Novel targeted system to deliver chemotherapeutic drugs to EphA2-expressing cancer cells

Article abstract of DOI:10.1021/jm201743s

The efficacy of anticancer drugs is often limited by their systemic toxicities and adverse side effects. We report that the EphA2 receptor is overexpressed preferentially in several human cancer cell lines compared to normal tissues and that an EphA2 targeting peptide (YSAYPDSVPMMS) can be effective in delivering anticancer agents to such tumors. Hence, we report on the synthesis and characterizations of a novel EphA2-targeting agent conjugated with the chemotherapeutic drug paclitaxel. We found that the peptide-drug conjugate is dramatically more effective than paclitaxel alone at inhibiting tumor growth in a prostate cancer xenograft model, delivering significantly higher levels of drug to the tumor site. We believe these studies open the way to the development of a new class of therapeutic compounds that exploit the EphA2 receptor for drug delivery to cancer cells.

Full text of DOI:10.1021/jm201743s

Article
pubs.acs.org/jmc
Novel Targeted System To Deliver Chemotherapeutic Drugs to
EphA2-Expressing Cancer Cells
Si Wang, William J. Placzek, John L. Stebbins, Sayantan Mitra, Roberta Noberini, Mitchell Koolpe,
Ziming Zhang, Russell Dahl, Elena B. Pasquale, and Maurizio Pellecchia*
Cancer Research Center, Sanford-Burnham Medical Research Institute, 10901 N. Torrey Pines Road, La Jolla, California 92037,
United States
S
* Supporting Information
ABSTRACT: The efficacy of anticancer drugs is often limited
by their systemic toxicities and adverse side effects. We report
that the EphA2 receptor is overexpressed preferentially in
several human cancer cell lines compared to normal tissues
and that an EphA2 targeting peptide (YSAYPDSVPMMS) can
be effective in delivering anticancer agents to such tumors.
Hence, we report on the synthesis and characterizations of a
novel EphA2-targeting agent conjugated with the chemo-
therapeutic drug paclitaxel. We found that the peptide−drug
conjugate is dramatically more effective than paclitaxel alone at inhibiting tumor growth in a prostate cancer xenograft model,
delivering significantly higher levels of drug to the tumor site. We believe these studies open the way to the development of a new
class of therapeutic compounds that exploit the EphA2 receptor for drug delivery to cancer cells.
reduce the risk of induced immune responses, but it cannot
eliminate immunogenicity completely.
INTRODUCTION
■
Current cancer therapy relies heavily on indiscriminate, highly
toxic, chemotherapeutic agents resulting in systemic toxicity
and adverse side effects. For instance, the mitotic inhibitor,
paclitaxel, is widely utilized in cancer treatment even though it
is highly toxic and only a small portion of the delivered dose
reaches the tumor.1 An ideal solution to such chemotherapeutic
limitations would be the selective delivery of anticancer drugs
to tumor tissues. To this end, recent advances in our
understanding of the cell surface proteome of cancer cells as
well as cells of the tumor microenvironment have led to the
identification of a number of tumor specific cell surface
biomarkers.2 Attempts to exploit these targets have thus far
focused on developing a variety of agents including antibodies,
polymers, polyunsaturated fatty acids, vitamins, hormones, and
peptides as selective tumor-homing reagents coupled to a
variety of anticancer or imaging agents.2,3
The most advanced tumor-homing molecules among these
make use of humanized monoclonal antibodies. Such
compounds rely on the selective nature of antibodies to
specifically bind to targets that have been identified on the
surface of cancer cells. These antibodies function as drug
delivery agents, serving to increase the local concentration of
payload drugs at or near the tumor site. Monoclonal antibody-
based cancer therapeutics are currently being evaluated in a
number of clinical trials (www.cancer.gov). However, while
antibodies can display high affinity and tumor specificity, they
suffer from clinical limitations. For example, the formulation
and preparation of homogeneous antibody−drug conjugates
present challenges due to the many factors that can affect
protein stability.4 Moreover, humanization of antibodies may
In this regard, short peptides that bind to tumor-specific
targets show a great deal of promise for selective tumor
targeting. Phage display technology and combinatorial chem-
istry methods have identified highly tumor specific peptide
sequences capable of selectively binding cancer cell-specific
targets.5 Conjugation of known chemotherapeutic agents to
these peptides at specific sites results in a homogeneous drug/
peptide ratio. Furthermore, some tumor targeting peptides have
the ability to not only selectively bind to cancer cells but also
mediate cell-permeabilization of both the peptide and conjugate
molecule.5a By possessing the ability to identify tumor cells and
mediate drug internalization, such peptides increase drug
activity and reduce drug toxicity by overcoming the inherent
poor selectivity and limited cellular penetration of many
anticancer drugs. For example, the synthetic peptides RC-160
and iRGD have been used to target the somatostatin receptor3a
and neuropilin-1 receptor,2a respectively. However, many
tumor specific peptides that have been characterized are unable
to facilitate cell penetration.6 In this regard, peptides that are
capable of both directly targeting tumor cells and mediating cell
permeabilization represent the most attractive molecular
entities for use as drug delivery agents.
The Eph family of receptor tyrosine kinases represents a
possible target for tumor-specific peptide development.7 The
Eph receptors play a central role in cellular proliferation and
survival processes and act on the actin cytoskeleton influencing
Received: December 27, 2011
Published: February 13, 2012
© 2012 American Chemical Society
2427
dx.doi.org/10.1021/jm201743s | J. Med. Chem. 2012, 55, 2427−2436

Journal of Medicinal Chemistry
Article
cell shape and migration. Several studies have demonstrated
that the disruption of binding of one family member, the
EphA2 receptor, to ephrin ligands in preclinical mouse tumor
models results in decreased tumor growth, likely due to
inhibition of tumor angiogenesis.7a,8 Furthermore, EphA2 is
highly expressed in a high proportion of cancer types, and in
some cancers the level of EphA2 expression has been correlated
with the degree of malignancy.7a,8b,9 Therefore, EphA2 is being
actively studied as a target for tumor diagnosis and
treatment.9b,10
Recently, a chimeric protein consisting of a protein toxin
(PE38QQR exotoxin) fused to the natural EphA2 ligand,
ephrin-A1, has been shown to cause potent and dose-
dependent killing of glioblastoma and breast and prostate
cancer cells that express high levels of the EphA2 receptor.11
Alternatively, a human EphA2 monoclonal antibody has been
developed and conjugated with the tubulin binding agent
monomethylauristatin.12 This antibody−drug conjugate targets
tumors expressing high levels of EphA2 and shows impressive
efficacy in mouse xenograft models. However, both the natural
ligand and the EphA2 antibody conjugate strategies still have
the traditional drawbacks of protein-based therapeutics, such as
immunogenic or allergic responses as well as difficulties in
ensuring homogeneous conjugation between drug and protein.
It is therefore desirable to develop peptide or small molecule
ligands that selectively bind to EphA2 and take advantage of its
ability to mediate internalization.7b
By using phage display, we have previously identified two
short peptides, YSA (amino acid sequence YSAYPDSVPMMS)
and SWL (amino acid sequence SWLAYPGAVSYR), which
selectively target EphA2 in preference to other Eph receptors.5b
Of the two biotinylated peptides, YSA showed higher affinity
for EphA2 (KD ≈ 200 nM) and was able to inhibit binding of
ephrin-A ligands to immobilized EphA2 receptor with IC50
values in the low micromolar range. Consistent with these
previous findings, Scarberry et al. recently reported that
magnetic cobalt ferrite nanoparticles coated with the YSA
peptide can selectively target EphA2 expressing ovarian
carcinoma cells.13 Similar to the ephrin ligands, the YSA
peptide can also induce EphA2 activation and downstream
signaling as well as decrease receptor levels on the cell
surface.5b,14 In order to exploit the diagnostic and therapeutic
cancer-targeting potential of the YSA peptide toward EphA2
overexpressing cells, we have developed an effective YSA-based
targeting agent using a synthetic strategy that allows the
conjugation of a variety of anticancer and/or imaging reagents
to the peptide. In particular, here we report the characterization
of the YSA peptide conjugated to paclitaxel and demonstrate its
successful delivery to tumors in vivo.
