Docking, synthesis and biological evaluation of novel diketoquinoline analogues as HIV-1 integrase inhibitor

Article abstract of DOI:10.14233/ajchem.2019.22045

A series of novel diketoquinoline acid derivatives as potential anti-HIV-1 Integrase inhibitors were docked, synthesized and characterized by IR, NMR, CHN and MS spectral analysis. Many compounds were identified and docked in integrase pocket. The target

Full text of DOI:10.14233/ajchem.2019.22045

Asian Journal of Chemistry; Vol. 31, No. 9 (2019), 2000-2008
A
SIAN
J
OURNAL OF HEMISTRY
C
https://doi.org/10.14233/ajchem.2019.22045
Docking, Synthesis and Biological Evaluation of Novel
Diketoquinoline Analogues as HIV-1 Integrase Inhibitor
1
1
2
3,*
KISHORE D. DEO , I.J. SINGHVI , S.R. PATIL and AVINASH V. PATIL
1Department of Pharmacy, Pacific Academy of Higher Education and Research University, Udaipur-313003, India
2M.G.S.M. Arts, Science and Commerce College, Chopda-425107, India
3Smt. S.S. Patil College of Pharmacy, Chopda-425107, India
*Corresponding author: E-mail: avinashay_princ@rediffmail.com
Received: 4 March 2019;
Accepted: 20 April 2019;
Published online: 31 July 2019;
AJC-19489
A series of novel diketoquinoline acid derivatives as potential anti-HIV-1 Integrase inhibitors were docked, synthesized and characterized
by IR, NMR , CHN and MS spectral analysis. Many compounds were identified and docked in integrase pocket. The target diketoquinolines
were prepared from substituted oxoquinoline-3-carboxylate. In vitro biological evaluation revealed that some of the titled compounds
exhibited moderate to good anti-HIV-1 Integrase inhibitory activity in comparison with the reference drugs i.e. raltegravir and nevirapine.
The cytotoxicity of most of testing compounds on C8166 were very low, the CC50 value of them were higher than 200 µM, except the few
compounds. Compounds 1-5 showed weak anti-HIV-1 activity, its therapeutic index was 457, 531, 583, 869 and 909 respectively. As a
positive control drug, Nevirapine has the best anti-HIV-1 activity (EC50 = 0.015-0.016 µM) in vitro and the CC50 of was higher than 200
µM, its therapeutic index was higher 12418.50. In integrase assay compound 6 and 7 showed EC50 value 0.08 µM as compared with
standard drug raltegravir.
Keywords: Elvitegravir, Diketoquinoline, Docking, HIV-1 integrase, Raltegravir, Nevirapine, Syncytium.
oriented hydrophobic benzyl moiety. They selectively inhibit
ST (strand transfer) reaction, suggesting that they bind at the
IN/DNA interface, acting as “interfacial inhibitors”. Elvite-
gravir binds to magnesium cations and inhibits the strand
transfer reaction. Designing such drug targeting integrase may
give rise to newer ideal drug to treat AIDS and overcome the
side effects of previous compounds and may generate second
generation integrase inhibitors [5-7].
The target diketoquinolines were first selected from zinc
database and few active compounds with their derivatives were
prepared from the carboxylate compounds reacted with substi-
tuted piperazine, benzoic acid, 2-phenoxyacetic acid and
benzene-1-sulfonyl chloride to form diketoquinoline series.
In the present study, structures were docked in integrase pocket.
In this context, we synthesized new diketoquinoline derivatives
(1-7) by the replacement of various substituent’s present on
elvitegravir.All these compounds were evaluated for their anti-
integrase activity.
INTRODUCTION
Integrase (IN) is a key enzyme for HIV-1 replication, cata-
lyzing the integration of reverse transcribed DNA into the host
cell genome. In the past decade, integrase has emerged as an
attractive target. Whereas structural studies of integrase reveal
a single binding site for Mg2+, the number of metal ions present
and required in the active site during the process remains con-
troversial. A great number of HIV-1 integrase inhibitors with
metal binding properties have been described and numerous
reviews have been published [1-4].
Among all reported integrase inhibitors, the β-diketo acid
(DKA) class of compounds has emerged as the most potent
and the most promising. Raltegravir is the first approved
integrase inhibitor whereas Elvitegravir and GSK364735
reached clinical development Fig. 1. Like other well-known
DKA inhibitors, these also share two common structural
chemotypes essential for the anti-integrase activity: a diketo
acid chain able to interact with Mg2+ metal ions and a properly
This is an open access journal, and articles are distributed under the terms of the Attribution 4.0 International (CC BY 4.0) License. This
license lets others distribute, remix, tweak, and build upon your work, even commercially, as long as they credit the author for the original
creation. You must give appropriate credit, provide a link to the license, and indicate if changes were made.

Vol. 31, No. 9 (2019)
Synthesis and Biological Evaluation of Novel Diketoquinoline Analogues as HIV-1 Integrase Inhibitor 2001
Cl
F
O
N
O
O
H
N
O
OH
OH
F
N
N
N
HO
N
N
H
N
H
N
N
O
N
O
O
OH
Raltegravir
Nevirapine
Elvitegravir
Fig. 1. Representative integrase inhibitors
carboxylate: A solution of methyl-1-cyclopropyl-6-fluoro-
1,4-dihydro-4-oxo-7-(piperazin-1-yl)quinoline-3-carboxylate
2g (5.80 mmol) in N,N-dimethylformamide (20 mL), 3-5
dichlorobenzoic acid (1.10 g, 5.80 mmol) and DIPEA (2.26
mL, 17.40 mmol) were added and stirred at room temperature
for 20 min, HATU (3.30 g, 8.70 mmol) was added and stirred
at room temperature for 6 h. TLC shows completion of starting
material. The reaction mixture was quenched with water,
extracted with ethyl acetate, the combined organic layer was
dried over sodium sulfate and concentrated under reduced
pressure, the obtained crude product was purified by column
chromatography using silica gel (100-200 mesh) and 5 %
methanol in dichloromethane as eluent, desired organic
fractions were distilled under reduced pressure to get methyl-
1-cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(3-5-dichloro-
benzoyl)piperazin-1-yl)quinoline-3-carboxylate.Yield (45 %,
1.35 g), m.p. 232-34 °C. 1H NMR (300 MHz, DMSO-d6) δ
ppm: 1.06 (s, 1H, cyclopropyl CH), 1.32-1.34 (d, 4H, cyclo-
propyl CH2), 3.40 (br-s, 4H, piperazine CH2), 3.60 (br-s, 4H,
piperazine CH2), 3.91 (s, 3H, OCH3), 7.42-7.62 (m, 5H), 7.90-
7.98 (d, 1H), 8.68 (s, 1H, N-C=C-H). IR (KBr, νmax, cm–1):
2922 (C-H Ar), 1710 (C=OOCH3), 1700 (C-CO-N), 1680
(C=O quinoline), 1564, 1469 (C=C aromatic), 1265 (C-O-C),
1380 (C-N st), 974 (C-H cyclopropyl).
