Design, synthesis and antibacterial activity of minor groove binders: The role of non-cationic tail groups

Article abstract of DOI:10.1016/j.ejmech.2012.08.013

The design and synthesis of a new class of minor groove binder (MGBs) in which, the cationic tail group has been replaced by a neutral, polar variant including cyanoguanidine, nitroalkene, and trifluoroacetamide groups. Antibacterial activity (against Gram positive bacteria) was found for both the nitroalkene and trifluoroacetamide groups. For the case of the nitroalkene tail group, strong binding of a minor groove binder containing this tail group was demonstrated by both DNA footprinting and melting temperature measurements, showing a correlation between DNA binding and antibacterial activity. The compounds have also been evaluated for binding to the hERG ion channel to determine whether non-cationic but polar substituents might have an advantage compared with conventional cationic tail groups in avoiding hERG binding. In this series of compounds, it was found that whilst non-cationic compounds generally had lower affinity to the hERG ion channel, all of the compounds studied bound weakly to the hERG ion channel, probably associated with the hydrophobic head groups.

Full text of DOI:10.1016/j.ejmech.2012.08.013

European Journal of Medicinal Chemistry 56 (2012) 39e47
Contents lists available at SciVerse ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Original article
Design, synthesis and antibacterial activity of minor groove binders: The role
of non-cationic tail groups
,
a
a
a
a
a
Abedawn I. Khalaf a , Claire Bourdin , David Breen , Gavin Donoghue , Fraser J. Scott , Colin J. Suckling ,
*
Donna MacMillan a, Carol Clements b, Keith Foxc, Doreen A.T. Sekibo c
a WestCHEM, Department of Pure and Applied Chemistry, University of Strathclyde, 295 Cathedral Street, Glasgow, G1 1XL, UK
b Department of Pharmaceutical Sciences, University of Strathclyde, 27 Taylor Street, Glasgow G4 0NR, UK
c Centre for Biological Sciences, Life Science Building, University of Southampton, Southampton SO17 1BJ, UK
a r t i c l e i n f o
a b s t r a c t
Article history:
The design and synthesis of a new class of minor groove binder (MGBs) in which, the cationic tail group
Received 4 May 2012
Received in revised form
31 July 2012
Accepted 8 August 2012
Available online 16 August 2012
has been replaced by
a neutral, polar variant including cyanoguanidine, nitroalkene, and
trifluoroacetamide groups. Antibacterial activity (against Gram positive bacteria) was found for both the
nitroalkene and trifluoroacetamide groups. For the case of the nitroalkene tail group, strong binding of
a minor groove binder containing this tail group was demonstrated by both DNA footprinting and
melting temperature measurements, showing a correlation between DNA binding and antibacterial
activity. The compounds have also been evaluated for binding to the hERG ion channel to determine
whether non-cationic but polar substituents might have an advantage compared with conventional
cationic tail groups in avoiding hERG binding. In this series of compounds, it was found that whilst
non-cationic compounds generally had lower affinity to the hERG ion channel, all of the compounds
studied bound weakly to the hERG ion channel, probably associated with the hydrophobic head groups.
Ó 2012 Elsevier Masson SAS. All rights reserved.
Keywords:
Minor groove binders
Antibacterial
DNase I footprinting
hERG
Nitroalkene
1. Introduction
lacking the cationic group at physiological pH, they might avoid
binding to the hERG (the human Ether-à-go-go-Related Gene) ion
Minor groove binders (MGBs) developed from distamycin 1 as
a prototype have been shown to be potent antibacterial agents both
in vitro and in vivo in our laboratories [1,2]. The most active
compounds are characterized by containing a hydrophobic N-
terminal group in which one of the amide links in distamycin has
been replaced by the alkene isostere (2e4). An additional key
property in the profile of these compounds is the weakly basic N-
alkylmorpholine as the tail group. Compared with alkyl tertiary
amine and guanidine tail groups, these compounds are both more
active against bacterial cells and less toxic to mammalian cell lines.
Although the reasons for this behaviour are not known, it is clear
that the physicochemical properties of such minor groove binders
play a major role in their antibacterial activity [3]. Extending the
argument; it would be interesting, therefore, to determine whether
compounds containing neutral tail groups could retain antibacterial
activity. Such compounds might conceivably have different cell
permeation properties and pharmacokinetic properties. Moreover,
channel, thereby removing a significant risk for their development
as drugs. This potassium ion channel has become a major anti-target
for the pharmaceutical industry due to drug interactions with it
being linked with induced long QT syndrome, a potentially fatal
arrhythmia of the heart. Molecules containing basic nitrogen atoms
are known to have a high likelihood of interacting with hERG;
accordingly, we have prepared a group of non-cationic minor groove
binders with neutral tail groups attached to the three backbones
that gave highest antibacterial activity in earlier studies [4].
2. Results and discussion
2.1. Compound selection
In designing minor groove binders, it has generally been
accepted that the cationic tail group forms strong ionic interactions
with DNA [5]. It has also been found in structural studies using NMR
that in solution, the alkylamino tail group is relatively mobile [2].
Consequently, unlike the backbone structure of the minor groove
binder where specific hydrogen bonding has been characterized
and discussed [6] the interactions of tail groups with DNA have not
* Corresponding author. Tel.: þ44 (0) 141 548 2520; fax: þ44 (0) 141 548 5743.
E-mail address: abedawn.khalaf@strath.ac.uk (A.I. Khalaf).
0223-5234/$ e see front matter Ó 2012 Elsevier Masson SAS. All rights reserved.
http://dx.doi.org/10.1016/j.ejmech.2012.08.013

40
A.I. Khalaf et al. / European Journal of Medicinal Chemistry 56 (2012) 39e47
been well defined. This gives considerable freedom to undertake an
exploration of non-cationic tail groups in the context of antibacte-
rial activity. The following were selected based upon a combination
of synthetic accessibility and precedent in medicinal chemistry:
Hydroxyl e small, neutral, and hydrogenbonddonorand acceptor,
Acetoxy e small, neutral, and hydrogen bond acceptor,
BOC-amino e large, hydrophobic, neutral, and hydrogen bond
donor and acceptor,
Trifluoroacetamido e small, dipolar, and hydrogen bond donor
and acceptor,
Nitroalkene e large, dipolar, and hydrogen bond donor and
acceptor,
Cyanoguanidine e large, dipolar, and hydrogen bond donor and
acceptor,
The primary amino group (a synthetic precursor) and the
guanidine group (a comparator for the nitroalkene and cyanogua-
nidine) were also examined.
