Design and synthesis of a class of twin-chain amphiphiles for self-assembled monolayer-based electrochemical biosensor applications

Article abstract of DOI:10.1002/ejoc.201201732

A new class of twin-chain hydroxyalkylthiols (mercaptoalkanols) is described that features a nearly constant cross section and the potential for modification at one or both termini. These compounds are regioselectively available through Pd-mediated coupli

Full text of DOI:10.1002/ejoc.201201732

FULL PAPER
DOI: 10.1002/ejoc.201201732
Design and Synthesis of a Class of Twin-Chain Amphiphiles for Self-
Assembled Monolayer-Based Electrochemical Biosensor Applications
Thomas J. Fisher,[a] Socrates Jose P. Cañete,[a] Rebecca Y. Lai,[a] and
Patrick H. Dussault*[a]
Keywords: Amphiphiles / Sensors / Self-assemby / Arenes / Sulfur / Cross-coupling
A new class of twin-chain hydroxyalkylthiols (mercaptoalk-
anols) is described that features a nearly constant cross sec-
tion and the potential for modification at one or both termini.
These compounds are regioselectively available through Pd-
mediated couplings of benzene diiododitriflate, and their
syntheses include an example of a previously unreported
coupling reaction to generate an ortho-substituted arene bis-
(acetic acid). In an electrochemical sensor system, the self-
assembled monolayers (SAMs) that were prepared from the
new amphiphiles demonstrate an improved stability in com-
parison to the monolayers prepared from analogous single-
chain thiols.
The vast majority of amphiphiles that are utilized for
surface passivation or substrate attachment in gold-thiolate
biosensors are single-chain mercaptoalkanols (hydroxyalk-
ylthiols),[6] the limitations of which have been reported else-
where.[7] A number of multidentate thiol-based amphiphiles
have also been reported (see Figure 1). Amphiphiles based
upon multidentate thiols have several advantages over their
single-chain counterparts, that is, they absorb more rapidly
onto the gold surface, and they generate more stable
SAMs.[8,9] These properties are directly relevant to the per-
formance, stability, and reusability of biosensors. However,
existing multidentate thiols either possess unfunctionalized
termini, which limit the ability to create functional mono-
layers, or feature a significant mismatch between the multi-
valent “head” and the termini.[10–12] As part of a collabora-
tion that targets the creation of SAM-based sensors on
Introduction
The use of functionalized amphiphiles is central to a
wide array of applications and disciplines.[1–3] One of the
most important classes of amphiphiles is constructed from
long-chain thiols. The strength of the gold-sulfur interac-
tion, combined with the selectivity of gold for thiols and
related functional groups, provides the basis for creating ro-
bust self-assembled monolayers (SAMs) that can tolerate a
diverse array of functionality (commonly, –OH, –N3, or –
CH3 groups) at the terminus or “tail” of the amphiphile.[4]
When incorporated into SAM-based electrochemical bio-
sensors, these functionalized amphiphiles serve to passivate
and provide stability to the sensing element and to tether
the sensing element to the surface. The stability of the
SAM, and therefore of the sensor, increases with the chain
length of the thiol component.[5] However, in electrochemi-
cal biosensor applications, the use of very long-chain thiol
backbones would result in the formation of highly resistive
monolayers, which consequently would impede electro-
chemical readouts. To address this, we now report the syn-
thesis of a new class of arene cross-linked twin-chain dithiol
amphiphiles. The new amphiphiles, which feature a nearly
constant cross section and functionalized termini, form
stable SAM-based sensors that are more capable of with-
standing multiple electrochemical perturbations than the
single-chain amphiphiles of similar length.
[a] Department of Chemistry and Center for Nanohybrid
Functional Materials, University of Nebraska-Lincoln,
Lincoln, NE 68588, USA
Fax: +1-402-472-9402
E-mail: pdussault1@unl.edu
Homepage: http://chem.unl.edu/faculty/dussault.shtml
Supporting information for this article is available on the
WWW under http://dx.doi.org/10.1002/ejoc.201201732.
Figure 1. Examples of multidentate thiol amphiphiles.
© 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim 3263
Eur. J. Org. Chem. 2013, 3263–3270

T. J. Fisher, S. J. P. Cañete, R. Y. Lai, P. H. Dussault
FULL PAPER
nanomaterial surfaces, we became interested in multivalent perature and atmospheric pressure delivered a mixture of
amphiphiles that incorporate functionalized termini and partially saturated products.[14] The reaction at 40 °C and
maintain a nearly constant cross section down the long axis. at 2 atm pressure furnished a modest yield (40%, not
Herein, we report the synthesis of a new class of twin-chain shown) of diol 6, which was accompanied by byproducts
thiols, which, upon incorporation into electrochemical bio- that were saturated but retained one (30%) or both (10%)
sensors, result in SAMs that possess improved stability in of the benzyl ethers. Although the overall yield could be
comparison to those prepared from an analogous single- improved by resubjecting the isolated byproducts to the re-
chain thiol.
action conditions, we found that complete saturation and
deprotection of 5 were easily achieved in high yield by the
tandem application of Raney nickel (Raney Ni) and Pd/H2.
The alcohol moieties of 6 were then activated as methane-
sulfonates, which were displaced by treatment with KSAc
to provide the bis(thioester) in 74% yield over the two steps.
Reduction with diisobutylaluminum hydride (DIBAL-H)
removed both the benzoate and thioacetate protecting
groups to provide the 13-carbon twin-chain amphiphile 1.
Results and Discussion
Our initial investigations focused on amphiphiles 1 and
2, which were chosen for their comparability to 13- and 11-
carbon single-chain thiol amphiphiles, respectively. The key
steps for the construction of the molecular frameworks in-
volve sequential cross-coupling reactions of diiododitriflate
3 (see Scheme 1). The synthesis for 13-carbon twin-chain
amphiphile 1 is made on the basis of research from our lab
that demonstrates the ability to prepare 1,2,4,5-tetralkynyl-
arenes from 3 with complete regiochemical control through
two sequential Sonagashira reactions.[13] The synthesis of
the shorter 11-carbon amphiphile 2 requires a new ap-
proach, in which the two chains that comprise the terminus
are introduced through two cross-coupling reactions be-
tween the bis(triflate) and a silyl ketene acetal.
Scheme 2. Synthesis of amphiphile 1.
The synthesis of 11-carbon amphiphile 2, as illustrated
in Scheme 3, also began with two Sonagashira coupling re-
actions of 3. The product dialkynylditriflate 7 was then sub-
jected to Pd-mediated coupling reactions with silyl ketene
acetal 8 to provide bis(ester) 9 in moderate yield. Although
the coupling of silyl ketene acetals with iodoarenes or aryl
triflates has been previously described, our experiment was
the first example of its application to ortho-positioned
bis(functionalization).[15] The ketene acetal couplings
proved considerably more challenging than the Sonagashira
reactions described earlier. Attaining even moderate yields
of the twofold coupling product 9 required the use of dry
lithium acetate and relatively pure silyl ketene acetal, and
Scheme 1. Retrosynthetic analysis for the 13- and 11-carbon am-
phiphiles (Bn = benzyl, Bz = benzoyl, Tf = trifluoromethylsulfonyl,
TBS = tert-butyldimethylsilyl).
