Discovery of gemfibrozil analogues that activate PPARα and enhance the expression of gene CPT1A involved in fatty acids catabolism

Article abstract of DOI:10.1016/j.ejmech.2011.08.022

A new series of gemfibrozil analogues conjugated with α-asarone, trans-stilbene, chalcone, and their bioisosteric modifications were synthesized and evaluated to develop PPARα agonists. In this attempt, we have removed the methyls on the phenyl ring of gemfibrozil and introduced the above scaffolds in para position synthesizing two series of derivatives, keeping the dimethylpentanoic skeleton of gemfibrozil unaltered or demethylated. Four compounds exhibited good activation of the PPARα receptor and were also screened for their activity on PPARα-regulated gene CPT1A.

Full text of DOI:10.1016/j.ejmech.2011.08.022

European Journal of Medicinal Chemistry 46 (2011) 5218e5224
Contents lists available at SciVerse ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Short communication
Discovery of gemfibrozil analogues that activate PPARa and enhance
the expression of gene CPT1A involved in fatty acids catabolism
Barbara De Filippis a, Antonella Giancristofaro b, Alessandra Ammazzalorso a, Alessandra D’Angelo a,
,
Marialuigia Fantacuzzi a, Letizia Giampietro a, Cristina Maccallini a, Michele Petruzzelli b, Rosa Amoroso a
*
a Dipartimento di Scienze del Farmaco, Università degli Studi “G. d’Annunzio”, Chieti, Italy
b Laboratorio del Metabolismo Lipidico e Tumorale, Consorzio Mario Negri Sud, Santa Maria Imbaro (CH), Italy
a r t i c l e i n f o
a b s t r a c t
Article history:
A new series of gemfibrozil analogues conjugated with
bioisosteric modifications were synthesized and evaluated to develop PPAR
have removed the methyls on the phenyl ring of gemfibrozil and introduced the above scaffolds in para
position synthesizing two series of derivatives, keeping the dimethylpentanoic skeleton of gemfibrozil
a
-asarone, trans-stilbene, chalcone, and their
agonists. In this attempt, we
Received 24 May 2011
Received in revised form
13 August 2011
Accepted 16 August 2011
Available online 23 August 2011
a
unaltered or demethylated. Four compounds exhibited good activation of the PPAR
also screened for their activity on PPAR -regulated gene CPT1A.
Ó 2011 Elsevier Masson SAS. All rights reserved.
a receptor and were
a
Keywords:
Nuclear receptors modulators
PPAR
a
Analogues of gemfibrozil
Stilbene
Fibrates
1. Introduction
hypolipidemic agents, that elicit biological effects by activating the
PPARs, acting mainly on the PPAR isoform [7,8]. As a consequence
a
Peroxisome proliferator activated receptors (PPARs) are tran-
scriptional factors belonging to the ligand-activated nuclear
of fibrates administration, marked changes are produced in the gene
expression of key enzymes involved in the synthesis of several
receptor superfamily; theyconsist of isoforms
a
(NR1C1),
g
(NR1C3),
apolipoproteins and lipoprotein metabolism. The a-asarone (Fig.1a)
and (NR1C2), encoded by separate genes [1]. The PPARs are
d
/
b
is a substance with potent hypolipidemic activity, mainly found in
the medicinal plant Guatteria gaumeri [9]. It has been found to
elevate high density lipoproteinecholesterol (HDLecholesterol)
fraction and to reduce low density lipoproteinecholesterol
(LDLecholesterol), by inhibiting cholesterol biosynthesis parallel to
the statin mechanism, with inhibitory effect on hepatic 3-hydroxy-
3-methylglutaryl-CoA reductase (HMGR) [10]. Several synthetic
essentially dietary fat sensors that maintain lipid and glucose
homeostasis through control of a network of genes involved in
metabolism [2]. PPARs bind as heterodimers with another nuclear
receptor, the retinoid X receptor, to specific response elements
termed peroxisome proliferator response elements (PPRE) and alter
the transcription rate of target genes [3]. PPAR
genes implicated in lipid oxidation, being expressed in cells with
high catabolic rates of fatty acids, such as hepatocytes [4]. PPAR
a mainly regulates
studies of a-asarone have been carried out, providing evidence that
g,
the hypocholesterolemic activity was enhanced when the methyl in
C-2 methoxy group was changed into an acetic group, miming the
pharmacophore of classical fibrates, like clofibrate, and the propenyl
side chain was unconjugated, by moving the double bond from the
original position to the vicinal carbon [11]. Stilbenes [12] and chal-
cones [13] (Fig. 1b), originally isolated from natural plant sources,
are molecules with relatively simple structure widely known for
antiinflammatory and antioxidant properties. Some their synthetic
derivatives have also shown to lower plasma lipid levels and
which was identified as an isoform highly expressed in adipose
tissue, is related to body energy storage, and is indeed a key tran-
scription factor involved in terminal differentiation of adipocytes
[5]. PPARd is expressed in many tissues, albeit at low levels in the
liver; its primary functions are the control of fatty acid catabolism
and energy homeostasis [6]. Fibrates are widely prescribed as
a significant PPAR
some gemfibrozil derivatives based on the resveratrol scaffold, the
a activation was observed [14,15]. Among them,
* Corresponding author. Tel.: þ39 0871 3554686; fax: þ39 0871 3554911.
E-mail address: ramoroso@unich.it (R. Amoroso).
0223-5234/$ e see front matter Ó 2011 Elsevier Masson SAS. All rights reserved.
doi:10.1016/j.ejmech.2011.08.022

B. De Filippis et al. / European Journal of Medicinal Chemistry 46 (2011) 5218e5224
5219
available or obtained according to literature procedure [19,20]
(Scheme 1). Ethylic or isobutylic esters 9e14, 16 and 25e31 were
obtained by SN2 reaction of nucleophiles 1e8 with proper 5-bromo-
or 5-chloroesters, in the presence of sodium in absolute ethanol at
reflux; only ester 15 was obtained under mild conditions, in the
presence of sodium in absolute ethanol at room temperature. The
branched ester containing the ureidic function was instable at room
temperature, therefore was not obtained. The 5-bromo-2,2-
dimethylpentanoic acid ethyl ester was synthesized as reported in
literature [21], while the other nucleophiles are commercial reagents.
The basic hydrolysis gave the desired acids 17e24 and 32e38.
a
OMe
O
OMe
O
OMe
OH
Y
OMe
α-Asarone
Unconjugated α-asarone
derivatives
b
O
2.2. Biology
All new compounds were evaluated for in vitro potency and
subtype selectivity in a cell-based transactivation assay in eukary-
otic cells [22]; our reporter systems utilizes firefly luciferase
reporter gene technology [23] to provide optimal assay sensitivity,
dynamic range when quantifying nuclear receptor activity and
good correlation with in vivo activity. We used two compounds as
trans-Stilbene
Chalcone
Fig. 1. (a) a-Asarone and unconjugated derivatives; (b) trans-stilbene and chalcone.
positive controls: gemfibrozil (150
ureido-based fibric acid with PPAR
m
M) and GW7647 (1
mM), an
most studied stilbene with beneficial cardiovascular effects,
appeared a good starting point for the development of novel pan-
PPAR agonists for the treatment of metabolic diseases [16].
a
agonistic activity in the
nanomolar range compared to the micromolar range for the
fibrates. The results of our investigation are summarized in Table 1.