Methyl-1-cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7-
(4-(4-methoxybenzoyl)piperazin-1-yl)quinoline-3-
carboxylate: A solution of methyl-1-cyclopropyl-6-fluoro-
1,4-dihydro-4-oxo-7-(piperazin-1-yl)quinoline-3-carboxylate
2g (5.80 mmol) in N,N-dimethylformamide (20 mL), 4-
methoxybenzoic acid (0.88 g, 5.80 mmol) and DIPEA (2.26
mL, 17.40 mmol) were added and stirred at room temperature
for 20 min, HATU (3.30 g, 8.70 mmol) was added and stirred
at room temperature for 6 h. TLC shows completion of starting
material. The reaction mixture was quenched with water,
extracted with ethyl acetate, the combined organic layer was
dried over sodium sulfate and concentrated under reduced
pressure, the obtained crude product was purified by column
chromatography using silica gel (100-200 mesh) and 5 %
methanol in dichloromethane as eluent, desired organic
fractions were distilled under reduced pressure to get methyl-
1-cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-methoxy-
benzoyl)piperazin-1-yl)quinoline-3-carboxylate.Yield (45 %,
1.25 g), m.p. 244-46 °C. 1H NMR (300 MHz, DMSO-d6) δ
EXPERIMENTAL
All commercially obtained reagents and solvents were
used as received. Reactions were monitored by TLC with silica
gel plates. Column chromatography was performed with silica
gel (100-200 mesh) as stationary phase. The melting points
determined were uncorrected. MS spectra of the synthesized
compounds were recorded on Shimadzu QP-5050 spectro-
photometer. 1H NMR spectra were acquired on a Varian-300
(300 MHz NMR ) spectrophotometer using CDCl3 and DMSO-
d6 as solvent. The infrared spectra were obtained using a Perkin
Elmer Spectrum ESVersion 10.5.3 Fourier-transform infrared
spectrometer. Elemental analysis was performed on FLASH
EA 1112 CHN Elemental analyzer, Thermofinnigen, Italy.
General procedure for synthesis of compounds 1-3
Methyl-1-cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-
(3-chlorobenzoyl)piperazin-1-yl)quinoline-3-carboxylate:
A solution of methyl-1-cyclopropyl-6-fluoro-1,4-dihydro-4-
oxo-7-(piperazin-1-yl)quinoline-3-carboxylate 2g (5.80 mmol)
in N,N-dimethylformamide (20 mL), 3-chlorobenzoic acid
(0.90 g, 5.80 mmol) and DIPEA (2.26 mL, 17.40 mmol) were
added and stirred at room temperature for 20 min, hexafluro-
phosphate azabenzotriazole tetramethyl uranium (HATU,
3.30 g, 8.70 mmol) was added and stirred at room temperature
for 6 h. TLC shows completion of starting material. The reac-
tion mixture was quenched with water, extracted with ethyl
acetate, the combined organic layer was dried over sodium
sulfate and concentrated under reduced pressure, the obtained
crude product was purified by column chromatography using
silica gel (100-200 mesh) and 5 % methanol in dichloromethane
as eluent, desired organic fractions were distilled under reduced
pressure to get methyl 1-cyclopropyl-6-fluoro-1,4-dihydro-4-
oxo-7-(4-(3-chlorobenzoyl)piperazin-1-yl)quinoline-3-
carboxylate. Yield (39 %, 1.09 g), m.p. 212-14 °C. 1H NMR
(300 MHz, CDCl3) δ ppm: 1.06 (s, 1H, cyclopropyl CH), 1.32-
1.34 (d, 4H, cyclopropyl CH2), 3.40 (br-s, 4H, piperazine CH2),
3.60 (br-s, 4H, piperazine CH2), 3.92 (s, 3H, OCH3), 7.42-
7.62 (m, 5H, Ar), 7.90-7.97 (d, 1H, Ar), 8.66 (s, 1H, N-C=C-
H). IR (KBr, νmax, cm–1): 2924 (C-H Ar), 1720 (C=OOCH3),
1700 (C-CO-N), 1680 (C=O quinoline), 1564, 1469 (C=CAr),
1380 (C-N st), 1260 (C-O-C), 974 (C-H cyclopropyl).
Methyl-1-cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7-
(4-(3-5-dichlorobenzoyl)piperazin-1-yl)quinoline-3-

2002 Deo et al.
Asian J. Chem.
ppm: 1.07 (s, 1H, cyclopropyl CH), 1.32-1.34 (d, 4H, cyclo-
propyl CH2), 3.40 (br-s, 4H, piperazine CH2), 3.60 (br-s, 4H,
piperazine CH2), 3.80 (s, 3H, Ph OCH3), 3.90 (s, 3H, COOCH3),
7.42-7.62 (m, 5H, Ar H), 7.90-7.98 (d, 1H, Ar H), 8.66 (s, 1H,
N-C=C-H). IR (KBr, νmax, cm–1): 2926 (C-H Ar), 1710
(C=OOCH3), 1700 (C-CO-N), 1680 (C=O quinoline), 1564,
1468 (C=C aromatic), 1262 (C-O-C), 1380 (C-N st), 974 (C-
H cyclopropyl).
148 (82). CHN analysis: C24H20Cl2FN3O4 Calcd. (%): C 57.16,
H 4.00, N 8.33, Found (%): C 57.17, H 4.04, N 8.36.
1-Cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(4-
methoxy benzoyl)piperazin-1-yl)quinoline-3-carboxylic
acid (3): A solution of methyl-1-cyclopropyl-6-fluoro-1,4-
dihydro-4-oxo-7-(4-methoxy benzoyl)piperazin-1-yl)quino-
line-3-carboxylate 4g (8.27 mmol) in methanol (55 mL) and
water (25 mL) LiOH·H2O (0.68 mL, 16.20 mmol) were added
and stirred at room temperature for 6 h. TLC shows completion
of starting material. The reaction mixture was concentrated
under reduced pressure, neutralized with 1N HCl extracted
with dichloromethane, the combined organic layer was dried
over sodiumsulphate and concentrated under vacuum to get
1-cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-methoxy-
benzoyl)piperazin-1-yl)quinoline-3-carboxylic acid.Yield (72
%, 2.73 g), m.p. 226-28 °C.1H NMR (300 MHz, DMSO-d6)δ
ppm: 1.08 (s, 1H, cyclopropyl CH), 1.32-1.34 (d, 4H, cyclo-
propyl 2CH2), 3.40 (br-s, 4H, piperazine CH2), 3.60 (br-s, 4H,
piperazine 2CH2), 3.70 (s, 3H, OCH3), 7.42-7.62 (m, 5H, Ar
H), 7.90-7.97 (d, 1H, Ar H), 8.68 (s, 1H, N-C=C-H), 15.20 (s,
1H, COOH). IR (KBr, νmax, cm–1): 3550 (OH st, COOH), 2922
(C-H Ar), 1717 (C=O, COOH), 1700 (C-CO-N), 1680 (C=O
quinoline), 1564, 1469 (C=C Ar), 1380 (C-N st), 974 (C-H
cyclopropyl). MS: m/z (relint %): 466 (21) [M+], 433 (28),
334 (26), 320 (28), 299 (100), 280 (31), 270 (38), 245 (41),
236 (44), 224 (45), 202 (48), 194 (72), 164 (78), 154 (58).
CHN analysis: C25H24FN3O5 Calcd. (%): C 64.51, H 5.20, N
9.00, Found (%): C 64.54, H 5.22, N 9.04.
