01 (s, 3H),
2.02 (s, 3H), 4.09 (dd, J 2.4 Hz, J 12.4 Hz, 1H), 4.16 (dd, J 5.2 Hz, J
12.4 Hz, 1H), 4.27 (ddd, J 2.4 Hz, J 5.2 Hz, J 10.0 Hz, 1H), 4.67–
4.74 (m, 1H), 5.16 (t, J 10.0 Hz, 1H), 5.38 (t, J 10.0 Hz, 1H), 6.19
(d, J 10.0 Hz, 1H), 7.11 (t, J 7.6 Hz, 1H), 7.32–7.36 (m, 2H), 7.81–
7.83 (m, 2H), 8.11 (d, J 9.2 Hz, 1H), 8.99 (s, 1H), 10.49 (br s, 1H);
13C NMR (100 MHz, DMSO-d6): d 20.26, 20.42, 20.52, 22.28,
52.19, 61.78, 67.95, 72.13, 73.48, 85.12, 120.45, 123.88, 126.44,
128.59, 138.36, 143.08, 157.88, 169.35, 169.52, 169.58, 170.04;
HRESIMS: calcd for [C23H27N5O9+H]+ m/z 518.1882, found, m/z
518.1889.
4.1.3.3.
2-((Trimethylsilyl)ethynyl)pyrimidine
(10b).
A
pale-yellow solid (89%, Rf 0.54, 3:1 PE–EtOAc). 1H NMR
(400 MHz, CDCl3): d 0.28 (s, 9H), 7.23 (t, J 5.2 Hz, 1H), 8.71 (d, J
5.2 Hz, 2H); 13C NMR (100 MHz, CDCl3): d ꢀ0.38, 94.60, 102.36,
120.18, 152.67, 157.36; HRESIMS: calcd for [C9H12N2Si+H]+ m/z
177.0843, found, m/z 177.0843.
4.1.3.4. 2-(1H-Pyrazol-1-yl)-6-((trimethylsilyl)ethynyl)pyridine
(11b).
4.1.2.6. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pyranosyl)-4-((E)-3-(4-methoxybenzyloxyamino)-3-oxoprop-1-
A brown liquid (87%, Rf 0.38, 15:1 PE–EtOAc). 1H
NMR (400 MHz, CDCl3): d 0.30 (s, 9H), 6.45 (s, 1H), 7.35 (d, J
7.6 Hz, 1H), 7.73–7.78 (m, 2H), 7.94 (d, J 8.4 Hz, 1H), 8.62 (d, J
2.0 Hz, 1H); 13C NMR (100 MHz, CDCl3): d ꢀ0.14, 95.56, 103.32,
107.96, 112.36, 125.36, 127.65, 138.88, 141.30, 142.36, 151.52;
HRESIMS: calcd for [C13H15N3Si+H]+ m/z 242.1108, found, m/z
242.1106.
enyl)-1,2,3-triazole (6b).
A white solid (83%, Rf 0.46, EtOAc).
1H NMR (400 MHz, DMSO-d6): d 1.59 (s, 3H), 1.95 (s, 3H), 2.00 (s,
3H), 2.02 (s, 3H), 3.76 (s, 3H), 4.07 (dd, J 2.0 Hz, J 12.4 Hz, 1H),
4.16 (dd, J 5.2 Hz, J 12.4 Hz, 1H), 4.26 (ddd, J 2.0 Hz, J 5.2 Hz, J
10.0 Hz, 1H), 4.56–4.64 (m, 1H), 4.80 (s, 2H), 5.10 (t, J 10.0 Hz,
1H), 5.35 (t, J 10.0 Hz, 1H), 6.11 (d, J 9.6 Hz, 1H), 6.57 (d, J
16.0 Hz, 1H), 6.93–6.96 (m, 2H), 7.33–7.35 (m, 2H), 7.43 (d, J
16.0 Hz, 1H), 8.09 (d, J 9.2 Hz, 1H), 8.61 (s, 1H), 11.31 (br s, 1H);
13C NMR (100 MHz, DMSO-d6): d 20.25, 20.39, 20.49, 22.25,
52.13, 55.07, 61.68, 67.95, 72.22, 73.38, 76.62, 84.84, 113.70,
119.78, 123.77, 127.73, 127.79, 130.69, 142.94, 159.38, 162.29,
169.33, 169.44, 169.57, 170.01; HRESIMS: calcd for [C27H33N5O11+-
Na]+ m/z 626.2069, found, m/z 626.2060.
4.1.3.5. 4-((Trimethylsilyl)ethynyl)pyrazole (12b).
A white
solid (83%, Rf 0.16, 5:1 PE–EtOAc). 1H NMR (400 MHz, CDCl3): d
0.23 (s, 9H), 7.72 (s, 2H); 13C NMR (100 MHz, CDCl3): d 0.11,
95.70, 96.04, 103.39, 137.12; HRESIMS: calcd for [C8H12N2Si+H]+
165.0843, found, m/z 165.0842.
4.1.3.6.
uridine (13b).
30,50-Di-O-acetyl-20-deoxy-5-((trimethylsilyl)ethynyl)-
A white solid (86%, Rf 0.56, 1:2 PE–EtOAc). 1H
4.1.2.7. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pyranosyl)-4-(3-N-(1,3-dioxo-1H-benzo[de]isoquinolin-2(3H)-
NMR (400 MHz, CDCl3): d 0.21 (s, 9H), 2.11 (s, 3H), 2.16–2.23 (m,
4H), 2.52 (ddd, J 2.4 Hz, J 5.6 Hz, J 14.4 Hz, 1H), 4.28 (dd, J 2.4 Hz,
J 5.6 Hz, 1H), 4.36–4.37 (m, 2H), 5.23–5.25 (m, 1H), 6.32 (dd, J
yl)phenyl)-1,2,3-triazole (7b).
A pale-yellow solid (87%, Rf
0.16, PE–EtOAc 1:2). 1H NMR (400 MHz, CDCl3): d 1.75 (s, 3H),
1.95 (s, 3H), 2.01 (s, 3H), 2.05 (s, 3H), 4.01–4.13 (m, 2H), 4.27
(dd, J 5.2 Hz, J 12.4 Hz, 1H), 4.49–4.57 (m, 1H), 5.21 (t, J 9.6 Hz,
1H), 5.57 (t, J 9.6 Hz, 1H), 6.16 (d, J 10.0 Hz, 1H), 6.82 (d, J 9.2 Hz,
1H), 7.30 (d, J 7.6 Hz, 1H), 7.60 (t, J 7.6 Hz, 1H), 7.76–7.80 (m,
2H), 7.85–7.89 (m, 2H), 8.13 (s, 1H), 8.24–8.26 (m, 2H), 8.61–
8.63 (m, 2H); 13C NMR (100 MHz, CDCl3): d 20.56, 20.60, 20.74,
22.86, 53.68, 61.71, 68.04, 72.24, 74.73, 85.62, 119.34, 122.67,
126.13, 126.33, 127.09, 128.50, 128.80, 130.02, 131.31, 131.69,
134.45, 136.17, 147.10, 164.37, 169.40, 170.61, 170.71, 171.10;
HRESIMS: calcd for [C34H31N5O10+H]+ m/z 670.2144, found, m/z
670.2138.