The synthesis of 1 commenced with the two Sonogashira the latter was frequently contaminated with the C-silylated
cross-coupling reactions of 3 with the benzyl ether of 4- isomer ethyl 2-trimethylsilylacetate.[16,17] However, even af-
pentyn-1-ol (see Scheme 2). Subsequent couplings of the re- ter the reaction was optimized, the monocarboxymethyl/
sulting dialkynylditriflate 4 with the benzoyl ester of 4-pent- monotriflate that was derived from a single cross-coupling
yn-1-ol generated tetraalkyne 5. We had originally planned reaction was often observed as a major byproduct.[18]
to employ a Pd-catalyzed reaction with H2 to achieve satu-
The monotriflate byproduct readily underwent a Sonaga-
ration of all four alkynes and hydrogenolytic deprotection shira coupling reaction with simple alkynes (not shown),
of both benzyl ethers. However, the reaction at room tem- which suggested a potentially general pathway to introduce
3264
www.eurjoc.org
© 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 2013, 3263–3270

Design and Synthesis of a Class of Twin-Chain Amphiphiles
the original response after 72 h, highlighting the stability of
the SAMs that were derived from the twin-chain amphi-
philes.
Figure 2. Comparison of stability of E-DNA sensors formed from
11-hydroxyundecanethiol, 1, and 2.
Scheme 3. Synthesis of amphiphile 2.
As a final test of stability, the sensors that were recovered
from the ACV monitoring after 72 h (see above) were chal-
lenged/hybridized with 1.0 μm complete complementary
target DNA, to which all the sensors responded. Upon sen-
sor regeneration with deionized water, the MB signal was
also regenerated, as expected for this class of sensors (see
Figure 3).[20]
differentially functionalized termini into future generations
of twin-chain amphiphiles. In marked contrast to what we
had observed for the tetraalkynylarenes, the bis(alkynes)
were easily saturated using Pd/C and hydrogen to furnish a
nearly quantitative yield of diol 10, which reflected concom-
itant desilylation under the protic reaction conditions.[19]
The conversion of 10 into the corresponding diol/dithiol 2
was achieved in a good yield by using a similar method as
that for the 13-carbon substrate above. No oxidative degra-
dation of the thiol moieties was observed during the reac-
tion, workup, or purification processes. The twin-chain am-
phiphiles 1 and 2 are easily handled oils and stable indefi-
nitely when stored in the cold in the absence of light and
oxygen.
Electrochemical DNA Sensor
The synthesized amphiphiles were applied to the fabrica-
tion of a folding-based electrochemical DNA (E-DNA) sen-
sor. An electrochemically cleaned gold disc electrode was
immersed for 10 min in a 2 mm ethanolic solution of either
11-hydroxyundecanethiol, 1, or 2. The resulting SAMs were
further modified (drop casting, 3 h) with a stem-loop DNA
sensing element that was thiolated at the 5Ј-terminus and
modified with methylene blue (MB) at the 3Ј-terminus.[20]
The fabricated sensors were then rinsed with deionized (DI)
water and placed in an electrochemical cell. The stability
of the sensors was assessed by monitoring the MB current
through alternating current voltammetry (ACV), scanning
every 12 h over a period of 72 h (see Figure 2). Although
the sensor that was prepared with the single-chain am-
Figure 3. Hybridization curves obtained from sensors passivated
with 11-hydroxyundecanethiol (red), 1 (green), and 2 (purple) in
the presence of 1.0 μm target DNA in Phys2 buffer after the 72 h
s t ab i l i t y r u n . K -ra s p ro be se qu en ce : 5Ј HS-(CH2 )1 1
-
CCGTTACGCCACCAGCTCCAAACGG–C7–MB-3Ј. K-ras tar-
get sequence: 5Ј-TTGGAGCTGGTGGCGTA-3Ј.
Conclusions
A new class of twin-chain amphiphiles was prepared
phiphile exhibited significant loss of response after 24–36 h, using routes that should be easily adaptable to a range of
the sensors fabricated with 1 and 2 retained nearly 100% of backbones and functional groups. The hydroxy groups of
Eur. J. Org. Chem. 2013, 3263–3270
© 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
3265

T. J. Fisher, S. J. P. Cañete, R. Y. Lai, P. H. Dussault
FULL PAPER
separated aqueous layer was extracted with Et2O (2ϫ75 mL). The
combined organic layers were dried with MgSO4, filtered through
a pad of silica, and concentrated in vacuo to afford 1,2-dihydroxy-
4,5-diiodobenzene (3.61 g, 9.99 mmol, quantitative) as an off-white
solid, which was considered pure by NMR analysis and used with-
out further purification, m.p. 116.0–116.5 °C; Rf = 0.50 (50%
the new amphiphiles, which were applied here as part of a
wettable passivation layer, provide the foundation for the
syntheses of functionalized nanomaterials and allow con-
trol of nearest neighbor interactions at the surface of the
monolayer.
In initial tests, the sensors fabricated that use the new
amphiphiles showed improved stability compared to those
prepared from the single-chain thiol. Electrochemical char-
acterization of the SAMs derived from 1 and 2 along with
details of the performance of E-DNA sensors that were fab-
ricated from these amphiphiles will be reported separately.
1
EtOAc/Hex). H NMR (400 MHz, [D6]acetone): δ = 8.48 (br. s, 2
H), 7.38 (s, 2 H) ppm. 13C NMR (150 MHz, [D6]acetone): δ =
146.5, 125.6, 93.7 ppm.