1-Cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(3-
chlorobenzoyl)piperazin-1-yl)quinoline-3-carboxylic acid
(1): A solution of methyl-1-cyclopropyl-6-fluoro-1,4-dihydro-
4-oxo-7-(4-(3-chlorobenzoyl)piperazin-1-yl)quinoline-3-
carboxylate 4g (8.27 mmol) in methanol (55 mL) and water
(25 mL) LiOH·H2O (0.68 mL, 16.20 mmol) were added and
stirred at room temperature for 6 h. TLC shows completion of
starting material. The reaction mixture was concentrated under
reduced pressure, neutralized with 1 N HCl extracted with
dichloromethane, the combined organic layer was dried over
sodiumsulphate and concentrated under vacuum to get 1-cyclo-
propyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(3-chlorobenzoyl)-
piperazin-1-yl)quinoline-3-carboxylicacid. Yield (68 %, 2.63
g), m.p. 198-200 °C. 1H NMR (300 MHz, DMSO-d6) δ ppm:
1.09 (s, 1H, cyclopropyl CH), 1.31-1.33 (d, 4H, cyclopropyl
CH2), 3.40 (br-s, 4H, piperazine CH2), 3.57 (br-s, 4H,
piperazine CH2), 7.42-7.60 (m, 5H, Ar H), 7.90-7.95 (d, 1H,
Ar H), 8.66 (s, 1H, N-C=C-H), 15.18 (s, 1H, COOH). IR (KBr,
ν
max, cm–1): 2924 (C-H Ar), 1712 (C=O, COOH), 1700 (C-
CO-N), 1680 (C=O quinoline), 1564, 1469 (C=C aromatic),
1380 (C-N st), 974 (C-H cyclopropyl), 3550 (OH st, COOH).
MS: m/z (rel int %): 470 (22) [M+], 430 (29), 337 (28), 320
(41), 297 (100), 278 (42), 270 (48), 245 (56), 234 (64), 223
(73), 205 (66), 194 (51), 149 (48). CHN analysis: C24H21N3O4FCl
Calcd. (%): C 61.29, H 4.46, N 8.93, Found (%): C 61.33, H
4.47, N 8.95.
General procedure for synthesis of compounds 4-5
Methyl-1-ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(2-
phenoxyacetyl)piperazin-1-yl)quinoli ne-3-carboxylate: A
solution of methyl 1-ethyl-6-fluoro-1,4-dihydro-4-oxo-7-
(piperazin-1-yl)quinoline-3-carboxylate 1g (3.00 mmol) in
DMF (10 mL), 2-phenoxyacetic acid (1.97 g, 3.00 mmol),
DIPEA (0.5 mL), HATU (1.70 g, 4.50 mmol) were added at
room temperature and stirred for 6h. TLC shows completion
of starting material. The reaction mixture was quenched with
water, extracted with ethyl acetate, dried over sodium sulfate
and concentrated under reduced pressure to get crude com-
pound. The obtained crude was purified by silica gel column
chromatography by using 5 % methanol in dichloromethane
as a eluent to get Methyl-1-ethyl-6-fluoro-1,4-dihydro-4-oxo-
7-(4-(2-phenoxyacetyl)piperazin-1-yl)quinoline-3-carbo-
xylateas. Yield (55 %, 0.77 g), m.p. 205 °C. 1H NMR (300
MHz, DMSO) δ 1.40-1.46 (t, 3H, CH3), 2.86-2.90 (S, 4H,
piperazine CH2), 3.15-3.17 (d, 1H, -C=C-H), 3.70 (s, 4H,
piperazine CH2), 3.75 (q, 2H, CH2), 3.82 (s, 3H, OCH3), 4.89
(s, 2H, -CH2OPh), 7.12-7.15 (d, 1H, Ar H), 7.94.7.98 (d, 1H,
Ar H) 8.97 (s, 5H, Ar H). IR (KBr, νmax, cm–1): 2924 (C-H Ar),
1710 (C=O, COOH), 1700 (C=O, CCON), 1680 (C=O quino-
line), 1625, 1566, 1451 (C=C Ar), 1380, 1327 (C-N st), 1263
(C-O-C).
1-Cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(3,5-
dichlorobenzoyl)piperazin-1-yl)quinoline-3-carboxylic
acid (2): A solution of methyl-1-cyclopropyl-6-fluoro-1,4-
dihydro-4-oxo-7-(4-(3,5-dichlorobenzoyl)piperazin-1-
yl)quinoline-3-carboxylate 4g (8.27 mmol) in methanol (55
mL) and water (25 mL) LiOH·H2O (0.68 mL, 16.20 mmol)
were added and stirred at room temperature for 6 h. TLC shows
completion of starting material. The reaction mixture was
concentrated under reduced pressure, neutralized with 1 N HCl
extracted with dichloromethane, the combined organic layer
was dried over sodium sulphate and concentrated under vacuum
to get 1-cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(3-5-
dichlorobenzoyl)piperazin-1-yl)quinoline-3-carboxylic acid.
Yield (68 %, 2.64 g), m.p. 218-20 °C. 1H NMR (300 MHz,
DMSO-d6) δ ppm: 1.06 (s, 1H, cyclopropyl CH), 1.32-1.34
(d, 4H, cyclopropyl 2CH2), 3.40 (br-s, 4H, piperazine CH2),
3.60 (br-s, 4H, piperazine 2CH2), 7.42-7.62 (m, 5H, Ar H),
7.90-7.97 (d, 1H, Ar H), 8.68 (s, 1H, N-C=C-H), 15.20 (s, 1H,
COOH). IR (KBr, νmax, cm–1): 3550 (OH st, COOH), 2922 (C-
HAr), 1714 (C=O, COOH), 1700 (C-CO-N), 1680 (C=O quino-
line), 1564, 1469 (C=C Ar), 1380 (C-N st), 974 (C-H cyclo-
propyl). MS: m/z (relint %): 504 (18) [M+], 465 (22), 420 (28),
395 (32), 370 (36), 330 (39), 320 (45), 296 (100), 280 (48),
272 (61), 248 (68), 230 (56), 221 (66), 204 (78), 194 (72),
Methyl-1-ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(2-4-
chloro phenoxyacetyl)piperazin-1-yl)quinoline-3-carboxy-
late: A solution of methyl 1-ethyl-6-fluoro-1,4-dihydro-4-oxo-
7-(piperazin-1-yl)quinoline-3-carboxylate 1g (3.00 mmol) in
DMF (10 mL), 2-(4-chloro phenoxy) acetic acid (0.55 g, 3.00

Vol. 31, No. 9 (2019)
Synthesis and Biological Evaluation of Novel Diketoquinoline Analogues as HIV-1 Integrase Inhibitor 2003
mmol), DIPEA (0.5 mL), HATU (1.70 g, 4.50 mmol) were added
at room temperature and stirred for 6 h. TLC shows completion
of starting material. The reaction mixture was quenched with
water, extracted with ethyl acetate, dried over sodium sulfate
and concentrated under reduced pressure to get crude com-
pound. The obtained crude was purified by silica gel column
chromatography by using 5 % methanol in dichloromethane
as a eluent to get Methyl-1-ethyl-6-fluoro-1,4-dihydro-4-oxo-
7-(4-2-(4-chloro phenoxyacetyl)piperazin-1-yl)quinoline-3-
carboxylate. Yield (62 %, 0.93 g), m.p. 241-43 °C. 1H NMR
(300 MHz, DMSO) δ: 3.84 (s, 3H, OCH3), 1.40-1.46 (t, 3H,
CH3), 2.86-2.90 (S, 4H, piperazine H e, f), 3.70 (s, 4H, pipe-
razine H c, d), 4.59-4.61 (q, 2H, CH2), 7.12-7.15 (d, 1H,
aromatic Ha), 7.94.7.98 (d, 1H, aromatic Hb), 3.15-3.17 (d, 1H,
-C=C-H), 4.90 (s, 2H, -CH2OPh), 8.98 (s, 5H, aromatic H).