expression of EphA2 compared to the levels observed in the
HDF cell line. As a comparison, the EphA4 expression levels
were uniformly higher in 16 of the normal tissue samples, while
the normal brain total RNA sample showed 45.74 11.87 fold
the expression seen in the reference HDF cell line.The trend is
reversed when observing cancer cell lines, with the expression
of the EphA4 receptor substantially unchanged with respect to
the HDF reference cell line (0.96 0.16 fold across the 68 cell
lines studied; p < 0.0001, Mann−Whitney test) (Figure 1A and
Supporting Information Figure 1), while the expression of the
EphA2 was markedly higher (>7× compared to HDF) in more
than half of the cell lines studied. When the cell lines were
grouped according to their tissue of origin, overexpression of
EphA2 was broadly observed in the colon (13.50 2.95 fold
the HDF expression levels; P = 0.0003), ovarian (13.72 3.46
fold the HDF expression levels; P = 0.0004), and renal (7.59
1.39 fold the HDF expression levels; P = 0.0043) derived
cancer cell lines (Figure 1C). For each of these three groups
more than 50% of the cell lines showed significant over-
expression. The leukemia cell lines showed significant under-
expression of EphA2 (0.26 0.13; P = 0.0012) compared to
the normal tissue samples (Supporting Information Figure 1).
To further verify that the mRNA expression data collected
reflect protein levels in cell, we performed ELISA-based assays
for 30 of the cell lines that are designed to quantify the amount
of total EphA2 protein present in the cells. The ELISA analysis
identified a significant correlation between the mRNA and
levels for EphA2 in these 30 cell lines (R2 = 0.6679, P <
0.0001) (Figure 1B, Supporting Information), corroborating
our analysis based on mRNA levels.
The YSA Peptide Targets the EphA2 Receptor and
Induces Its Internalization. In order to investigate the
EphA2 targeting ability of our previously described YSA
peptide, we transfected COS cells with a plasmid encoding
either the extracellular and transmembrane domains of the
EphA2 receptor fused to EGFP (EphA2-EGFP) or membrane-
targeted EGFP (EGFP-F). Incubation of COS cells with
biotinylated YSA peptide (a YSA peptide conjugated at the C-
terminal with biotin) bound to streptavidin conjugated red
fluorescent quantum dots (YSA-Qdots) revealed the presence
of quantum dots bound to cells transfected with EphA2-EGFP
but not control cells transfected with EGFP-F or untransfected
cells (Figure 2A). Although COS cells express endogenous
EphA2, overexpressing the receptor provides increased
sensitivity. We also observed that the YSA peptide targets
quantum dots to endogenous EphA2 located on the surface of
human umbilical vein endothelial (HUVE) cells while a control
peptide that does not bind to EphA2 or quantum dots without
any bound peptide does not bind to the HUVE cell surface
(Figure 2B). In addition, we used the lysosomal marker Lamp1
to show that the YSA peptide successfully mediates cellular
uptake of quantum dots into lysosomes in the MDA-MB-231
breast cancer cell line, which expresses high levels of EphA215
(Figure 2C). Thus, the YSA peptide not only binds to EphA2
but also is able to initiate the active internalization of the
receptor into cancer cells, resulting in the concomitant
internalization of its cargo.
RESULTS
■
EphA2 Receptor Is Overexpressed in Most Solid
Tumors. We employed a qPCR (quantitative real-time
polymerase chain reaction) screen of total cDNA libraries
collected from 68 human cancer cell lines across nine separate
cancer types as well as samples extracted from 17 normal tissue
types to quantify the expression of the EphA2 receptor
(NM_004431.2). The data were compared to the expression
of the EphA4 receptor (NM_004438.3) and normalized to the
expression levels observed in a cultured human dermal
fibroblast (HDF) cell line (Supporting Information Figure 1).
In the 17 normal human tissues total RNA samples we
Design, Synthesis, and Characterization of a YSA−
Paclitaxel Conjugate (YSA−PTX). We developed a novel
antitriazole linker for the synthesis of YSA peptide−drug
conjugates to avoid the compatibility problems of disulfide and
hydrazone linkers. Conjugation at the C-terminus of the
peptide was preferred because modifications at the N-terminus
observed an average of 2.83
0.45 (mean
SEM) fold
2428
dx.doi.org/10.1021/jm201743s | J. Med. Chem. 2012, 55, 2427−2436

Journal of Medicinal Chemistry
Article
Figure 1. EphA2 and EphA4 expression in 68 human cancer cell lines
and 17 normal tissue RNA samples. (A) EphA2 and EphA4 receptor
expression in normal and cancer cell lines. Bar graph shows the fold
expression of both EphA2 and EphA4 receptors in MDA-MD-231,
PC-3, and LNCaP cancer cell lines compared to cultured human
dermal fibroblast (HDF) and to a total human prostate RNA sample
(prostate). (B) Correlation between EphA2 mRNA expression and
EphA2 protein levels in 30 selected human cancer cell lines. (C) Box
and Whisker plots of the 10th to 90th percentile of EphA2 expression
for the RNA samples grouped according to their tissue of origin.
Dotted lines depict cutoffs for 7-fold and 14-fold expression levels
observed in the reference HDF cell line, respectively.
Figure 2. YSA peptide targets cells expressing EphA2. (A) The YSA
peptide targets quantum dots to EphA2 on the cell surface. COS cells
transfected with either the extracellular and transmembrane portions
of EphA2 fused to enhanced green fluorescent protein (EphA2-EGFP)
or membrane targeted EGFP-F were incubated with YSA bound to red
fluorescent quantum dots (YSA−Qdots). YSA−Qdots only bind to
cells transfected with EphA2-EGFP. EGFP fluorescence is green.
Nuclei are stained in blue with DAPI. (B) YSA targets quantum dots
to endogenous EphA2 on the cell surface. HUVE cells were incubated
at 4 °C with YSA conjugated Qdots (YSA−Qdots), an unrelated 12-
mer control peptide that does not bind to EphA2 also conjugated to
Qdots (Ctrl-Qdots), or unconjugated Qdots (Qdots). Only quantum
dots conjugated to the YSA peptide bind to the HUVE cells. (C) YSA
targets Qdots to lysosomes. MDA-MB-231 cells, which express high
levels of endogenous EphA2, were incubated at 4 °C with YSA−Qdots
followed by incubation at 37 °C for 0, 15, and 60 min. YSA−Qdots are
seen on the cell surface at 0 min but become concentrated in
structures near the nucleus at 15 and 60 min (arrow). Double labeling
with the lysosomal marker Lamp1 (green) shows colocalization of the
quantum dots in lysosomes at 60 min (arrows).
of the YSA peptide decrease EphA2 binding activity (data not
shown). Hence, the C-terminus of YSA was derivatized with
Nε-(5-hexynoyl)lysine, resulting in the amino acid sequence
YSAYPDSVPMMS[Nε-(5-hexynoyl)-K], hereafter referred to
as “YSA motif”. This motif provides the alkyne moiety for
subsequent coupling of modified paclitaxel using click
chemistry.16 To provide the azide counterpart of click
chemistry, we attached a diglycolic acid 6-azidohexanyl
monoester to the 2′-hydroxyl of paclitaxel by employing a
selective protection/deprotection strategy (Supporting Infor-
mation). Coupling of the YSA motif with the azide-linker-
derived paclitaxel (PTX) was accomplished under mild click-
chemistry reaction conditions, generating the desired YSA−
PTX conjugate (Figure 3A). A similar synthetic approach was
used to conjugate a YSA scrambled peptide control (DYP−
PTX; amino acid sequence DYPSMAMYSPSV[Nε-(5-hexyno-
yl)-K])17 to PTX (Figure 3A) as well as for biotinylated
peptides, YSA−PTX−biotin and DYP−PTX−biotin (Support-
ing Information).