6.0 Hz, J
8.0 Hz, 1H), 7.83 (s, 1H), 8.86 (s, 1H); 13C NMR
(100 MHz, CDCl3): d ꢀ0.07, 21.02, 21.07, 38.38, 63.97, 74.14,
82.71, 85.43, 95.10, 100.07, 101.10, 142.27, 149.18, 160.84,
170.18, 170.53; HRESIMS: calcd for [C18H24N2O7Si+H]+ m/z
409.1426, found, m/z 409.1428.
4.1.3.7. 2-((Trimethylsilyl)ethynyl)pyrazine (14b).
A brown
liquid (85%, Rf 0.26, 20:1 PE–EtOAc). 1H NMR (400 MHz, CDCl3): d
0.27 (s, 9H), 8.46 (d, J 2.4 Hz, 1H), 8.52 (dd, J 1.6 Hz, J 2.4 Hz, 1H),
8.66 (d, J 1.6 Hz, 1H); 13C NMR (100 MHz, CDCl3): d ꢀ0.33, 99.99,
100.72, 140.03, 143.16, 144.44, 148.01; HRESIMS: calcd for
[C9H12N2Si+H]+ m/z 177.0843, found, m/z 177.0840.

T. Li et al. / Carbohydrate Research 346 (2011) 1083–1092
1089
4.1.3.8. 3-((Trimethylsilyl)ethynyl)quinoline (15b).
A brown
4.27 (ddd, J 2.0 Hz, J 5.2 Hz, J 10.0 Hz, 1H), 4.73–4.80 (m, 1H),
5.18 (t, J 10.0 Hz, 1H), 5.38 (t, J 10.0 Hz, 1H), 6.18 (d, J 10.0 Hz,
1H), 7.48 (t, J 4.8 Hz, 1H), 8.13 (d, J 9.2 Hz, 1H), 8.91 (d, J 4.8 Hz,
2H), 9.01 (s, 1H); 13C NMR (100 MHz, DMSO-d6): d 20.27, 20.42,
20.51, 22.27, 52.02, 61.86, 67.97, 72.22, 73.41, 84.99, 120.36,
125.30, 146.55, 157.82, 158.17, 169.36, 169.46, 169.60, 170.05;
HRESIMS: calcd for [C20H24N6O8+H]+ m/z 477.1728, found, m/z
477.1720.
liquid (87%, Rf 0.33, 30:1 PE–EtOAc). 1H NMR (400 MHz, CDCl3): d
0.30 (s, 9H), 7.53–7.57 (m, 1H), 7.68–7.76 (m, 2H), 8.07 (d, J
8.4 Hz, 1H), 8.25 (d, J 1.6 Hz, 1H), 8.91 (d, J 2.0 Hz, 1H); 13C NMR
(100 MHz, CDCl3): d ꢀ0.16, 98.22, 102.00, 117.25, 127.05, 127.25,
127.57, 129.30, 130.15, 138.92, 146.76, 152.22; HRESIMS: calcd
for [C14H15NSi+H]+ m/z 226.1047, found, m/z 226.1046.
4.1.3.9. 2-((Trimethylsilyl)ethynyl)thiazole (16b).
A brown
liquid (87%, Rf 0.38, 30:1 PE–EtOAc). 1H NMR (400 MHz, CDCl3): d
0.27 (s, 9H), 7.32 (d, J 3.2 Hz, 1H), 7.79 (d, J 3.2 Hz, 1H); 13C NMR
(100 MHz, CDCl3): d ꢀ0.38, 96.54, 100.93, 120.83, 143.50, 148.68;
HRESIMS: calcd for [C8H11NSSi+H]+ m/z 182.0454, found, m/z
182.0453.
4.1.4.4. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pyranosyl)-4-(2-(1H-pyrazol-1-yl)-6-pyridyl)-1,2,3-triazole
(11c).
NMR (400 MHz, DMSO-d6): d 1.61 (s, 3H), 1.98 (s, 3H), 2.02 (s,
3H), 2.04 (s, 3H), 4.10 (dd, J 2.0 Hz, J 12.4 Hz, 1H), 4.20 (dd, J
5.2 Hz, J 12.4 Hz, 1H), 4.32 (ddd, J 2.0 Hz, J 5.2 Hz, J 10.0 Hz,
A pale-yellow solid (84%, Rf 0.46, 1:4 PE–EtOAc). 1H
4.1.4. General procedure for the synthesis of compounds 8c–16c
To a stirred solution of alkyne precursor 8b–16b (1.2 equiv) in
THF was added dropwise a 1.0 M solution of TBAF in THF
(1.44 equiv). The reaction mixture was stirred at room temperature
for about 15 min. TLC analysis showed complete conversion of
starting material to a major product (the de-silylation intermediate
was slightly more polar than the alkyne precursor). The glycosyl
azide (1.0 equiv), and 1:1 tert-butyl alcohol–water were then
added to the above solution. A solution of sodium ascorbate
(0.4 equiv) in water, followed by CuSO4 (0.2 equiv) in water, was
successively added. The bright-yellow suspension was stirred vig-
orously at room temperature overnight. TLC analysis showed com-
plete conversion of the starting material to a major product. The
mixture was evaporated under reduced pressure, and the resultant
residue was purified by flash chromatography to yield pure
material.
1H), 4.67–4.75 (m, 1H), 5.17 (t, J 10.0 Hz, 1H), 5.44 (t, J
10.0 Hz, 1H), 6.23 (d, J 9.6 Hz, 1H), 6.66 (t, J 2.0 Hz, 1H), 7.88–
7.90 (m, 2H), 7.95 (d, J 7.6 Hz, 1H), 8.10 (d, J 7.6 Hz, 1H), 8.17
(d, J 9.2 Hz, 1H), 8.87 (d, J 2.8 Hz, 1H), 9.20 (s, 1H); 13C NMR
(100 MHz, DMSO-d6): d 20.26, 20.42, 20.53, 22.31, 52.47, 61.80,
67.98, 72.17, 73.37, 84.93, 108.16, 110.86, 116.96, 123.08,
127.21, 140.73, 142.45, 146.84, 148.06, 150.57, 169.40, 169.57,
170.04; HRESIMS: calcd for [C24H27N7O8+H]+ m/z 542.1994,
found, m/z 542.1994.