IR (KBr, νmax, cm–1): 2924 (C-H Ar), 1710 (C=O, COOH),
1700 (C=O, CCON), 1680 (C=O quinoline), 1625, 1566, 1451
(C=C Ar), 1380, 1328 (C-N st), 1264 (C-O-C).
4.59-4.61 (q, 2H, CH2), 4.90 (s, 2H, -CH2OPh), 7.12-7.15 (d,
1H, Ar H), 7.94.7.98 (d, 1H, ArH), 8.98 (s, 5H, ArH), 15.30
(s, 1H, COOH). IR (KBr, νmax, cm–1): 3550 (O-H st, COOH),
2924 (C-H Ar), 1710 (C=O, COOH), 1680 (C=O quinoline),
1625, 1566, 1451 (C=C Ar), 1380, 1328 (C-N st), 1264 (C-O-
C). MS: m/z (relint %) 488 (17) [M+], 474 (21), 445 (12), 432
(21), 405 (22), 384 (27), 342 (42), 312 (32), 293 (48), 277
(41), 251 (20), 222 (41), 208 (10), 194 (100), 168 (50), 144
(42). CHN analysis: C24H23N3O5ClF Calcd. (%): C 59.08, H
4.75, N 08.61, Found (%): C 59.10, H 4.82, N 8.65.
General procedure for synthesis of compounds 6-7
Methyl-1-ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(4-
methoxyphenylsulfonyl)piperazin-1-yl)quinoline-3-
carboxylate: A solution of methyl 1-ethyl-6-fluoro-1,4-dihydro-
4-oxo-7-(piperazin-1-yl)quinoline-3-carboxylate (1g, 3.00
mmol) in dichloromethane (20 mL), DIPEA (0.2 mL, 15.15
mmol), 4-methoxybenzene-1-sulfonyl chloride (0.62 g, 3.0
mmol) and HATU (1.70 g, 4.50 mmol) were added stirred at
room temperature for 6 h. TLC shows the completion of starting
material. The reaction mixture quenched with water extracted
with dichloromethane, dried over sodium sulfate and concen-
trated under reduced pressure to get crude. The obtained crude
was purified by silica gel column chromatography by to get
methyl1-ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(4-methoxy-
phenylsulfonyl)piperazin-1-yl)quinoline-3-carboxylate.Yield
1-Ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(2-phenoxy-
acetyl)piperazin-1-yl)quinoline-3-carboxylic acid (4): A
solution of methyl 1-ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-
(2-phenoxyacetyl)piperazin-1-yl)quinoline-3-carboxylate (1g,
2.14 mmol) in Methanol (16 mL), Water (6 mL). LiOH·H2O
(0.26 mL, 6.42 mmol) was added stirred at room temperature
for 6 h, TLC shows completion of starting material. The reac-
tion mixture was quenched wit 1 N HCl, extracted with dichloro-
methane, dried over sodium sulphate, concentrated under reduced
pressure, washed with hexane to get 1-ethyl-6-fluoro-1,4-
dihydro-4-oxo-7-(4-(2-phenoxyacetyl)piperazin-1-yl)quino-
line-3-carboxylic acid, Yield (65 %, 0.63 g), m.p. 196-98 °C.
1H NMR (300 MHz, DMSO-d6) δ ppm: 1.40-1.47 (t, 3H, CH3),
2.86-2.92 (S, 4H, piperazine CH2), 3.14-3.17 3.70 (s, 4H,
piperazine CH2), 4.59-4.63 (q, 2H, CH2), 7.12-7.17 (d, 1H, Ar
H), 7.96.7.98 (d, 1H, Ar H), (d, 1H, -C=C-H), 4.90 (s, 2H,
-CH2OPh), 8.96 (s, 5H, ArH). 15.34 (s, 1H, COOH). IR (KBr,
1
(75 %, 1.31 g), m.p. 186-88 °C. H NMR (300 MHz, DMSO-
d6) δ ppm: 1.38 (t, 3H, CH3), 3.05 (br-s, 4H, piperazine 2CH2),
3.36 (br-s, 4H, piperazine 2CH2), 3.85 (s, 3H, OCH3), 3.88 (s,
3H, OCH3), 4.53 (q, 2H, CH2CH3), 7.17-7.20 (d, 3H, Ar H),
7.71-7.75 (d, 2H, Ar H), 7.87-7.91 (d, 1H, Ar H), 8.94 (s, 1H,
CH=C). IR (KBr, νmax, cm–1): 2924 (C-HAr), 2852 (C-H alkyl),
1710 (C=O, COOCH3), 1684 (C=O quinoline), 1596, 1565
(C=C Ar), 1346, 1376 (C-N st), 1259 (C-O-C).
Methyl-1-ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(4-
ethoxyphenylsulfonyl)piperazin-1-yl)quinoline-3-carbo-
xylate: A solution of methyl 1-ethyl-6-fluoro-1,4-dihydro-4-
oxo-7-(piperazin-1-yl)quinoline-3-carboxylate (1g, 3.00
mmol) in dichloromethane (20 mL), DIPEA (0.2 mL, 15.15
mmol), 4-ethoxybenzene-1-sulfonyl chloride (0.66 mL, 3.0
mmol) and HATU (1.70 g, 4.50 mmol) were added stirred at
room temperature for 6 h. TLC shows the completion of starting
material. The reaction mixture quenched with water extracted
with dichloromethane, dried over sodium sulfate and concen-
trated under reduced pressure to get crude. The obtained crude
was purified by silica gel column chromatography by to get
methyl1-ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(4-ethoxyphe-
nylsulfonyl)piperazin-1-yl)quinoline-3-carboxylate. Yield (64
%, 0.99 g), m.p. 158-60 °C. 1H NMR (300 MHz, DMSO-d6) δ
ppm: 1.11 (t, 3H, CH3), 1.39-1.45 (t, 3H, CH3), 3.10 (br-s, 4H,
piperazine 2CH2), 3.20 (q, 2H, OCH2), 3.38 (br-s, 4H, piperazine
2CH2), 3.86 (s, 3H, OCH3), 4.55-4.62 (q, 2H, CH2), 7.16-7.20
(d, 3H, Ar H), 7.70-7.75 (d, 2H, Ar H), 7.87-7.92 (d, 1H, Ar H),
8.94 (s, 1H, CH=C). IR (KBr, νmax, cm–1): 2922 (C-HAr), 2854
(C-H alkyl), 1710 (C=O, COOCH3), 1684 (C=O quinoline),
1596, 1565 (C=C Ar), 1346, 1378 (C-N st), 1260 (C-O-C).
1-Ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(4-methoxy-
phenylsulfonyl)piperazin-1-yl)quino line-3-carboxylic acid
ν
max, cm–1): 3638 (O-H, COOH), 2924 (C-H Ar), 1710 (C=O,
COOH), 1680 (C=O quinoline), 1625, 1566, 1451 (C=C Ar),
1380, 1327 (C-N st), 1263 (C-O-C). MS: m/z (relint %) 454
(11) [M+], 430 (18), 402 (21), 388 (15), 356 (29), 309 (24),
297 (41), 278 (40), 270 (62), 245 (54), 234 (24), 223 (44),
205 (100), 194 (72), 149 (58). CHN analysis: C24H24N3O5F
Calcd. (%): C 63.57, H 5.33, N 09.27, Found (%): C 63.62, H
5.38, N 9.34.