4,5-Diiodo-1,2-phenylene Bis(trifluoromethanesulfonate) (3):[13] To a
flame-dried 100 mL RBF were added 1,2-dihydroxy-4,5-diiodo-
benzene (2.84 g, 7.85 mmol, 1 equiv.), CH2Cl2 (55 mL), and pyr-
idine (3.16 mL, 3.10 g, 39 mmol, 5 equiv.). The solution was cooled
to 0 °C, and Tf2O (2.91 mL, 4.88 g, 17.3 mmol, 2.2 equiv.) was
added dropwise through a syringe over 10 min. The reaction was
stirred for 6 h, as the mixture warmed to ambient temperature. The
reaction mixture was then cooled to 0 °C and quenched with H2O
(30 mL). The separated aqueous layer was extracted with CH2Cl2
(2ϫ30 mL). The combined organic layers were dried with MgSO4
and filtered through a tall pad of silica. The pad was washed care-
fully with CH2Cl2 to avoid the elution of impurities, and the filtrate
was concentrated in vacuo to afford 3 (4.90 g, 7.82 mmol, quantita-
tive) as an off-white solid, which was considered pure by NMR
analysis and used without further purification. [Note: For reactions
in which small amounts of impurities were observed after filtration,
the product was obtained in pure form by column chromatography
(10% EtOAc/Hex).] M.p. 46.5–47.7 °C; Rf = 0.60 (10% EtOAc/
Hex). 1H NMR (400 MHz, CDCl3): δ = 7.91 (s, 2 H) ppm. 13C
Experimental Section
General Information: All reactions were carried out in flame-dried
glassware under dry nitrogen and using magnetic stirring. The sol-
vents were used as purchased with the exception of tetrahydrofuran
(THF) and CH2Cl2, which were distilled from Na/Ph2CO and
CaH2, respectively. Thin layer chromatography was performed with
0.25 mm hard-layer silica G plates, and the developed plates were
visualized with a UV lamp and by staining with 1% aqueous
KMnO4 solution (for unsaturated compounds), I2 (general), and
vanillin or phosphomolybdic acid (general, after charring). The
NMR spectroscopic data were obtained by using CDCl3 as the
solvent with the data reported in parts per million (δ, ppm), [multi-
plicity, coupling constant (Hz), integration]. The 13C NMR spec-
NMR (100 MHz, CDCl3): δ = 139.6, 133.4, 118.5 (q, JC,F
=
1
troscopic data are reported in parts per million (δ, ppm). The H
321.0 Hz), 108.0 ppm. FTIR: ν = 1429, 1335, 1215, 1125, 1105,
˜
and 13C NMR spectroscopic data were referenced to the residual
proton in CDCl3 and CDCl3, respectively. Infrared spectra were
recorded as neat films using attenuated total reflectance (ATR).
Selected absorptions were reported in wavenumbers (cm–1). HRMS
analysis was obtained with the ionization source listed for each
compound.
868, 788, 745, 689 cm–1. HRMS (ESI): calcd. for C8H2F6I2NaO6S2
[M + Na]+ 648.7184; found 648.7164.
5-Benzyloxypentyne:[23] To a flame-dried 250 mL RBF was added
NaH (60% dispersion in mineral oil, 1.9 g, 47.6 mmol, 2 equiv.).
The solid was washed with hexanes (15 mL). THF (95 mL) was
added, and the suspension was cooled to 0 °C. Pentynol (2.0 g,
23.8 mmol, 1 equiv.) in THF (5 mL) was added dropwise. BnBr
(2.60 mL, 21.9 mmol, 0.92 equiv.) was added dropwise. The reac-
tion was then warmed to room temp. over 16 h and then quenched
with a saturated aqueous solution of NH4Cl (25 mL). The mixture
was diluted with H2O (20 mL), and the resulting solution was ex-
tracted with EtOAc (2ϫ40 mL). The combined organic layers were
washed with brine (40 mL), dried with Na2SO4, and concentrated
in vacuo. Purification by flash chromatography (4% EtOAc/Hex)
afforded the benzyl ether (3.60 g, 20.7 mmol, 94%) as a colorless
1,2-Diiodo-4,5-dimethoxybenzene:[13,21] To a flame-dried 100 mL
round-bottomed flask (RBF) equipped with a short air condenser
were added H5IO6 (5.84 g, 25.6 mmol, 0.41 equiv.) and methanol
(36 mL). The mixture was stirred at room temp., and then I2
(12.76 g, 50.2 mmol, 0.8 equiv.) was added. The reaction was stirred
vigorously for 10 min, and then 1,2-dimethoxybenzene (8.0 mL,
8.7 g, 63 mmol, 1 equiv.) was added through a syringe in one por-
tion. The reaction was heated to 70 °C in an oil bath for 5 h, which
resulted in the formation of a white solid. The solid made stirring
difficult, but the reaction proceeded in the absence of efficient stir-
ring. The hot solution was poured into dilute aqueous Na2S2O5
(approximately 100 mL), and the mixture was cooled to room temp.
The solid was collected by filtration through a glass frit, washed
quickly with cold MeOH (2ϫ30 mL), and dried in vacuo to afford
the diiodoarene (21.07 g, 54 mmol, 86%) as a white solid, which
was considered pure by NMR analysis and used without further
purification, m.p. 134.5–136.0 °C; Rf = 0.49 [20% ethyl acetate
1
liquid; Rf = 0.41 (5% EtOAc/Hex). H NMR (300 MHz, CDCl3):
δ = 7.29–7.44 (5 H), 4.55 (s, 2 H), 3.61 (t, J = 6.2 Hz, 2 H), 2.36
(td, J = 7.1, 2.6 Hz, 2 H), 1.97 (t, J = 2.6 Hz, 1 H), 1.81–1.93 (m,
2 H) ppm. 13C NMR (75 MHz, CDCl3): δ = 138.5, 128.4, 127.63,
127.58, 84.0, 73.0, 68.7, 68.5, 28.7, 15.3 ppm. CAS: 57618-47-0.
4,5-Bis(5-benzyloxypent-1-yn-1-yl)-1,2-phenylene Bis(trifluorometh-
anesulfonate) (4):[13] A flame-dried 20 mL vial fitted with a screw-
cap septum was charged with PdCl2(PPh3)2 (84 mg, 0.12 mmol,
0.06 equiv.), CuI (45.6 mg, 0.24 mmol, 0.12 equiv.), and compound
3 (1.25 g, 2 mmol, 1 equiv.). The vessel was evacuated/backfilled
with nitrogen (3ϫ), and to this were sequentially added THF
(4 mL), Et3N (0.85 mL, 6 mmol, 3 equiv.), and 5-benzyloxypentyne
(802 mg, 4.6 mmol, 2.3 equiv.) in THF (1 mL). The reaction was
stirred for 3 h at room temp. and filtered through a pad of silica,
which was washed with Et2O. The filtrate was concentrated in
vacuo and purified by flash chromatography (gradient from Hex to
10% EtOAc/Hex) to afford 4 (1.14 g, 1.59 mmol, 79%); Rf = 0.27
1
(EtOAc)/hexane (Hex)]. H NMR (600 MHz, CDCl3): δ = 7.25 (s,
2 H), 3.85 (s, 6 H) ppm. 13C NMR (150 MHz, CDCl3): δ = 149.6,
121.7, 96.1, 56.2 ppm.