After preparation of the YSA−PTX conjugate, we confirmed
that the conjugation does not interfere with the ability of YSA
to bind EphA2 and cause its internalization. The ability of
YSA−PTX to efficiently compete, in a dose dependent manner,
with ephrin-A5 fused to alkaline phosphatase (ephrin-A5 AP)
for binding to the EphA2 extracellular domain fused to Fc
(EphA2 Fc) in ELISA assays demonstrates that the conjugate
retains its EphA2 binding ability (Table 1 and Figure 3B). In
contrast, neither of the control compounds, the DYP motif nor
DYP−PTX conjugate, show any detectable displacement of
ephrin-A5. We measured a KD of ∼0.8 μM for the binding of
biotinylated YSA−PTX to EphA2 Fc immobilized in ELISA
wells, whereas binding of the biotinylated control DYP−PTX
was undetectable (Figure 3C).
In vitro cell viability assays confirmed that the YSA−PTX
conjugate retained the ability of paclitaxel to induce cell death
at low nanomolar concentrations in the EphA2 overexpressing
prostate cancer cell line PC3 (Figure 3D), while paclitaxel
conjugated to the scrambled peptide, DYP−PTX, showed no
significant cell killing in the same assay (Figure 3D). These data
suggest that the peptide has sufficient affinity for the receptor
to deliver an effective dose of drug.
Further analysis of YSA−PTX−Qdots revealed that the
peptide conjugate facilitates Qdot uptake into the lysosomes of
the highly EphA2 expressing prostate cancer cell line, PC3.18 In
2429
dx.doi.org/10.1021/jm201743s | J. Med. Chem. 2012, 55, 2427−2436

Journal of Medicinal Chemistry
Article
Figure 3. YSA−PTX retains high potency for inhibition of EphA2-ephrin-A5 binding and high EphA2 binding affinity. (A) General chemical
structures of YSA and DYP peptide−drug conjugates. (B) YSA, YSA−PTX, and control DYP−PTX were incubated at the indicated concentrations
together with a constant concentration of ephrin-A5 AP in ELISA wells precoated with EphA2 Fc. The ratio of ephrin-A5 AP bound in the presence
and in the absence of peptide is shown. (C) Biotinylated YSA−PTX and control DYP−PTX were incubated at the indicated concentrations in
EphA2 Fc-coated ELISA wells and were then detected with streptavidin−HRP. The graphs show averages SE from quadruplicate measurements in
representative experiments, while the KD and IC50 values are calculated from three to five experiments. (D) ATP-Lite analysis of viability of PC-3
cells 72 h after the addition of DYP, DYP−PTX, YSA, YSA−PTX, or PTX at 10 nM (n = 3).
a
Table 1. EphA2 Inhibition
Fc ligand (Figure 4B). YSA−PTX, but not DYP−PTX, also
causes EphA2 tyrosine phosphorylation (which is indicative of
activation) and loss of the receptor from the surface of not only
PC3 cancer cells but also HUVE endothelial cells (Figure 4C).
These data indicate that the YSA−PTX conjugate retains the
ability of YSA to bind EphA2 and allows effective internal-
ization of PTX into cells. Furthermore, they suggest that YSA−
PTX may be useful to target not only cancer cells but also the
tumor vasculature.
compd
YSA
sequence
IC50 (μM)
n
YSAYPDSVPMMS
12.6 1.03
1.68 0.26
6.82 0.81
>200
15
6
YSA motif
YSA−PTX
DYP motif
DYP−PTX
YSAYPDSVPMMS-K*
YSAYPDSVPMMS-K*-PTX
DYPSMAMYSPSV-K*
DYPSMAMYSPSV-K*-PTX
6
2
>200
2
a
K* is a modified lysine with an alkyne linker.
YSA−PTX Targets Tumors in Vivo. In preparation for in
vivo studies of the YSA−PTX conjugate, we found that YSA−
PTX shows favorable plasma and microsomal half-lives (43 and
23 min, respectively) and is able to release native paclitaxel in
the presence of PC3 cells with nearly complete release in about
60 min (data not shown). Therefore, we examined the effects
of YSA−PTX in preliminary in vivo studies using PC3 tumor
xenografts. Tumor-bearing mice were treated twice weekly with
an intravenous injection of PTX or YSA−PTX for a total of 3
weeks. Remarkable tumor growth inhibition (p < 0.05) was
contrast, YSA−PTX−Qdots does not target the LNCaP
prostate cancer cell line (Figure 4A), which, according to
both our qPCR data (Figure 1A) and previous literature data,19
does not express detectable levels of EphA2. As a further
control, the DYP−PTX control scrambled peptide does not
target PC3 cells and does not trigger EphA2 internalization
(Figure 4A). Moreover, we confirmed that even when not
coupled to quantum dots, YSA−PTX causes EphA2 internal-
ization into the lysosomes of PC3 cells, similar to the ephrin-A1
2430
dx.doi.org/10.1021/jm201743s | J. Med. Chem. 2012, 55, 2427−2436

Journal of Medicinal Chemistry
Article
Figure 4. YSA−PTX is internalized in cancer and endothelial cells expressing EphA2. (A) YSA−PTX coupled to fluorescent quantum dots, but not
DYP−PTX, is internalized with EphA2 into lysosomes of prostate cancer cells expressing EphA2. PC3 prostate cancer cells, which express high levels
of EphA2, or LNCaP prostate cancer cells, which do not detectably express EphA2 protein, were treated for 20 min with 100 μM YSA−PTX or
control DYP−PTX, followed by a 20 min of incubation with streptavidin-conjugated quantum dots (Qdots). After removal of the solution
containing the peptides and the quantum dots, the cells were incubated for 2 h at 37 °C to allow EphA2 internalization induced by YSA−PTX
binding. The cells were stained for EphA2 (left) or the lysosomal marker Lamp1 (right). Qdots were also imaged, and nuclei were labeled with DAPI
in blue. Representative fluorescence micrographs are shown. Scale bar = 25 μM. (B) Ephrin-A1 Fc and YSA−PTX, but not DYP−PTX, cause EphA2
internalization into lysosomes. PC3 cells were treated for 2 h with 0.2 μg/mL ephrin-A1 Fc, 100 μM YSA−PTX, or 100 μM control DYP−PTX. The
cells were stained for Lamp1 (red) and EphA2 (green). Nuclei were labeled with DAPI (blue). Representative confocal micrographs are shown. Scale
bar = 25 μm. (C) Ephrin-A1 Fc and YSA−PTX, but not DYP−PTX, cause EphA2 internalization into cells. PC3 prostate cancer and HUVE
endothelial cells were treated for 1 h with 0.2 μg/mL ephrin-A1 Fc, 100 μM YSA−PTX, or 100 μM control DYP−PTX. Proteins present on the cell
surface were then labeled with biotin. EphA2 immunoprecipitates were probed with antiphosphotyrosine antibody (PTyr), streptavidin−HRP
(biotin), and EphA2 antibody. The amount of GAPDH in the cell lysates used for the immune precipitations is also shown as a control for equal
amounts of protein in the lysates used for immunoprecipitation.
observed with YSA−PTX (Figure 5A) while unconjugated PTX
administered at an equimolar dose did not significantly affect
tumor growth compared to vehicle control. Moreover, mouse
body weights were not affected by YSA−PTX administration in
comparison to administration of vehicle control, and no adverse
signs of toxicity in the YSA−PTX-treated mice were observed.
To confirm preferential delivery of paclitaxel to tumor
xenografts, we analyzed tumors dissected from mice treated
with PTX or YSA−PTX to determine PTX tumor delivery
using mass spectrometry. Tumor-bearing mice were treated
with a single dose of PTX or YSA−PTX at equimolar doses,
and PTX levels were measured in tumor tissue and plasma 30
min after administration. This revealed that the tumor tissue
from the YSA−PTX group shows significantly higher PTX
levels compared to the group where unconjugated PTX was
administered, while plasma PTX concentrations were equiv-
alent (Figure 5B).