1-Ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(2-4-chloro
phenoxyacetyl)piperazin-1-yl)quino line-3-carboxylic acid
(5): A solution of methyl 1-ethyl-6-fluoro-1,4-dihydro-4-oxo-
7-(4-(2-4-chloro phenoxyacetyl)piperazin-1-yl)quinoline-3-
carboxylate (1g, 2.14 mmol) in methanol (16 mL), water (6
mL). LiOH·H2O (0.26 mL, 6.42 mmol) was added stirred at
room temperature for 6 h. TLC shows completion of starting
material. The reaction mixture was quenched wit 1 N HCl,
extracted with dichloromethane, dried over sodium sulphate,
concentrated under reduced pressure, washed with hexane to
get 1-ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(2-4-chlorophe-
noxyacetyl)piperazin-1-yl)quinoline-3-carboxylicacid, Yield
(70 %, 0.72 g), m.p. 227-29 °C. 1H NMR (300 MHz, DMSO-
d6) δ ppm: 1.40-1.46 (t, 3H, CH3), 2.86-2.90 (S, 4H, piperazine
CH2), 3.15-3.17 (d, 1H, -C=C-H), 3.70 (s, 4H, piperazine CH2),

2004 Deo et al.
Asian J. Chem.
(6): A solution of methyl 1-ethyl-6-fluoro-1,4-dihydro-4-oxo-
7-(4-(4-methoxyphenylsulfonyl)piperazin-1-yl)quinoline-3-
carboxylate (0.8 g, 1.59 mmol) in THF (7 mL), methanol
(1 mL) and water (3 mL). LiOH·H2O (0.19 g, 4.77 mmol) was
added and stirred at room temperature for 6 h. TLC shows the
completion of starting material. The reaction mixture neutra-
lized with 1 N HCl extracted with dichloromethane, dried over
sodium sulphate, concentrated under reduced pressure and
washed with hexane to get 1-ethyl-6-fluoro-1,4-dihydro-4-oxo-
7-(4-(4-methoxyphenylsulfonyl)piperazin-1-yl)quinoline-3-
carboxylic acid,Yield (70 %, 0.53 g), m.p. 178-80 °C.1H NMR
(300 MHz, DMSO-d6) δ ppm: 1.36 (t, 3H, CH3), 3.05 (br-s,
4H, piperazine 2CH2), 3.38 (br-s, 4H, piperazine 2CH2), 3.86
(s, 3H, OCH3), 4.55 (q, 2H, CH2CH3), 7.18-7.20 (d, 3H, Ar
H), 7.71-7.74 (d, 2H, Ar H), 7.87-7.90 (d, 1H, Ar H), 8.93 (s,
1H, CH=C), 15.27 (s, 1H, COOH). MS, M+ 489.8. IR (KBr,
purchased from Sigma; 2-ME (2-mercapto ethanol) was pur-
chased from Bio-Rad. RPMI-1640 and fetal bovine serum
(FBS) were purchased from Gibco.
C8166 cells and HIV-1IIIB were kindly donated by Medical
Research Council,AIDS Regent Project. The cells were main-
tained at 37 °C in 5 % CO2 in RPMI-1640 medium supple-
mented with 10 % heat-inactivating FBS (Gibco). HIV-1IIIB
was prepared from the supernatants of H9/HIV-1IIIB cells. The
50 % HIV-1 tissue culture infectious dose (TCID50) in C8166
cells was determined and calculated by Reed and Muench
method [8,9].Virus stocks were stored in small aliquots at -76
°C. The titer of virus stock was 1.0 × 108 TCID50 per mL.
in vitro assays
Inhibition of syncytia formation: The inhibition effect
of samples on acute HIV-1 infection was measured by the
syncytia formation assay. In the presence or absence of various
concentrations of samples, 4 × 104 C8166 cells were infected
with HIV-1 at a multiplicity of infection (MOI) of 0.04 and
cultured in 96-well plates at 37 °C in 5 % CO2 for 72 h. NVP was
used as a positive control. At 72 h post-infection, cytopathic
effect (CPE) was measured by counting the number of syncytia
(multinucleated giant cell) in each well of 96 well plates under
an inverted microscope (100×). The inhibitory percentage of
syncytia formation was calculated by the percentage of syncytia
number in treated sample compared to that in infected control.
50 % effective concentration (EC50) was calculated [10].
Cytotoxicity: The cellular toxicity of compounds on
C8166 was assessed by MTT colorimetric assay [9]. Briefly,
100 µL of 4 × 105 cells were plated into 96-well plates, 100 µL
of various concentrations of compounds was added and incu-
bated at 37 °C in a humidified atmosphere of 5 % CO2 for 72 h.
Discard 100 µL supernatant, MTT reagent was added and
incubated for 4 h, 100 µL 50 % DMF-15 % SDS was added.
After the formazan was dissolved completely, the plates were
analyzed by a Bio-Tek ELx 800 ELISA reader at 570 nm/630
nm. 50 % cytotoxicity concentration (CC50) was calculated.
Integrase assays: The enzymatic integration reactions
were carried out with minor modifications as described previ-
ously [11]. To determine the susceptibility of the HIV-1 integrase
enzyme to different compounds, we used an enzyme-linked
immunosorbent assay (ELISA) adapted from Hwang et al. [8].
The overall integration assay uses an oligonucleotide substrate
for which one oligonucleotide (5'-ACTGCTAGAGATTTTCC
ACACTGACTAAAAGGGTC-3')is labeled with biotin at the
3' end and the other oligonucleotide(5'-GACCCTTTTAGTCA
GTGTGGAAAATCTCTAGCAGT-3') is labeled with
digoxigenin at the 5' end. For the strand transfer assay, apre-
cleaved oligonucleotide substrate (the second oligonucleotide
lacks GT [underlined] at the 3' end) was used. The integrase
enzyme was diluted in 750 mM NaCl, 10 mM Tris (pH 7.6),
10 % glycerol and 1 mM β-mercaptoethanol. To perform the
reaction, 4µL of diluted integrase (corresponding to a concen-
tration of1.6 µM) and 4 µL of annealed oligonucleotides (7nM)
were added in a final reaction volume of 40 µL containing
10 mM MgCl2, 5 mM dithiothreitol, 20 mM HEPES (pH 7.5),
5 % polyethyleneglycol and 15 % dimethyl sulfoxide.As such,
the final concentrationof integrase in this assay was 160 nM.
The reaction was carried outfor 1 h at 37 °C. Reaction products
ν
max, cm–1): 3550 (OH, COOH), 2924 (C-H Ar), 2852 (C-H
alkyl), 1714 (C=O, COOH), 1684 (C=O quinoline), 1596, 1565
(C=CAr), 1346, 1376 (C-N st), 1259 (C-O-C). MS: m/z (relint
%) 490 (12) [M+], 472 (11), 451 (12), 432 (16), 404 (21), 375
(24), 348 (31), 326 (33), 302 (16), 280 (31), 255 (33), 218
(65), 202 (100), 184 (68), 166 (24), 145 (40), 125 (44), 102
(48). CHN analysis: C23H24N3O6SF Calcd. (%): C 56.38, H
4.90, N 8.58, Found (%): C 56.42, H 4.94, N 8.62.