Unsurprisingly, no antibacterial activity was observed for
compounds bearing simple hydroxyl or acetoxy tail groups (9a,b,
16a,b), nor for the one BOC-amino compound tested (8b). It was
surprising, however, that the primary amino tail group did not lead
to any antibacterial activity (10c), although it would be expected to
be positively charged under the conditions of the assay. It is
important to remember, however, that antibacterial activity may
require not only binding to DNA but also penetration of the
bacterial cell wall. Whilst there is no evidence in this class of
compounds to suggest why, it is possible that the primary amine
does not accumulate in the target cells whereas the corresponding
tertiary amines do, in the case of 2, giving exceptionally strong anti-
Gram positive activity. No activity was found with the cyanogua-
nidine examples (12b,c); this may reflect the particular combina-
tion of components in this minor groove binder rather than any
intrinsic property of the cyanoguanidine. Nevertheless, minor
groove binders with both nitroalkenyl (11a,c) and tri-
fluoroacetamido (14c) tail groups showed significant antibacterial
activity. Consistent with trends in previous studies [2], the anti-
bacterial activity of the compound containing the quinolyl head
group with the nitroalkene tail (11c) was notably greater than the
2.2. Synthesis
The synthesis of the required compounds followed the strategy
of coupling the alkene-containing head group dimers to protected
dipyrrole amides with a suitably protected tail group (BOC amino or
acetoxy). Coupling reactions were carried out using HBTU, the aryl
dimer acid chloride [7], or T3P [8]. Cleavage of the tail group and
subsequent elaboration using appropriate reagents [14,15] afforded
the required compounds in moderate yields after HPLC purification
(Scheme 1).
others. An MIC of 1e2
mM in these tests would be significant
enough to warrant further evaluation were it not for the fact that
the parent compound (2a) is an order of magnitude more potent
still. Nevertheless, it is remarkable in terms of conventional views
of the properties of minor groove binders that such activity is seen
at all and raises questions as to whether these compounds with
neutral tail groups do actually bind to DNA in a similar manner to
related cationic minor groove binders. This question has been
investigated using both footprinting studies and melting temper-
ature studies.
2.3. Antibacterial activity
The antibacterial activity of the compounds obtained was
evaluated in our laboratories using the methods described previ-
ously. No activity was found with any compound against Gram
negative bacteria. The results obtained against Staphylococcus
aureus as a representative Gram positive bacterium are given in
Table 1.
2.4. DNA binding
The direct binding of the 3-quinolyl MGBs (11c) and (13c), which
have nitroalkene and amidine tail groups respectively has been studied
before [11,12]. Using the HexA and HexB polydeoxyribonucleotides as

A.I. Khalaf et al. / European Journal of Medicinal Chemistry 56 (2012) 39e47
41
Scheme 1. General route for the synthesis of MGBs. Reagents: i H2/PdeC; ii N-methylmorpholine; iii HBTU, SOCl2 to perform acid chloride, or T3P; iv trifluoroacetic acid/DCM; v
LiOH; vi as appropriate, phenyl N0-cyano-N-methylimidocarbamate, methylimidothiocarbonate salt, or trifluoroacetic anhydride.
targets, it was found that both (11c) and (13c) bind significantly to DNA
predominantly at AT rich sites, as would be expected from their
structures (Figs.1 and 2). Fig.1 shows DNase I digestion of the HexA and
HexARev fragment in the presence of compounds 11c and 13c. Both of
these ligands produce clear regions of protection (as indicated by the
bars in this Figure). The regions of protection are summarised along-
side the sequence in Fig. 2, inwhich it can be seen that the binding sites
are predominantly in AT-rich regions, common to other minor groove
binders such as distamycin. Both ligands produce footprints at similar
Table 1
sites at concentrations below 10 mM, though in general the protections
Synthetic methods and biological activity of MGBs prepared. Coupling methods:
A ¼ HBTU, B ¼ acid chloride, C ¼ T3P; NI ¼ not isolated, nd ¼ not determined
antibacterial activity of compounds tested against S. aureus. Results are given as MIC
with 13c persist to lower ligand concentrations. These results support
a close connection between antibacterial activity and DNA binding. To
complement the footprinting study, the same two compounds were
evaluated for DNA binding by measuring the change in melting
temperature of the oligonucleotide, 50-GCGATATATGCG-30 and its
complement. A substantial increase of 16 ꢀC was measured for the
nitroalkene 11c and an exceptionally large increase of 29 ꢀC was
observed for the amidine 13c. These results are consistent with the
intensity of the footprinting observed. Taken in isolation, it would be
expected on the basis of ionic interactions that 11c would bind to DNA
more strongly than 13c. However the antibacterial activity of 13c is
somewhat greater than that of 11c, the opposite of what is observed in
DNA binding. Moreover the other guanidines examined in this study
did not show measurable antibacterial activity. It can be hypothesized
that this difference is due to the relative accessibility of the minor
groove binders to DNA in the target bacterial cells. The quinolyl head
group evidently provides favourable properties, and this could be due
to favourable cell penetration, to resistance to efflux pumping, or to
a combination of the two.
(
m
M). NA ¼ not active. nd ¼ not determined. Inhibition of hERG ion channel:
compounds were assessed at 10
m
M and % displacement of [3H]-astemizole is re-
ported. Each assay was run in triplicate and 3 separate experiments were carried out
(n ¼ 3).