DISCUSSION
■
The development of tumor specific, cell penetrating molecules
remains a primary focus in cancer research. Our data
demonstrate that the YSA peptide is capable of specifically
targeting the EphA2 receptor and of causing receptor activation
and internalization, which also results in the internalization of
the YSA peptide and any conjugated biomolecule. As expected,
YSA−PTX can induce activation of EphA2, thus mediating its
internalization into cancer and endothelial cells. In addition,
2431
dx.doi.org/10.1021/jm201743s | J. Med. Chem. 2012, 55, 2427−2436

Journal of Medicinal Chemistry
Article
Along with increasing tumor selectivity and tumor tissue
penetration, conjugation to YSA may increase the water
solubility of paclitaxel, thus making it more bioavailable,21 as
well as allow an increase in the therapeutic window of the drug.
In fact, EphA2 expression is limited in normal tissues,7a,8b,9 and
in normal epithelial cells EphA2 is likely found in complex with
ephrin ligands and therefore cannot be efficiently targeted by
YSA, an ephrin antagonist, in contrast to tumor tissue where
EphA2 is not frequently coexpressed with ephrin ligands.15,22
The low EphA2 expression observed in normal tissues and its
engagement with ephrin ligands, as well as our biodistribution
data, highlight the fact that the use of the YSA peptide for drug
delivery may reduce exposure of normal tissues to cytotoxic
drugs, thus presumably reducing toxic side effects. As a result,
YSA−PTX may broaden the therapeutic window of paclitaxel
to an extent that elevated doses could still be safely used.
Administering larger doses of YSA−PTX to patients may
increase the chances of eradicating tumors while decreasing the
cancer cells’ ability to evade either the YSA targeting molecule
or the cell stress caused by the chemotherapeutic.
The use of a targeting peptide, as opposed to a protein or
antibody drug conjugate, for delivery of anticancer drugs has
also a number of significant advantages over the use of full
length ephrins or antibodies. The short peptide sequence is a
single, relatively small molecule that lacks the size necessary to
mount an immune response during therapy. Also not to be
overlooked is the significant lower cost for the synthesis of a
homogeneous short peptide when compared to the preparation
of proteins and humanized antibodies.
In summary, YSA−PTX has been demonstrated to have a
powerful antitumor activity in vitro and in vivo and could serve
as a valuable candidate for further preclinical and eventually
clinical evaluation in humans. The use of small peptide ligands
targeting EphA2-expressing tumors for drug delivery could
provide a new arsenal of diagnostic and therapeutic options for
cancer patients. With this report we intend to share our
compelling preliminary findings, which we believe open the way
to future studies to optimize the peptide sequence for binding
affinity and in vivo stability, investigate additional YSA−drug
conjugates, conjugate YSA and optimized derivatives with MRI
or PET imaging agents such as DTPA or DOTA, and perform
detailed studies on the pharmacokinetics of the conjugates.
Figure 5. Expression of EphA2 and cellular and in vivo activity of drug
conjugates. (A) Groups of five to seven SCID beige mice bearing pre-
established subcutaneous PC3 tumors were treated with twice weekly
with intravenous doses of vehicle (CT), paclitaxel (5 mg/kg), YSA−
paclitaxel (equimolar doses of the paclitaxel dose), starting at day 0.
Tumor sizes were measured, and averages SEM are shown. p < 0.05
for the comparison of YSA−paclitaxel with control, by repeated-
measures two-way ANOVA using all the measurements as well as by
one-way ANOVA and Dunnett’s post hoc test using the measurements
at day 18. (B) Biodistribution analysis. PC3 tumors (n = 3, average
volume of 200 mm3) were excised 30 min after equimolar amounts of
YSA−PTX or PTX (25 mg/kg) were injected intravenously. LC−MS
analysis was performed to quantify PTX levels from tumor extracts.
The histogram shows averages SEM. p < 0.05 for the comparison of
PTX levels, by t test analysis. Plasma levels of PTX were not
significantly different (YSA−PTX = 998 742 ng/mL; PTX = 771
585 ng/mL).
conjugation of PTX to the YSA peptide does not interfere with
the chemotherapeutic function of PTX.
Our qPCR studies show that overexpression of EphA2 is a
common (occurring in one-third of the solid tumor-derived cell
lines studies) but not universal characteristic of solid tumor
types. Recent studies have reported that EphA2 expression
levels may be up-regulated in response to hypoxic stress.20 As a
result, the overexpression of EphA2 in tumor tissues in vivo
may be much higher than the levels observed in tissue culture
environment, where oxygen levels are abnormally high
compared to not only the hypoxic regions of tumors but also
the levels in normal tissues. In addition, EphA2 is widely up-
regulated in the tumor vasculature but is not expressed in
normal quiescent vasculature.7a,8a Our results suggest that the
YSA peptide could be used as a vehicle for the delivery of
diagnostic and chemotherapeutic agents to EphA2 expressing
tumors.
Our preliminary paclitaxel biodistribution studies demon-
strate that the YSA−PTX conjugate affords a significant
increase in the amount of drug delivered to the tumor
compared with administration of free paclitaxel. Consistent
with this, our results show that YSA−PTX is much more
effective in inhibiting PC3 tumor xenograft growth than free
paclitaxel, with no overt signs of toxicity. We speculate that the
enhanced antitumor activity of YSA−PTX can be attributed to
its two sought-after traits: tumor selectivity and tumor tissue
penetration. Conjugation of the YSA peptide to paclitaxel
endows YSA−PTX with the ability to selectively bind to and
activate EphA2, leading to internalization of the EphA2−YSA−
PTX complex. As a result, paclitaxel is actively transported into
cells rather than relying on passive transport as is the case when
a tumor selective molecule lacks the ability to mediate
internalization. Our data demonstrate that for equivalent
molar dosing, YSA−PTX delivers a higher proportion of active
drug molecules into the tumors, leading to a dramatic decrease
in tumor growth.
EXPERIMENTAL SECTION
■
Chemical Synthesis and Purification. Unless otherwise noted,
all reagents and anhydrous solvents were obtained from commercial
sources and used without purification, and the fully protected peptides
on resin were purchased from Biopeptide Co. The YSA and DYP
peptides were purchased from either Medical College of Wisconsin or
Abgent, Inc. (San Diego, CA). All reactions were performed in oven-
dried glassware. All reactions involving air or moisture sensitive
reagents were performed under a nitrogen atmosphere. Silica gel
chromatography was performed using prepacked silica gel or C-18
cartridges (RediSep). All final compounds were purified to >95%
purity, as determined by a HPLC Breeze from Waters Co. using an
Atlantis T3 5.0 μm, 4.6 mm ×150 mm reverse phase column. 1D and
2D NMR spectra were recorded on a Bruker 600 MHz instrument.
Chemical shifts are reported in ppm (δ) relative to 1H (Me4Si at 0.00
ppm). Coupling constant (J) are reported in Hz throughout, and
NMR signal assignments were based on DEPT, 2D [13C,1H]HSQC,
2D [1H,1H]COSY, 2D [1H,1H]-TOCSY, and 2D [1H,1H]HMBC
experiments. Low resolution and high resolution mass spectral data
were acquired on an Esquire LC00066 mass spectrometer, an Agilent
ESI-TOF mass spectrometer, or a Bruker Daltonic Autoflex MALDI-
TOF/TOF mass spectrometer. Detailed synthetic procedures and
2432
dx.doi.org/10.1021/jm201743s | J. Med. Chem. 2012, 55, 2427−2436

Journal of Medicinal Chemistry
Article
analytical data for compound intermediates and final compounds are
reported in the Supporting Information section.
cells, supplemented with 10 mM HEPES and stored at 4 °C, and the
cells were serum starved for 3 h in serum-free medium. The cells were
then treated with 100 μM biotinylated YSA−PTX or DYP−PTX in
quantum dots binding buffer for 20 min on ice, followed by 20 nM
streptavidin-conjugated Qdot 655 in binding buffer for 20 min on ice.