The agonist responses were expressed as EC50, defined as the
concentration of test compound to produce 50% of maximal
reporter activity. The efficacy was measured against that of refer-
ence compound gemfibrozil, normalized to 100%.
Since fibrates are weak PPAR
profiling compounds with increased potency and selectivity for
PPAR as lipid-lowering drugs. We previously reported the phar-
a agonists, we were interested in
a
macological evaluation of a series of compounds related to clofibric
acid [17], the active metabolite of clofibrate, and gemfibrozil [18],
All compounds showed a significant activation of the receptor,
except for 18, 22, 24, and 33, that were found inactive. Combination
of gemfibrozil with chalcone scaffold exhibited detrimental effects,
which are evident from the activity of both derivatives 20 and 35
(EC50 109.3 and 61.2 mM, respectively). All other tested compounds
exhibited better values of EC50 than the classical fibrate gemfibrozil.
The analogues containing the dimethylpentanoic chain of gemfi-
with different PPAR
a agonistic activity. The novel structural
features of described compounds coupled with their interesting
in vitro biological profile prompted us to embark on further
investigation. In this study, we wish to report the combination of
gemfibrozil with
isosteric modifications, to develop new PPAR
the hypolipidemic effect via PPAR pathway.
a
-asarone, stilbene, chalcone, and other bio-
a
agonists and verify
a
brozil were found to be more potent PPAR
fibrozil, except 35. The highest agonistic activity was seen with the
trans-stilbene derivative 34 (EC50 ¼ 1.0 M), showing that the wide
electron delocalization could be an important factor to determine
agonistic PPAR activity; moreover, based on docking studies for
a activators than gem-
In this attempt, we have removed the methyls on phenyl ring
and introduced the above scaffolds in para-position; we synthe-
sized two series of derivatives, branched or linear, keeping the
dimethylpentanoic skeleton of gemfibrozil unaltered or demethy-
lated (Fig. 2). The in vitro transactivation assay was used to test the
m
a
similar molecules [14,16], we hypothesize that our compounds fit
very well into the receptor Y-shaped pocket, establishing hydro-
phobic interactions in comparison with gemfibrozil. Compounds
PPAR
a
activation of new compounds, and for a preliminary evalu-
; compounds with best EC50 were
ation of selectivity over PPAR
also selected for the in vitro evaluation of CPT1A gene activation by
real-time quantitative PCR analysis.
g
containing the unconjugated
phenoxy (37), and the diazocompound 38, showed EC50 values
ranging between 6.6 and 43.3 M. When the methyls in to the
a-asarone (32), benzophenone (36),
m
a
2. Results and discussion
carboxylic group of gemfibrozil were deleted, generating linear
derivatives, it resulted in a weaker agonistic activity as compared to
all ramificated compounds; for this reason, we envisioned that
dimethylpentanoic chain of gemfibrozil plays an important role in
the modulation of potency of the test compounds. Among linear
derivatives, compounds 17, 19, 21, and 23, containing respectively
asarone, stilbene, benzophenone, and diazophenyl para-substitu-
ents on the aromatic system, were found more potent of gemfi-
brozil. Only compound 20, in which the aromatic ring was
substituted with the chalcone skeleton, failed to retain its potency
2.1. Chemistry
The acids 17e24 and 32e38 were easily obtained in good yields by
standard esterification procedures followed by hydrolysis. The
hydrophobic building blocks phenols 1e8 were commercially
Linear or ramificate
derivatives
Substitution with hindered
groups
toward lead compound (EC50 ¼ 109.3
With the aim to achieve preliminary information on selectivity
PPAR , we performed the transactivation assay on both the iso-
forms, testing selected compounds at concentration of PPAR EC50
In these conditions, gemfibrozil showed a moderate selectivity for
PPAR isoform (0.7), whereas the other tested compounds were
mM).
O
a/g
a
.
O
OH
Removal of
methyls
g
found to be essentially equipotent dual activators, with selectivity
around 1. An increase of selectivity was seen only with GW7647 (2.9)
and chalcone derivatives 20 and 35 (3.0 and 2.1, respectively). This
gemfibrozil
Fig. 2. Chemical modifications of gemfibrozil.

5220
B. De Filippis et al. / European Journal of Medicinal Chemistry 46 (2011) 5218e5224
R
2
R
2
O
b
a
O
O
OEt
O
OH
R
1
R
1
9-16
17-24
R
2
OH
R
1
1-8
c
R
R
2
2
d
O
O
O
25-31
OEt
O
OH
R
1
R
1
32-38
Scheme 1. a) Br(CH2)4COOEt, Na, EtOH, reflux, 10e15 h; only for ester 15, Br(CH2)4COOEt, Na2CO3, acetone, rt, 10e15 h; b) KOH, EtOH, reflux, 6e10 h; only for acid 23, 10% KOH,
EtOH, rt, 6 h; c) Cl(CH2)3C(CH3)2COOEt or Br(CH2)3C(CH3)2COOiBu, Na, EtOH, reflux, 10e15 h; d) 10% KOH or 2 N NaOH, EtOH, reflux, 6e10 h.
Table 1
In vitro PPAR transactivation of test and reference compounds.
Efficacy (%)b
Selectivity PPARa/g
a
Compound
R1
R2
Linear (L) or branched (B)
EC50
17
32
18
33
19
34
20
35
21
36
22
37
23
L
B
L
B
L
B
L
B
L
B
L
B
L
11.3 ꢀ 1.1
6.6 ꢀ 0.6
iac
94 ꢀ 11
117 ꢀ 4
ia
0.8
1.0
ed
e
OCH3
O
H
ia
ia
H
H
H
H
18.8 ꢀ 1.2
1.0 ꢀ 0.02
109.3 ꢀ 3.0
61.5 ꢀ 2.2
27.1 ꢀ 0.3
9.3 ꢀ 0.9
ia
206 ꢀ 12
223 ꢀ 18
235 ꢀ 10
165 ꢀ 14
123 ꢀ 11
82 ꢀ 10
ia
1.1
1.4
3.0
2.1
1.0
0.9
e
O
O
O
H
H
H
9.1 ꢀ 0.9
9.3 ꢀ 0.9
118 ꢀ 12
106 ꢀ 4
1.4
1.3
H
N
H
N
O
24
L
ia
ia
e
N N
H
38
B
43.7 ꢀ 0.4
59.0 ꢀ 3.9
0.2 ꢀ 0.02
76 ꢀ 3
0.8
0.7
2.9
Gemfibrozil
GW7647
100 ꢀ 3
164 ꢀ 13
a
Compounds were tested in at least three separate experiments at five concentrations ranging from 1 to 150
Compounds were tested at least three separate experiments at 150 mM. Only 1 was tested at 1 mM. Efficacy values were calculated as percentage of the maximum obtained
mM. The results are expressed ꢀ SEM.
b
fold induction with the reference compound gemfibrozil.
c
ia: inactive at tested concentration.
Not determined.
d

B. De Filippis et al. / European Journal of Medicinal Chemistry 46 (2011) 5218e5224
5221
standard
0,1 uM
1 uM
10 uM
100 uM
1600 PerkineElmer spectrometer. NMR spectra were run at
300 MHz on a Varian instrument; chemical shifts (d) are reported in
6
5
4
3
2
1
0
ppm. Microanalyses were carried out with a Eurovector Euro EA
3000 model analyzer. GC analyses were run on an autosystem GC
Perkin Elmer apparatus using a fused silica capillary column (30 m,
0.53 mm ID), SPB-5 Supelco. Commercial reagents were used as
received from Aldrich or Fluka. We report only chemical data for
PPARa activators more potent than the gemfibrozil (EC50 < 59 mM)
and their previous esters.