No. Ar1
Ar2
Tail
Method S. aureus hERG
3
4
3-OMe phenyl Phenyl
4-OMe phenyl 2-Pyridyl Ethyl morpholine
Ethyl morpholine
A
A
A
A
A
C
A
NI
e
e
e
e
e
e
e
e
e
e
A
B
2.0
6.25
0.12
25
nd
NA
nd
nd
nd
NA
31
NA
2.5
NA
NA
NA
25
7.8
12.5
NA
NA
NA
NA
65
58
65
60
nd
36
nd
nd
nd
55
nd
nd
51
58
54
nd
69
nd
24
nd
nd
nd
32
2a 3-Quinolyl
2b 3-Quinolyl
8a 4-OMe phenyl 2-Pyridyl NHBOC
8b 3-OMe phenyl Phenyl
8c 3-Quinolyl Phenyl
10a 4-OMe phenyl 2-Pyridyl NH2
10b 3-OMe phenyl Phenyl
10c 3-Quinolyl Phenyl
11a 4-OMe phenyl 2-Pyridyl Nitroalkene
11b 3-OMe phenyl Phenyl
11c 3-quinolyl Phenyl
12b 3-OMe phenyl Phenyl
12c 3-Quinolyl Phenyl
13a 4-OMe phenyl 2-Pyridyl Guanidine
13b 3-OMe phenyl Phenyl
13c 3-Quinolyl
14c 3-Quinolyl
9a 4-OMe phenyl 2-Pyridyl Acetoxy
16a 4-OMe phenyl 2-Pyridyl Hydroxy
Phenyl
Phenyl
Ethyl morpholine
DMAP
NHBOC
NHBOC
NH2
NH2
Nitroalkene
Nitroalkene
Cyanoguanidine
Cyanoguanidine
Guanidine
Guanidine
Trifluoroacetamide
3. Conclusion
Phenyl
Phenyl
The results here show that it is possible for a non-cationic minor
groove binder developed from the structure of distamycin both to
bind to DNA and to result in significant antibacterial activity. These
minor groove binders with nitroalkenyl tail groups therefore are
e
9b 3-OMe phenyl Phenyl
16b 3-OMe phenyl Phenyl
Acetoxy
Hydroxy
C
e

42
A.I. Khalaf et al. / European Journal of Medicinal Chemistry 56 (2012) 39e47
compounds can readily be modified to include not only binding to
DNA but also physicochemical properties that would be relevant to
therapeutic applications.
4. Experimental
4.1. DNase I footprinting
DNase I footprinting was performed as previously described [9]
using the HexA and HexRev DNA fragments [11e13]. These frag-
ments which, contain the same sequence that has been inserted
into the polylinker in opposite orientations, contain a selection of
symmetrical hexanucleotide sequences and have previously been
used for examining the interaction of several small ligands with
DNA. The fragments were obtained by cutting the plasmids with
HindIII and SacI and radiolabelling the 30-end of the HindIII using
a-
32P[dATP] using reverse transcriptase.
Footprinting was performed by mixing the radiolabelled DNA
(dissolved in 10 mM TriseHCl, pH 7.5 containing 0.1 mM EDTA at
a concentration of about 10 cps/ l (<10 nM)) with 1.5 L ligand
m
m
(diluted in 10 mM TriseHCl, pH 7.5 containing 10 mM NaCl).
Samples were incubated for at least 30 min at room temperature,
before adding 2
2 mM MnCl2) at a concentration of about 0.01 units/mL. The
digestion was stopped after 1 min by adding 4.5 L of formamide
mL DNase I (diluted in 20 mM NaCl, 2 mM MgCl2,
m
containing 10 mM EDTA and bromophenol blue. Samples were
heated at 100 ꢀC for 3 min before loading onto an 8% denaturing
polyacrylamide gel containing 8 M urea. After electrophoresis gels
were fixed in 10% acetic acid, dried and exposed over night to
a phosphorimaging screen.
4.2. hERG evaluation [10]
Fig. 1. DNase I digestion of the HexA and HexB fragments in the presence of (11c) and
(13c). The DNA was labelled at the 30-end so that the gel runs 30-50- from bottom to top.
The ligand concentration (mM) is shown at the top of each gel lane. Tracks labelled
4.2.1. Preparation of cells
“con” are controls in the absence of added ligand while GA corresponds to a marker
lane specific for purines. The sequence of the HexA fragment is shown in Figure KF2.
The bars indicate the positions that are protected from cleavage by (13c).
hERG transfected HEK293 cells were kindly gifted from Dr. J.
Mitcheson, University of Leicester. Cell cultures were maintained in
GibcoÒ Dulbecco’s Modified Eagle Medium (D-MEM) þ GlutaMAX-
1Ô medium supplemented with 10% foetal bovine serum (BSA), 1%
penicillinestreptomycin and 0.8% GeneticinÒ in a Sanyo humidified
incubator (37 ꢀC, 5% CO2). Once at 80e90% confluency, the cells
were lifted using PBS based, enzyme free, Cell Dissociation Buffer.
the first examples of a new class of minor groove binder. The
structural flexibility within this class has not yet been exploited but
it can be readily appreciated that by changing the N-methyl group
of the nitroalkene tail for other substituents, the properties of such
HexA (top), HexARev (bottom)
-GGATCCCGGGATATCGATATATGGCGCCAAATTTAGCTATAGATCTAGAATTCCGGACCGCGGTTTAAACGTTAACCGGTACCT
-CCTAGGGCCCTATAGCTATATACCGCGGTTTAAATCGATATCTAGATCTTAAGGCCTGGCGCCAAATTTGCAATTGGCCATGGA
AGGCCTGCAGCTGCGCATGCTAGCGCTTAAGTACTAGTGCACGTGGCCATGGATCC-
TCCGGACGTCGACGCGTACGATCGCGAATTCATGATCACGTGCACCGGTACCTAGG-
11c
13c
Fig. 2. Sequence of the HexA (top strand) and HexARev (lower strand), indicating the regions protected by 11c (black) and 13c (red). Hatched boxes show region that are only
protected at the highest ligand concentration (10 mM). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

A.I. Khalaf et al. / European Journal of Medicinal Chemistry 56 (2012) 39e47
43
The cell suspension was counted using a Bright Line Haemocy-
tometer and centrifuged at 1000 rpm for 5 min and the supernatant
discarded. The pellet was resuspended in ice-cold Tris$HCl pH 7.4
(20 mM) with 1% phenylmethylsulfonyl fluoride (PMSF). The cells
were homogenised using a Brinkman Polytron and the homogenate
centrifuged using a Beckman Coulter Optima L-70K Ultracentrifuge
or a L-100 XP Ultracentrifuge at 200,000 g for 40 min at 4 ꢀC,
resuspended in buffer (10 mM HEPES, pH 7.4, 130 mM NaCl, 5 mM
KCl, 0.8 mM MgCl2, 10 mM glucose, 0.1% BSA), aliquots quick-frozen
in liquid N2 and stored at e 80 ꢀC.