1,2-Dihydroxy-4,5-diiodobenzene:[13,22] A flame-dried 250 mL RBF
was charged with 1,2-diiodo-4,5-dimethoxybenzene (3.90 g,
10 mmol, 1 equiv.) and then evacuated/backfilled with nitrogen
(3ϫ). CH2Cl2 (70 mL) was added. The solution was cooled to 0 °C,
and BBr3 (1.0 m solution in CH2Cl2, 25 mL, 25 mmol, 2.5 equiv.)
was added by using a syringe pump over 20 min. The reaction was
stirred at 0 °C for 4 h and then quenched with H2O (50 mL). The
3266
www.eurjoc.org
© 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 2013, 3263–3270

Design and Synthesis of a Class of Twin-Chain Amphiphiles
(10% EtOAc/Hex). 1H NMR (600 MHz, CDCl3): δ = 7.42 (s, 2 H),
7.27–7.39 (10 H), 4.56 (s, 4 H), 3.65 (t, J = 6.0 Hz, 4 H), 2.62 (t, J
= 7.1 Hz, 4 H), 1.92–1.98 (m, 4 H) ppm. 13C NMR (150 MHz,
CDCl3): δ = 138.8, 138.3, 128.4, 128.2, 127.59, 127.56, 126.3, 121.7,
in THF (3 mL) and added to an 8 mL vial, which had been charged
with 10 wt.-% Pd/C (20 mg). The reaction was placed under an
atmosphere of H2 for 16 h and then filtered through a plug of
silica. The filtrate was concentrated in vacuo, and the resulting resi-
119.6, 117.5, 115.3, 98.1, 77.4, 73.0, 68.5, 28.6, 16.5 ppm. FTIR: ν due was purified by flash chromatography (55% EtOAc/Hex) to
˜
= 2859, 2230, 1489, 1433, 1210, 1178, 1135, 1080, 732 cm–1. HRMS afford 6 (129 mg, 0.21 mmol, 82%) as a colorless oil; Rf = 0.30
1
(ESI): calcd. for C32H28F6O8S2Na [M + Na]+ 741.1027; found (60% EtOAc/Hex). H NMR (600 MHz, CDCl3): δ = 8.04–8.10 (4
741.1039.
H), 7.54–7.61 (2 H), 7.42–7.50 (4 H), 6.94 (s, 2 H), 4.36 (t, J =
6.7 Hz, 4 H), 3.67 (t, J = 6.6 Hz, 4 H), 2.53–2.68 (8 H), 1.80–1.91 (6
H), 1.53–1.72 (16 H), 1.44–1.51 (4 H) ppm. 13C NMR (150 MHz,
CDCl3): δ = 166.7, 137.6, 137.3, 132.8, 130.4, 129.9, 129.5, 128.3,
65.0, 62.7, 32.5, 32.21, 32.15, 31.2, 30.9, 28.6, 26.1, 25.8 ppm.
5-Benzoyloxypentyne:[24] To a flame-dried 100 mL RBF were added
pentynol (2.0 g, 24 mmol, 1 equiv.) and CH2Cl2 (80 mL). The reac-
tion was cooled to 0 °C, and BzCl (3.3 mL, 28 mmol, 1.2 equiv.)
was added dropwise followed by the addition of N,N-dimethylami-
nopyridine (DMAP, 300 mg, 2.4 mmol, 0.1 equiv.) and Et3N
(7 mL). The reaction was warmed to room temp. over 12 h and
then quenched with HCl (2 n solution, 10 mL). The solution was
FTIR: ν = 3776, 2988, 2972, 2901, 1717, 1334, 1271, 1067, 1057,
˜
1028 cm–1. HRMS (ESI): calcd. for C40H54O6Na [M + Na]+
653.3818; found 653.3823.
extracted with EtOAc (2ϫ40 mL), and the combined extracts were 1,2-Bis(5-benzoyloxypentyl)-4,5-bis(5-methylsulfonylpentyl)benzene:
washed with brine (40 mL), dried with Na2SO4, and concentrated
in vacuo. The residue was purified by flash chromatography (2.5%
EtOAc/Hex) to afford the protected alkynol (4.02 g, 21.4 mmol,
89%) as a colorless oil; Rf = 0.57 (10% EtOAc/Hex). 1H NMR
(600 MHz, CDCl3): δ = 8.03–8.07 (2 H), 7.53–7.60 (1 H), 7.42–7.48
(2 H), 4.44 (t, J = 6.1 Hz, 2 H), 2.40 (td, J = 7.3, 2.7 Hz, 2 H),
1.98–2.05 (overlapping signals, 3 H) ppm. 13C NMR (150 MHz,
CDCl3): δ = 166.5, 132.9, 130.3, 129.6, 128.3, 83.0, 69.1, 63.4, 27.7,
15.4 ppm. CAS: 5390-04-5.
To a flamed-dried 20 mL vial fitted with a screw-cap septum were
added 6 (215 mg, 0.34 mmol, 1 equiv.), CH2Cl2 (4 mL), and Et3N
(0.19 mL, 1.36 mmol, 4 equiv.). DMAP (4.2 mg, 0.034 mmol,
0.1 equiv.) was added followed by the dropwise addition of meth-
anesulfonyl chloride (MsCl, 0.08 mL, 1.02 mmol, 3 equiv.). The re-
action was stirred for 3 h and quenched with a saturated aqueous
solution of NaHCO3 (10 mL). The layers were separated, and the
aqueous layer was extracted with CH2Cl2 (3ϫ10 mL). The com-
bined organic layers were washed with H2O (20 mL), dried with
Na2SO4, and concentrated in vacuo. Purification by flash
chromatography (45% EtOAc/Hex) afforded the bis(methanesul-
fonate) (294 mg, 0.37 mmol, 91%) as a colorless oil; Rf = 0.27 (40%
EtOAc/Hex). 1H NMR (600 MHz, CDCl3): δ = 8.01–8.11 (4 H),
7.54–7.62 (2 H), 7.46 (t, J = 7.6 Hz, 4 H), 6.92 (s, 2 H), 4.35 (t, J
= 6.6 Hz, 4 H), 4.26 (t, J = 6.6 Hz, 4 H), 3.02 (s, 6 H), 2.60 (br. t,
J = 8.0 Hz, 4 H), 2.57 (br. t, J = 8.0 Hz, 4 H), 1.77–1.88 (8 H),
1.48–1.70 (16 H) ppm. 13C NMR (150 MHz, CDCl3): δ = 166.7,
137.6, 137.3, 132.9, 130.5, 129.9, 129.5, 128.3, 70.1, 65.0, 37.4, 32.2,
4,5-Bis(5-benzyloxypent-1-yn-1-yl)-1,2-phenylene Bis(pent-4-yn-1-
ol-5-yl, Benzoate Ester) (5): A flame-dried 20 mL vial fitted with a
screw-cap septum was charged with PdCl2(PPh3)2 (127 mg,
0.18 mmol, 0.12 equiv.), CuI (89.4 mg, 0.45 mmol, 0.30 equiv.), and
Bu4NI (1.65 g, 4.5 mmol, 3 equiv.). The vessel was evacuated/back-
filled with nitrogen (3ϫ), followed by the addition of bis(triflate) 4
in a mixture of N,N-dimethylformamide (DMF)/Et3N (5:1, 7 mL).
The mixture was stirred for 5 min at room temp., and 5-benzoyl-
oxypentyne (980 mg, 6.1 mmol, 4.1 equiv.) in DMF/Et3N (5:1,
1.5 mL) was then added. The reaction was heated to 70 °C (oil
bath) for 5.5 h and then cooled to room temp. The crude reaction
mixture was filtered through a pad of silica, which was washed with
Et2O. The filtrate was concentrated in vacuo, and the residue was
purified by flash chromatography (15% EtOAc/Hex) to afford 5
(930 mg, 1.17 mmol, 79%) as a colorless oil; Rf = 0.39 (20%
32.1, 31.1, 30.8, 29.1, 28.7, 26.2, 25.6 ppm. FTIR: ν = 2937, 1714,
˜
1352, 1272, 1173, 1114, 1070, 944, 908 cm–1. HRMS (ESI): calcd.
for C42H58O10S2Na [M + Na]+ 809.3369; found 809.3367.