1-Ethyl-6-fluoro-1,4-dihydro-4-oxo-7-(4-(4-ethoxy-
phenylsulfonyl)piperazin-1-yl)quinoline-3-carboxylic acid
(7): A solution of methyl1-ethyl-6-fluoro-1,4-dihydro-4-oxo-
7-(4-(4-ethoxyphenylsulfonyl)piperazin-1-yl)quinoline-3-
carboxylate (0.8 g, 1.59 mmol) in THF (7 mL), methanol
(1 mL) and water (3 mL). LiOH·H2O (0.19 g, 4.77 mmol) was
added and stirred at room temperature for 6 h. TLC shows the
completion of starting material. The reaction mixture neutra-
lized with 1NHCl extracted with dichloromethane, dried over
sodium sulphate, concentrated under reduced pressure and
washed with hexane to get 1-ethyl-6-fluoro-1,4-dihydro-4-
oxo-7-(4-(4-ethoxyphenylsulfonyl)piperazin-1-yl)quinoline-
3-carboxylic acid, Yield (58 %, 0.44 g), m.p. 150-52 °C. 1H
NMR (300 MHz, DMSO-d6) δ ppm: 1.22 (t, 3H, CH3), 1.38 (t,
3H, CH3), 3.10 (br-s, 4H, piperazine 2CH2), 3.20 (q, 2H, OCH2),
3.38 (br-s, 4H, piperazine 2CH2), 4.54 (q, 2H, CH2CH3), 7.16-
7.20 (d, 3H, ArH), 7.70-7.75 (d, 2H, Ar H), 7.88-7.92 (d, 1H,
Ar H), 8.94 (s, 1H, CH=C), 15.30 (s, 1H, COOH). IR (KBr,
ν
max, cm–1): 3550 (O-H st, COOH), 2922 (C-H Ar), 2856 (C-H
alkyl), 1682 (C=O quinoline), 1596, 1566 (C=C Ar), 1346,
1376 (C-N st), 1260 (C-O-C). MS: m/z (relint %) 504 (10)
[M+], 484 (8), 468 (16), 448 (21), 424 (20), 386 (20), 355
(36), 340 (38), 312 (18), 290 (38), 266 (38), 249 (48), 222
(82), 194 (100), 178 (28), 154 (41), 136 (48) 122 (48), 102
(51). CHN analysis: C24H26N3O6SF Calcd. (%): C 57.25, H
5.20, N 8.34, Found (%): C 57.30, H 5.25, N 8.40.
Biological assays
Cells and viruses: Assay was performed in Laboratory
of Molecular Immunopharmacology, Kunming Institute of
Zoology, Chinese Academy of Science. Reagents were pro-
cured in laboratory as HEPES (N-2(2-hydroxyothyl)pipera-
zine-N’-(2-ethanesufonic acid), MTT (3-(4,5-dimethylthiazol-
2-yl)-2,5-diphenyl tetrazolium bromide), DMF (N,N’-dimethyl
formamine), penicillin, streptomycin sulfate, glutamine were

Vol. 31, No. 9 (2019)
Synthesis and Biological Evaluation of Novel Diketoquinoline Analogues as HIV-1 Integrase Inhibitor 2005
were denatured with 30 mM NaOH and detected by ELISA
on avidin-coated plates. For determining the effect of com-
pounds on the 3’processing activity a classical cleavage assay
with detection of products by denaturating gelelectrophoresis
was performed as described previousluy [10,11]. Briefly,
0.2 pmol of the radioactive labeled oligonucleotide substrate
(INT1, 32P-5’ TGTGGAAAATCTCTAGCAGT 3’; INT2,5’-
ACTGCTAGAGATTTTCCACA 3’) and 10 nmol integrase in
a final volume of 10 µL was incubated for 1 h at 37°C. The final
reaction mixture contained 20 mM HEPES pH 7.5), 5 mM
dithiothreitol (DTT), 10 mM MgCl2, 0.5 % (v/v) polyethylene
glycol 8000, 15 % DMSO, integrase was diluted previosly in
750 mM NaCl, 10 mM Tris (pH 7.6), 10 % glycerol and 1 mM
β-mercaptoethanol. The reactions were stopped by the addition
of formamide loading buffer (95 % formamide, 0.1 % xylene
cyanol, 0.1 % xylene cyanol, 0.1 % bromophenol blue and
0.1 % sodium dodecyl sulfate). Samples were loaded on a 15 %
denaturating polyacrylamide/ureum gel. The extent of 3’
processing or DNA strand transfer was based on measuring
the respective amounts of -2 bands or strand transfer products
relative to the intensity of the total radioactivity present in the
lane. These data were determined using the Opti QuantAcqui-
sition andAnalysis software (Perkin Elmer Corporate, Fremont,
CA).
Drug susceptibility assay: The inhibitory effect of antiviral
drugs on the HIV-induced CPE in MT-4 cell culture was deter-
mined by the MTT-assay [9]. This assay is based on the reduc-
tion of the yellow coloured 3-(4,5-dimethylthiazol-2yl)-2,5-
diphenyltetrazolium bromide (MTT) by mitochondrial dehydro-
genase of metabolically active cells to a blue formazan derivative,
which can be measured spectrophotometrically. The 50 % cell
culture infective dose of the HIV strains was determined by
titration of the virus stock using MT-4 cells. For the drug suscep-
tibility assays,MT-4 cells were infected with 100 to 300 50 %
cell culture infectivedoses of the HIV strains in the presence
of fivefold serial dilution of the antiviral drugs. The concen-
tration of the compound achieving 50 % protection against
the CPE of HIV, which is definedas the 50 % effective concen-
tration (IC50), was determined. Theconcentration of the compound
destroying 50 % of the MT-4 cells, which is defined as the 50
% cytotoxic concentration (CC50), was determined as well.
The crystal structure was obtained from the protein data bank,
PDB ID: 1qs4. The protein preparation was carried out using
‘protein preparation wizard’ in Maestro 8.0 in two steps, pre-
paration and refinement. Grids were generated centering onco-
crystalized ligand. The ligands were developed using maestro
build panel and prepared by Ligprep 2.2 module that produces
the low energy conformer of ligands using OPLS 2005 force
field.The low energy conformation of the ligands was selected
and docked into the grid generated from protein structures
using standard precision (SP) docking mode.
RESULTS AND DISCUSSION
Design of the compounds: The design for the series of
compounds to be considered for study was performed using
virtual screening protocol [12-14]. Considering the pharma-
cophoric requirements and the standard compound elvitegravir,
the zinc database was explored. The in silico screened com-
pounds were then tested for Lipinsky rule of five to evaluate
drug likeness, which becomes an essential tool to facilitate
drug discovery. The novelty of compounds in terms of HIV-1
Integrase inhibitory activity was checked over SciFinder. These
virtually screened hits were synthesized along with its
derivatives and evaluated for their inhibitory potential.
It was found that diketoquinolines have not been much
explored for HIV-I integrase activity. Hence, we studied the
diketoquinoline motif for integrase inhibition. A series of
compound were synthesized as diketoquinoline analogues.
Chemistry: The target diketoquinolines (1-7) were prepared
from the commercially procured intermediates such as methyl-
1-cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7-(piperazin-1-yl)-
quinoline-3-carboxylate and 1-ethyl-6-fluoro-1,4-dihydro-4-
oxo-7-(piperazin-1-yl)quinoline-3-carboxylate [15-20]. The
synthetic route is outlined in Scheme-I. All the carboxylate
compounds were reacted with substituted benzoic acid, phenoxy
acetic acid and benzene-1-sulfonyl chloride via substitution
of hydrogen of piperazine in presence of DIPEA (N,N-di
isopropyl ethyl amine) to produce intermediate compound in
an excellent yield. The ester linkage in intermediate compound
(COOCH3) is hydrolyzed to carboxylic acid (COOH) in alkaline
medium in the presence of aqueous lithium hydroxide to yield
the target compounds 1-7. The conformation of removal of
C-Cl and attachment of substituted compounds and conversion
of carboxylate to carboxylic acid verified by spectral analysis.