4.1.4.5. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pyranosyl)-4-(4-pyrazolyl)-1,2,3-triazole (12c).
A white so-
lid (91%, Rf 0.47, 10:1 CH2Cl2–MeOH). 1H NMR (400 MHz, DMSO-
d6): d 1.60 (s, 3H), 1.96 (s, 3H), 2.01 (s, 3H), 2.02 (s, 3H), 4.07 (dd,
J 1.6 Hz, J 12.4 Hz, 1H), 4.17 (dd, J 5.2 Hz, J 12.4 Hz, 1H), 4.27
(ddd, J 1.6 Hz, J 5.2 Hz, J 10.0 Hz, 1H), 4.55–4.62 (m, 1H), 5.10 (t, J
9.6 Hz, 1H), 5.38 (t, J 10.0 Hz, 1H), 6.12 (d, J 10.0 Hz, 1H), 7.83 (s,
1H), 8.11–8.13 (m, 2H), 8.46 (s, 1H); 13C NMR (100 MHz, DMSO-
d6): d 20.27, 20.40, 20.51, 22.31, 52.25, 61.77, 68.00, 72.33, 73.32,
84.75, 111.47, 118.64, 125.75, 140.50, 169.34, 169.42, 169.57,
170.02; HRESIMS: calcd for [C19H24N6O8+H]+ m/z 465.1728, found,
m/z 465.1727.
4.1.4.1. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pyranosyl)-4-(5-uracilyl)-1,2,3-triazole (8c).
A white solid
(89%, Rf 0.31, 10:1 CH2Cl2–MeOH). 1H NMR (400 MHz, DMSO-d6):
d 1.59 (s, 3H), 1.95 (s, 3H), 2.00 (s, 3H), 2.02 (s, 3H), 4.06 (dd, J
2.0 Hz, J 12.4 Hz, 1H), 4.17 (dd, J 5.2 Hz, J 12.4 Hz, 1H), 4.23 (ddd,
J 2.0 Hz, J 5.2 Hz, J 9.6 Hz, 1H), 4.60–4.67 (m, 1H), 5.16 (t, J
9.6 Hz, 1H), 5.35 (t, J 9.6 Hz, 1H), 6.14 (d, J 10.0 Hz, 1H), 8.06 (s,
1H), 8.11 (d, J 9.2 Hz, 1H), 8.49 (s, 1H), 11.25 (br s, 1H), 11.46 (br
s, 1H); 13C NMR (100 MHz, DMSO-d6): d 20.27, 20.41, 20.50,
22.30, 51.93, 61.88, 67.97, 72.42, 73.38, 84.69, 103.33, 120.53,
138.01, 139.31, 150.52, 162.02, 169.30, 169.36, 169.61, 170.05;
HRESIMS: calcd for [C20H24N6O10+H]+ m/z 509.1627, found, m/z
509.1616.
4.1.4.6. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pyranosyl)-4-(5-(20-deoxy-30,50-di-O-acetyl-uridyl))-1,2,3-tria-
zole (13c).
A white solid (92%, Rf 0.36, 25:1 CH2Cl2–MeOH).
1H NMR (400 MHz, DMSO-d6): d 1.58 (s, 3H), 1.95 (s, 3H), 2.00 (s,
3H), 2.01 (s, 3H), 2.08 (s, 3H), 2.12 (s, 3H), 2.38–2.47 (m, 2H),
4.06 (dd, J 2.0 Hz, J 12.4 Hz, 1H), 4.15–4.31 (m, 5H), 4.61–4.69
(m, 1H), 5.17 (t, J 10.0 Hz, 1H), 5.24–5.25 (m, 1H), 5.34 (t, J
10.0 Hz, 1H), 6.15 (d, J 9.6 Hz, 1H), 6.25 (t, J 6.8 Hz, 1H), 8.09 (d, J
9.2 Hz, 1H), 8.43 (s, 1H), 8.55 (br s, 1H), 11.81 (s, 1H); 13C NMR
(100 MHz, DMSO-d6): 20.26, 20.40, 20.50, 20.53, 20.75, 22.23,
36.87, 51.95, 61.90, 63.70, 68.00, 72.41, 73.43, 74.16, 81.72,
84.82, 85.00, 105.06, 120.97, 135.55, 138.88, 149.48, 160.93,
169.33, 169.59, 170.04, 170.32; HRESIMS: calcd for
[C29H36N6O15+H]+ m/z 709.2311, found, m/z 709.2312.
4.1.4.2.
acetyl-20-deoxy-b-D-glucopyranosyl)-1,2,3-triazole (9c).
4-(3-(7-Azaindolyl))-1-(20-acetamido-30,40,60-tri-O-
A
pale-yellow solid (92%, Rf 0.13, 1:5 PE–EtOAc). 1H NMR
(400 MHz, DMSO-d6): d 1.60 (s, 3H), 1.97 (s, 3H), 2.01 (s, 3H),
2.03 (s, 3H), 4.08–4.24 (m, 2H), 4.28 (dd, J 3.2 Hz, J 9.6 Hz,
1H), 4.69–4.77 (m, 1H), 5.14 (t, J 9.6 Hz, 1H), 5.41 (t, J 9.6 Hz,
1H), 6.17 (d, J 10.0 Hz, 1H), 7.18 (dd, J 4.4 Hz, J 7.6 Hz, 1H),
7.93 (s, 1H), 8.12 (d, J 9.2 Hz, 1H), 8.30 (d, J 4.4 Hz, 1H), 8.41
4.1.4.7. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
(d,
J
7.6 Hz, 1H), 8.74 (s, 1H), 11.94 (br s, 1H); 13C NMR
pyranosyl)-4-(2-pyrazyl)-1,2,3-triazole (14c).
A white solid
(100 MHz, DMSO-d6): d 20.27, 20.42, 20.52, 22.34, 52.22, 61.79,
68.02, 72.35, 73.27, 84.77, 104.63, 116.01, 116.83, 118.29,
123.42, 128.08, 142.02, 143.27, 148.55, 169.39, 169.48, 169.58,
170.04; HRESIMS: calcd for [C23H26N6O8+H]+ m/z 515.1885,
found, m/z 515.1892.