1,2-Bis(5-benzoyloxypentyl)-4,5-bis[5-(acetylthiyl)pentyl]benzene:
To a flame-dried 8 mL vial fitted with screw-cap septum were
added the bis(methanesulfonate) (222 mg, 0.282 mmol, 1 equiv.)
EtOAc/Hex). 1H NMR (600 MHz, CDCl3): δ = 8.04–8.10 (4 H), and DMF (2.5 mL) followed by KSAc (97 mg, 0.85 mmol,
7.54–7.60 (2 H), 7.42–7.47 (4 H), 7.39–7.41 (2 H), 7.33–7.38 (8 H), 3 equiv.). The reaction was stirred for 14 h and then diluted with
7.27–7.31 (2 H), 4.55 (s, 4 H), 4.53 (t, J = 6.3 Hz, 4 H), 3.66 (t, J
= 6.2 Hz, 4 H), 2.70 (t, J = 7.0 Hz, 4 H), 2.60 (t, J = 7.0 Hz, 4 H), the organic layer was washed with a saturated aqueous solution
2.11 (quint, J = 6.6 Hz, 4 H), 1.94 (quint, J = 6.6 Hz, 4 H) ppm. of NaHCO3 (3ϫ10 mL), dried with Na2SO4, and concentrated in
13C NMR (150 MHz, CDCl3): δ = 166.5, 138.5, 135.3, 133.0, 130.2, vacuo. Purification by flash chromatography (10% EtOAc/Hex) af-
Et2O (20 mL) and H2O (10 mL). The layers were separated, and
129.6, 128.38, 128.36, 127.60, 127.56, 125.3, 124.9, 95.0, 93.9, 79.6,
forded the bis(thioacetate) (170 mg, 0.228 mmol, 81%) as a color-
less oil; Rf = 0.32 (15% EtOAc/Hex). 1H NMR (600 MHz, CDCl3):
δ = 8.07 (d, J = 7.3 Hz, 4 H), 7.58 (t, J = 7.4 Hz, 2 H), 7.46 (t, J
= 7.8 Hz, 4 H), 6.92 (s, 2 H), 4.36 (t, J = 6.7 Hz, 4 H), 2.90 (t, J =
7.3 Hz, 4 H), 2.60 (br. t, J = 7.9 Hz, 4 H), 2.55 (br. t, J = 7.9 Hz,
4 H), 2.35 (s, 6 H), 1.80–1.89 (8 H), 1.54–1.70 (8 H), 1.44–1.51 (4
H) ppm. 13C NMR (150 MHz, CDCl3): δ = 195.9, 166.7, 137.5,
137.3, 132.8, 130.5, 129.9, 129.5, 128.3, 65.0, 32.3, 32.2, 31.1, 30.9,
79.1, 73.0, 68.7, 63.7, 28.9, 28.0, 16.7, 16.6 ppm. FTIR: ν = 3675,
˜
2988, 2972, 2901, 2229, 1716, 1451, 1394, 1269, 1107, 1068, 1027,
900 cm–1. HRMS (ESI): calcd. for C54H50O6Na [M + Na]+
817.3505; found 817.3503. Note: This procedure differs from a pre-
vious report in the use of 12 mol-% PdCl2(PPh3)2 rather than
6 mol-%.[13]
1,2-Bis(5-benzoyloxypentyl)-4,5-bis(5-hydroxypentyl)benzene
(6):
30.7, 29.5, 29.1, 28.7, 26.3 ppm. FTIR: ν = 3684, 3675, 2988, 2972,
˜
Raney Ni (50% in water, 120 mg) was added to an 8 mL vial. The
solid was collected on a stir bar and washed with MeOH
(3ϫ5 mL). The vial was then fitted with a screw-cap septum and
charged with a solution of 5 (199 mg, 0.25 mmol, 1 equiv.) in
MeOH/EtOAc (3:1, 4 mL). The vial was placed under an atmo-
sphere of H2 (balloon), and the reaction was stirred for 16 h. The
reaction mixture was filtered through a plug of silica, and the fil-
trate was concentrated under vacuum. The residue was dissolved
2901, 1717, 1688, 1406, 1394, 1383, 1230, 1057, 1028 cm–1. HRMS
(ESI): calcd. for C44H58O6S2Na [M + Na]+ 769.3573; found
769.3568.
1,2-Bis(5-hydroxypentyl)-4,5-bis(5-thiylpentyl)benzene (1): A flame-
dried 8 mL vial fitted with a screw-cap septum was charged with
the bis(thioacetate) (144 mg, 0.193 mmol, 1 equiv.) and THF
(2.5 mL). DIBAL-H (nominally 1.5 m solution in toluene, 1.55 mL,
Eur. J. Org. Chem. 2013, 3263–3270
© 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
3267

T. J. Fisher, S. J. P. Cañete, R. Y. Lai, P. H. Dussault
FULL PAPER
2.3 mmol, 12 equiv.) was added dropwise. The reaction was stirred
at room temp. for 2.5 h, cooled to 0 °C, and quenched by the care-
ful addition of HCl (2 n solution, 4 mL). The solution was diluted
with H2O (10 mL), and the resulting mixture was extracted with
Et2O (3ϫ10 mL). The organic layers were washed with brine
(10 mL), dried with Na2SO4, and concentrated in vacuo. The resi-
due was purified by flash chromatography (50% EtOAc/Hex) to
afford 1 (74 mg, 0.163 mmol, 84%) of a colorless oil; Rf = 0.19
(45% EtOAc/Hex). 1H NMR (600 MHz, CDCl3): δ = 6.92 (s, 2 H),
3.68 (t, J = 6.6 Hz, 4 H), 2.53–2.61 (12 H), 1.56–1.72 (18 H), 1.45–
1.53 (8 H), 1.37 (t, J = 7.9 Hz, 2 H) ppm. 13C NMR (150 MHz,
CDCl3): δ = 137.6, 137.4, 129.9, 62.9, 33.9, 32.6, 32.3, 32.2, 31.2,
centration in vacuo followed by distillation (70–80 °C, 40–50 Torr)
provided 8 as a colorless liquid (see NMR spectrum for approxi-
mate composition). CAS: 18295-66-4.
Diethyl 2,2Ј-(4,5-Bis{6-[(tert-butyldimethylsilyl)oxy]hex-1-ynyl}-1,2-
phenylene)diacetate (9): A flame-dried 8 mL vial fitted with a
screw-top septum was charged with Pd(PPh3)4 (87 mg, 0.075 mmol,
0.15 equiv.) and anhydrous LiOAc (133 mg, 2 mmol, 4 equiv.). The
vessel was evacuated and backfilled with dry nitrogen (3ϫ) fol-
lowed by the addition of 7 (398 mg, 0.5 mmol, 1 equiv.) and 8
[321 mg, 2 mmol, 4 equiv. (based on mass, approximately 75% pure
by 1H NMR analysis)] in THF (3.5 mL). The sealed reaction vessel
was placed in a 70 °C oil bath for 5 h and then cooled to room
temp. followed by dilution with H2O (10 mL) and EtOAc (10 mL).