4.1.2. General procedure for the preparation of esters 9e16 and
25e31
A solution of phenol (5 mmol) was added to a solution of sodium
(114 mg, 5 mmol) in absolute EtOH (5 mL) at room temperature.
After stirring for 30 min, a solution of suitable ethyl or isobutyl ester
(5-bromovalerate, 5-bromo-2,2-dimethylpentanoic acid ethyl ester
or 5-chloro-2,2-dimethylpentanoic acid isobutyl ester) (5 mmol) in
absolute EtOH (5 mL) was added and the solution was stirred at
reflux for 10e15 h. The solvent was removed under reduced pres-
sure and the residue was dissolved into CH2Cl2 or ethyl acetate
(25 mL) and washed with NaOH 2 N (3 ꢁ 25 mL). The organic layer
was dried over Na2SO4 and concentrated under reduced pressure to
yield the crude product that was purified by column chromatog-
raphy to give the ester 9e14, 16 or 25e31. Ester 15 was obtained
with the same procedure, but under milder conditions: K2CO3
(1.1 g, 8.38 mmol) was added to a solution of N-(4-hydroxyphenyl)-
N0-phenylurea (531 mg, 2.33 mmol) in acetone (10 mL) at room
temperature. After stirring for 30 min, a solution of ethyl 5-
bromovalerate (488 mg, 2.33 mmol, 0.37 mL) in acetone (10 mL)
was added. After 30 h the solvent was removed under reduced
pressure and the residue was treated as above to give the
compound 15.
DMSO gemfibrozil GW7647
17
23
32
34
Fig. 3. CPT1A expression in HepG2 following treatment. RTqPCR was performed to
measure CPT1A mRNA levels. Values shown represent the mean ꢀ SEM of four inde-
pendent determinations performed in duplicate. Cyclophilin was used as reference
gene, and values were normalized to data obtained from vehicle treated cells.
evaluation was only a qualitative overview, but furnished a selec-
tivity profile in order to explore a possible activation of PPAR
g.
In the liver, PPAR has been shown to affect fatty acid import into
a
hepatocyte mitochondria by up-regulating expression of the liver-
predominant mitochondrial carnitine palmitoyl acyl-CoA trans-
ferase 1 (CPT1A) [24]; the expression pattern of this gene is a well
established in vitro model to study PPARa activation [25]. Human
hepatocellular carcinoma cell line HepG2 was used to analyze the
impact of selected compounds 17, 23, 32, and 34 (with best EC50
values) on PPARa expression; measurement of mRNA concentration
was done as a quantitative analysis by RTqPCR. HepG2 cells were
stimulated with increasing amounts of selected compounds (from 1
to 100 mM) and compared with gemfibrozil and GW7647 at EC50
concentration; control cells were treated with DMSO alone (Fig. 3).
Stimulation of HepG2 cells with gemfibrozil showed a slight
increase of mRNA level, while compounds 17, 23, and 32 did not
influence the CPT1A expression. Incubation of cells with increasing
amounts of 34 led to a significant and concentration-dependent
increase of mRNA levels; indeed, at intermediate concentration of
4.1.2.1. Ethyl 5-(4-allyl-2-methoxyphenoxy)pentanoate (9). Yellow
oil, 90 mg, 3.2 mmol, 65% yield. IR (neat) 3076, 2937, 2872, 1732,
1589, 1513, 1260, 1036 cmꢂ1
;
1H NMR (CDCl3)
d
1.24 (t, J ¼ 7.4 Hz,
3H, CH3CH2), 1.61e1.90 (m, 4H, CH2CH2), 2.37 (t, J ¼ 7.4 Hz, 2H,
CH2CO), 3.32 (d, J ¼ 6.6, 2H, CH2CAr), 3.83 (s, 3H, CH3O), 3.99 (t,
J ¼ 6.0 Hz, 2H, CH2CH3), 4.11 (q, J ¼ 7.2 Hz, 2H, CH2O), 5.06 (t,
J ¼ 6.9 Hz, 2H, H2C]CH), 5.90e5.96 (m, 1H, H2C]CH), 6.70 (s, 2H,
10
m
M the mRNA induction was doubled with respect to gemfibrozil
M the relative mRNA was about 6.0. This value of mRNA
and at 100
m
CHArCH2), 6.79 (d, J ¼ 8.7 Hz, 1H, CHArCO); 13C NMR (CDCl3)
d 14.47
level is a little higher than the potent PPAR activator GW7647 (5.0).
The up-regulation of CPT1A gene by 34 well also corresponds with
the best EC50 value compared to other tested compounds, showing
that the combination of stilbene scaffold and gemfibrozil enhances
(CH3CH2), 21.79 (CH2CH2CO), 28.90 (CH2CH2O), 34.22 (CH2CO),
40.04 (CH2C]C), 56.14 (CH3O), 60.52 (CH2CH3), 68.82 (CH2O),
112.54 (CArHCOCH3), 113.45 (CArHC), 115.83 (CH2]C), 120.65
(CArHCCH2), 133.10 (CArCH2), 137.92 (CH]CH2), 147.11 (CArO), 149.58
(CArOMe), 173.74 (C]O). Anal. Calcd for C17H24O4: C, 69.84; H, 8.27.
Found: C, 69.82; H, 8.30.
the PPARa agonistic activity.
3. Conclusions
In the course of our study with gemfibrozil derivatives, we
constructed our structureeactivity relationships with data derived
from cell-based functional assay. This investigation led to the
identification of several active compounds; among them, the stil-
bene derivative 34 was found more effective than gemfibrozil in
4.1.2.2. Ethyl 5-{4-[(E)-2-phenylvinyl]phenoxy}pentanoate (11). White
solid, 97 mg, 2.9 mmol, 60% yield, mp 107e109 ꢃC. IR (KBr) 3076,
2937, 1732, 1513, 1260, 1036 cmꢂ1 1H NMR (CDCl3)
; d 1.26 (t,
J ¼ 7.2 Hz, 3H, CH3CH2), 1.68e1.80 (m, 4H, CH2CH2), 2.39 (m, 2H,
CH2CO), 3.99 (t, J ¼ 4.5 Hz, 2H, CH2O), 4.13 (q, J ¼ 7.2 Hz, 2H, CH2CH3),
6.8 (d, J ¼ 8.7 Hz, 2H, CHAr), 7.0 (q, J ¼ 14.1 Hz, 2H, HC]CH), 7.17 (m,
1H, CHAr), 7.34 (t, J ¼ 7.2 Hz, 2H, CHAr), 7.44 (d, J ¼ 9.0 Hz, 2H, CHAr),
ability to activate PPARa. Noticeably, its profile of transactivation,
selectivity and CPT1A gene induction are similar to full PPAR
a
7.49 (d, J ¼ 7.8 Hz, 2H, CHAr); 13C NMR (CD3OD)
d 14.49 (CH3), 21.88
agonist GW7647, providing a good starting point for development
of new lead compounds in the treatment of lipid disorders.