(88%, Rf 0.32, 1:4 PE–EtOAc). 1H NMR (400 MHz, DMSO-d6): d
1.61 (s, 3H), 1.97 (s, 3H), 2.01 (s, 3H), 2.03 (s, 3H), 4.09 (dd, J
2.0 Hz, J 12.4 Hz, 1H), 4.17 (dd, J 5.2 Hz, J 12.4 Hz, 1H), 4.29 (ddd,
J 2.0 Hz, J 5.2 Hz, J 10.0 Hz, 1H), 4.73–4.80 (m, 1H), 5.18 (t, J
10.0 Hz, 1H), 5.39 (t, J 10.0 Hz, 1H), 6.21 (d, J 10.0 Hz, 1H), 8.14
(d, J 9.2 Hz, 1H), 8.65 (d, J 2.4 Hz, 1H), 8.72 (dd, J 1.6 Hz, J 2.4 Hz,
1H), 9.03 (s, 1H), 9.25 (d, J 1.2 Hz, 1H). 13C NMR (100 MHz,
DMSO-d6): d 20.26, 20.42, 20.50, 22.28, 52.05, 61.81, 67.95,
72.21, 73.41, 85.04, 123.34, 141.13, 144.13, 144.65, 144.90,
145.08, 169.36, 169.50, 169.59, 170.04; HRESIMS: calcd for
[C20H24N6O8+H]+ m/z 477.1728, found, m/z 477.1718.
4.1.4.3. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pyranosyl)-4-(2-pyrimidyl)-1,2,3-triazole (10c).
A pale-yel-
low solid (89%, Rf 0.37, 20:1 CH2Cl2–MeOH); 1H NMR (400 MHz,
DMSO-d6): d 1.60 (s, 3H), 1.97 (s, 3H), 2.01 (s, 3H), 2.03 (s, 3H),
4.09 (dd, J 2.0 Hz, J 12.4 Hz, 1H), 4.17 (dd, J 5.2 Hz, J 12.4 Hz, 1H),

1090
T. Li et al. / Carbohydrate Research 346 (2011) 1083–1092
4.1.4.8. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pyranosyl)-4-(3-quinolyl)-1,2,3-triazole (15c). A white solid
4.1.5.4. 1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-pyri-
dyl-1,2,3-triazole (4).
A pale-yellow solid (93%). 1H NMR
(86%, Rf 0.41, 20:1 CH2Cl2–MeOH). 1H NMR (400 MHz, DMSO-d6): d
1.62 (s, 3H), 1.98 (s, 3H), 2.03 (s, 3H), 2.04 (s, 3H), 4.11 (dd, J 2.0 Hz,
J 12.4 Hz, 1H), 4.21 (dd, J 5.2 Hz, J 12.4 Hz, 1H), 4.35 (ddd, J 2.0 Hz, J
5.2 Hz, J 10.0 Hz, 1H), 4.64–4.71 (m, 1H), 5.14 (t, J 10.0 Hz, 1H), 5.44
(t, J 10.0 Hz, 1H), 6.23 (d, J 10.0 Hz, 1H), 7.65–7.69 (m, 1H), 7.77–
7.82 (m, 1H), 8.06–8.10 (m, 2H), 8.17 (d, J 9.2 Hz, 1H), 8.85 (d, J
(400 MHz, CD3OD): d 1.77 (s, 3H), 3.58–3.68 (m, 2H), 3.74–3.82
(m, 2H), 3.94 (dd, J 2.0 Hz, J 12.0 Hz, 1H), 4.25 (t, J 10.0 Hz, 1H),
5.88 (d, J 9.6 Hz, 1H), 7.50 (t, J 6.0 Hz, 1H), 8.04–8.13 (m, 2H),
8.58 (s, 1H), 8.88 (s, 1H); 13C NMR (75 MHz, CD3OD): d 22.62,
54.71, 60.64, 69.73, 73.69, 79.98, 86.30, 119.89, 122.10, 123.33,
138.06, 146.25, 148.97, 169.28; HRESIMS: calcd for [C15H19N5O5+-
Na]+ m/z 372.1278, found, m/z 372.1273.
2.0 Hz, 1H), 9.16 (s, 1H), 9.37 (d,
J
2.0 Hz, 1H); 13C NMR
(100 MHz, DMSO-d6): 20.28, 20.41, 20.52, 22.30, 52.46, 61.73,
68.00, 72.19, 73.41, 85.00, 121.25, 123.47, 127.32, 127.48, 128.37,
128.81, 129.77, 131.12, 143.95, 147.16, 148.02, 169.37, 169.55,
169.58, 170.03; HRESIMS: calcd for [C25H27N5O8+H]+ m/z
526.1932, found, m/z 526.1936.
4.1.5.5. 1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-(phe-
nylcarbamoyl)-1,2,3-triazole (5).
A white solid (92%). 1H
NMR (400 MHz, CD3OD): d 1.70 (s, 3H), 3.47–3.56 (m, 2H), 3.62–
3.71 (m, 2H), 3.82 (dd, J 1.6 Hz, J 12.0 Hz, 1H), 4.15 (t, J 9.6 Hz,
1H), 5.77 (d, J 9.6 Hz, 1H), 7.05 (t, J 7.6 Hz, 1H), 7.24–7.28 (m,
2H), 7.60–7.62 (m, 2H), 8.63 (s, 1H); 13C NMR (100 MHz, CD3OD):
d 22.51, 57.03, 62.30, 71.30, 75.46, 81.39, 88.50, 121.96, 125.78,
126.72, 129.90, 139.11, 144.28, 160.31, 170.25, 173.66; HRESIMS:
calcd for [C17H21N5O6ꢀH]ꢀ m/z 390.1419, found, m/z 390.1424.
4.1.4.9. 1-(20-Acetamido-30,40,60-tri-O-acetyl-20-deoxy-b-D-gluco-
pyranosyl)-4-(2-thiazolyl)-1,2,3-triazole (16c).
A white solid
(88%, Rf 0.52, 20:1 CH2Cl2–MeOH). 1H NMR (400 MHz, DMSO-d6): d
1.61 (s, 3H), 1.97 (s, 3H), 2.01 (s, 3H), 2.03 (s, 3H), 4.09 (dd, J 2.0 Hz,
J 12.4 Hz, 1H), 4.15 (dd, J 5.2 Hz, J 12.4 Hz, 1H), 4.27 (ddd, J 2.0 Hz, J
5.2 Hz, J 10.0 Hz, 1H), 4.73–4.80 (m, 1H), 5.17 (t, J 10.0 Hz, 1H), 5.38
(t, J 10.0 Hz, 1H), 6.18 (d, J 10.0 Hz, 1H), 7.81 (d, J 3.2 Hz, 1H), 7.96
(d, J 3.2 Hz, 1H), 8.13 (d, J 9.2 Hz, 1H), 8.97 (s, 1H); 13C NMR
(100 MHz, DMSO-d6): d 20.26, 20.42, 20.50, 22.28, 52.03, 61.78,
67.92, 72.17, 73.41, 85.11, 120.29, 121.31, 142.34, 143.68, 157.91,
169.36, 169.51, 169.59, 170.03; HRESIMS: calcd for
[C19H23N5O8S+H]+ m/z 482.1340, found, m/z 482.1336.