J ¼ 5.7 Hz), 3.91 (3H, s, NCH3), 4.10 (2H, t, CH2, J ¼ 5.7 Hz), 7.43 (1H,
d, AreH, J ¼ 2.0 Hz), 8.14 (1H, d, AreH, J ¼ 1.7 Hz), 8.54 (1H, t, NH,
J ¼ 6.5 Hz). 13C NMR [DMSO-d6, 100 MHz]: dC 159.9, 155.7, 133, 127.7,
126.5, 107.4, 77.7, 37.2, 28.2. HRFABMS: Found: 256.0887 calculated
for C10H14N3Oþ5 256.0889. Anal. Calcd. For C10H13N3O5: C, 47.06; H,
5.13; N, 16.46. Found: C, 47.13; H, 5.32; N, 16.16.
4.3.3. tert-Butyl 2-{[(1-methyl-4-nitro-1H-pyrrol-2-yl)carbonyl]
amino}ethylcarbamate (5b)
2,2,2-Trichloro-1-(1-methyl-4-nitro-1H-pyrrol-2-yl)ethanone
(1.000 g, 3.70 mmol) was dissolved in DCM (15 mL), and a solution
4.2.2. hERG cell binding assay
of t-butyl 2-aminoethylcarbamate (584 mL, 3.70 mmol) in DCM
[3H]-Astemizole binding in hERG transfected HEK293 cells were
(5 mL) added. The solution was allowed to stir for 1 h after which
the solvent was removed under reduced pressure to yield the title
compound as an off-white solid (1.13 g, 98%), Mp. 180e182 ꢀC. IR
performed in 300
conditions: Cells (w200,000 cells per assay tube, 100
astemizole (0.5 nM, 100 L), incubation buffer (10 mM HEPES, pH
7.4, 130 mM NaCl, 5 mM KCl, 0.8 mM MgCl2, 10 mM glucose, 0.1%
BSA, 100 L) for total binding or drug compound (10 M, 100 L) for
single point assay. Non-specific binding was determined using non-
radiolabelled astemizole (10 M, 100 L). The tubes were incubated
mL total volume according to the following
m
L), [3H]-
m
nmax: 3347, 3126, 2941, 1686, 1644, 1329 and 1274 cmꢂ1 1H NMR
.
[DMSO-d6, 400 MHz]: dH 1.36 (9H, s, 3ꢁ CH3), 3.05 (2H, q, CH2,
J ¼ 6.1 Hz), 3.2 (2H, q, CH2, J ¼ 6.1 Hz), 3.88 (3H, s, NCH3), 6.89 (1H, t,
NH, J ¼ 5.6 Hz), 7.38 (1H, d, AreH, J ¼ 1.9 Hz), 8.11 (1H, d, AreH,
J ¼ 1.9 Hz), 8.37 (1H, t, NH, J ¼ 5.6 Hz). LRMS: Found 313.1; calcu-
m
m
m
m
m
þ
for 1 h at 30 ꢀC after which time the tube contents were rapidly
filtered using a Brandel Cell Harvester under vacuum, through GF/B
filters and washed with ice-cold incubation buffer (2 mL ꢁ 5, see
above). The radioactivity retained on the filters (pre-soaked in 0.5%
PEI) was measured by counting in scintillation fluid (4 mL, Tri-Carb
1500 Packard; Emulsifier Safe).
lated for C13H21N4O5 313.1. Calcd. for C13H20N4O5: C, 49.99; H,
6.45; N, 17.94; Found: C, 50.16; H, 6.20; N, 17.75.
4.3.4. 2-{[(1-Methyl-4-{[(1-methyl-4-nitro-1H-pyrrol-2-yl)
carbonyl]amino}-1H-pyrrol-2-yl)carbonyl]amino}ethyl acetate (6a)
2-{[(1-Methyl-4-nitro-1H-pyrrol-2-yl)carbonyl]amino}ethyl
acetate (5a) (0.900 g, 3.56 mmol) was dissolved in methanol
(10 mL), Pd/C (10%, 0.450 g) was then added, the solution was then
allowed to stir under hydrogen for 3 h. The solutionwas then filtered
and the solvent removed under reduced pressure. The residue was
dissolved in DMF (1.5 mL) and added to a solution of 1-methyl-4-
nitro-1H-pyrrole-2-carbonyl chloride (0.600 g, 3.56 mmol) and N-
4.3. Synthesis
4.3.1. General experimental methods
1H and 13C NMR spectra were measured on a Bruker DPX e
400 MHz spectrometer with chemical shifts given in ppm
methylmorpholine (431 mL, 4.27 mmol), the solution was allowed to
(d values), relative to proton and carbon traces in solvent. Coupling
stir over night, during which time the product precipitated as
a bright yellow solid which was collected by filtration (0.860 g, 63%),
Mp. 155e160 ꢀC. IR nmax: 3399, 3296, 3129, 2957, 1731, 1657 and
1303 cmꢂ1. 1H NMR (DMSO-d6, 400 MHz): dH 2.01 (3H, s, CH3), 3.42
(2H, q, CH2, J ¼ 5.8 Hz), 3.81 (3H, s, NCH3), 3.96 (3H, s, NCH3), 4.09
(2H, t, CH2, J ¼ 5.8 Hz), 6.87 (1H, d, AreH, J ¼ 1.9 Hz), 7.23 (1H, d, Are
H, J ¼ 1.8 Hz), 7.58 (1H, d, AreH, J ¼ 2.0 Hz), 8.14 (2H, m, AreH and
NH), 10.25 (1H, s, NH). LREIMS: Found 378.1365 calculated for
C16H20N5Oþ6 378.1369. Calcd. for C16H19N5O6: C, 50.93; H, 5.08; N,
18.56; Found: C, 50.47; H, 5.68; N, 18.21.