(CH2CH2CO), 28.90 (CH2CH2O), 34.19 (CH2CO), 60.57 (CH2CH3), 67.65
(CH2O), 114.89 (CArH), 126.46 (CH]CH), 126.76 (CArH), 127.42 (CArH),
127.93 (CArH),128.45 (CH]CH),128.87 (CAr),130.29 (CAr),137.88 (CAr),
158.91 (CArO), 173.70 (C]O). Anal. Calcd for C21H24O3: C, 77.75; H
7.46. Found: C, 77.80; H 7.41.
4. Experimentals
4.1. Chemistry
4.1.1. Materials and methods
4.1.2.3. Ethyl 5-(4-benzoylphenoxy)pentanoate (13). Uncolored oil,
Melting points were determined on a Büchi B-540 apparatus
and are uncorrected. Infrared spectra were recorded on an FT-IR
1.19 g, 3.4 mmol, 70% yield. IR (neat) 3061, 2941, 1732, 1653, 1601,
1255 cmꢂ1
;
1H NMR (CDCl3)
d
1.25 (t, J ¼ 7.2 Hz, 3H, CH3CH2),

5222
B. De Filippis et al. / European Journal of Medicinal Chemistry 46 (2011) 5218e5224
1.84e1.82 (m, 4H, CH2CH2), 2.36e2.40 (m, 2H, CH2COO), 4.02e4.10
(m, 2H, CH2O), 4.12 (q, J ¼ 7.2 Hz, 2H, CH2CH3), 6.90 (d, J ¼ 8.7 Hz,
2H, CHAr), 7.47 (d, J ¼ 7.2 Hz, 2H, CHAr), 7.51e7.54 (m, 1H, CHAr), 7.74
(d, J ¼ 6.6 Hz, 2H, CHAr), 7.8 (d, J ¼ 9 Hz, 2H, CHAr); 13C NMR (CDCl3)
162.91 (CArO), 177.90 (COOiBu), 196.0 (C]O). Anal. Calcd for
C24H30O4: C, 75.36; H, 9.91. Found: C, 75.39; H, 9.89.
4.1.2.8. Isobutyl 2,2-dimethyl-5-(4-phenoxyphenoxy)pentanoate (30).
d
14.48 (CH3CH2), 21.78 (CH2CH2CO), 28.72 (CH2CH2O), 34.09
Uncolored oil, 1.2 g, 3.5 mmol, 70% yield. IR (neat) 2963, 2930,2638,
(CH2CO), 60.61 (CH2CH3), 67.85 (CH2O), 114.92 (CAr), 128.16 (CAr),
129.8 (CAr), 132.31 (CAr), 138.22 (CArCO), 162.17 (CArO), 173.71 (COO),
195.98 (CO). Anal. Calcd for C20H22O4: C, 73.60; H, 6.79. Found:
73.58; H, 6.80.
1723, 1676, 1505, 1386, 1202, 1138 cmꢂ1; 1H NMR (CDCl3)
d 0.93 (d,
J ¼ 6.6 Hz, 6H, CH3), 1.20 (s, 6H, CH3), 1.68 (m, 4H, CH2CH2), 1.92 (m,
1H, CH), 3.84 (m, 2H, CH2O), 6.86 (d, J ¼ 9.0 Hz, 2H, CHArCO), 6.99 (m,
4H, CHArCO), 7.07 (m,1H, CHAr), 7.2 (t, J ¼ 6.9 Hz, 2H, CHArC); 13C NMR
(CD3OD)
d 19.35 (CH3), 25.41 (CH3), 28.00 (CH2), 37.23 (CH2C), 42.41
4.1.2.4. Ethyl 5-{4-[(anilinocarbonyl)amino]phenoxy}pentanoate (15).
White solid, 500 mg, 1.40 mmol, 60% yield, mp 152e153 ꢃC. IR (KBr)
(CCO), 68.99 (CH), 70.72 (CH2O),116.20 (CArCOAl),118.9 (CArCO), 120.3
(CArCO), 123.7 (CAr), 150.6 (CArO), 151.10 (CArOAl), 157.3 (CArO), 178.04
(C]O). Anal. Calcd for C23H30O4: C, 74.56; H, 8.16. Found: C, 74.54;
H, 8.18.
1729 cmꢂ1; 1H NMR (AcD)
d
1.20 (t, J ¼ 7.2 Hz, 3H, CH3CH2), 1.76e1.78
(m, 4H, CH2CH2), 2.36e2.40 (m, 2H, CH2COO), 3.95e3.98 (m, 2H,
CH2O), 4.08 (q, J ¼ 7.2 Hz, 2H, CH2CH3), 6.85 (d, J ¼ 9 Hz, 2H, CHAr),
6.94e6.98 (m, 1H, CAr), 7.25 (t, J ¼ 7.8 Hz, 2H, CAr), 7.41 (d, J ¼ 9 Hz, 2H,
CAr), 7.51 (d, J ¼ 8.1 Hz, 2H, CAr), 7.90 (s, 1H, NHCONH), 8.01 (s, 1H,
4.1.2.9. Isobutyl 2,2-dimetyl-5-{4-[(E)-phenyldiazenyl]phenoxy}pen-
tanoate (31). Orange solid, 1.14 g, 3 mmol, 60% yield, mp 46e47 ꢃC.
NHCONH); 13C NMR (AcD)
d
14.48 (CH3CH2), 21.78 (CH2CH2CO), 28.72
IR (KBr) 2964, 2873, 1719, 1602, 1501, 1469, 1255, 1192, 1142 cmꢂ1
;
(CH2CH2O), 34.09 (CH2CO), 60.61 (CH2CH3), 67.85 (CH2O), 116.60 (CAr),
120.43 (CAr), 118.6 (CAr), 122.65 (CAr), 129.26 (CAr), 134.13 (CArNH),
139.42 (CArNH), 152.14 (CArO), 115.57 (CONH), 173.71 (COO). Anal.
Calcd for C20H24N2O4: C, 67.40; H, 6.79; N, 7.86. Found: C, 67.38; H,
6.77; N, 7.89.
1H NMR (CDCl3)
d
0.94 (d, J ¼ 6.6 Hz, 6H, CH3CHCH3), 1.57 (s, 6H,
CH3CCH3), 1.74e1.76 (m, 4H, CH2CH2), 1.89e1.98 (m, 1H, CHCH3),
3.85 (t, J ¼ 6.6 Hz, 2H, CH2O), 4.02 (t, J ¼ 5.7 Hz, 2H, CH2CH), 6.97 (d,
J ¼ 9.0 Hz, 2H, CHArCO), 7.25e7.52 (m, 3H, CHAr), 7.85e7.92 (m, 4H,
CHArN]NCHAr); 13C NMR (CDCl3)
d 19.35 (2CH3), 25.20 (CH3), 25.45
(CH3), 28.02 (CH), 31.19 (CH2), 37.16 (CH2), 42.41 (CCH3), 68.62
(CH2O), 70.79 (CH2OCO), 114.87 (CArCO), 122.75 (CArCN), 124.96
(CArCN), 129.25 (CArC), 130.55 (CAr), 147.11 (CArN), 161.74 (CArO),
177.94 (C]O). Anal. Calcd for C23H30N2O3: C, 72.22; H, 7.91; N, 7.32.
Found: C, 72.20; H, 7.94; N, 7.31.