After removal of the quantum dot solution, the cells were washed with
the binding buffer and incubated with the stored conditioned medium
in a 37 °C CO2 incubator for 2 h to allow internalization of the
EphA2−YSA−PTX−quantum dots complexes. The cells were then
washed with ice cold PBS, fixed in 4% formaldehyde with 4% sucrose
for 10 min, permeabilized for 5 min with 0.05% Triton-X100 in PBS,
and incubated for 1 h with PBS containing 10% goat serum and 2%
BSA. For EphA2 staining, the coverslips were incubated with a rabbit
anti-EphA2 antibody (Life Technologies/Invitrogen) followed by a
secondary anti-rabbit antibody conjugated with Alexa Fluor 488 (Life
Technologies/Molecular Probes). For staining of lysosomes, the
coverslips were incubated with polyclonal rabbit anti-human Lamp1
antibody24 followed by a secondary anti-rabbit antibody conjugated
with Alexa Fluor 568. The nuclei were counterstained with DAPI.
Images were obtained with an inverted TE300 Nikon fluorescence
microscope and processed using Adobe Photoshop.
To image EphA2 internalization and colocalization with lysosomes
after stimulation PC3 cells plated on glass coverslips were serum
starved for 1 h in serum-free medium and then stimulated with 0.2 μg/
mL Fc (as a negative control), 0.2 μg/mL ephrin-A1 Fc (as a positive
control), 100 μM YSA−PTX−biotin or 100 μM DYP−PTX−biotin
for 2 h. The cells were then fixed, permeabilized, and labeled as
described above. Images were acquired using a Radiance 2100 MP
confocal microscope.
Immunoprecipitation and Immunoblotting. PC3 cells were
serum-starved for 1 h in serum-free medium and treated for 1 h with
0.2 μg/mL human Fc (as a negative control), 0.2 μg/mL ephrin-A1 Fc
(as a positive control), 100 μM YSA−PTX, or 100 μM DYP−PTX.
The cells were then placed on ice, rinsed once with cold PBS, and
incubated for 20 min at 4 °C with a 0.5 mg/mL EZ-link sulfo-NHS-
biotin (Thermo Scientific/Pierce, Rockford, IL) in PBS. The cells were
then washed 3 times with a 100 mM glycine in PBS to quench the
biotinylation reaction, followed by PBS. The cells were lysed in
modified RIPA lysis buffer (150 mM NaCl, 1 mM EDTA, 1% Triton
X-100, 1% sodium deoxycholate, 0.1% SDS, 20 mM Tris, pH 8.0)
containing protease inhibitors and 1 mM sodium orthovanadate. For
immunoprecipitations, cell lysates were incubated with 2 μg of anti-
EphA2 antibody (Millipore-Upstate, Inc. Temecula, CA) immobilized
on GammaBind Sepharose beads (GE Healthcare Life Sciences).
Immunoprecipitates and lysates were probed by immunoblotting with
anti-phosphotyrosine antibody (Millipore, Inc., Temecula, CA),
streptavidin coupled to HRP (Thermo Scientific/Pierce, Rockford,
IL), anti-EphA2 antibody (Life Technologies/Invitrogen), and anti-
GAPDH antibody (Sigma-Aldrich, Steinheim, Germany).
ELISA-Based Displacement and Binding Assays. EphA2 Fc
(R&D Systems, Minneapolis, MN) diluted to 1 μg/mL in TBST
buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5, with 0.01% Tween
20) was immobilized in protein A coated wells. The wells were then
incubated for 3 h with 0.01 nM ephrin-A5 fused to alkaline
phosphatase (ephrin-A5 AP)5b in culture medium diluted in TBST
in the presence of different concentrations of YSA, YSA−PTX, or
DYP−PTX. The concentration of ephrin-A5 AP was calculated based
on AP activity measurements.23 Bound ephrin-A5 AP was quantified
by adding pNPP as the substrate and measuring the absorbance at 405
nm. Absorbance from wells where human Fc (R&D Systems,
Minneapolis, MN) was added instead of EphA2 Fc was subtracted
as the background. Curves for the binding of biotinylated YSA−PTX
and DYP−PTX to EphA2 Fc were measured by adding different
concentrations of the peptides to ELISA wells precoated with protein
A and EphA2 Fc. Bound biotinylated peptides were detected with
horseradish peroxidase (HRP) conjugated streptavidin (Thermo
Scientific/Pierce, Rockford, IL; 1:2000 dilution in TBST). Absorbance
at 405 nm was measured following incubation with 0.2 mg/mL 2,2′-
azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) (Sigma-Al-
drich, Steinheim, Germany) in citric acid as a substrate, and the
absorbance in wells without peptide was subtracted as background.
The inhibition and binding curves were analyzed using nonlinear
regression and the program Prism (GraphPad Software Inc.).
Fluorescence Cell Imaging. COS cells and MDA-MB-231 breast
cancer cells (ATCC) were grown in Dulbecco’s modified Eagle’s
medium (DMEM) (Mediatech, Inc., Herndon, VA) with 10% fetal
bovine serum (FBS) (Hyclone, Logan, UT) and Pen/Strep (Omega
Scientific, Tarzana, CA). PC3-3M-luc-C6 Bioware (Caliper) and
LNCaP prostate cancer cells (ATCC) were grown in RPMI 1640
medium (Mediatech, Inc., Herndon, VA) with 10% FBS and Pen/
Strep. Human umbilical vein endothelial cells (HUVECs, Cascade
Biologics, Portland, OR) were grown in medium 200 supplemented
with low serum growth supplements (Cascade Biologics), 10% FBS,
Pen/Strep, and fungizone (Omega Scientific, Tarzana, CA).
To label cells expressing transfected EphA2 with fluorescent
quantum dots, COS cells grown in 6 cm plates were transfected
with 3 μg of a plasmid encoding EphA2 extracellular and trans-
membrane domains fused to enhanced green fluorescent protein
(EGFP) or 3 μg of a vector encoding farnesylated EGFP (F-EGFP)
(BD Biosciences Clontech) as control, using SuperFect transfection
reagent (Qiagen, Inc., Valencia, CA). The cells were plated on glass
coverslips and labeled 2 days after transfection. For the labeling
experiments, 20 nM streptavidin-conjugated Qdot 655 quantum dots
(Invitrogen/Molecular Probes, Eugene, OR) were preincubated for 20
min at
4 °C with 500 nM biotinylated YSA peptide
(YSAYPDSVPMMS-GSGSK-biotin), or a biotinylated control 12-
mer peptide that does not bind to EphA2, in quantum dots binding
buffer (1 mM CaCl2, 2% BSA in PBS). The cells were then incubated
for 20 min at 4 °C with quantum dots containing the YSA peptide or
the control peptide, or quantum dots without peptide as a further
control, and then washed with ice cold 1 mM CaCl2 in PBS. To label
human umbilical endothelial (HUVE) cells expressing endogenous
EphA2, the cells were plated on glass coverslips coated with
fibronectin (10 μg/mL) and incubated with 100 μM biotinylated
YSA peptide in quantum dots binding buffer for 20 min at 4 °C. The
cells were then washed with ice cold 1 mM CaCl2 in PBS, followed by
incubation with 20 nM streptavidin quantum dots for 20 min at 4 °C
in quantum dots binding buffer.
RNA Expression of Tumor Cells. Cancer cell lines and human
dermal fibroblast cells were cultured, and total RNA was isolated from
each as previously described.25 The Firstchoice Human Total RNA
Survey Panel (Agilent Technologies) was purchased to serve as control
for normal tissue RNA expression levels. Total RNA was extracted
from 3 × 106 cells from each line harvested at 70−80% confluence and
prepared using the Illustra RNAspin mini total RNA extraction kit (GE
Healthcare) according to the manufacturer’s recommendations for
cultured cells. DNA contamination and sample concentration for each
sample were determined using a NanoDrop ND-1000 spectropho-
tometer. The RNA integrity of each sample was further confirmed
using a BioRad Experion bioanalyzer to assess the ratio of 28s and 18s
RNA. All samples exhibited 28s/18s ratios of 1.8−2.2 and RIN values
of 9 or greater, which indicates the presence of high quality total RNA.
cDNA was produced using qScript cDNA Supermix (Quanta
Biosciences) according to manufacturer’s recommendations in 20 μL
reaction mixtures using 400 ng of total RNA as the template. The
resultant cDNA was stored at −40 °C and diluted 1:7 prior to use in
qPCR.
