Design, synthesis, and properties of boat-shaped glucopyranosyl nucleic acid

Article abstract of DOI:10.1021/ol2025229

A boat-shaped glucopyranosyl nucleic acid (BsNA) was synthesized to investigate the possibility that the lean of a nucleobase is a factor affecting duplex-forming ability of oligonucleotides. From the crystal structure of a BsNA nucleoside and the thermal stability of duplex oligonucleotides, it was found that not only the lean of the base but also the rotation angle of the glycosidic bond axis were important factors in a stable duplex formation.

Full text of DOI:10.1021/ol2025229

ORGANIC
LETTERS
2011
Vol. 13, No. 22
6050–6053
Design, Synthesis, and Properties of
Boat-Shaped Glucopyranosyl Nucleic Acid
Kazuto Mori, Tetsuya Kodama,* and Satoshi Obika*
Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita,
Osaka 565-0871, Japan
kodama@phs.osaka-u.ac.jp; obika@phs.osaka-u.ac.jp
Received September 17, 2011
ABSTRACT
A boat-shaped glucopyranosyl nucleic acid (BsNA) was synthesized to investigate the possibility that the lean of a nucleobase is a factor affecting
duplex-forming ability of oligonucleotides. From the crystal structure ofa BsNAnucleoside andthe thermalstabilityofduplex oligonucleotides,itwas
found that not only the lean of the base but also the rotation angle of the glycosidic bond axis were important factors in a stable duplex formation.
Much effort to develop nucleic acid therapeutics has
been made to date.1 Natural oligonucleotides (ONs) are
not appropriate for therapeutic applications because they
do not have enough target specificity, resistance toward
nucleases, or cell membrane permeability. To improve
their properties, nucleic acids have been chemically mod-
ified, and several clinical trials are currently being con-
ductedwith these artificial nucleic acids.1 Inaddition to use
in therapy, chemically modified ONs are also used in many
other areas, such as nanotechnology,2 diagnostics,3 and
drug target validation and gene function determination.4
For these reasons, chemically modifiedONs haveattracted
increasing attention.
We and other groups have developed numerous 20,40-
bridged nucleic acid (20,40-BNA)5/locked nucleic acid
(LNA)6 analogues7,8 whose sugar moieties are fixed in the
North-type (C30-endo) conformation, similar to a nucleo-
tide in an A-type RNA duplex, by a bridge between the
C20- and C40-positions. Because of this structural pre-
organization,9 these analogues have high duplex-forming
ability for complementary RNA. We have attempted to
create additional artificial nucleic acids that form stable
duplexes with complementary strands. However, there
have been few BNA analogues8b,c,e,11 that have affinities
for RNA as high as the original 20,40-BNA/LNA, which
remains the most promising BNA derivative even now.
20,40-BNACOC, which has the sugar conformation closest
(1) (a) Chen, X.; Dudgeon, N.; Shen, L.; Wang, J. H. Drug Discovery
Today 2005, 10, 587. (b) Juliano, R.; Bauman, J.; Kang, H.; Ming, X.
Mol. Pharmaceutics 2009, 6, 686. (c) Yamamoto, T.; Nakatani, M.;
Narukawa, K.; Obika, S. Future Med. Chem. 2011, 3, 339. (d) Shukla, S.;
Sumaria, C. S.; Pradeepkumar, P. I. ChemMedChem 2010, 5, 328.
(2) (a) Bandy, T. J.; Brewer, A.; Burns, J. R.; Marth, G.; Nguyen, T.;
Stulz, E. Chem. Soc. Rev. 2011, 40, 138. (b) Endo, M.; Sugiyama, H.
ChemBioChem 2009, 10, 2420.
(3) (a) Singh, R. P.; Oh, B. K.; Choi, J. W. Bioelectrochemistry 2010,
79, 153. (b) Cerqueira, L.; Azevedo, N. F.; Almeida, C.; Jardim, T.;
Keevil, C. W.; Vieira, M. J. Int. J. Mol. Sci. 2008, 9, 1944. (c) MacAskill,
A.; Crawford, D.; Graham, D.; Faulds, K. Anal. Chem. 2009, 81, 8134.
(4) Ravichandran, L. V.; Dean, N. M.; Marcusson, E. G. Oligonu-
cleotides 2004, 14, 49.
(7) For the BNA or LNA analogues reported before 2010, see the
following review. Obika, S.; Rahman, S. M. A.; Fujisaka, A.; Kawada,
Y.; Baba, T.; Imanishi, T. Heterocycles 2010, 81, 1347.
(8) For the BNA or LNA analogues not included in ref 7, see the
following references. (a) Zhou, C.; Liu, Y.; Andaloussi, M.; Badgujar,
N.; Plashkevych, O.; Chattopadhyaya, J. J. Org. Chem. 2009, 74, 118. (b)
Prakash, T. P.; Siwkowski, A.; Allerson, C. R.; Migawa, M. T.; Lee, S.;
Gaus, H. J.; Black, C.; Seth, P. P.; Swayze, E. E.; Bhat, B. J. Med. Chem.
2010, 53, 1636. (c) Seth, P. P.; Vasquez, G.; Allerson, C. A.; Berdeja, A.;
Gaus, H.; Kinberger, G. A.; Prakash, T. P.; Migawa, M. T.; Bhat, B.;
Swayze, E. E. J. Org. Chem. 2010, 75, 1569. (d) Nishida, M.; Baba, T.;
Kodama, T.; Yahara, A.; Imanishi, T.; Obika, S. Chem. Commun. 2010,
46, 5283. (e) Seth, P. P.; Allerson, C. R.; Berdeja, A.; Siwkowski, A.;
Pallan, P. S.; Gaus, H.; Prakash, T. P.; Watt, A. T.; Egli, M.; Swayze,
E. E. J. Am. Chem. Soc. 2010, 132, 14942. (f) Mori, K.; Kodama, T.;
Baba, T.; Obika, S. Org. Biomol. Chem. 2011, 9, 5272.
(5) Obika, S.; Nanbu, D.; Hari, Y.; Morio, K.; In, Y.; Ishida, T.;
Imanishi, T. Tetrahedron Lett. 1997, 38, 8735.
(6) Singh, S. K.; Nielsen, P.; Koshkin, A. A.; Wengel, J. Chem.
Commun. 1998, 455.
(9) Kool, E. T. Chem. Rev. 1997, 97, 1473.
r
10.1021/ol2025229
Published on Web 10/17/2011
2011 American Chemical Society