The separated aqueous layer was extracted with EtOAc
(2ϫ10 mL), and the combined organic layers were washed with
brine (1ϫ20 mL), dried with Na2SO4, and concentrated in vacuo.
The residue was purified by flash chromatography (8 % EtOAc/
Hex) to afford 9 (134 mg, 0.20 mmol, 40%) as a colorless oil; Rf =
30.8, 28.5, 25.9, 24.6 ppm. FTIR: ν = 3353, 2930, 2857, 2358, 2338,
˜
1775, 1460, 1143 cm–1. HRMS (ESI): calcd. for C26H46O2S2Na [M
+ Na]+ 477.2837; found 477.2821.
6-(tert-Butyldimethylsilyloxy)hexyne:[25]
A flame-dried 100 mL
RBF was charged with hexynol (2.50 g, 25.5 mmol, 1 equiv.),
CH2Cl2 (60 mL), TBSCl (4.23 g, 28.1 mmol, 1.1 equiv.), and imid-
azole (3.82 g, 56.1 mmol, 2.2 equiv.). The reaction was stirred for
1.5 h, and then quenched with a saturated aqueous solution of
NaHCO3 (40 mL). The layers were separated, and the aqueous
layer was extracted with CH2Cl2 (2ϫ20 mL). The combined or-
ganic layers were dried with Na2SO4 and concentrated in vacuo.
The residue was filtered through a pad of silica to afford the silyl-
protected alkynol (4.93 g, 23.2 mmol, 91%) as a colorless oil; Rf =
1
0.30 (10% EtOAc/Hex). H NMR (400 MHz, CDCl3): δ = 7.28 (s,
2 H), 4.14 (q, J = 7.1 Hz, 4 H), 3.68 (t, J = 5.8 Hz, 4 H), 3.64 (s,
4 H), 2.49 (t, J = 6.5 Hz, 4 H), 1.64–1.78 (8 H), 1.25 (t, J = 7.1 Hz,
6 H), 0.92 (s, 18 H), 0.07 (s, 12 H) ppm. 13C NMR (150 MHz,
CDCl3): δ = 170.8, 134.1, 132.5, 125.5, 94.0, 79.3, 62.7, 61.0, 38.7,
31.9, 26.0, 25.2, 19.4, 18.4, 14.1, –5.3 ppm. FTIR: ν = 2987, 2856,
˜
1735, 1250, 1211, 1102, 1030, 833, 773 cm–1. HRMS (ESI): calcd.
for C38H62O6Si2Na [M + Na]+ 693.3983; found 693.3961.
1
0.70 (5% EtOAc/Hex). H NMR (400 MHz, CDCl3): δ = 3.65 (t,
J = 6.0 Hz, 2 H), 2.24 (td, J = 6.8 Hz, 2.7 Hz, 2 H), 1.96 (t, J =
2.5 Hz, 1 H), 1.56–1.70 (2 H), 0.92 (s, 9 H), 0.07 (s, 6 H) ppm. 13C
NMR (100 MHz, CDCl3): δ = 84.5, 68.2, 62.6, 31.8, 25.9, 25.0,
18.3, 18.2, –5.3 ppm. CAS: 73448-13-2.
Diethyl 2,2Ј-[4,5-Bis(6-hydroxyhexyl)-1,2-phenylene]diacetate (10):
A flame-dried 20 mL vial fitted with a screw-cap septum was
charged with 10% (w/w) Pd/C (10 mg) followed by the addition of
a solution of 9 (103 mg, 0.155 mmol, 1 equiv.) in MeOH/EtOAc
(1:1, 8 mL). The reaction was placed under an atmosphere of H2
(balloon) and stirred for 18 h. The mixture was filtered through a
pad of Celite, and the filtrate was concentrated in vacuo to provide
10 (66 mg, 0.149 mmol, 97%) as a colorless oil; Rf = 0.41 (75%
4,5-Bis[6-(tert-butyldimethylsilyloxy)hex-1-ynyl]-1,2-phenylene Bis-
(trifluoromethanesulfonate) (7): A flame-dried 20 mL vial fitted
with a screw-cap septum was charged with PdCl2(PPh3)2 (126 mg,
0.18 mmol, 0.06 equiv.), CuI (68 mg, 0.36 mmol, 0.12 equiv.), and
3 (1.88 g, 3 mmol, 1 equiv.). The vessel was evacuated/backfilled
with nitrogen (3ϫ), and to this were sequentially added THF
(5 mL), Et3N (1.29 mL, 9 mmol, 3 equiv.), and a solution of 6-(tert-
butyldimethylsilyloxy)hexyne (1.46 g, 6.9 mmol, 2.3 equiv.) in THF
(2.5 mL). The reaction was stirred for 3 h at room temp. and then
filtered through a pad of silica, which was washed with Et2O. The
filtrate was concentrated in vacuo, and the residue was purified by
flash chromatography (gradient from 0 to 2% EtOAc/Hex) to af-
ford 7 (2.29 g, 2.29 mmol, 96%) as a colorless oil; Rf = 0.27 (2.5 %
EtOAc/Hex). 1H NMR (400 MHz, CDCl3): δ = 7.44 (s, 2 H), 3.66–
3.72 (4 H), 2.49–2.61 (4 H), 1.66–1.77 (8 H), 0.92 (s, 18 H), 0.08
(s, 12 H) ppm. 13C NMR (150 MHz, CDCl3): δ = 138.8, 128.3,
126.3, 118.5 (q, JC,F = 320.9 Hz), 98.6, 77.3, 62.5, 31.9, 25.9, 24.9,
1
EtOAc/Hex). H NMR (600 MHz, CDCl3): δ = 7.03 (s, 2 H), 4.15
(q, J = 7.1 Hz, 4 H), 3.63–3.70 (overlapping s/t, 8 H), 2.54–2.62
(m, 4 H), 1.55–1.64 (10 H), 1.39–1.45 (8 H), 1.27 (t, J = 7.1 Hz, 6
H) ppm. 13C NMR (150 MHz, CDCl3): δ = 171.7, 139.6, 131.5,
130.4, 62.9, 60.8, 38.6, 32.7, 32.2, 31.0, 29.4, 25.6, 14.2 ppm. FTIR:
ν = 3346, 2930, 2856, 1729, 1367, 1256, 1155, 1027 cm–1. HRMS
˜
(ESI): calcd. for C26H42O6Na [M + Na]+ 473.2879; found 473.2888.