constants are reported in Hz. IR spectra were recorded on a Perkin
Elmer, 1 FT-IR spectrometer. Elemental analysis was carried out on
a Perkin Elmer 2400, analyser series 2. Mass spectra were obtained
on a Jeol JMS AX505. Anhydrous solvents were obtained from
a Puresolv purification system, from Innovative Technologies, or
purchased as such from Aldrich. Melting points were recorded on
a Reichert hot-stage microscope, and are uncorrected. Chroma-
tography was carried out using 200e400 mesh silica gels, or using
reverse-phase HPLC on a water system using a C18 Luna column
with the gradient given in Table 2.
4.3.5. tert-Butyl 2-{[(1-methyl-4-{[(1-methyl-4-nitro-1H-pyrrol-2-yl)
carbonyl]amino}-1H-pyrrol-2-yl)carbonyl]amino}ethylcarbamate (6b)
2-{[(1-Methyl-4-nitro-1H-pyrrol-2-yl)carbonyl]amino}ethyl
acetate (5a) (0.500 g, 1.60 mmol) was dissolved in methanol
(10 mL), Pd/C (10%) (0.250 g) was then added, the solution was then
allowed to stir under hydrogen for 3 h. The solution was then
filtered and the solvent removed under reduced pressure.
The residue was dissolved in DMF (1.5 mL) and added to a solution
of 1-methyl-4-nitro-1H-pyrrole-2-carbonyl chloride (0.272 g,
4.3.2. 2-{[(1-Methyl-4-nitro-1H-pyrrol-2-yl)carbonyl]amino}ethyl
acetate (5a)
N-(2-Hydroxyethyl)-1-methyl-4-nitro-1H-pyrrole-2-
carboxamide (0.826 g, 5.42 mmol) was dissolved in DCM (10 mL)
and cooled to 0 ꢀC. Acetylchloride (386
mL, 5.42 mmol) in DCM
(2 mL) was then added dropwise followed by triethylamine (550 L,
m
6.50 mmol) and the solution was allowed to return to room
temperature over 2 h. The solvent was then removed under
reduced pressure and the residue purified by flash chromatography
to give the title compound as an off-white solid (1.34 g, 97%), Mp.
127e129 ꢀC. IR nmax: 3410, 3110, 2952,1723, 1661 and 1308 cmꢂ1. 1H
NMR [DMSO-d6, 500 MHz]: dH 2.01 (3H, s, CH3), 3.44 (2H, q, CH2,
1.60 mmol) and N-methylmorpholine (215 mL, 2.10 mmol) in DCM
(10 mL). The solution was allowed to stir over night, during which
time the product precipitated as a pale yellow solid which was
collected by filtration (0.511 g, 72%), Mp. >230 ꢀC. IR nmax: 3392,
3143, 2936, 1683, 1663, 1632, 1318 and 1254 cmꢂ1. 1H NMR [DMSO-
d6, 500 Hz]: dH 1.37 (9H, s, 3(CH3)), 3.05 (2H, q, CH2, J ¼ 6.1 Hz), 3.20
(2H, q, CH2, J ¼ 6.1 Hz), 3.80 (3H, s, NCH3), 3.94 (3H, s, NCH3), 6.85
(2H, m, NH and AreH), 7.20 (1H, d, AreH, J ¼ 1.9 Hz), 7.57 (1H, d,
AreH, J ¼ 1.87 Hz), 8.01 (1H, t, NH, J ¼ 5.51 Hz), 8.17 (1H, d, AreH,
J ¼ 1.9 Hz), 10.23 (1H, s, NH). 13C NMR [DMSO-d6, 100 MHz]: dC
161.2, 156.8, 155.7, 133.8, 128.1, 126.3, 123.1, 121.3, 118.0, 107.5, 104.1,
77.6, 45.5, 37.4, 35.9, 28.2. HRFABMS: Found 435.1945 calculated for
Table 2
Programme for HPLC purification of minor groove binders.
Time/pump
A
B
Flow rate (mL/min)
0
90
30
10
90
90
10
70
90
10
10
6
6
6
6
0
28
33
38
40

44
A.I. Khalaf et al. / European Journal of Medicinal Chemistry 56 (2012) 39e47
C19H26N6Oþ6 435.1947. Calculated for C19H25N6O6: C, 52.53; H, 6.03;
N, 19.34: Found: C, 51.98; H, 5.89; N, 19.57.