4.1.5.6. 1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-((E)-3-
(4-methoxybenzyloxyamino)-3-oxoprop-1-enyl)-1,2,3-triazole
(6).
A white solid (94%). 1H NMR (400 MHz, CD3OD): d 1.68 (s,
3H), 3.43–3.52 (m, 2H), 3.58–3.67 (m, 2H), 3.70 (s, 3H), 3.80 (dd, J
1.2 Hz, J 12.0 Hz, 1H), 4.11 (t, J 10.0 Hz, 1H), 4.74 (s, 2H), 5.69 (d, J
10.0 Hz, 1H), 6.47 (d, J 15.6 Hz, 1H), 6.82–6.84 (m, 2H), 7.26–7.28
(m, 2H), 7.45 (d, J 15.6 Hz, 1H), 8.30 (s, 1H); 13C NMR (100 MHz,
CD3OD): d 22.50, 55.74, 56.89, 62.30, 71.33, 75.58, 78.88, 81.32,
88.29, 114.88, 120.26, 124.52, 128.90, 130.05, 132.16, 144.74,
161.65, 165.49, 173.56; HRESIMS: calcd for [C21H27N5O8+Na]+ m/
z 500.1752, found, m/z 500.1745.
4.1.5. General procedure for synthesis of compounds 1–16
Compounds 1–16 were prepared by treating the precursor 1b–
7b and 8c–16c (final concentration 0.1–0.2 M) with NaOMe in dry
MeOH or dry MeOH and CH2Cl2 (final pH 9–10). Reactions were
complete within 30 min as detected by TLC. The solution was neu-
tralized by Dowex-50 (H+), followed by filtration and evaporation
to afford compounds 1–16.
4.1.5.7. 1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-(3-N-
(1,3-dioxo-1H-benzo[de]isoquinolin-2(3H)-yl)phenyl)-1,2,3-tri-
azole (7).
A pale-yellow solid (92%). 1H NMR (400 MHz,
DMSO-d6): d 1.63 (s, 3H), 3.30 (t, J 8.8 Hz, 1H), 3.47–3.50 (m, 2H),
3.55–3.66 (m, 2H), 4.09 (t, J 10.0 Hz, 1H), 5.73 (d, J 10.0 Hz, 1H),
7.35 (d, J 7.6 Hz, 1H), 7.61 (t, J 7.6 Hz, 1H), 7.86–7.94 (m, 4H),
8.48–8.52 (m, 4H), 8.69 (s, 1H); 13C NMR (100 MHz, DMSO-d6): d
22.45, 54.70, 60.48, 69.62, 73.47, 79.72, 86.16, 120.33, 122.31,
125.00, 125.79, 127.28, 127.75, 128.72, 129.72, 130.91, 131.20,
131.38, 131.56, 134.62, 136.58, 145.55, 163.79, 169.69; HRESIMS:
calcd for [C28H25N5O7+H]+ m/z 544.1827, found, m/z 544.1824.
4.1.5.1. 1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-pen-
tyl-1,2,3-triazole (1).
A white solid (96%). 1H NMR (400 MHz,
DMSO-d6): d 0.86 (t, J 6.8 Hz, 3H), 1.21–1.33 (m, 4H), 1.52–1.57 (m,
2H), 1.61 (s, 3H), 2.56–2.60 (m, 2H), 3.25 (t, J 9.2 Hz, 1H), 3.40–3.55
(m, 3H), 3.70 (dd, J 4.8 Hz, J 10.8 Hz, 1H), 4.04 (t, J 10.0 Hz, 1H),
5.63 (d, J 9.6 Hz, 1H), 7.83 (s, 1H); 13C NMR (100 MHz, DMSO-d6): d
14.34, 22.31, 23.08, 25.28, 28.96, 31.04, 54.72, 61.08, 70.34, 74.35,
80.44, 86.31, 120.69, 147.07, 169.40; HRESIMS: calcd for
[C15H26N4O5+Na]+ m/z 365.1795, found, m/z 365.1790.
4.1.5.8.
uracilyl)-1,2,3-triazole (8).
1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-(5-
A white solid (91%). 1H NMR
4.1.5.2.
hydroxymethyl-1,2,3-triazole (2).
1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-
A white solid (92%). 1H
(400 MHz, CD3OD): d 1.68 (s, 3H), 3.46–3.53 (m, 2H), 3.60–3.69 (m,
2H), 3.82 (dd, J 2.0 Hz, J 12.4 Hz, 1H), 4.13 (t, J 10.0 Hz, 1H), 5.72 (d,
J 10.0 Hz, 1H), 8.00 (s, 1H), 8.41 (s, 1H); 13C NMR (100 MHz, CD3OD):
d 22.53, 57.02, 62.47, 71.44, 75.67, 81.37, 88.20, 105.78, 122.43,
139.19, 140.79, 152.80, 163.87, 173.54; HRESIMS: calcd for
[C14H18N6O7+H]+ m/z 383.1310, found, m/z 383.1305.
NMR (400 MHz, DMSO-d6): d 1.64 (s, 3H), 3.27 (t, J 9.2 Hz, 1H),
3.52–3.58 (m, 1H), 3.70 (dd, J 4.8 Hz, J 11.2 Hz, 1H), 4.06 (t, J
10.0 Hz, 1H), 4.89 (s, 2H), 5.22–5.29 (m, 2H), 5.69 (d, J 10.0 Hz,
1H), 7.97 (s, 1H); 13C NMR (75 MHz, DMSO-d6): d 22.70, 54.41,
54.89, 60.69, 69.93, 74.01, 79.95, 85.87, 121.11, 147.68, 169.16;
HRESIMS: calcd for [C11H18N4O6+Na]+ m/z 325.1119, found, m/z
325.1111.
4.1.5.9. 4-(3-(7-Azaindolyl))-1-(20-acetamido-20-deoxy-b-D-glu-
copyranosyl)-1,2,3-triazole (9).
A
white solid (90%). 1H
NMR (400 MHz, CD3OD): d 1.70 (s, 3H), 3.50–3.56 (m, 2H), 3.62–
3.73 (m, 2H), 3.83 (dd, J 2.0 Hz, J 11.6 Hz, 1H), 4.26 (t, J 9.6 Hz,
1H), 5.76 (d, J 9.6 Hz, 1H), 7.13 (dd, J 4.8 Hz, J 8.0 Hz, 1H), 7.75 (s,
1H), 8.16 (d, J 4.4 Hz, 1H), 8.34 (d, J 7.6 Hz, 1H), 8.41 (s, 1H); 13C
NMR (100 MHz, CD3OD): d 22.60, 56.76, 62.29, 71.33, 75.81,
81.25, 88.30, 106.62, 117.43, 119.73, 119.82, 124.90, 130.63,
143.47, 143.64, 149.03, 173.63; HRESIMS: calcd for
[C17H20N6O5+H]+ m/z 389.1568, found, m/z 389.1570.