4.1.2.5. Ethyl 5-(2-methoxy-4-allyl-phenoxy)-2,2-dimethyl penta-
noate (25). Yellow oil, 1.39 g, 4.3 mmol, 87% yield. IR (nujol) 3076,
2937, 1722, 1513, 1260, 1036 cmꢂ1 1H NMR (CDCl3)
; d 1.18 (s, 6H,
CH3), 1.24 (t, J ¼ 7.2 Hz, 3H, CH3CH2), 1.61e1.90 (m, 4H, CH2CH2),
3.32 (d, J ¼ 6.6 Hz, 2H, CH2CAr), 3.83 (s, 3H, CH3O), 3.99 (t, J ¼ 6.0 Hz,
2H, CH2CH3), 4.11 (q, J ¼ 7.2 Hz, 2H, CH2O), 5.06 (t, J ¼ 6.9 Hz, 2H,
H2C]CH), 5.90e5.96 (m, 1H, H2C]CH), 6.70 (s, 2H, CHArCH2), 6.69
4.1.3. General procedure for the preparation of acids 17e24 and
32e38
(d, J ¼ 8.7 Hz, 1H, CHArCO); 13C NMR (CDCl3)
d
14.47 (CH3CH2), 25.18
A solution of KOH 1% in absolute EtOH (420 mg, 7.5 mmol) was
added to ester 9e14, 16 or 25e31 (5 mmol) in absolute EtOH (5 mL),
and the mixture was stirred at reflux for 6e10 h. Only ester 15
reacted at rt. The solvent was removed under reduced pressure and
the residue was poured into water (10 mL) and acidified with 2 N
HCl. The aqueous layer was extracted with dichloromethane
(3 ꢁ 100 mL) and then the organic layer was dried over Na2SO4 and
concentrated under reduced pressure. The crude product was
purified by crystallization in cyclohexane or by flash chromatog-
raphy to give the acid 17e24 or 33e39.
(CH3), 25.34 (CH3), 28.90 (CH2CH2O), 36.08 (CH2CH2CO), 40.04
(CCO), 42.19 (CH2C]C), 56.01 (CH3O), 60.52 (CH2CH3), 69.54
(CH2O), 112.54 (CArHCOCH3), 113.45 (CArHCO), 115.83 (CH2]C),
120.65 (CArHCCH2),133.10 (CArCH2),137.92 (CH]CH2),147.11 (CArO),
149.58 (CArOMe), 173.74 (C]O). Anal. Calcd for C19H28O4: C, 71.22;
H, 8.81. Found: C, 71.19; H, 8.80.
4.1.2.6. Ethyl 2,2-dimethyl-5-{4-[(E)-2-phenylvinyl]phenoxy}penta-
noate (27). White solid, 1.09 g, 3.1 mmol, 62% yield. IR (neat) 3022,
2974, 1720, 1604, 1513, 1248, 1048 cmꢂ1; 1H NMR (CDCl3)
d 1.21 (s,
6H, CH3), 1.25 (t, J ¼ 6.9 Hz, 3H, CH3CH2), 1.68e1.80 ( m, 4H,
CH2CH2), 3.95 (t, J ¼ 5.7 Hz, 2H, CH2O), 4.12 (q, J ¼ 7.2 Hz, 2H,
CH2CH3), 6.8 (d, J ¼ 8.4 Hz, 2H, CHAr), 7.0 (q, J ¼ 14.1 Hz, 2H, HC]
CH), 7.24 (d, J ¼ 8.1 Hz, 1H, CHAr), 7.34 (t, J ¼ 7.2 Hz, 2H, CHAr), 7.38
(d, J ¼ 8.7 Hz, 2H, CHAr), 7.48 (d, J ¼ 7.2 Hz, 2H, CHAr); 13C NMR
4.1.3.1. 5-(4-Allyl-2-methoxyphenoxy)pentanoic acid (17). White
solid, 0.77 g, 3.07 mmol, 86% yield, mp 62 ꢃC. IR (neat) 2957, 1713,
1514, 1259, 1135, 1016, 906 cmꢂ1; 1H NMR (CD3OD)
d 1.61e1.90 (m,
4H, CH2CH2), 2.37 (t, J ¼ 7.3 Hz, 2H, CH2CO), 3.30 (t, J ¼ 1.8 Hz, 2H,
CH2CAr), 3.83 (s, 3H, CH3O), 3.96 (q, J ¼ 7.2 Hz, 2H, CH2O), 4.88 (t,
J ¼ 5.7 Hz, 2H, H2C ¼ C), 5.90e5.96 (m, 1H, CH]CH2), 6.70 (s, 2H,
(CD3OD)
d 14.49 (CH3), 25.17 (CH3), 21.88 (CH2CCO), 28.90
(CH2CH2O), 36.97 (CCO), 60.57 (CH2CH3), 67.65 (CH2O), 114.89
(CArH), 126.46 (CH]CH), 126.76 (CArH), 127.42 (CArH), 127.93 (CArH),
128.45 (CH]CH), 128.87 (CAr), 130.29 (CAr), 137.88 (CArH), 158.91
(CArO), 173.70 (C]O). Anal. Calcd for C23H28O3: C, 78.38; H, 8.01.
Found: C, 78.36; H, 8.00.
CHArCH2), 6.69 (d, J ¼ 7.5 Hz, 1H, CHArCO); 13C NMR (CD3OD)
d 21.79
(CH2CH2CO), 28.90 (CH2CH2O), 34.22 (CH2CO), 40.04 (CH2C]C),
56.14 (CH3O), 68.82 (CH2O), 112.54 (CArHCOMe), 113.45 (CArHCCH2),
115.83 (CH2]C), 120.65 (CArHC), 133.10 (CArCH2), 137.92 (CH]CH2),
147.11 (CArO), 149.58 (CArOMe), 173.74 (C]O). Anal. Calcd for
C15H20O4: C, 68.16; H, 7.63. Found: C, 68.14; H, 7.66.