(6b) (0.200 g, 0.46 mmol) was taken up in methanol (10 mL) and
cooled to 0 ꢀC Pd/C (10%, 0.100 g) was then added in small portions
and the solution stirred under hydrogen for 3 h. The solution was
then filtered and the solvent removed under reduced pressure. The
residue was dissolved in anhydrous DMF (1 mL), 4-[(E)-2-(3-
quinolinyl)ethenyl]benzoic acid (0.126 g, 0.46 mmol) was then
added along with HBTU (0.350 g, 0.92 mmol) and 4-
4.3.6. tert-Butyl 2-[({4-[({4-[({6-[(E)-2-(4-methoxyphenyl)ethenyl]-3-
pyridinyl}carbonyl)amino]-1-methyl-1H-pyrrol-2-yl}carbonyl)amino]-
1-methyl-1H-pyrrol-2-yl}carbonyl)amino]ethylcarbamate (8a)
tert-Butyl 2-{[(1-methyl-4-{[(1-methyl-4-nitro-1H-pyrrol-2-yl)
carbonyl]amino}-1H-pyrrol-2-yl)carbonyl]amino}ethylcarbamate
(6b) (0.200 g, 0.46 mmol) was dissolved in methanol (10 mL) and
cooled to 0 ꢀC Pd/C (10%, 0.100 g) was then added in small portions
and the solution stirred under hydrogen for 3 h. The solution was
then filtered and the solvent removed under reduced pressure. The
residue was dissolved anhydrous DMF (1 mL), 6-[(E)-2-(4-
methoxyphenyl)ethenyl]nicotinic acid (7a) (0.117 g, 0.46 mmol)
was then added along with HBTU (0.350 g, 0.92 mmol) and 4-
methylmorpholine (40 mL, 0.46 mmol). The resulting solution was
allowed to stir for 16 h before being purified by HPLC and the
product fractions freeze dried to yield the product as a yellow solid
(84 mg, 25%) Mp. >230 ꢀC, purity by HPLC ¼ 98%. IR nmax: 3420,
3066, 2922, 1658, 1578 and 1393 cmꢂ1 1H NMR (DMSO-d6): 1.38
.
(9H, s), 3.06 (2H, m), 3.20 (2H, m), 3.80 (3H, s), 3.87 (3H, s), 6.87 (2H,
m) 7.09 (1H, d, J ¼ 1.7 Hz), 7.19 (1H, d, J ¼ 1.7 Hz), 7.35 (1H, d,
J ¼ 1.7 Hz), 7.49 (1H, d, J ¼ 16.5 Hz), 7.64 (4H, m), 7.81 (4H, m), 8.02
(2H, m), 8.63 (1H, d, J ¼ 1.9 Hz), 9.24 (1H, d, J ¼ 2.1 Hz), 9.94 (1H, s),
10.39 (1H, s). LRMS: Found, 662.13 (M þ 1); calculated for
C37H39N7O5þ, 661.30.
methylmorpholine (40 mL, 0.46 mmol). The resulting solution was
allowed to stir for 16 h before being purified by HPLC and the
product fractions freeze dried to yield the title compound as an
orange solid (45 mg, 15%), Mp. > 230 ꢀC, purity by HPLC ¼ 98%. IR
nmax: 3446, 3132, 2925, 1637, 1594 and 1260 cmꢂ1. 1H NMR (DMSO-
d6, 400 Hz): dH 1.37 (9H, s, t-Bu), 3.05 (2H, m, CH2), 3.19 (2H, m,
CH2), 3.82 (6H, m, NCH3 and OCH3), 3.87 (3H, s, NCH3), 6.88 (3H, m,
AreH, NH), 6.99 (2H, d, AreH, J ¼ 8.8 Hz), 7.08 (1H, d, AreH,
J ¼ 1.8 Hz), 7.20 (1H, d, AreH, J ¼ 1.8 Hz), 7.25 (1H, d, (C]CeH),
J ¼ 16.1 Hz), 7.35 (1H, d, AreH, J ¼ 1.8 Hz), 7.66 (3H, m, AreH),
7.76 (1H, d, (C]CeH), J ¼ 16.1 Hz), 7.98 (1H, t, NH, J ¼ 5.6 Hz),
8.27 (1H, d of d, AreH, J ¼ 2.2 and 8.2 Hz), 9.06 (1H, d, AreH,
J ¼ 2.2 Hz), 9.96 (1H, s, NH), 10.50 (1H, s, NH). HRFABMS: Found:
4.3.9. 2-[({4-[({4-[({6-[(E)-2-(4-Methoxyphenyl)ethenyl]-3-
pyridinyl}carbonyl)amino]-1-methyl-1H-pyrrol-2-yl}carbonyl)
amino]-1-methyl-1H-pyrrol-2-yl}carbonyl)amino]ethyl acetate (9a)
6-[(E)-2-(4-Methoxyphenyl)ethenyl]nicotinic acid (7a) (0.067 g,
0.27 mmol) was dissolved in DCM (2 mL) and thionyl
chloride (5 mL) added and the solution refluxed for 1 h, after
which the solvent was removed under reduced pressure to give 6-
[(E)-2-(4-methoxyphenyl)ethenyl]nicotinoyl chloride as a dark
orange solid. 2-{[(1-Methyl-4-{[(1-methyl-4-nitro-1H-pyrrol-2-yl)
þ
642.2991; calculated for C34H40N7O6 642.2995.
carbonyl]amino}-1H-pyrrol-2-yl)carbonyl]amino}ethyl
acetate
(6a) (0.100 g, 0.27 mmol) was dissolved in methanol (5 mL), Pd/C,
(10%, 0.050 g) was then added, the solution was then allowed to stir
under hydrogen for 3 h, the solution was then filtered and the
solvent removed under vacuum, the residue was dissolved in DMF
(1.5 mL) and added to the previously prepared 6-[(E)-2-(4-
methoxyphenyl)ethenyl]nicotinoyl chloride, and N-methyl-
4.3.7. tert-Butyl 2-({[4-({[4-({4-[(E)-2-(3-methoxyphenyl)ethenyl]
benzoyl}amino)-1-methyl-1H-pyrrol-2-yl]carbonyl}amino)-1-
methyl-1H-pyrrol-2-yl]carbonyl}amino)ethylcarbamate (8b)
tert-Butyl 2-{[(1-methyl-4-{[(1-methyl-4-nitro-1H-pyrrol-2-yl)
carbonyl]amino}-1H-pyrrol-2-yl)carbonyl]amino}ethylcarbamate
5a (0.230 g, 0.529 mmol) was dissolved in methanol (25 mL) with
stirring under nitrogen. The reaction mixture was cooled to 0 ꢀC and
pd/C-10% (70 mg) was added. The reaction mixture was hydroge-
nated for 4 h at room temperature and atmospheric pressure. The
catalyst was removed over Kieselguhr and the solvent was removed
under reduced pressure to give the amine as a brown glassy material
which was used in the next step without further purification. The
amine so formed was dissolved in DMF (5 mL, dry) to which
2,3,4,5,6-pentafluorophenyl 4-[(E)-2-(3-methoxyphenyl)ethenyl]
benzoate (240 mg, 0.751 mmol,1.1 molar equivalent) was added and
the reaction mixture was heated at 55 ꢀC for 3 days. Solvent was
removed in vacuo and the residue was partitioned between (ethyl
acetate/methanol 90/10) and potassium carbonate. The organic
layer was collected after the extraction, dried (Na2SO4) and the
solvent was removed under reduced pressure. The crude product
was triturated with a small amount of ethyl acetate and filtered. The
required product (140 mg, 41%) was obtained as brown powder with
no distinct melting point. IR nmax: 1695,1639,1584, 1537, 1397,1274,
1169, 1040, 958, 849 and 776 cmꢂ1. 1H NMR [DMSO-d6, 400 Hz]: dH
10.34 (1H, s), 9.96 (1H, s), 7.99 (3H, d, J ¼ 8.5 Hz and br s), 7.76 (2H, d,
J ¼ 8.5 Hz), 7.38e7.31 (4H, m), 7.24e7.21 (3H, m), 7.10 (1H, d,1.8 Hz),
6.91e6.87 (3H, m), 3.89 (3H, s), 3.82 (3H, s), 3.81 (3H, s), 3.24 (2H, q,
J ¼ 6.5 Hz), 3.09 (2H, q, J ¼ 6.5 Hz), 1.39 (9H, s). HRESIMS: Found,
641.3081; calculated for C35H41O6N6, 641.3082.