For quantum dot internalization experiments, MDA-MB-231, PC3,
and LNCaP cells were grown on glass coverslips. For MDA-MB-231
cells, 20 nM streptavidin-conjugated QDot 655 quantum dots were
preincubated for 20 min on ice with 500 nM biotinylated YSA peptide
in conditioned medium supplemented with 10 mM HEPES. The cells
were then incubated for 20 min on ice with the quantum dot/YSA
peptide mixture, or quantum dots without peptide (negative control),
and then in a 37 °C CO2 incubator for various periods of time. For
PC3 and LNCaP cells, the conditioned medium was removed from the
Primers for use in qPCR were identified using the Universal Probe
Library design tools (Roche Applied Sciences) for both EphA2
2433
dx.doi.org/10.1021/jm201743s | J. Med. Chem. 2012, 55, 2427−2436

Journal of Medicinal Chemistry
Article
receptor (NM_004431.2; sense, ggcaggagttggcttctttat; antisense,
tgttctgacttggagaagtaaacg) and EphA4 receptor (NM_004438.3;
sense, gatagcaagccctctggaag; antisense, ggtaggttcggattggtgtatt) in
combination with the universal probe no. 69 (Roche Applied
Sciences). Each qPCR reaction also contained the primers and
probe necessary to run a simultaneous internal G6PH multiplexed
control (Roche Applied Sciences). Primers were purchased from
Invitrogen. All qPCR reactions were performed in 17 μL reaction
mixtures containing 2 μL of the diluted cDNA, 0.5 μL of G6PH primer
mix, 0.5 μL G6PH probe, 1.0 μL of EphA2 or EphA4 primer mix, 0.5
μL probe no. 69, 10 μL of Mastermix (Roche Applied Sciences), and
2.5 μL of molecular grade water. Each sample was run in triplicate in a
96-well polypropylene plate (Stratagene) with the Mx3000P qPCR
system (Stratagene). Thermocycling conditions consisted of an initial
polymerase inactivation step at 95 °C for 10 min, followed by 40 cycles
at 95 °C for 30 s, 55 °C for 1 min, and 72 °C for 1 min. Baselines and
thresholds were automatically set by the software. Serial dilution
showed that the Cq value for all data was linear over 5 orders of
magnitude (R2 of 0.996). Control experiments without primers,
template, or probe exhibited no detectable signal.
Calculated Cq values were exported to Excel 2007 (Microsoft) and
Prism 5.04 (Graphpad Softward Inc.) for further analysis. Each cell
type’s data were normalized to the average level of mRNA expression
(Cq value) of G6PH across all cell lines. SEM values for the three
replicates for each gene in all 68 cell lines and 17 normal tissue cDNA
pools were then calculated from these normalized Cq values. The Cq
value for each cell line was compared to that observed in the cultured
human dermal fibroblast cell line. The average the SEM values were
calculated and transformed into fold expression values for the purpose
of displaying the error bars in graphical representations of the data.
EphA2 Protein Quantification. The amount of EphA2 protein in
each cell line was assayed using the human total EphA2 DuoSet Elisa
kit (R&D Systems, Minneapolis, MN). Lysates were collected from a
selection of the cell lines studied using a concentration of 1 million
cells/mL of lysis buffer no. 9. Total protein samples were flash frozen
and stored at −80 °C until tested. The protein concentration from
each sample was determined by BCA protein analysis (Pierce
Biotechnology Inc., Rockford, IL), and 100 and/or 30 μg of total
protein was analyzed as outlined by the manufacturer’s directions.
Each protein sample dilution was tested in duplicate. A standard curve
of recombinant EphA2 protein (R2 = 0.996) was used to quantify the
resulting absorbance values.
was run in duplicate with a positive control known to be degraded in
plasma.
In Vivo Xenograft Studies. PC3-3M-luc-C6 cells (1 × 106) were
injected subcutaneously in SCID-beige mice, and tumor sizes were
monitored twice per week using calipers. Once the tumors reached
sizes of ∼100 mm3, the mice were treated twice a week with
intravenous doses of vehicle, PTX (5 mg/kg), and YSA−PTX (at a
dose that is equimolar to the taxol dose, i.e., 15 mg/kg). Both YSA−
PTX and PTX were dissolved in a mixture of 84% PBS, 8% DMSO,
and 8% water and injected in a 100 μL final volume.
Tissue Drug Level Determination. Tumor samples were
weighted, homogenized, and extracted with 4 equal volumes (5-fold
dilution) of quenching solution: water/acetonitrile (20:80) with 0.05%
formic acid. The plasma samples were extracted with 1 equal volume
(2-fold dilution) of quenching solution. The samples were centrifuged
at approximately 14000g for 15 min, and the supernatants were mixed
1:1 with quenching solution containing an internal standard (2.5 μM
indomethacin). After a second centrifugation, the supernatants were
transferred to an autosampler vial and the relative concentrations were
assessed by LC−MS/MS in multiple reaction monitoring (MRM)
mode. LC−MS/MS was performed using a Prominence liquid
chromatography system (Shimadzu) directly coupled to an API3000
triple quadrupole mass spectrometer. (Applied Biosystems) using
MRM. Chromatography was carried out using gradient elution (water/
acetonitrile) on a C18 reversed-phase column (Kromasil 100-5 μm,
C18 50 mm × 2.1 mm i.d., Peeke Scientific) at a flow rate of 0.4 mL/
min.
PTX concentrations were determined using an eight-point
calibration curve derived from peak areas obtained from serially
diluted solutions of the compound. The standard solutions were
prepared using the same procedure outlined above. PTX concen-
trations in tissue extracts were determined using Analyst 1.4.2 software
(Applied Biosystems). This gives a very accurate quantification of drug
levels in tissues.
ASSOCIATED CONTENT
■
S
* Supporting Information
Detailed experimental procedures and spectral and purity
analysis of all compounds; data relative to EphA2 and EphA4
RNA expression from 68 cancer cell lines. This material is
available free of charge via the Internet at http://pubs.acs.org.
ATP-Lite Based Analysis of Cell Viability. PC3 cells were
cultured and tested using the ATP-Lite Onestep kit (Perkin-Elmer) as
outlined previously.25 A fixed concentration of 0.5% DMSO was
present in each 100 μL culture volume upon addition of the
compounds, and ATP concentration was recorded 72 h after addition
of the compounds.
Microsomal and Plasma Stability Assays. To assess micro-
somal stability of YSA−PTX, the conjugate was incubated with rat
liver microsomes (RLM) for 60 min at 37 °C. The final incubation
solutions contained 4 μM YSA−PTX, 2 mM NADPH, 1 mg/mL (total
protein) microsomes, and 50 mM phosphate (pH 7.2). Compound
solutions, protein, and phosphate were preincubated at 37 °C for 5
min, and the reactions were initiated by the addition of NADPH and
incubated for 1 h at 37 °C. Aliquots were taken at 30 min time-points
and quenched with the addition of methanol containing an internal
standard. Following protein precipitation and centrifugation, the
samples were analyzed by LC−MS. YSA−PTX was run in duplicate
with a control compound of known half-life. HLM t1/2 ≥ 30 min is
generally classified as good microsomal stability.
For measurements of plasma stability, 1 μM YSA−PTX was
incubated at 37 °C with fresh rat plasma, 2.5% final DMSO
concentration. The reactions were terminated at 0, 30, and 60 min
by the addition of two volumes of methanol containing an internal
standard. Following protein precipitation and centrifugation, the
samples were analyzed by LC−MS. The percentage of YSA−PTX
remaining at each time point relative to the 0 min sample is calculated
from peak area ratios in relation to the internal standard. YSA−PTX
AUTHOR INFORMATION
■
Corresponding Author
*Phone: 858-646-3159. E-mail: mpellecchia@sanfordburnham.
org.