4.1.5.3. 1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-phe-
nyl-1,2,3-triazole (3).
A
white solid (94%). 1H NMR
(400 MHz, DMSO-d6): d 1.62 (s, 3H), 3.30 (t, J 9.2 Hz, 1H), 3.46–
3.52 (m, 2H), 3.60 (t, J 9.2 Hz, 1H), 3.73 (dd, J 4.8 Hz, J 10.4 Hz,
1H), 4.09–4.16 (m, 1H), 5.74 (d, J 10.0 Hz, 1H), 7.34 (t, J 7.2 Hz,
1H), 7.43–7.47 (m, 2H), 7.84–7.86 (m, 2H), 8.67 (s, 1H); 13C NMR
(100 MHz, DMSO-d6): d 23.15, 55.21, 61.15, 70.36, 74.20, 80.51,
86.67, 120.50, 125.63, 128.45, 129.38, 130.96, 146.56, 169.69;
HRESIMS: calcd for [C16H20N4O5+Na]+ m/z 371.1326, found, m/z
371.1318.
4.1.5.10.
pyrimidyl)-1,2,3-triazole (10).
1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-(2-
A white solid (95%). 1H NMR

T. Li et al. / Carbohydrate Research 346 (2011) 1083–1092
1091
(400 MHz, CD3OD): d 1.69 (s, 3H), 3.48–3.56 (m, 2H), 3.62–3.71 (m,
2H), 3.83 (dd, J 2.0 Hz, J 12.0 Hz, 1H), 4.19 (t, J 9.6 Hz, 1H), 5.78 (d, J
9.6 Hz, 1H), 7.30 (t, J 4.8 Hz, 1H), 8.73–8.75 (m, 3H); 13C NMR
(100 MHz, CD3OD): d 22.50, 57.00, 62.36, 71.35, 75.61, 81.42,
88.42, 121.52, 125.99, 147.87, 158.95, 159.79, 173.60; HRESIMS:
calcd for [C14H18N6O5+H]+ m/z 351.1411, found, m/z 351.1409.
62.36, 71.32, 75.53, 81.43, 88.49, 120.87, 122.12, 143.83, 144.29,
160.37, 173.63; HRESIMS: calcd for [C13H17N5O5S+Na]+ m/z
378.0843, found, m/z 378.0837.
4.2. Enzymatic assays
4.2.1. Cloning, expression, and purification of OGA44,45
4.1.5.11.
(1H-pyrazol-1-yl)-6-pyridyl)-1,2,3-triazole (11).
1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-(2-
A white so-
The OGA gene was amplified using human OGA cDNA (Gen-
Bank accession number AB014579, provided by Dr. Hart) as tem-
plate. The following primers were used for the amplification:
50CGCGCGGCCGCGTGCAGAAGGAGAGTCAA30 (NcoI underlined)
and 50GCGCTCGAGTTAATCTTCACT GTCAGTCATC30 (XhoI under-
lined). The PCR product was digested with NcoI and XhoI, and
then inserted into vector pET28a digested with corresponding
restriction sites. The resultant construction was checked by
DNA sequencing and transformed into Escherichia coli BL21
(DE3) for protein expression. E. coli BL21 (DE3) carrying the plas-
mid was grown at 37 °C in LB medium containing kanamycin.
When the optical density (OD600) of the culture reached 0.6–
0.7, isopropyl 1-thio-b-D-galactopyranoside (IPTG) was added
to a final concentration of 0.015 mM, and the culture was al-
lowed to grow for another 10 h at 13 °C, 110 rpm. Cells were
harvested and resuspended with lysis buffer (50 mM phosphate
buffer, pH 8.0, 300 mM NaCl, 0.5 mg/mL lysozyme, 1 mM PMSF)
to 5% of their original volume. After brief sonication, the lysate
was centrifuged (12,000g, 45 min, 4 °C) and passed through a
0.45 mm filter. The filtrate was then loaded onto Ni2+–NTA (nick-
el–nitrilotriacetic acid) column (Qiagen), and the resin was
washed with washing buffer (phosphate buffer containing
30 mM imidazole). Target proteins were eluted with Elute buffer
(phosphate buffer containing 100 mM imidazole). The proteins
were concentrated and desalted against 50 mM Tris–HCl buffer
(pH 7.0) containing 1 mM dithiothreitol (DTT), 10% glycerol
and 150 mM NaCl. The protein concentration was determined
by the Bradford method,46 and the purity was determined by
SDS–PAGE.47
lid (93%). 1H NMR (400 MHz, DMSO-d6): d 1.63 (s, 3H), 3.34 (t, J
8.8 Hz, 1H), 3.53–3.79 (m, 3H), 4.10–4.22 (m, 2H), 5.80 (d, J
9.6 Hz, 1H), 6.62 (s, 1H), 7.85–7.87 (m, 2H), 7.92–7.98 (m, 2H),
8.07 (t, J 7.6 Hz, 1H), 8.88 (s, 1H), 8.96 (s, 1H); 13C NMR
(100 MHz, DMSO-d6): d 22.66, 55.01, 60.77, 69.94, 73.64, 80.10,
86.31, 108.13, 110.69, 116.95, 122.81, 127.44, 140.59, 142.37,
146.39, 148.38, 150.60, 169.24; HRESIMS: calcd for
[C18H21N7O5+H]+ m/z 416.1677, found, m/z 416.1677.
4.1.5.12.
pyrazolyl)-1,2,3-triazole (12).
1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-(4-
A white solid (96%). 1H NMR
(400 MHz, CD3OD): d 1.69 (s, 3H), 3.45–3.53 (m, 2H), 3.60–3.70
(m, 2H), 3.82 (dd, J 2.0 Hz, J 12.0 Hz, 1H), 4.16 (t, J 10.0 Hz, 1H),
5.71 (d, J 9.6 Hz, 1H), 7.88 (s, 2H), 8.23 (s, 1H); 13C NMR
(100 MHz, CD3OD): d 22.55, 56.89, 62.38, 71.41, 75.72, 81.31,
88.29, 120.17, 132.71, 141.94, 173.60; HRESIMS: calcd for
[C13H18N6O5+H]+ m/z 339.1411, found, m/z 339.1407.
4.1.5.13.
(20-deoxyuridyl))-1,2,3-triazole (13).
1H NMR (400 MHz, CD3OD): d 1.68 (s, 3H), 2.14–2.27 (m, 2H),
3.46–3.52 (m, 2H), 3.60–3.68 (m, 3H), 3.74 (dd, J 3.2 Hz,
1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-(5-
A white solid (90%).