morpholine (36 mL, 0.32 mmol) added and the solution allowed to
stir over night, the solution was then purified by HPLC to give the
title compound as an orange solid (40 mg, 27%), Mp. >230 ꢀC, purity
by HPLC ¼ 97%. IR nmax: 3446, 2925, 1637, 1594 and 1260 cmꢂ1. 1H
NMR [DMSO-d6, 400 Hz]: dH 2.02 (3H, s, CH3), 3.40 (2H, q, CH2,
J ¼ 5.7 Hz), 3.81 (6H, m, NCH3 and OCH3), 3.88 (3H, s, NCH3), 4.09
(2H, t, CH2, J ¼ 5.7 Hz), 6.89 (1H, d, AreH, J ¼ 1.8 Hz), 7.00 (2H, d,
AreH, J ¼ 8.8 Hz), 7.10 (1H, d, AreH, J ¼ 1.8 Hz), 7.23 (1H, d, AreH,
J ¼ 1.8 Hz), 7.26 (1H, d, (C]CeH), J ¼ 16.1 Hz), 7.37 (1H, d, AreH,
J
¼
1.8 Hz), 7.66 (3H, m, AreH), 7.77 (1H, d, (C]CeH),
J ¼ 16.1 Hz), 8.14 (1H, t, NH, J ¼ 5.6 Hz), 8.29 (1H, d of d, AreH,
J ¼ 2.3 and 8.2 Hz), 9.07 (1H, d, AreH, J ¼ 2.2 Hz), 9.98 (1H, s,
NH), 10.51 (1H, s, NH). HRMS: Found, 585.2419; calculated for
þ
C31H33N6O6 585.2417.
4.3.10. 2-({[4-({[4-({4-[(E)-2-(3-Methoxyphenyl)ethenyl]benzoyl}
amino)-1-methyl-1H-pyrrol-2-yl]carbonyl}amino)-1-methyl-1H-
pyrrol-2-yl]carbonyl}amino)ethyl acetate (9b)
2-{[(1-Methyl-4-{[(1-methyl-4-nitro-1H-pyrrol-2-yl)carbonyl]
amino}-1H-pyrrol-2-yl)carbonyl]amino}ethyl acetate (25 mg,
0.07 mmol) was dissolved in methanol (25 mL) with stirring under
nitrogen. The reaction mixture was cooled to 0 ꢀC and Pd/C-10%
(15 mg) was added. The reaction mixture was hydrogenated for
2 h at room temperature and atmospheric pressure. The catalyst
was removed over Kieselguhr and the solvent was removed under
reduced pressure to give the amine which was used in the next step
without further purification. The amine so formed was dissolved in
DMF (3 mL, dry) to which 2,3,4,5,6-pentafluorophenyl 4-[(E)-2-(3-
methoxyphenyl)ethenyl]benzoate (56 mg, 0.13 mmol) was added
and the reaction mixture was heated at 50 ꢀC for 2 days. Solvent
4.3.8. tert-Butyl 2-({[1-methyl-4-({[1-methyl-4-({4-[(E)-2-(3-
quinolinyl)ethenyl]benzoyl}amino)-1H-pyrrol-2-yl]carbonyl}
amino)-1H-pyrrol-2-yl]carbonyl}amino)ethylcarbamate (8c)
tert-Butyl 2-{[(1-methyl-4-{[(1-methyl-4-nitro-1H-pyrrol-2-yl)
carbonyl]amino}-1H-pyrrol-2-yl)carbonyl]amino}ethylcarbamate

A.I. Khalaf et al. / European Journal of Medicinal Chemistry 56 (2012) 39e47
45
was removed in vacuo and the residue was partitioned between
ethyl acetate and sodium hydrogen carbonate. The organic layer
was collected after the extraction, dried and the solvent removed.
The crude product was purified by column chromatography using
ethyl acetate/n-hexane (2/1, RF ¼ 0.1). The required product (22 mg,
54%) was obtained as a pale yellow solid with no distinct melting
point. IR nmax: 1741, 1638, 1583, 1540, 1515, 1469, 1437, 1394, 1242,
1043 and 776 cmꢂ1. 1H NMR [DMSO-d6, 400 Hz]: dH 10.31 (1H, s),
9.94 (1H, s), 8.12 (1H, t, J ¼ 5.5 Hz), 7.97 (2H, d, J ¼ 8.5 Hz), 7.74 (2H,
d, J ¼ 8.5 Hz), 7.36e7.30 (4H, m), 7.22e7.21 (3H, m), 7.10 (1H, d,
J ¼ 1.8 Hz), 6.89e6.87 (2H, m), 4.10 (2H, t, J ¼ 5.8 Hz), 3.87 (3H, s),
3.81 (3H, s), 3.80 (3H, s), 3.42e3.24 (2H, q, J ¼ 5.8 Hz), 2.01 (3H, s).