Author Contributions
S.W., W.J.P., and J.L.S. contributed equally to this work. M.P.
designed the research strategy for the peptide conjugates. S.W.
synthesized the peptide−PTX conjugates. W.J.P. performed the
qPCR experiments, EphA2 protein quantification, and
characterization of peptide−PTX conjugates in cultured PC3
cells. J.L.S. performed the tumor xenograft experiments. S.M.
and R.N. performed the ELISA and cell culture experiments, in
Figures 3 and 4. M.K. performed the YSA cell labeling and
internalization experiments in Figure 2. R.D. performed the
plasma and microsomal stability experiments. E.P.B. and M.P.
helped the other authors design and interpret experiments, and
M.P. wrote the manuscript with help from the other authors.
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
Financial support was obtained in part by NIH Grant
CA138390 to M.P. and E.B.P.
2434
dx.doi.org/10.1021/jm201743s | J. Med. Chem. 2012, 55, 2427−2436

Journal of Medicinal Chemistry
Article
Sorsa, T.; Ruoslahti, E.; Pasqualini, R. Tumor targeting with a selective
gelatinase inhibitor. Nat. Biotechnol. 1999, 17 (8), 768−774.
(6) Gersuk, G. M.; Corey, M. J.; Corey, E.; Stray, J. E.; Kawasaki, G.
H.; Vessella, R. L. High-affinity peptide ligands to prostate-specific
antigen identified by polysome selection. Biochem. Biophys. Res.
Commun. 1997, 232 (2), 578−582.
(7) (a) Pasquale, E. B. Eph receptors and ephrins in cancer:
bidirectional signalling and beyond. Nat. Rev. Cancer 2010, 10 (3),
165−180. (b) Noberini, R.; Lamberto, I.; Pasquale, E. B. Targeting
Eph receptors with peptides and small molecules: progress and
challenges. Semin. Cell Dev. Biol. [Online early access]. DOI: 10.1016/
j.semcdb.2011.10.023. Published Online: Oct 25, 2011.
(8) (a) Ireton, R. C.; Chen, J. EphA2 receptor tyrosine kinase as a
promising target for cancer therapeutics. Curr. Cancer Drug Targets
2005, 5 (3), 149−157. (b) Wykosky, J.; Debinski, W. The EphA2
receptor and ephrinA1 ligand in solid tumors: function and therapeutic
targeting. Mol. Cancer Res. 2008, 6 (12), 1795−1806.
ABBREVIATIONS USED
■
YSA, linear peptide of sequence YSAYPDSVPMMS; DYP,
linear peptide of sequence DYPSMAMYSPSV; PTX, paclitaxel;
qPCR, quantitative real-time polymerase chain reaction; DTPA,
diethylenetriaminepentaacetic acid; DOTA, 1,4,7,10-tetraazacy-
clododecane-N,N′,N″,N‴-tetraacetic acid; ELISA, enzyme
linked immunosorbent assay; DMEM, Dulbecco’s modified
Eagle’s medium; HDF, human dermal fibroblast
REFERENCES
■
(1) Gangloff, A.; Hsueh, W. A.; Kesner, A. L.; Kiesewetter, D. O.; Pio,
B. S.; Pegram, M. D.; Beryt, M.; Townsend, A.; Czernin, J.; Phelps, M.
E.; Silverman, D. H. Estimation of paclitaxel biodistribution and uptake
in human-derived xenografts in vivo with (18)F-fluoropaclitaxel. J.
Nucl. Med. 2005, 46 (11), 1866−1871.
(2) (a) Sugahara, K. N.; Teesalu, T.; Karmali, P. P.; Kotamraju, V. R.;
Agemy, L.; Greenwald, D. R.; Ruoslahti, E. Coadministration of a
tumor-penetrating peptide enhances the efficacy of cancer drugs.
Science 2010, 328 (5981), 1031−1035. (b) Wu, A. M.; Senter, P. D.
Arming antibodies: prospects and challenges for immunoconjugates.
Nat. Biotechnol. 2005, 23 (9), 1137−1146.
(3) (a) Jaracz, S.; Chen, J.; Kuznetsova, L. V.; Ojima, I. Recent
advances in tumor-targeting anticancer drug conjugates. Bioorg. Med.
Chem. 2005, 13 (17), 5043−5054. (b) Langer, R. New methods of
drug delivery. Science 1990, 249 (4976), 1527−1533. (c) Schrama, D.;
Reisfeld, R. A.; Becker, J. C. Antibody targeted drugs as cancer
therapeutics. Nat. Rev. Drug Discovery 2006, 5 (2), 147−159. (d) van
Vlerken, L. E.; Amiji, M. M. Multi-functional polymeric nanoparticles
for tumour-targeted drug delivery. Expert Opin. Drug Delivery 2006, 3
(2), 205−216.
(9) (a) Landen, C. N.; Kinch, M. S.; Sood, A. K. EphA2 as a target for
ovarian cancer therapy. Expert Opin. Ther. Targets 2005, 9 (6), 1179−
1187. (b) Tandon, M.; Vemula, S. V.; Mittal, S. K. Emerging strategies
for EphA2 receptor targeting for cancer therapeutics. Expert Opin.
Ther. Targets 2011, 15 (1), 31−51.
(10) Biao-Xue, R.; Xi-Guang, C.; Shuan-Ying, Y.; Wei, L.; Zong-Juan,
M. Epha2-dependent molecular targeting therapy for malignant
tumors. Curr. Cancer Drug Targets 2011, 11 (9), 1082−1097.
(11) (a) Wykosky, J.; Gibo, D. M.; Debinski, W. A novel, potent, and
specific ephrinA1-based cytotoxin against EphA2 receptor expressing
tumor cells. Mol. Cancer Ther. 2007, 6 (12, Part 1), 3208−3218.
(b) Sun, X. L.; Xu, Z. M.; Ke, Y. Q.; Hu, C. C.; Wang, S. Y.; Ling, G.
Q.; Yan, Z. J.; Liu, Y. J.; Song, Z. H.; Jiang, X. D.; Xu, R. X. Molecular
targeting of malignant glioma cells with an EphA2-specific
immunotoxin delivered by human bone marrow-derived mesenchymal
stem cells. Cancer Lett. 2011, 312 (2), 168−177.
(12) Jackson, D.; Gooya, J.; Mao, S.; Kinneer, K.; Xu, L.; Camara, M.;
Fazenbaker, C.; Fleming, R.; Swamynathan, S.; Meyer, D.; Senter, P.
D.; Gao, C.; Wu, H.; Kinch, M.; Coats, S.; Kiener, P. A.; Tice, D. A. A
human antibody-drug conjugate targeting EphA2 inhibits tumor
growth in vivo. Cancer Res. 2008, 68 (22), 9367−9374.
(13) Scarberry, K. E.; Dickerson, E. B.; McDonald, J. F.; Zhang, Z. J.
Magnetic nanoparticle−peptide conjugates for in vitro and in vivo
targeting and extraction of cancer cells. J. Am. Chem. Soc. 2008, 130
(31), 10258−10262.
(4) (a) Leader, B.; Baca, Q. J.; Golan, D. E. Protein therapeutics: a
summary and pharmacological classification. Nat. Rev. Drug Discovery
2008, 7 (1), 21−39. (b) Marx, J. L. Monoclonal antibodies in cancer.
Science 1982, 216 (4543), 283−285.
(5) (a) Aina, O. H.; Liu, R.; Sutcliffe, J. L.; Marik, J.; Pan, C. X.; Lam,
K. S. From combinatorial chemistry to cancer-targeting peptides. Mol.
Pharmaceutics 2007, 4 (5), 631−651. (b) Koolpe, M.; Dail, M.;
Pasquale, E. B. An ephrin mimetic peptide that selectively targets the
EphA2 receptor. J. Biol. Chem. 2002, 277 (49), 46974−46979.
(c) Hatakeyama, S.; Sugihara, K.; Shibata, T. K.; Nakayama, J.; Akama,
T. O.; Tamura, N.; Wong, S. M.; Bobkov, A. A.; Takano, Y.; Ohyama,
C.; Fukuda, M.; Fukuda, M. N. Targeted drug delivery to tumor
vasculature by a carbohydrate mimetic peptide. Proc. Natl. Acad. Sci.