Biological activity: Diketoquinolines derivatives (1-7)
were tested in vitro for their cytotoxicity assay and inhibition
Molecular modeling
Docking: The molecular docking tool, GLIDE was used
for ligand docking studies into the HIV-1 Integrase pocket.
O
O
O
O
O
O
F
F
O
F
O
a
b
OH
N
N
X
N
N
X
N
N
X
HN
N
N
R4
R4
1 - 3
4 - 7
= X =
= X =
1-3
-C2H5
= R4 = ClPhCO,Cl2PhCO,OCH3PhCO
4-5 = R4 = PhOCH2CO,Cl2PhOCH2CO
6-7
= R4 = OCH3PhSO2 ,OC2H5PhSO2
Scheme-I: Reagents and conditions: (a) DMF/dichloromethane, DIPEA, substituted benzoic acid/2-phenoxy acetic acid/benzene sulphonyl chloride,
HATU stirred 6 h; (b) methanol, water, LiOH·H2O, stirred 6 h

2006 Deo et al.
Asian J. Chem.
of syncytia formation using a MTT and CPE method [8,9].
CC50 and EC50 values were generated from duplicate experi-
ments in µM and selective index also calculated using dose
response curves Table-1.As already observed for diketoquino-
lines derivative series [21], acidic derivatives were more potent
with a high selectivity against integrase. The replacement of
hydrophobic ring from C6 of elvitegravir by flourine and C7
by substituted piperazine group and further benzene groups
does not lead to significant improvement in HIV-1 integrase
inhibition. Substitution at quinoline ‘N’by ethyl and piperazine
‘N’ by hydrophobic phenoxy carbonyl and sulphonyl group
4-7 showed EC50 of 0.10 and 0.08 µM against integrase enzyme
respectively. This suggests that substitution of quinoline ‘N’
by alkyl and hydrophobic moiety at piperazine ‘N’ affect the
ability of the inhibitors to bind with integrase enzyme. Other
substitution does not make any significant interaction with
HIV-1 integrase enzyme Table-2.
Molecular docking: The binding mechanisms of synthe-
sized compounds were investigated using molecular docking
studies. The docking studies for the designed and synthesized
molecules were performed using Schrodinger Suite. The
molecular docking tool, GLIDEwas used for ligand docking
studies into the HIV-1 integrase pocket [22-24]. The crystal
structure of HIV-1 integrase was obtained from the protein
data bank, PDB ID: 1QS4. The protein preparation was carried
out using ‘protein preparation wizard’ in Maestro 8.0 in two
steps, preparation and refinement. Grids were generated cen-
tering on co-crystallized ligand. The ligands were developed
using maestro build panel and prepared by Ligprep 2.2 module
that produces the low energy conformer of ligands using OPLS
2005 force field.The low energy conformation of the ligands
was selected and docked into the grid generated from protein
structures using standard precision (SP) docking mode.
As per the literature, the active site comprises of Thr 66,
Lys 156, Lys 159 and DDE motif (Asp 64, Asp 116 and Glu
152). The docking poses revealed the interaction of few ligands
with desired amino acids. The standard drug elvitegravir had
docking score of -8.931402 and displayed interactions with
lys156, Asn155, Lys159 and Thr66. When raltegravir and
nevirapine were docked in the same active site, they displayed
comparable docking scores and interaction patterns. Ralte-
gravir revealed hydrogen bonding with Asp 116 while nevira-
pine showed hydrogen bonding with Asp 64. The synthesized
compounds which displayed fair integrase inhibition were also
docked to ascertain the interactions and were compared with
standard pose. Compound 6, 7 had maximum potency with
EC50 of 0.08 mM and 0.08 mM in enzyme inhibition and cell
line assay respectively. The docking analysis also shows that
though the compounds favoured interactions with desired
amino acids but none of the compounds could show inter-
TABLE-1
CYTOTOXICITY AND INHIBITION OF SYNCYTIUM FORMATION ACTIVITIES OF COMPOUNDS 1-7
Therapeutic
index (TI)
Compd. No.
Experiment
Cytotoxicity assay
Inhibition of syncytium formation
Cytotoxicity assay
Inhibition of syncytium formation
Cytotoxicity assay
Inhibition of syncytium formation
Cytotoxicity assay
Inhibition of syncytium formation
Cytotoxicity assay
Inhibition of syncytium formation
Cytotoxicity assay
Inhibition of syncytium formation
Cytotoxicity assay
Inhibition of syncytium formation
Cytotoxicity assay
Method
CC50 (µM)
EC50 (µM)
MTT
CPE
MTT
CPE
MTT
CPE
MTT
CPE
MTT
CPE
MTT
CPE
MTT
CPE
MTT
CPE
160
–
170
–
175
–
> 200
–
> 200
–
> 200
–
> 200
–
> 200
–
–
0.35
–
0.32
–
0.30
–
0.23
–
0.22
–
0.18
–
0.17
–
0.016
1
457
531
2
3
583
4
869
5
909
6
7
1111
1176
12500
Nevirapine
Inhibition of syncytium formation
TABLE-2
CORRELATION OF DOCKING SCORE AND CYTOTOXICITY AND
ANTI-INTEGRASE ACTIVITIES OF SYNTHESIZED COMPOUNDS 1-7
Compd. No.
Docking score
-8.839481
-8.865308
-8.884674
-9.715626
-9.989743
-10.583468
-10.884390
-4.291
EC50 (µM)
0.15
CC50 (µM)
192
188
188
>200
>200
>200
>200
Not determined
Selective index
1280
1342
1446
2000
2000
1
2
3
4
5
6
7
0.14
0.13
0.10
0.10
0.08
0.08
0.0111
2500
2500
Raltegravir
Not determined
Note: When data indicate > 200 for EC50 and CC50 it means that the compounds were neither active not toxic at 200 µM, which is the highest
concentration we can test to stay in the DMSO tolerance levels. When data indicate a number lower than 200 for EC50 and then the same number
with the equality sign in the CC50 it means that we observed toxicity at this concentration.

Vol. 31, No. 9 (2019)
Synthesis and Biological Evaluation of Novel Diketoquinoline Analogues as HIV-1 Integrase Inhibitor 2007
Elvitegravir
Compound 6
Fig. 2. Docked view for quinolonyl diketo compounds
actions with the important Mg ions i.e. Mg1001 and Mg1002.
The docking scores are given in Table-2 and Fig. 2 represents
the docked view.
REFERENCES
1. Z. Hajimahdi and A. Zarghi, Iran. J. Pharm. Res., 15, 595 (2016).
2. Y. Mehellou and E. De Clercq, J. Med. Chem., 53, 521 (2010);
https://doi.org/10.1021/jm900492g.
3. O. Tabarrini, S. Massari and V. Cecchetti, Future Med. Chem., 2, 1161
(2010);
Conclusion
In order to elucidate the binding mode of diketoacid quino-
lonyl series of compounds, new derivatives were synthesized
by replacing the 6-position with flourine atom in place of
substituted hydrophobic benzyl moiety of elvitegravir and
substitution at 7-position by substituted piperazine, benzoic
acid, 2-phenoxyacetic acid and benzene-1-sulfonyl chloride.