4.1.2.7. Isobutyl 5-(4-benzoylphenoxy)-2,2-dimethylpentanoate (29).
Uncolored oil, 1.2 g, 3.2 mmol, 65% yield. IR (neat) 3058, 2950, 1702,
4.1.3.2. 5-{4-[(E)-2-phenylvinyl]phenoxy}pentanoic acid (19). White
solid, 0.58 g, 1.9 mmol, 60% yield, mp 176e177 ꢃC. IR (KBr) 3022,
1698, 1570 cmꢂ1
;
1H NMR (CDCl3)
d
0.94 (d, J ¼ 6.6 Hz, 6H,
CH3CHCH3), 1.22 (s, 6H, CH3), 1.70e1.76 (m, 4H, CH2CH2), 1.80e1.98
(m, 1H, CHCH2), 3.84 (d, J ¼ 6.3 Hz, 2H, CH2CH), 4.01 (t, J ¼ 4.5 Hz,
2H, CH2CH2O), 6.92 (d, J ¼ 8.7 Hz, 2H, CHAr), 7.43e7.49 (m, 2H,
CHAr), 7.53e7.59 (m, 1H, CHAr), 7.76 (d, J ¼ 8.4 Hz, 2H, CHAr), 7.81 (d,
2948, 1695, 1507, 1244, 1170, 1029 cmꢂ1 1H NMR (CDCl3)
;
d
1.68e1.80 (m, 4H, CH2CH2), 2.39 (m, 2H, CH2CO), 3.95 (t, J ¼ 4.5 Hz,
2H, CH2O), 6.8 (d, J ¼ 8.7 Hz, 2H, CHAr), 7.0 (q, J ¼ 13.5 Hz, 2H, HC]
CH), 7.17 (m, 1H, CHAr), 7.33 (t, J ¼ 7.2 Hz, 2H, CHAr), 7.43 (d,
J ¼ 8.4 Hz, 2H, CHAr), 7.48 (d, J ¼ 7.5 Hz, 2H, CHAr); 13C NMR (CD3OD)
J ¼ 9.0 Hz, 2H, CHAr); 13C NMR (CDCl3)
d 19.35 (CH3CHCH3), 25.15
(CH2), 25.45 (CH3CCH3), 28.02 (CH), 37.14 (CH2C), 42.39 (CCH3),
68.56 (CH2CH2O), 70.80 (OCH2CH), 114.18 (CAr), 128.40 (CAr), 129.95
(CAr), 130.20 (CArCO), 132.09 (CAr), 132.80 (CAr), 138.53 (CArCO),
d 21.88 (CH2CH2CO), 28.90 (CH2CH2O), 34.19 (CH2CO), 67.65 (CH2O),
114.89 (CArH), 126.46 (CH]CH), 126.76 (CArH), 127.42 (CArH), 127.93
(CArH), 128.45 (CH]CH), 128.87 (CAr), 130.29 (CAr), 137.88 (CAr),

B. De Filippis et al. / European Journal of Medicinal Chemistry 46 (2011) 5218e5224
5223
158.91 (CArO), 173.70 (C]O). Anal. Calcd for C19H20O3: C, 77.00; H,
6.80. Found: C, 77.09; H, 6.83.
4.1.3.8. 2,2-Dimethyl-5-(4-phenoxyphenoxy)pentanoic acid (37).
White solid, 864 mg, 2.7 mmol, 55% yield, mp 85e88 ꢃC, IR (KBr)
2963, 2930, 2638, 1693, 1676, 1505, 1386, 1202 cmꢂ1 1H NMR
;
4.1.3.3. 5-(4-Benzoylphenoxy)pentanoic acid (21). White solid,
(CD3OD) d 1.21 (s, 6H, CH3), 1.64e1.82 (m, 4H, CH2CH2), 3.92 (t,
0.98 g, 3.29 mmol, 87% yield, mp 103 ꢃC. IR (KBr) 3050 (broad),
J ¼ 6.0 Hz, 2H, CH2O), 6.90 (s, 6H, CHAr), 6.98e7.07 (m, 1H, CHAr),
2954, 2913, 2873, 1698, 1639, 1604 cmꢂ1
;
1H NMR (CD3OD)
7.27 (d, J ¼ 7.5 Hz, 2H, CHArC); 13C NMR (CD3OD)
d 25.41 (CH3),
d
1.84e1.82 (m, 4H, CH2CH2), 2.36e2.40 (m, 2H, CH2COO),
28.00 (CH2), 37.23 (CH2C), 42.41 (CCO), 70.72 (CH2O), 116.20 (CAr
-
4.02e4.10 (m, 2H, CH2O), 7.02 (d, J ¼ 8.7 Hz, 2H, CHAr), 7.51 (d,
COAl), 118.9 (CArCO), 120.3 (CArCO), 123.7 (CAr), 150.6 (CArO), 151.10
(CArOAl), 157.3 (CArO), 178.04 (C]O). Anal. Calcd for C19H22O4: C,
72.59; H, 7.05. Found: C, 72.56; H, 7.07.
J ¼ 7.8 Hz, 2H, CHAr), 7.57e7.59 (m, 1H, CHAr), 7.70 (d, J ¼ 7.2 Hz, 2H,
CHAr), 7.77 (d, J ¼ 8.7 Hz, 2H, CHAr); 13C NMR (CD3OD)
d 21.78
(CH2CH2CO), 28.72 (CH2CH2O), 34.09 (CH2CO), 67.85 (CH2O), 114.92
(CAr), 128.16 (CAr), 129.8 (CAr), 132.31 (CAr), 138.22 (CArCO), 162.17
(CArO), 173.71 (COOH), 195.98 (CO). Anal. Calcd for C18H18O8: C,
72.47; H, 6.08. Found: C, 72.45; H, 6.09.
4.1.3.9. 2,2-Dimethyl-5-{4-[(E)-phenyldiazenyl]phenoxy}pentanoic
acid (38). Orange solid, 1.4 mg, 4.3 mmol, 87% yield, mp 85e87 ꢃC;
IR (KBr) 2946, 2873, 1693, 1602, 1503, 1255, 1145, 1030 cmꢂ1 1H
;
NMR (CD3OD)
J ¼ 6.0 Hz, 2H, CH2O), 7.05 (d, J ¼ 9.0 Hz, 2H, CHArCO), 7.32e7.58 (m,
3H, CHAr), 7.83e7.90 (m, 4H, CHArN); 13C NMR (CD3OD)
25.41
(CH3), 28.00 (CH2), 37.23 (CH2C), 42.41 (CCO), 70.72 (CH2O), 116.01
(CArCO), 122.44 (CArCN), 125.07 (CArCN), 129.45 (CArC), 130.58 (CAr),
145.53 (CArN), 152.31 (CArN), 161.03 (CArO), 178.04 (C]O). Anal.
Calcd for C19H22N2O3: C, 69.92; H, 6.79; N, 8.58. Found: C, 69.95; H,
6.78; N, 8.59.
d 1.21 (s, 6H, CH3), 1.64e1.82 (m, 4H, CH2CH2), 4.05 (t,
4.1.3.4. 5-{4-[(Anilinocarbonyl)amino]phenoxy}pentanoic acid (23).
White solid, 300 mg, 60% yield, mp 229 ꢃC (dec). IR (KBr) 3313, 2936,
d
1639, 1595, 1566, 1515, 1241 cmꢂ1; 1H NMR (AcD)
d
1.76e1.78 (m, 4H,
CH2CH2), 2.36e2.40 (m, 2H, CH2COO), 3.95e3.98 (m, 2H, CH2O), 6.86
(d, J ¼ 9 Hz, 2H, CHAr), 6.94e6.98 (m, 1H, CAr), 7.25 (t, J ¼ 7.8 Hz, 2H,
CAr), 7.42 (d, J ¼ 9 Hz, 2H, CAr), 7.52 (d, J ¼ 8.1 Hz, 2H, CAr), 7.94 (s, 1H,
NHCONH), 8.05 (s,1H, NHCONH); 13C NMR (AcD)
d 21.78 (CH2CH2CO),
28.72 (CH2CH2O), 34.09 (CH2CO) 67.85 (CH2O), 116.60 (CAr), 120.43
(CAr), 118.6 (CAr), 122.65 (CAr), 129.26 (CAr), 134.13 (CArNH), 139.42
(CArNH), 152.14 (CArO), 115.57 (CONH), 173.71 (COOH). Anal. Calcd for
C18H20N2O4: C, 65.84; H, 6.14; N, 8.53. Found: C, 65.86; H, 6.16; N,
8.50.
4.2. Biology
4.2.1. Reporter plasmids and luciferase assays
Human embryonic kidney cells (HEK293) were grown in Dul-
becco’s Modified Eagles’s Medium (DMEM) containing 10% of FCS,
penicillin/streptomycin, sodium pyruvate and nonessential amino
acids. HEK293 cells were incubated at 37 ꢃC in 5% CO2 incubator
until they were 80% confluent. One day before the experiment, the
cells were plated in 96-well plates. The next day, the culture
medium was replaced by a fresh one without FCS and the transient
transfection was conducted using the calcium phosphate method.