U.S.A. 2011, 108 (49), 19587−19592. (d) Cutrera, J.; Dibra, D.; Xia,
X.; Hasan, A.; Reed, S.; Li, S. Discovery of a linear peptide for
improving tumor targeting of gene products and treatment of distal
tumors by IL-12 gene therapy. Mol. Ther. 2011, 19 (8), 1468−1477.
(e) Corti, A.; Curnis, F. Tumor vasculature targeting through NGR
peptide-based drug delivery systems. Curr. Pharm. Biotechnol. 2011, 12
(8), 1128−1134. (f) Wu, H. C.; Chang, D. K. Peptide-mediated
liposomal drug delivery system targeting tumor blood vessels in
anticancer therapy. J. Oncol. 2010, 2010, 723798. (g) Brown, K. C.
Peptidic tumor targeting agents: the road from phage display peptide
selections to clinical applications. Curr. Pharm. Des. 2010, 16 (9),
1040−1054. (h) Newton, J. R.; Deutscher, S. L. In vivo bacteriophage
display for the discovery of novel peptide-based tumor-targeting
agents. Methods Mol. Biol. 2009, 504, 275−290. (i) Yang, W.; Luo, D.;
Wang, S.; Wang, R.; Chen, R.; Liu, Y.; Zhu, T.; Ma, X.; Liu, R.; Xu, G.;
Meng, L.; Lu, Y.; Zhou, J.; Ma, D. TMTP1, a novel tumor-homing
peptide specifically targeting metastasis. Clin. Cancer Res. 2008, 14
(17), 5494−5502. (j) Laakkonen, P.; Porkka, K.; Hoffman, J. A.;
Ruoslahti, E. A tumor-homing peptide with a targeting specificity
related to lymphatic vessels. Nat. Med. 2002, 8 (7), 751−755.
(k) Ruoslahti, E. Targeting tumor vasculature with homing peptides
from phage display. Semin. Cancer Biol. 2000, 10 (6), 435−442.
(l) Koivunen, E.; Arap, W.; Valtanen, H.; Rainisalo, A.; Medina, O. P.;
Heikkila, P.; Kantor, C.; Gahmberg, C. G.; Salo, T.; Konttinen, Y. T.;
(14) Mitra, S.; Duggineni, S.; Koolpe, M.; Zhu, X.; Huang, Z.;
Pasquale, E. B. Structure−activity relationship analysis of peptides
targeting the EphA2 receptor. Biochemistry 2010, 49 (31), 6687−6695.
(15) Macrae, M.; Neve, R. M.; Rodriguez-Viciana, P.; Haqq, C.; Yeh,
J.; Chen, C.; Gray, J. W.; McCormick, F. A conditional feedback loop
regulates Ras activity through EphA2. Cancer Cell 2005, 8 (2), 111−
118.
(16) (a) Kolb, H. C.; Finn, M. G.; Sharpless, K. B. Click chemistry:
diverse chemical function from a few good reactions. Angew. Chem.
2001, 40 (11), 2004−2021. (b) Deshayes, S.; Maurizot, V.; Clochard,
M. C.; Baudin, C.; Berthelot, T.; Esnouf, S.; Lairez, D.; Moenner, M.;
Deleris, G. “Click” conjugation of peptide on the surface of polymeric
nanoparticles for targeting tumor angiogenesis. Pharm. Res. 2011, 28
(7), 1631−1642. (c) Dijkgraaf, I.; Rijnders, A. Y.; Soede, A.; Dechesne,
A. C.; van Esse, G. W.; Brouwer, A. J.; Corstens, F. H.; Boerman, O.
C.; Rijkers, D. T.; Liskamp, R. M. Synthesis of DOTA-conjugated
multivalent cyclic-RGD peptide dendrimers via 1,3-dipolar cyclo-
addition and their biological evaluation: implications for tumor
targeting and tumor imaging purposes. Org. Biomol. Chem. 2007, 5
(6), 935−944. (d) von Maltzahn, G.; Ren, Y.; Park, J. H.; Min, D. H.;
Kotamraju, V. R.; Jayakumar, J.; Fogal, V.; Sailor, M. J.; Ruoslahti, E.;
Bhatia, S. N. In vivo tumor cell targeting with “click” nanoparticles.
Bioconjugate Chem. 2008, 19 (8), 1570−1578.
(17) Blackburn, W. H.; Dickerson, E. B.; Smith, M. H.; McDonald, J.
F.; Lyon, L. A. Peptide-functionalized nanogels for targeted siRNA
delivery. Bioconjugate Chem. 2009, 20 (5), 960−968.
2435
dx.doi.org/10.1021/jm201743s | J. Med. Chem. 2012, 55, 2427−2436

Journal of Medicinal Chemistry
Article
(18) Cai, W.; Ebrahimnejad, A.; Chen, K.; Cao, Q.; Li, Z. B.; Tice, D.
A.; Chen, X. Quantitative radioimmunoPET imaging of EphA2 in
tumor-bearing mice. Eur. J. Nucl. Med. Mol. Imaging 2007, 34 (12),
2024−2036.
(19) Fox, B. P.; Tabone, C. J.; Kandpal, R. P. Potential clinical
relevance of Eph receptors and ephrin ligands expressed in prostate
carcinoma cell lines. Biochem. Biophys. Res. Commun. 2006, 342 (4),
1263−1272.
(20) Vihanto, M. M.; Plock, J.; Erni, D.; Frey, B. M.; Frey, F. J.;
Huynh-Do, U. Hypoxia up-regulates expression of Eph receptors and
ephrins in mouse skin. FASEB J. 2005, 19 (12), 1689−1691.
(21) (a) Liu, Y.; Zhang, B.; Yan, B. Enabling anticancer therapeutics
by nanoparticle carriers: the delivery of paclitaxel. Int. J. Mol. Sci. 2011,
12 (7), 4395−4413. (b) Singh, S.; Dash, A. K. Paclitaxel in cancer
treatment: perspectives and prospects of its delivery challenges. Crit.
Rev. Ther. Drug Carrier Syst. 2009, 26 (4), 333−372.
(22) (a) Coffman, K. T.; Hu, M.; Carles-Kinch, K.; Tice, D.;
Donacki, N.; Munyon, K.; Kifle, G.; Woods, R.; Langermann, S.;
Kiener, P. A.; Kinch, M. S. Differential EphA2 epitope display on
normal versus malignant cells. Cancer Res. 2003, 63 (22), 7907−7912.
(b) Wakayama, Y.; Miura, K.; Sabe, H.; Mochizuki, N. EphrinA1-
EphA2 signal induces compaction and polarization of Madin−Darby
canine kidney cells by inactivating ezrin through negative regulation of
RhoA. J. Biol. Chem. 2011, 286, 44243−44253. (c) Miura, K.; Nam, J.
M.; Kojima, C.; Mochizuki, N.; Sabe, H. EphA2 engages Git1 to
suppress Arf6 activity modulating epithelial cell−cell contacts. Mol.
Biol. Cell 2009, 20 (7), 1949−1959.
(23) Flanagan, J. G.; Cheng, H. J.; Feldheim, D. A.; Hattori, M.; Lu,
Q.; Vanderhaeghen, P. Alkaline phosphatase fusions of ligands or
receptors as in situ probes for staining of cells, tissues, and embryos.
Methods Enzymol. 2000, 327, 19−35.
(24) Carlsson, S. R.; Roth, J.; Piller, F.; Fukuda, M. Isolation and
characterization of human lysosomal membrane glycoproteins, h-lamp-
1 and h-lamp-2. Major sialoglycoproteins carrying polylactosamino-
glycan. J. Biol. Chem. 1988, 263 (35), 18911−18919.
(25) Placzek, W. J.; Wei, J.; Kitada, S.; Zhai, D.; Reed, J. C.;
Pellecchia, M. A survey of the anti-apoptotic Bcl-2 subfamily
expression in cancer types provides a platform to predict the efficacy
of Bcl-2 antagonists in cancer therapy. Cell Death Dis. 2010, 1, e40.
2436
dx.doi.org/10.1021/jm201743s | J. Med. Chem. 2012, 55, 2427−2436