J
12.0 Hz, 1H), 3.80–3.87 (m, 2H), 4.12 (t, J 10.0 Hz, 1H), 4.32–4.35
(m, 1H), 5.72 (d, J 9.6 Hz, 1H), 6.25 (t, J 6.8 Hz, 1H), 8.42 (s, 1H),
8.53 (s, 1H); 13C NMR (100 MHz, CD3OD): d 22.54, 41.55, 57.00,
62.46, 62.96, 71.43, 72.34, 75.69, 81.38, 86.91, 88.24, 89.12,
106.57, 122.72, 138.05, 140.78, 151.54, 162.94, 173.51; HRESIMS:
calcd for [C19H26N6O10+H]+ m/z 499.1783, found, m/z 499.1780.
4.2.2. Activity assays of OGA
4.1.5.14.
pyrazyl)-1,2,3-triazole (14).
1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-(2-
A white solid (95%). 1H NMR
The reaction system (25 lL, pH 6.5) contained 50 mM NaH2PO4,
100 mM NaCl, 0.1% BSA, fluorescent substrate 4-methylumbellife-
ryl 2-acetamido-2-deoxy-b-D-glucopyranoside (concentrations
used: 0.15625, 0.3125, 0.625, 1.25, 2.5, 5.0 mM), compound 7 (con-
(400 MHz, DMSO-d6): d 1.63 (s, 3H), 3.48–3.63 (m, 3H), 3.73 (dd,
J 4.8 Hz, J 10.4 Hz, 1H), 4.10–4.17 (m, 1H), 4.66 (t, J 9.6 Hz, 1H),
5.79 (d, J 9.6 Hz, 1H), 7.93 (d, J 8.8 Hz, 1H), 8.63 (d, J 2.0 Hz, 1H),
8.70 (s, 1H), 8.83 (s, 1H), 9.25 (s, 1H); 13C NMR (100 MHz, DMSO-
d6): 22.63, 54.70, 60.65, 69.71, 73.67, 80.03, 86.35, 123.05,
141.11, 143.96, 144.44, 144.60, 145.31, 169.26; HRESIMS: calcd
for [C14H18N6O5+H]+ m/z 351.1411, found, m/z 351.1414.
centrations used: 0, 50, 75, 100
Reactions were incubated at 37 °C for 4 min and terminated by
the addition of 150 L of quenching buffer (200 mM glycine–
NaOH, pH 10.8). The assay solution (150 L) was then transferred
lM) and 5 lL of purified OGA.
l
l
into a 96-well plate and the fluorescence was measured on a
microplate reader (excitation, 368 nm; emission, 450 nm). Inhibi-
tion constants (Ki) were determined as previously reported.48
Hexosaminidases A from human placenta (Sigma, A56152) assay
and percent inhibition assays of OGA toward compounds 1–16
were measured as described above.
4.1.5.15.
quinolyl)-1,2,3-triazole (15).
1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-(3-
A white solid (94%). 1H NMR
(400 MHz, CD3OD): d 1.71 (s, 3H), 3.50–3.57 (m, 2H), 3.63–3.74
(m, 2H), 3.74 (dd, J 1.2 Hz, J 12.4 Hz, 1H), 4.22 (t, J 10.0 Hz,
1H), 5.78 (d, J 10.0 Hz, 1H), 7.56 (t, J 7.2 Hz, 1H), 7.69 (t, J
7.2 Hz, 1H), 7.90–7.96 (m, 2H), 8.66 (d, J 1.6 Hz, 1H), 8.75 (s,
1H), 9.23 (d, J 1.6 Hz, 1H); 13C NMR (100 MHz, CD3OD): d
22.55, 57.05, 62.36, 71.38, 75.63, 81.35, 88.51, 122.13, 125.41,
128.89, 128.97, 129.53, 129.55, 131.52, 134.03, 145.61, 148.06,
148.96, 173.64; HRESIMS: calcd for [C19H21N5O5+H]+ m/z
400.1615, found, m/z 400.1622.
4.3. Docking
Computational docking of compounds 3, 4, 7, and 10 against
CpOGA structure 2J62 was performed by Autodock 4.2.
Acknowledgments
4.1.5.16.
thiazolyl)-1,2,3-triazole (16).
(400 MHz, CD3OD): d 1.70 (s, 3H), 3.47–3.53 (m, 2H), 3.61–3.71
(m, 2H), 3.84 (dd, J 1.6 Hz, J 12.4 Hz, 1H), 4.15 (t, J 10.0 Hz, 1H),
5.77 (d, J 10.0 Hz, 1H), 7.54 (d, J 2.4 Hz, 1H), 7.78 (d, J 2.4 Hz,
1H), 8.56 (s, 1H); 13C NMR (100 MHz, CD3OD): d 22.48, 57.09,
1-(20-Acetamido-20-deoxy-b-D-glucopyranosyl)-4-(2-
A white solid (96%). 1H NMR
We are grateful to Dr. G. W. Hart, of the School of Medicine,
Johns Hopkins University for kindly providing the human O-
GlcNAcase cDNA. This work is supported by the National Basic
Research Program of China (973 Program: No. 2007CB914403)
and Natural Science Foundation of China (Nos. 20802037,
31000371).

1092
T. Li et al. / Carbohydrate Research 346 (2011) 1083–1092
23. Yuzwa, S. A.; Macauley, M. S.; Heinonen, J. E.; Shan, X.; Dennis, R. J.; He, Y.;
Supplementary data
Whitworth, G. E.; Stubbs, K. A.; McEachern, E. J.; Davies, G. J.; Vocadlo, D. J. Nat.
Chem. Biol. 2008, 4, 483–490.
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.carres.2011.03.026.
24. Gothelf, K. V.; Jorgensen, K. A. Chem. Rev. 1998, 98, 863–909.
25. Banert, K. Chem. Ber. 1989, 122, 911–918.
26. Rostovtsev, V. V.; Green, L. G.; Fokin, V. V.; Sharpless, K. B. Angew. Chem., Int. Ed.
2002, 41, 2596–2599.
27. Chan, T. R.; Hilgraf, R.; Sharpless, K. B.; Fokin, V. V. Org. Lett. 2004, 6, 2853–
2855.
References
28. Wang, Q.; Chan, T. R.; Hilgraf, R.; Fokin, V. V.; Sharpless, K. B.; Finn, M. G. J. Am.
Chem. Soc. 2003, 125, 3192–3193.