Cells were transfected with expression plasmids encoding the
4.1.3.5. 5-(2-Methoxy-4-allylphenoxy)-2,2-dimethylpentanoic acid
(32). White solid, 1.02 g, 2.6 mmol, 52% yield, mp 77e83 ꢃC. IR
(KBr) 3076, 2953 (broad), 1707, 1513, 1261 cmꢂ1 1H NMR (CDCl3)
;
d
1.18 (s, 6H, CH3), 1.61e1.90 (m, 4H, CH2CH2), 3.32 (m, 2H, CH2CAr),
3.83 (s, 3H, CH3O), 4.11 (q, J ¼ 4.9 Hz, 2H, CH2O), 5.06 (t, J ¼ 6.9 Hz,
2H, H2C]CH), 5.90e5.96 (m, 1H, H2C]CH), 6.70 (s, 2H, CHArCH2),
6.69 (d, J ¼ 7.5 Hz, 1H, CHArCO); 13C NMR (CDCl3)
d 24.49 (CH3),
25.02 (CH3), 28.90 (CH2CH2O), 36.87 (CH2CH2CO), 40.04 (CCO),
42.19 (CH2C]C), 56.01 (CH3O), 69.54 (CH2O), 109.5 (CAr), 113.45
(CAr), 118.83 (CH2]C), 123.18 (CAr), 130.79 (CAr), 131.8 (CH]CH2),
147.76 (CAr), 149.75 (CAr), 180.65 (C]O). Anal. Calcd for C17H24O4: C,
69.84; H, 8.27. Found: C, 69.80; H, 8.29.
fusion protein GAL4-PPARaLBD or GAL4-PPARgLBD (30 ng),
reporter plasmid (50 ng), renilla luciferase normalization vector
(20 ng), and pGEM carrier DNA (40 ng) to make a total of 140 ng of
DNA per well. 8 h after transfection, cells were treated for 18 h with
the indicated ligands. The two luciferase activities were measured
using a dual luciferase assay kit (Promega) on a microplate
luminometer (Labsystems Ascent LuminoskanReader). All trans-
fection experiments were repeated at least twice.
4.1.3.6. 2,2-Dimethyl-5-{4-[(E)-2-phenylvinyl]phenoxy}pentanoic
acid (34). White solid, 1.2 mg, 4.0 mmol, 80% yield, mp 151e155 ꢃC.
IR (KBr) 3023, 2955 (broad), 1690, 1604, 1510, 1267, 1170,
1021 cmꢂ1
;
1H NMR (CDCl3)
d
1.21 (s, 6H, CH3), 7.70e1.79 (m, 4H,
4.2.2. Real-time quantitative PCR (RTqPCR)
CH2CH2), 3.96 (t, J ¼ 6 Hz, 2H, CH2O), 6.8 (d, J ¼ 8.7 Hz, 2H, CHAr), 7.0
(q, J ¼ 13.5 Hz, 2H, HC]CH), 7.24 (d, J ¼ 8.1 Hz, 1H, CHAr), 7.33 (t,
J ¼ 7.5 Hz, 2H, CHAr), 7.43 (d, J ¼ 8.7 Hz, 2H, CHAr), 7.48 (d, J ¼ 7.2 Hz,
HepG2 cells were obtained from ATCC (ATCC-LGC Promochem,
London, U.K.). Cells were maintained in growth medium composed
of DMEM supplemented with 10% FCS-GOLD and 1% penicillin/
streptomycin. One day before the treatment, HepG2 cells were
seeded in six-well plates at a density of 5 ꢁ 105 cells/well and
incubated at 37 ꢃC, 5% CO2. The next day, the cells were treated for
24 h with the indicated ligands dissolved in dimethyl sulfoxide
(DMSO) and diluted in the growth medium. After incubation, cells
were washed with PBS and assayed for the gene expression analysis.
Total RNA was isolated by TRIzol reagent (Invitrogen, Carlsbad,
CA) following the manufacturer’s instructions. To avoid possible
DNA contamination, RNA was treated with DNAase-1 (Ambion,
Foster City, CA). RNA purity was checked by spectrophotometer and
RNA integrity by examination on agarose gel electrophoresis.
Complementary DNA (cDNA) was synthesized retrotranscribing
2H, CHAr); 13C NMR (CD3OD)
d 21.89 (CH2CCO), 28.90 (CH2CH2O),
25.22 (CH3), 36.97 (CCO), 68.31 (CH2O), 114.89 (CAr), 126.46 (CH]
CH), 126.76 (CAr), 127.42 (CAr), 127.93 (CAr), 128.45 (CH]CH), 128.87
(CAr), 130.29 (CAr), 137.88 (CAr), 158.91 (CAr), 173.70 (C]O). Anal.
Calcd for C21H24O3: C, 77.75; H, 7.46. Found: C, 77.79; H, 7.43.
4.1.3.7. 5-(4-Benzoylphenoxy)-2,2-dimethylpentanoic acid (36).
White solid, 930 mg, 2.8 mmol, 57% yield, mp 103e105 ꢃC; IR (KBr)
3040, 2960, 1690, 1630, 1550 cmꢂ1; 1H NMR (CD3OD)
d 1.22 (s, 6H,
CH3), 1.70e1.76 (m, 4H, CH2CH2), 3.84 (d, J ¼ 6.3 Hz, 2H, CH2CH),
6.92 (d, J ¼ 8.7 Hz, 2H, CHAr), 7.43e7.49 (m, 2H, CHAr), 7.53e7.59 (m,
1H, CHAr), 7.76 (d, J ¼ 8.4 Hz, 2H, CHAr), 7.81 (d, J ¼ 9.0 Hz, 2H, CHAr);
13C NMR (CDCl3)
d
25.15 (CH2), 25.45 (CH3CCH3), 37.14 (CH2C), 42.39
4 mg of total RNA in a total volume of 100 mL using the High Capacity
(CCH3), 68.56 (CH2O), 114.18 (CAr), 128.40 (CAr), 129.95 (CAr), 130.20
(CArCO), 132.09 (CAr), 132.80 (CAr), 138.53 (CArCO), 162.91 (CArO),
177.90 (COOH), 196.0 (C]O). Anal. Calcd for C20H22O4: C, 73.60; H,
6.79. Found: C, 73.63; H, 6.78.
DNA Archive Kit (Applied Biosystems, Foster City, CA) and following
the manufacturer’s instructions.
RTqPCR primers were designed using Primer Express Software.
PCR assays were performed in 96 well optical reaction plates using

5224
B. De Filippis et al. / European Journal of Medicinal Chemistry 46 (2011) 5218e5224
[10] L. Rodríguez-Páez, M. Juárez-Sanchez, J. Antúnez-Solís, I. Baeza, C. Wong, a-
the ABI 7500HT machine (Applied Biosystems). PCR assays ampli-
fication plots were kept constant to obtain normalized cycle times
and linear regression data. The following reaction mixture per well
Asarone inhibits HMG-CoA reductase, lowers serum LDL-cholesterol levels
and reduces biliary CSI in hypercholesterolemic rats, Phytomedicine 10 (2003)
397e404.