Scheme 1. Synthesis of Nucleoside 10
Figure 1. Relevance between the leans of nucleobases of BNA
analogues, their binding affinities for ssRNA, and the molecular
model of BsNA.
to a typical A-type RNA duplex in the BNA analogues
developed by us, forms a stable duplex with complemen-
tary RNA, but its affinity is not as high as that of LNA.10
Thus, there is a need to develop a new type of artificial
nucleic acid based on a brand new concept. We investi-
gated all aspects of the structural properties of BNAs to
determine the factors that affect the duplex-forming ability
of ONs.
more than that of LNA owing to this unusual skeleton.13
We report here the synthesis of BsNA and the thermal
stability of the ONs including BsNA.
BsNA was synthesized from known glucopyranoside 114
as shown in Scheme 1. First, ozonolysis of glucopyranoside
1 followed by sodium borohydride reduction yielded alco-
hol 2. Then, the tosylation of alcohol 2 was carried out with
p-toluenesulfonyl chloride in pyridine, and the resulting
When internucleotidic phosphodiester bonds are kept
immobile, the nucleobases of BNA analogues lean in the
direction of the arrow in Figure 1 with decreasing numbers
of atoms forming the bridge. In BNA analogues, the
binding affinity for complementary RNA tends to become
higher with decreasing size of the bridge and is the highest
when the bridge is composed of 5 or 6 atoms. We suspected
the lean of the nucleobases could be a factor impacting the
duplex-forming ability and wondered what the binding
affinity would be if the nucleobase leaned at still larger
angles than that of LNA. We newly designed a boat-shaped
glucopyranosyl nucleic acid (BsNA12), which had a pyra-
nose ring as the basic skeleton. The nucleobase will lean
compound 3 was coupled with a silylated thymine by
€
15
Vorbruggen’s method to give compound 4. Next, 4 was
subjected to hydrogenolysis conditions using palladium
hydroxide and the resultant alcohol was treated with phenyl
chlorothionoformate in the presence of N,N-dimethyl-4-
aminopyridine to yield compound 5. Subsequently, 5 was
deoxygenated smoothly using tris(trimethylsilyl)silane and
azobisisobutyronitrile,16 and the obtained compound 6
was deacetylated to give triol 7. The 40- and 60-hydroxy
groups of triol 7 were protected as a isopropylidene ketal,
and the resulting compound 8 was subjected to sodium
hydride under moderate heating conditions to form the
bridge between the C20- and C50-positions. Finally, removal
of the isopropylidene group with aqueous acetic acid
furnished desired nucleoside 10.
(10) (a) Hari, Y.; Obika, S.; Ohnishi, R.; Eguchi, K.; Osaki, T.;
Ohishi, H.; Imanishi, T. Bioorg. Med. Chem. 2006, 14, 1029. (b)
Mitsuoka, Y.; Kodama, T.; Ohnishi, R.; Hari, Y.; Imanishi, T.; Obika,
S. Nucleic Acids Res. 2009, 37, 1225.
Tritylation of 10 at the 60-hydroxy group with 4,
40-dimethoxytrityl chloride and phosphitylation at the
(11) Rahman, S. M. A.; Seki, S.; Obika, S.; Yoshikawa, H.; Miyashita,
K.; Imanishi, T. J. Am. Chem. Soc. 2008, 130, 4886.
(12) BsNA was also independently synthesized by the ISIS Pharma-
ceuticals group and was reported very recently. Migawa, M. T.; Seth,
P. P.; Swayze, E. E.; Ross, B. S.; Song, Q.; Han, M. PCT Int. Appl. 2011,
WO 2011/017521 A2.
ꢀ
(14) Bleriot, Y.; Vadivel, S. K.; Herrera, A. J.; Greig, I. R.; Kirby,
A. J.; Sinay, P. Tetrahedron 2004, 60, 6813.
(15) Vorbruggen, H.; Bennua, B. Chem. Ber. 1981, 114, 1279.
(16) Barton, D. H. R.; McCombie, S. W. J. Chem. Soc., Perkin Trans.
€
(13) Zhou, C.; Chattopadhyaya, J. ARKIVOC 2009, iii, 171.
1 1975, 1574.
Org. Lett., Vol. 13, No. 22, 2011
6051