1. Torres, C. R.; Hart, G. W. J. Biol. Chem. 1984, 259, 3308–3317.
2. Henrissat, B.; Bairoch, A. Biochem. J. 1996, 316, 695–696.
3. Wells, L.; Vosseller, K.; Hart, G. W. Science 2001, 291, 2376–2378.
4. Hart, G. W.; Housley, M. P.; Slawson, C. Nature 2007, 446, 1017–1022.
5. Steven, P. J.; Bittersweet, A. Circ. Res. 2005, 96, 925–926.
6. Zhang, F.; Su, K.; Yang, X.; Bowe, D. B.; Paterson, A. J.; Kudlow, J. E. Cell 2003,
115, 715–725.
29. Spees, A. E.; Adam, G. C.; Cravatt, B. F. J. Am. Chem. Soc. 2003, 125, 4686–4687.
30. Lewis, W. G.; Geen, L. G.; Grynszpan, F.; Radic, Z.; Carlier, P. R.; Taylor, P.; Finn,
M. G.; Sharpless, K. B. Angew. Chem., Int. Ed. 2002, 41, 1053–1057.
31. Manetsch, R.; Krasinski, A.; Radic, Z.; Raushel, J.; Taylor, P.; Sharpless, K. B.;
Kolb, H. C. J. Am. Chem. Soc. 2004, 126, 12809–12818.
32. Srinivasan, R.; Uttamchandani, M.; Yao, S. Q. Org. Lett. 2006, 8, 713–716.
33. Rossi, L. L.; Basu, A. Bioorg. Med. Chem. Lett. 2005, 15, 3596–3599.
34. Wilkinson, B. L.; Bornaghi, L. F.; Houston, T. A.; Innocenti, A.; Supuran, C. T.;
Poulsen, S. A. J. Med. Chem. 2006, 49, 6539–6548.
35. Lee, L. V.; Mitchell, M. L.; Huang, S. J.; Fokin, V. V.; Sharpless, K. B.; Wong, C.-H.
J. Am. Chem. Soc. 2003, 125, 9588–9589.
36. Osborn, H. In Best Synthetic Methods: Carbohydrates, Davis, B. G.; Chambers, D.;
Cumpstey, I.; France, R.; Gamblin, D. Eds.; Academic Press: London, 2003; pp
79–80.
37. Tropper, F. D.; Andersson, F. O.; Braun, S.; Roy, R. Synthesis 1992, 618–620.
38. Wilkinson, B. L.; Bornaghi, L. F.; Poulsen, S. A.; Houston, T. A. Tetrahedron 2006,
8115–8125.
7. McClain, D. A.; Lubas, W. A.; Cooksey, R. C.; Hazel, M.; Parker, G. J.; Love, D. C.;
Hanover, J. A. Proc. Natl. Acad. Sci. U.S.A. 2002, 99, 10695–10699.
8. Shaw, P.; Freeman, J.; Bovey, R.; Iggo, R. Oncogene 1996, 12, 921–930.
9. Arnold, C. S.; Johnson, G. V.; Cole, R. N.; Dong, D. L.; Lee, M.; Hart, G. W. J. Biol.
Chem. 1996, 271, 28741–28744.
10. Lefebvre, T.; Dehennaut, V.; Guinez, C.; Ovlivier, S.; Drougat, L.; Mir, A. M.;
Mortuaire, M.; Vercoutter-Edouart, A. S.; Michalski, J. C. Biochim. Biophys. Acta
2010, 1800, 67–89.
11. Butkinaree, C.; Park, K.; Hart, G. W. Biochim. Biophys. Acta 2010, 1800, 96–106.
12. Fischer, P. M. Nat. Chem. Biol. 2008, 4, 448–449.
13. Toleman, C.; Paterson, A. J.; Whisenhunt, T. R.; Kudlow, J. E. J. Biol. Chem. 2004,
279, 53665–53673.
39. Shen, J.; Woodward, R.; Kedenburg, J. P.; Liu, X. W.; Chen, M.; Fang, L. Y.; Sun, D.
X.; Wang, P. G. J. Med. Chem. 2008, 51, 7417–7427.
40. Wang, B.; Wang, S.; Zhang, Z. X.; Yan, P.; Tian, Y.; Wang, P.; Zhang, Q.; Bai, G.
Chinese J. Struct. Chem. 2009, 28, 1008–1012.
41. Kumar, V.; Dority, J. A.; Bacon, E. R.; Singh, B.; Lesher, G. Y. J. Org. Chem. 1992,
57, 6995–6998.
42. Hartley, C. S.; Elliott, E. L.; Moore, J. S. J. Am. Chem. Soc. 2007, 129, 4512–4513.
43. Rao, F. V.; Dorfmueller, H. C.; Villa, F.; Allwood, M.; Eggleston, L. M.; van Aalten,
D. M. F. EMBO J. 2006, 25, 1569–1578.
14. Rigden, D. J.; Jedrzejas, M. J.; de Mello, L. V. FEBS Lett. 2003, 544, 103–111.
15. Macauley, M. S.; Whitworth, A. W.; Debowski, D. C.; Vocadlo, D. J. J. Biol. Chem.
2005, 280, 25313–25322.
16. Cetinbas, N.; Macauley, M. S.; Stubbs, K. A.; Drapala, R.; Vocadlo, D. J.
Biochemistry 2006, 45, 3835–3844.
17. Macauley, M. S.; Stubbs, K. A.; Vocadlo, D. J. J. Am. Chem. Soc. 2005, 127, 17202–
17203.
18. Toleman, C.; Paterson, A. J.; Kudlow, J. E. Biochim. Biophys. Acta 2006, 1760,
829–839.
44. Gao, Y.; Wells, L.; Comer, F. I.; Parker, G. J.; Hart, G. W. J. Biol. Chem. 2001, 276,
9838–9845.
19. Zou, L.; Yang, S.; Hu, S.; Chaudry, I. H.; Marchase, R. B.; Chatham, J. C. Shock
2007, 27, 402–408.
45. Kim, E. J.; Kang, D. O.; Love, D. C.; Hanover, J. A. Carbohydr. Res. 2006, 341, 971–
982.
46. Bradford, M. M. Anal. Biochem. 1976, 72, 248–254.
47. Laemmli, U. K. Nature 1970, 227, 680–685.
20. Dorfmueller, H. C.; Borodkin, V. S.; Schimpl, M.; Shepherd, S. M.; Shpiro, N. A.;
van Aalten, D. M. F. J. Am. Chem. Soc. 2006, 128, 16484–16485.
21. Dorfmueller, H. C.; Borodkin, V. S.; Schimpl, M.; van Aalten, D. M. F. Biochem. J.
2009, 420, 221–227.
22. Whitworth, G. E.; Macauley, M. S.; Stubbs, K. A.; Dennis, R. J.; Taylor, E. J.;
Davies, G. J.; Greig, I. R.; Vocadlo, D. J. J. Am. Chem. Soc. 2007, 129, 635–644.
48. Lineweaver, H.; Burk, D. J. Am. Chem. Soc. 1934, 56, 658–666.