These compounds were evaluated for their enzymatic activity.
The replacement of hydrophobic ring from C6 of elvitegravir
by F and C7 by piperazine group does not lead to significant
improvement in HIV-1 integrase inhibition. Substitution at
quinoline N by ethyl and piperazine N by sulphonyl group 6,
7 showed IC50 value 0.08 and 0.08 µM against integrase
enzyme. This result suggests that substitution of quinoline N
by alkyl and hydrophobic moiety at piperazine N by phenyl
carbonyl and sulphonyl effect on the ability of the inhibi-
tors to bind with integrase enzyme. Other substitution does
not make any significant interaction with HIV-1 integrase
enzyme.
https://doi.org/10.4155/fmc.10.208.
4. F. Clavel and A.J. Hance, Engl. J. Med., 350, 1023 (2004);
https://doi.org/10.1056/NEJMra025195.
5. N.F. Crum, R.H. Riffenburgh, S. Wegner, B.K.Agan, S.A. Tasker, K.M.
Spooner, A.W. Armstrong, S. Fraser and M.R. Wallace, J. Acquir.
Immune Defic. Syndr., 41, 194 (2006);
https://doi.org/10.1097/01.qai.0000179459.31562.16.
6. M.F. Dybul, A.S. Bartlett, J.G. Kaplan and A.K. Pau, Ann. Intern. Med.,
137, 381 (2002);
https://doi.org/10.7326/0003-4819-137-5_Part_2-200209031-00001.
7. A. Engelman and P. Cherepanov, Nat. Rev. Microbiol., 10, 279 (2012);
https://doi.org/10.1038/nrmicro2747.
8. Y. Hwang, D. Rhodes and F. Bushman, Nucleic Acids Res., 28, 4884
(2000);
https://doi.org/10.1093/nar/28.24.4884.
9. R. Pauwels, J. Balzarini, M. Baba, R. Snoeck, D. Schols, P. Herdewijn,
J. Desmyter and E. De Clercq, J. Virol. Methods, 20, 309 (1988);
https://doi.org/10.1016/0166-0934(88)90134-6.
10. F. Christ, K. Busschots, J. Hendrix, M. McNeely, Y. Engelborghs and
Z. Debyser, ed.: N. Neamati, Assays for Evaluation of HIV1 Integrase
EnzymaticActivity, DNA Binding and Cofactor Interaction, John Wiley
& Sons, Inc. (2011).
11. Z. Debyser, P. Cherepanov,W. Pluymers and E. De Clercq, ed.: C.H. Schein,
Assays for the Evaluation of HIV-1 Integrase Inhibitors, In: Methods
in Molecular Biology, Nuclease Methods and Protocols, Humana Press,
Totowa, N.J., p. 139, 160 (2001).
ACKNOWLEDGEMENTS
12. A.L. Hopkins, J. Ren, J. Milton, R.J. Hazen, J.H. Chan, D.I. Stuart and
The authors are grateful to The Director and Laboratory
of Molecular Immunopharmacology, Kunming Institute of
Zoology, Chinese Academy of Science, Kunming, Yunnan,
P.R. China for carried out anti-HIV activity of compounds
and support. Thanks are also due to Prof.Dr. H.N. Patel, R.C.
Patel College of Pharmacy, Shirpur, India for providing kind
support in molecular modeling study.
D.K. Stammers, J. Med. Chem., 47, 5912 (2004);
https://doi.org/10.1021/jm040071z.
13. G.A. Freeman, C.W.Andrews,A.L. Hopkins, G.S. Lowell, L.T. Schaller,
J.R. Cowan, S.S. Gonzales, G.W. Koszalka, R.J. Hazen, L.R. Boone,
R.G. Ferris, K.L. Creech, G.B. Roberts, S.A. Short, K. Weaver, D.J.
Reynolds, J. Milton, J. Ren, D.I. Stuart, D.K. Stammers and J.H. Chan,
J. Med. Chem., 47, 5923 (2004);
https://doi.org/10.1021/jm040072r.
14. M. Sato, T. Motomura, H. Aramaki, T. Matsuda, M. Yamashita, Y. Ito,
H. Kawakami, Y. Matsuzaki, W. Watanabe, K. Yamataka, S. Ikeda, E.
Kodama, M. Matsuoka and H. Shinkai, J. Med. Chem., 49, 1506 (2006);
https://doi.org/10.1021/jm0600139.
15. Z. Luo, C. Zeng, F. Wang, H. He, C. Wang, H. Du and L. Hu, Chem.
Res. Chin. Univ., 25, 841 (2009).
CONFLICT OF INTEREST
The authors declare that there is no conflict of interests
regarding the publication of this article.

2008 Deo et al.
Asian J. Chem.
16. N. Ahmed, K.G. Brahmbhatt, S. Sabde, D. Mitra, I.P. Singh and K.K.
Bhutani, Bioorg. Med. Chem., 18, 2872 (2010);
https://doi.org/10.1016/j.bmc.2010.03.015.
17. D. Sriram, T.R. Bal and P. Yogeeswari, Bioorg. Med. Chem., 12, 5865
(2004);
https://doi.org/10.1016/j.bmc.2004.08.028.
18. S. Chen, R. Chen, M. He, R. Pang, Z. Tan and M. Yang, Bioorg. Med.
Chem., 17, 1948 (2009);
21. R. Di Santo, R. Costi, A. Roux, M. Artico, A. Lavecchia, L. Marinelli,
E. Novellino, L. Palmisano, M. Andreotti, R. Amici, C.M. Galluzzo,
L. Nencioni, A.T. Palamara, Y. Pommier and C. Marchand, J. Med.
Chem., 49, 1939 (2006);
https://doi.org/10.1021/jm0511583.
22. M. Billamboz, F. Bailly, M.L. Barreca, L. De Luca, J.-F. Mouscadet,
C. Calmels, M.-L. Andréola, M. Witvrouw, F. Christ, Z. Debyser and
P. Cotelle, J. Med. Chem., 51, 7717 (2008);
https://doi.org/10.1016/j.bmc.2009.01.038.
https://doi.org/10.1021/jm8007085.
19. L. Sancineto, N. Iraci, M.L. Barreca, S. Massari, G. Manfroni, G.
Corazza, V. Cecchetti, A. Marcello, D. Daelemans, C. Pannecouque
and O. Tabarrini, Bioorg. Med. Chem., 22, 4658 (2014);
https://doi.org/10.1016/j.bmc.2014.07.018.
23. M. Billamboz, F. Bailly, C. Lion, C. Calmels, M.-L. Andréola, M.
Witvrouw, F. Christ, Z. Debyser, L. De Luca,A. Chimirri and P. Cotelle,
Eur. J. Med. Chem., 46, 535 (2011);
https://doi.org/10.1016/j.ejmech.2010.11.033.
20. C. Bénard, F. Zouhiri, M. Normand-Bayle, M. Danet, D. Desmaële, H.
Leh, J.-F. Mouscadet, G. Mbemba, C.-M. Thomas, S. Bonnenfant, M.
Le Bret and J. d’Angelo, Bioorg. Med. Chem. Lett., 14, 2473 (2004);
https://doi.org/10.1016/j.bmcl.2004.03.005.
24. S. Ghanei, H. Eshghi and J. Lari, J. Chem. Pharm. Res., 7, 428 (2015).