Diethyl 2,2Ј-(4,5-Bis{6-[(methylsulfonyl)oxy]hexyl}-1,2-phenylene)-
diacetate: To a flamed-dried 8 mL vial fitted with a screw-cap sep-
tum were sequentially added 10 (55 mg, 0.124 mmol, 1 equiv.),
CH2Cl2 (1.5 mL), Et3N (0.075 mL, 0.5 mmol, 4 equiv.), DMAP
(1.6 mg, 0.013 mmol, 0.1 equiv.), and MsCl (0.031 mL,
0.372 mmol, 3 equiv.) dropwise. The reaction was stirred for 3 h
and then quenched with a saturated aqueous solution of NaHCO3
(10 mL). The layers were separated, and the aqueous layer was ex-
tracted with CH2Cl2 (3ϫ 10 mL). The combined organic layers
were dried with Na2SO4 and concentrated in vacuo. The residue
was purified by flash chromatography (55% EtOAc/Hex) to afford
the bis(methanesulfonate) (64 mg, 0.105 mmol, 85%) as a colorless
19.4, 18.3, –5.3 ppm. FTIR: ν = 2945, 2930, 2858, 2230, 1489, 1436,
˜
11247, 1211, 1179, 1137, 1087, 834, 807, 774 cm–1. HRMS (ESI):
calcd. for C32H48F6O8S2Na [M + Na]+ 817.2131; found 817.2120.
[(1-Ethoxyvinyl)oxy]trimethylsilane (8):[26] To a flame-dried 250 mL
RBF were added iPr2NH (4.8 mL, 34.1 mmol, 1.2 equiv.) and THF
(33 mL). The solution was cooled to 0 °C, and BuLi (nominally
1.6 m solution in hexane, 19.5 mL, 31.2 mmol, 1.1 equiv.) was
added dropwise. The mixture was stirred for 15 min and then co-
1
oil; Rf = 0.86 (75% EtOAc/Hex). H NMR (400 MHz, CDCl3): δ
oled to –78 °C. A mixture of EtOAc (2.8 mL, 28.4 mmol, 1 equiv.) = 7.03 (s, 2 H), 4.25 (t, J = 6.5 Hz, 4 H), 4.15 (q, J = 7.1 Hz, 4 H),
and trimethylsilyl chloride (TMSCl, 4.4 mL, 34.3 mmol, 1.2 equiv.)
in THF (15 mL) was added over 5 min, and the cooling bath was
removed. The reaction was warmed to room temp. and then stirred
for 4 h. The solvent was removed in vacuo, and the resulting residue
was dissolved in hexane (50 mL). The solution was filtered through
a pad of Celite, which was washed with hexane (2ϫ15 mL). Con-
3.66 (s, 4 H), 2.60 (s, 6 H), 2.54–2.62 (m, 4 H), 1.79 (4 H), 1.55–
1.65 (4 H), 1.39–1.45 (8 H), 1.27 (t, J = 7.1 Hz, 6 H) ppm. 13C
NMR (150 MHz, CDCl3): δ = 171.6, 139.3, 131.5, 130.5, 70.1, 60.8,
38.6, 37.4, 32.1, 30.9, 29.1, 25.4, 14.2 ppm. FTIR: ν = 2935, 2860,
˜
1729, 1349, 1332, 1170, 1028, 948, 914, 729 cm–1. HRMS (ESI):
calcd. for C28H46O10S2Na [M + Na]+ 629.2430; found 629.2459.
3268
www.eurjoc.org
© 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 2013, 3263–3270

Design and Synthesis of a Class of Twin-Chain Amphiphiles
Diethyl 2,2Ј-{4,5-Bis[6-(acetylthio)hexyl]-1,2-phenylene}diacetate:
ACV scans were collected every 12 h for a total of 72 h. The sensors
To a flamed-dried 8 mL vial fitted with a screw-cap septum was
were then interrogated/hybridized with 1.0 μm complete comple-
added diethyl 2,2Ј-(4,5-bis{6-[(methylsulfonyl)oxy]hexyl}-1,2-phen- mentary target DNA (see sequence below) until no change in the
ylene)diacetate (61 mg, 0.101 mmol, 1 equiv.) in DMF (1.5 mL) fol-
lowed by KSAc (58 mg, 0.505 mmol, 5 equiv.). The reaction was
stirred for 14 h and then quenched with a saturated aqueous solu-
tion of NaHCO3 (5 mL). The mixture was diluted with Et2O
(20 mL), and the separated organic layer was washed with a satu-
rated aqueous solution of NaHCO3 (2ϫ5 mL), dried with Na2SO4,
and concentrated in vacuo. The residue was purified by flash
chromatography (15% EtOAc/Hex) to afford the bis(thioacetate)
(46 mg, 0.081 mmol, 80 %) as a colorless oil; Rf = 0.22 (10 %
MB current was observed. The sensors were then regenerated by
rinsing continuously with deionized water for 30 s. The sensors
were subsequently transferred to a fresh Phys2 buffer solution for
electrochemical monitoring of the regenerated current [K-ras probe
s e q u e n c e : 5 Ј H S - ( C H 2 ) 1 1 - C C G T T A C G C C A C -
CAGCTCCAAACGG–C7–MB-3Ј; K-ras target sequence: 5Ј-
TTGGAGCTGGTGGCGTA-3Ј].
Supporting Information (see footnote on the first page of this arti-
cle): NMR spectra for major compounds.
1
EtOAc/Hex). H NMR (400 MHz, CDCl3): δ = 7.02 (s, 2 H), 4.15
(q, J = 7.1 Hz, 4 H), 3.66 (s, 4 H), 2.89 (t, J = 7.3 Hz, 4 H), 2.52–
2.60 (m, 4 H), 2.35 (s, 6 H), 1.52–1.64 (8 H), 1.38–1.46 (8 H), 1.27
(t, J = 7.1 Hz, 6 H) ppm. 13C NMR (150 MHz, CDCl3): δ = 196.0,
171.6, 139.5, 131.5, 130.4, 60.8, 38.6, 32.2, 31.0, 30.6, 29.5, 29.2,
Acknowledgments
This research was supported by the National Science Foundation
(NSF) (EPS-1004094) and the University of Nebraska-Lincoln.
Portions of this work were conducted in facilities that were remod-
elled with support from the National Institutes of Health (NIH)
(grant number RR016544).
29.1, 28.7, 14.2 ppm. FTIR: ν = 2927, 2855, 1732, 1688, 1254, 1133,
˜
1029, 950 cm–1. HRMS (ESI): calcd. for C30H46O6S2Na [M +
Na]+ 589.2634; found 589.2651.