[11] D. Hernández, P. Bernal, A. Cruz, Y. Garciafigueroa, L. Garduño, M. Salazar,
F. Díaz, G. Chamorro, J. Tamariz, Potent hypolipidemic activity of mimetic
amides of fibrates based on the 2-methoxy-4-(2-propenyl)phenoxyacetic
scaffold, Drug Dev. Res. 61 (2004) 19e36.
[12] T. Shen, X.N. Wang, H.X. Lou, Natural stilbenes: an overview, Nat. Prod. Rep.
26 (2009) 916e935.
[13] A.E. Star, T.J. Mabry, Flavonoid frond exudates from two Jamaican ferns, Pity-
rogramma tartarea and P. calomelanos, Phytochemistry 10 (1971) 2817e2818.
[14] C.S. Mizuno, G. Ma, S. Khan, A. Patny, M.A. Avery, A.M. Rimando, Design,
synthesis, biological evaluation and docking studies of pterostilbene analogs
was used: 12.5
primer at the final concentration of 300 nM, 4.7
water, 3 L cDNA. All reactions were carried out using the following
m
L Power Syber Green (Qiagen, Quantitect), 4.8
mL
mL RNAse free
m
protocol: 95 ꢃC for 15 min; 40 cycles of 94 ꢃC for 15 s, 60 ꢃC for 30 s,
72 ꢃC for 30 s. Each experimental measurement was normalized to
the corresponding cyclophilin mRNA levels. Relative quantification
was performed using the DDCt method.
Validated primers for RTqPCR are listed below:
Human CPT1A: FW-50TGCCATGGATCTGCTGTATATCC30,
RV-50GCGTTGCCGGCTCTTG30
inside PPAR
[15] X.-H. Li, H.-J. Zou, A.-H. Wu, Y.-L. Ye, J.-H. Shen, Structure-based drug design of
a novel family of chalcones as PPAR agonists: virtual screening, synthesis,
a, Bioorg. Med. Chem. 16 (2008) 3800e3808.
a
Human GAPDH: FW-50CAACTTTGGTATCGTGGAAGGAC30,
RV-50ACAGTCTTCTGGGTGGCAGTG30.
and biological activities in vitro, Acta Pharm. Sin. 28 (2007) 2040e2052.
[16] W. Li, X. He, W. Shi, H. Jia, B. Zhong, Pan-PPAR agonists based on the
resveratrol scaffold: biological evaluation and docking studies, Chem-
MedChem 5 (2010) 1977e1982.
[17] L. Giampietro, A. Ammazzalorso, A. Giancristofaro, F. Lannutti, G. Bettoni, B. De
Filippis, M. Fantacuzzi, C. Maccallini, M. Petruzzelli, A. Morgano, A. Moschetta,
R. Amoroso, Synthesis and biological evaluation of 2-heteroarylthioalkanoic
acid analogues of clofibric acid as peroxisome proliferator-activated
Acknowledgments
This study was supported by University “G. d’Annunzio” of
Chieti grants. The authors gratefully acknowledge Dr. David J.
Mangeldorf (Dallas, TX) for the PPAR plasmids and Dr. Antonio
Moschetta for his precious scientific help.
receptor
a agonists, J. Med. Chem. 52 (2009) 6224e6232.
[18] B. De Filippis, L. Giampietro, A. Giancristofaro, A. Ammazzalorso,
M. Fantacuzzi, C. Maccallini, M. Petruzzelli, R. Amoroso, Synthesis and bio-
logical evaluation of gemfibrozil chiral analogues as potential PPAR
a agonists,
Lett. Drug Des. Disc. 8 (2011) 154e158.
[19] G.Y. Yeap, I. Susanti, B.S. Teoh, W.A.K. Mahmood, W.T.A. Harrison, Synthesis
and phase transition in new chalcone derivatives: crystal structure of 1-
phenyl-3-(40-undecylcarbonyloxyphenyl)-2-propen-1-one, Mol. Cryst. Liq.
Cryst. 442 (2005) 133e146.
References
[20] D.M. Stout, W.L. Matier, C. Barcelon-Yang, R.D. Reynolds, B.S. Brown, Synthesis
and antiarrhythmic and parasympatholytic properties of substituted phenols.
3. Modifications to the linkage region (region 3), J. Med. Chem. 28 (1985)
295e298.
[1] I. Issemann, S. Green, Activation of a member of the steroid hormone receptor
superfamily by peroxisome proliferators, Nature 347 (1990) 645e650.
[2] E. Robinson, D.J. Grieve, Significance of peroxisome proliferator-activated
receptors in the cardiovascular system in health and disease, Pharmacol.
Ther. 122 (2009) 246e263.
[3] B.P. Kota, T.H.-W. .Huang, B.D. Roufogalis, An overview on biological mecha-
nisms of PPARs, Pharm. Res. 51 (2005) 85e94.
[4] J.-C. Fruchart, Peroxisome proliferator-activated receptor-alpha (PPARa): at
[21] P.W. Manley, D.P. Tuffin, N.M. Allanson, P.E. Buckle, N. Lad, S.M.F. Lai,
D.O. Lunt, R.A. Porter, P.J. Wade, Thromboxane synthase inhibitors. Synthesis
and pharmacological activity of (R)-, (S)-, and (þꢂ)-2,2-dimethyl-6-[2-(1H-
imidazol-1-yl)-1-[[(4-methoxyphenyl)methoxy]methyl]ethoxy]
hexanoic
acids, J. Med. Chem. 30 (1987) 1812e1818.
the crossroads of obesity, diabetes and cardiovascular disease, Atherosclerosis
[22] I.G. Schulman, R.A. Heyman, The flip side: identifying small molecule regu-
lators of nuclear receptors, Chem. Biol. 11 (2009) 639e646.
[23] L.H. Naylor, Reporter gene technology: the future looks bright, Biochem.
Pharmacol. 58 (1999) 749e757.
205 (2009) 1e8.
[5] M. Kawai, C.J. Rosen, PPAR
and osteogenesis, Natl. Rev. 6 (2010) 629e636.
[6] F. Karpe, E.E. Ehrenborg, PPAR in humans: genetic and pharmacological
g: a circadian transcription factor in adipogenesis
d
[24] J.D. McGarry, N.F. Brown, The mitochondrial carnitine palmitoyltransferase
system. From concept to molecular analysis, Eur. J. Biochem. 244 (1997) 1e14.
[25] J.W. Lawrence, Y. Li, S. Chen, J.G. De Luca, J.P. Berger, D.R. Umbenhauer,
D.E. Moller, G. Zhou, Differential gene regulation in human versus rodent
hepatocytes by peroxisome proliferator-activated receptor (PPAR) alpha.
PPAR alpha fails to induce peroxisome proliferation-associated genes in
human cells independently of the level of receptor expression, J. Biol. Chem.
276 (2001) 31521e31527.
evidence for a significant metabolic function, Curr. Opin. Lipidol. 20 (2009)
333e336.
[7] R. Seth Loomba, R. Arora, Fibrates: where are we now? Ther. Adv. Cardiovasc.
Dis. 3 (2009) 91e96.
[8] J.-C. Fruchart, P. Duriez, Mode of action of fibrates in the regulation of
triglyceride and HDL-cholesterol metabolism, Drugs Today 42 (2006) 39e64.
[9] R. Enriquez, M. Chávez, F. Jáuregui, Propenylbenzenes from Guatteria gaumeri,
Phytochemistry 19 (1980) 2024e2025.