Table 1. Yields and MALDI-TOF-MS Data for the
Oligonucleotides
Scheme 2. Synthesis of Phosphoramidite Building Blocks
yield calcd
found
oligonucleotidea
(%)b [M-H]ꢀ [M-H]ꢀ
50-d(GCGTTTTTTGCT)-30 (14)
46
55
29
34
14
6
3675.4 3676.2
3759.5 3755.6
3759.5 3756.7
3885.6 3883.9
4539.0 4536.9
4539.0 4539.0
50-d(GCGTTTTTTGCT)-30 (15)
50-d(GCGTTTTTTGCT)-30 (16)
50-d(GCGTTTTTTGCT)-30 (17)
50-d(TTTTTmCTTTmCTmCTmCT)-30 (18)
50-d(TTTTTmCTTTmCTmCTmCT)-30 (19)
a Underlined bold characters indicate the modified residues. Super-
script m shows that the following C is a 5-methylcytidine derivative.
b The isolation yields for ON 14ꢀ19 were calculated from the UV
absorbance at 260 nm.
The sequences were the same as those in our previous
studies, and cytidines of ONs 18 and 19 were replaced by
5-methylcytidines for the stable triplex formation.7 Each
coupling reaction of modified monomers was accom-
plished using 5-[3,5-bis(trifluoromethyl)phenyl]-1H-tetra-
zole as an activator over 6 min. Coupling yields were
checked by trityl monitoring and were estimated to be
over 95%. Synthesized ONs were cleaved from the solid
supports and deprotected by treatment with concentrated
ammonium hydroxide solution. Simultaneously, the tria-
zole group of ON 19 was converted to an amino group to
give a BsNA-5-methylcytosine-modified oligonucleotide.
40-hydroxy group with 2-cyanoethyl N,N-diisopropyla-
minochlorophosphoramidite afforded the desired phos-
phoramidite building block 12 (Scheme 2). A portion of
the thymine phosphoramidite 12 was converted to the
triazolyl derivative 13, which is a convertible phosphor-
amidite, by the treatment of 1,2,4-triazole in the presence
of triethylamine and phosphoryl chloride.17
The conformation of the sugar in BsNA was determined
from the crystal structure of compound 1019 (Figure2).Com-
pared to the X-ray structure of 20,40-BNA analogues,10a,11,18
the thymine base of 10 leans more, as we designed; C50/C60ꢀ
C10ꢀN1 angles, e.g., of 20,40-BNACOC, 20,40-BNANC[NMe],
20,40-BNA/LNA, and 10 were 106°, 111°, 112°, and 125°,
respectively.
Table 2. Evaluation of Thermal Denaturation Temperatures
(Tm Values) of Duplexesa
Tm (°C)b
DNA
RNA
oligonucleotide
complement
complement
Natural
14
51
48
41
39
15
NDc
25
NDc
24
16
17
NDc
NDc
a UV melting curves for the duplexes formed by ONs and the target
strand, 50-AGCAAAAAACGC-30, were measured under the following
conditions: 10 mM sodium phosphate buffer (pH 7.2) containing 100
mM NaCl; each strand concentration = 4 μM; scan rate of 0.5 °C minꢀ1
at 260 nm. b Tm was determined by taking the first derivative of the
melting curve. The number is the average of three independent measure-
ments. c ND = not detected.
Figure 2. X-ray structures of 20,40-BNA/LNA thymidine (a)18
and 10 (b),19 and their superimposed images (c).
BsNA-phosphoramidites 12 and 13 were introduced
into ONs using an automated DNA synthesizer (Table 1).
6052
Org. Lett., Vol. 13, No. 22, 2011