2,2Ј-[4,5-Bis(6-thiylhexyl)-1,2-phenylene]diethanol (2): A flame-
dried 8 mL vial fitted with a screw-cap septum was charged with
the bis(thioacetate) (44 mg, 0.078 mmol, 1 equiv.) and THF (1 mL)
followed by the dropwise addition of DIBAl-H (nominally 1.5 m
solution in toluene, 0.65 mL, 0.93 mmol, 12 equiv.). The reaction
was stirred for 3 h and then quenched by the slow dropwise ad-
dition of HCl (2 n solution, 2 mL) at 0 °C. The mixture was diluted
with H2O (10 mL), and the resulting solution was extracted with
Et2O (3ϫ10 mL). The combined organic layers were washed with
brine (10 mL), dried with Na2SO4, and concentrated in vacuo. The
residue was purified by flash chromatography (70% EtOAc/Hex)
to afford 2 (22 mg, 0.055 mmol, 71%) as a colorless oil; Rf = 0.22,
(50% EtOAc/Hex). 1H NMR (600 MHz, CDCl3): δ = 6.98 (s, 2 H),
3.85 (t, J = 6.5 Hz, 4 H), 2.90 (t, J = 6.7 Hz, 4 H), 2.52–2.60 (m,
8 H), 2.12 (s, 2 H), 1.65 (quint, J = 7.2 Hz, 4 H), 1.58 (quint, J =
7.5 Hz, 4 H), 1.38–1.49 (8 H), 1.36 (t, J = 7.5 Hz, 2 H) ppm. 13C
NMR (150 MHz, CDCl3): δ = 138.8, 134.3, 130.8, 63.6, 35.3, 33.9,
[1] Th. Wink, S. J. van Zuilen, A. Bult, W. P. van Bennkom, Ana-
lyst 1997, 122, 43R–50R.
[2] F. M. Menger, J. S. Keiper, Angew. Chem. 2000, 112, 1980; An-
gew. Chem. Int. Ed. 2000, 39, 1906–1920.
[3] A. Ulman, Chem. Rev. 1996, 96, 1533–1554.
[4] J. C. Love, L. A. Estroff, J. K. Kriebel, R. G. Nuzzo, G. M.
Whitesides, Chem. Rev. 2005, 105, 1103–1169.
[5] J. J. Gooding, F. Mearns, W. Yang, J. Liu, Electroanalysis 2003,
15, 81–96.
[6] C. Vericat, M. E. Vela, G. Benitze, P. Carro, R. C. Salvarezza,
Chem. Soc. Rev. 2010, 39, 1805–34.
[7] A. Fragoso, N. Laboria, D. Latta, C. K. O’Sullivan, Anal.
Chem. 2008, 80, 2556–2563.
[8] P. Chinwangso, A. C. Jamison, T. R. Lee, Acc. Chem. Res.
2011, 44, 511–519.
[9] L. Srisombat, S. Zhang, T. R. Lee, Langmuir 2010, 26, 41–46.
[10] T. Weidner, N. Ballav, U. Siemeling, D. Troegel, T. Walter, R.
Tacke, D. G. Castner, M. Zharnikov, J. Phys. Chem. C 2009,
113, 19609–19617.
32.2, 31.2, 29.2, 28.2, 24.6 ppm. FTIR: ν = 3332, 2925, 2853, 1503,
˜
1460, 1040 cm–1. HRMS (ESI): calcd. for C22H38O2S2Na [M +
Na]+ 421.2211; found 421.2212.
[11] An imbalance in a cross section has been used as a means to
introduce spacing between binding sites. For details, see: N.
Phares, R. J. White, K. W. Plaxco, Anal. Chem. 2009, 81, 1095–
1100.
[12] B. C. Mei, E. Oh, K. Susumu, D. Farrell, T. J. Mountziaris, H.
Mattoussi, Langmuir 2009, 25, 10604–10611.
[13] T. J. Fisher, P. H. Dussault, Eur. J. Org. Chem. 2012, 2831–
2836.
[14] The slow saturation of the alkyne is surprising given previous
examples of similar reductions with Pd catalysis. For example,
see: A. Dondoni, A. Marra, M. G. Zampolli, Synlett 2002,
1850–1854.
[15] C. Carfagna, A. Musco, G. Sallese, R. Santi, T. Fiorani, J. Org.
Chem. 1991, 56, 261–263; for others who have also noted vari-
able yields for this coupling, see: J.-F. Brière, G. Dupas, G.
Quéguiner, J. Bourguignon, Tetrahedron 2000, 56, 8679–8688.
[16] A. Mallinger, T. Le Gall, C. Mioskowski, J. Org. Chem. 2009,
74, 1124–1129.
E-DNA Sensor Fabrication: Prior to SAM formation, gold disc
electrodes (2 mm diameter, CHI, Instruments, Austin, TX) were
electrochemically cleaned by cycling between –0.4 and 1.6 V versus
Ag/AgCl in sulfuric acid (0.5 m) until the gold oxide formation re-
gion of the voltammogram displayed three distinct peaks and suc-
cessive scans showed minimal to no change. The E-DNA sensors
were fabricated in two steps: (1) The electrochemically cleaned gold
disc electrodes were immersed in a 2 mm ethanolic solution of
either 1, 2, or 11-hydroxyundecaneundecanol for 10 min. The elec-
trodes were then rinsed with deionized water and dried under N2.
(2) A stem-loop DNA sensing element thiolated at the 5Ј-end and
modified with methylene blue (MB) at the 3Ј-end (see representa-
tion of sensor construct below) was then drop casted on the pre-
formed SAMs for 3 h.[19] Electrochemical measurements were per-
formed at room temperature (22Ϯ1 °C) with a CHI 1040A Electro-
chemical Workstation (CH Instruments, Austin, TX). The modified
electrodes were analyzed using alternating current voltammetry
(ACV) at a frequency of 10 Hz and an amplitude of 25 mV. All
voltammograms were recorded in a physiological buffer solution
(Phys2) that consisted of Tris (20 mm), NaCl (140 mm), KCl (5 mm),
MgCl2 (1 mm), and CaCl2 (1 mm). The solution was adjusted to
pH = 7.4 with hydrochloric acid. For sensor stability monitoring,
[17] C. Ainsworth, F. Chen, Y. N. Kuo, J. Organomet. Chem. 1972,
46, 59–71.
[18] We are currently investigating this reaction.
[19] H. Sajiki, T. Ikawa, K. Hattori, K. Hirota, Chem. Commun.
2003, 654–655.
[20] S. J. P. Cañete, W. Yang, R. Y. Lai, Chem. Commun. 2009,
4835–4837.
Eur. J. Org. Chem. 2013, 3263–3270
© 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.eurjoc.org
3269

T. J. Fisher, S. J. P. Cañete, R. Y. Lai, P. H. Dussault
FULL PAPER
[21] J. Lacour, D. Monchaud, G. Bernardinelli, F. Favarger, Org.
Lett. 2001, 3, 1407–1410.
[25]
L. Cleary, H. Yoo, K. J. Shea, Org. Lett. 2011, 13, 1781–1783.
[26] K. Oisaki, Y. Suto, M. Kanai, M. Shibasaki, J. Am. Chem. Soc.
2003, 125, 5644–5645.
[22] J. D. Kinder, W. J. Youngs, Organometallics 1996, 15, 460–463.
[23] J. A. Marshall, H. R. Chobanian, M. M. Yanik, Org. Lett.
2001, 3, 4107–4110.
Received: December 21, 2012
Published Online: April 9, 2013
[24] D. Stevens, S. G. Nelson, J. Org. Chem. 2005, 70, 4375–4379.
3270
www.eurjoc.org
© 2013 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Eur. J. Org. Chem. 2013, 3263–3270