Table 3. Evaluation of Thermal Denaturation Temperatures
(Tm Values) of Triplexesa
oligonucleotide
Tm (°C)b
Natural
18
37
29
26
19
a UV melting curves for the triplexes formed by ONs and the target
strand, 50-d(GCTAAAAAGAAAGAGAGATCG)-30/30-d(CGATTTTTC-
TT-TCTCTCTAGC)-50, were measured under the following conditions:
7 mM sodium cacodylate buffer (pH 7.0) containing 140 mM KCl and
10 mM MgCl2; each strand concentration = 1.5 μM; scan rate of 0.5 °C
minꢀ1 at 260 nm. The italic portions indicate the target site for triplex
formation. b Tm was determined by taking the first derivative of the melting
curve. The number is the average of three independent measurements.
Figure 3. Nucleobase orientations of a typical A-type RNA
duplex, BNA analogues, and 10, and their superimposed images.
Hydrogen atoms are omitted in the superimposed images.
However, other factors can be attributed to the destabi-
lization of the duplex and triplex. As shown in Figure 3, the
nucleobase orientation of 10 (magenta) differs from those
of a typical A-type RNA duplex or other BNA analogues
(black), and moreover, the rotation of the C10ꢀN1 bond
axis in 10 may be restricted. Therefore, in the hybridiza-
tion, the nucleobase orientation of the target strand per-
haps needs to be altered to form hydrogen bonds, which is
an unfavorable process. In addition, the axial H30 has the
potential to inhibit π-stacking between neighboring bases.
Investigation of these possibilities is currently underway in
our laboratory.
We evaluated the affinity of the synthesized ONs with
complementary single-stranded RNA (ssRNA) and DNA
(ssDNA) and double-stranded DNA (dsDNA) through
UV melting experiments. The UV melting profiles and
thermal denaturation temperatures (Tm values) are sum-
marized in Tables 2 and 3. BsNAformedunstable duplexes
with ssRNA and ssDNA and a triplex with dsDNA. When
a larger number of BsNA monomers were introduced into
ONs, a smaller hyperchromicity was observed. This is
perhaps explained by steric repulsion or destabilization
of the hydrogen bonds between the base pairs due to a too
large lean of the BsNA nucleobase. This indicates that the
lean of the nucleobase may be an important factor in the
duplex-forming ability.
Acknowledgment. Thiswork was supportedby a Grant-
in-Aid for Challenging Exploratory Research (22651076)
from JSPS, for Young Scientists (B) (20790010) and for
Scientific Research on Innovative Area (22136006) from
MEXT, and the Program for Promotion of Fundamental
Studies in Health Sciences of NIBIO.
(17) (a) Scerr, M.; Klebba, C.; Hanner, A.; Ganser, A.; Engels, J. W.
Bioorg. Med. Chem. Lett. 1997, 7, 1791. (b) Sung, W. L. J. Chem. Soc.,
Chem. Commun. 1981, 1089.
(18) Morita, K.; Takagi, M.; Hasegawa, C.; Kaneko, M.; Tsutsumi,
S.; Sone, J.; Ishikawa, T.; Imanishi, T.; Koizumi, M. Bioorg. Med. Chem.
2003, 11, 2211.
(19) Crystallographic data for 10 can be found in the Supporting
Information. Deposition no. CCDC 840597.
Supporting Information Available. Experimental de-
tails and characterization data for new compounds. This
material is available free of charge via the Internet at
http://pubs.acs.org.
(20) RNA structure was obtained using Spartan ’06, Wavefunction,
Inc., Irvine, CA.
Org. Lett., Vol. 13, No. 22, 2011
6053