HRESIMS: Found: 584.2499; calculated for C32H34O6N5, 584.2504.
potassium carbonate (0.016 g, 0.06 mmol) is then added followed
by methyl-(1-methylsulfanyl-2-nitro-vinyl)-amine (0.015 g,
0.06 mmol) the solution was then refluxed over night. The solution
was then allowed to cool to room temperature before removing the
solvent under reduced pressure; the residue was then dissolved in
DMF and purified by HPLC to yield the desired product as a yellow/
orange solid (4 mg, 21%), Mp. >230 ꢀC, purity by HPLC ¼ 98%. IR
nmax: 3438, 3137, 2908, 1628, 1530 and 1353 cmꢂ1. 1H NMR (DMSO-
d6, 400 Hz): dH 2.38 (3H, s, CH3), 3.75 (2H, m, CH2), 2.96 (2H, m,
CH2), 3.84 (6H, m, NCH3 and OCH3), 3.89 (3H, s, NCH3), 6.86 (3H, m,
AreH, NH), 7.01 (2H, d, AreH, J ¼ 8.8 Hz), 7.10 (1H, d, AreH,
J ¼ 1.8 Hz), 7.21 (1H, d, AreH, J ¼ 1.8 Hz), 7.27 (1H, d, (C]CeH),
J ¼ 16.1 Hz), 7.33 (1H, d, AreH, J ¼ 1.8 Hz), 7.66 (3H, m, AreH),
7.75 (1H, d, (C]CeH), J ¼ 16.1 Hz), 7.98 (1H, t, NH, J ¼ 5.6 Hz),
8.25 (1H, d of d, AreH, J ¼ 2.3 and 8.2 Hz), 9.06 (1H, d, AreH,
J ¼ 2.2 Hz), 9.98 (1H, s, NH), 10.50 (1H, s, NH). HRFABMS: Found:
4.3.11. N-(5-{[(2-Aminoethyl)amino]carbonyl}-1-methyl-1H-
pyrrol-3-yl)-4-({4-[(E)-2-(3-methoxyphenyl)ethenyl]benzoyl}
amino)-1-methyl-1H-pyrrole-2-carboxamide (10b)
þ
642.2743; calculated for C34H36N9O6 642.2744.
tert-Butyl
2-({[4-({[4-({4-[(E)-2-(3-methoxyphenyl)ethenyl]
benzoyl}amino)-1-methyl-1H-pyrrol-2-yl]carbonyl}amino)-1-met
hyl-1H-pyrrol-2-yl]carbonyl}amino)ethylcarbamate (8b) (20 mg,
0.03 mmol) was dissolved in dichloromethane (4 mL, dry) to which
was added trifluoroacetic acid (0.5 mL). The reaction mixture was
heated under reflux for 30 min. Excess trifluoroacetic acid and
dichloromethane were removed under reduced pressure to give the
protonated amine as light brown solid in quantitative yield with no
distinct melting point. IR nmax: 1779, 1641, 1587, 1535, 1438, 1404,
1274, 1166, 1050, 962, 810, 781 and 703 cmꢂ1. 1H NMR [DMSO-d6,
400 Hz]: dH 10.32 (1H, s), 9.97 (1H, s), 8.13 (1H, t, J ¼ 5.5 Hz), 7.99
(2H, d, J ¼ 8.5 Hz), 7.76 (2H, d, J ¼ 8.5 Hz), 7.37e7.31 (4H, m), 7.24e
7.22 (2H, m), 7.21 (1H, d, 1.8 Hz), 7.13 (1H, d, J ¼ 1.8 Hz), 6.99 (1H, d,
J ¼ 1.8 Hz), 6.91e6.88 (1H, m), 3.88 (3H, s), 3.84 (3H, s), 3.82 (3H, s),
3.45 (2H, q, J ¼ 6.0 Hz), 2.98 (2H, qt, J ¼ 6.0 Hz). HRESIMS: Found:
541.2556; calculated for C30H33O4N6, 541.2558.
4.3.14. 4-({4-[(E)-2-(3-Methoxyphenyl)ethenyl]benzoyl}amino)-1-
methyl-N-(1-methyl-5-{[(2-{[(E)-1-(methylamino)-2-nitroethenyl]
amino}ethyl)amino]carbonyl}-1H-pyrrol-3-yl)-1H-pyrrole-2-
carboxamide (11b)
N-(5-{[(2-Aminoethyl)amino]carbonyl}-1-methyl-1H-pyrrol-3-
yl)-4-({4-[(E)-2-(3-methoxyphenyl)ethenyl]benzoyl}amino)-1-meth
yl-1H-pyrrole-2-carboxamide (10b) (16 mg, 0.03 mmol) was dis-
solved in ethanol (4 mL) to which potassium carbonate (20 mg,
0.14 mmol) and (E)-N-methyl-1-(methylsulfanyl)-2-nitroethenamine
(22 mg, 0.14 mmol) were added and the reaction mixture was heated
under refluxed for 48 h under nitrogen. The solvent was removed
under reduced pressure to give the crude product which was purified
by HPLC. Fractions containing the required material were collected
and freeze-dried to give the desired product as a pale yellow solid
(4 mg, 21%) with no distinct melting point. IR nmax: 1641, 1575, 1534,
1436, 1266, 1200, 1155, 1052 and 779 cmꢂ1 1H NMR [DMSO-d6,
.
4.3.12. 3-[(E)-2-(4-{[(5-{[(5-{[(2-Ammonioethyl)amino]carbonyl}-1-
methyl-1H-pyrrol-3-yl)amino]carbonyl}-1-methyl-1H-pyrrol-3-yl)
amino]carbonyl}phenyl)ethenyl]quinolinium bis(trifluoroacetate) (10c)
tert-Butyl 2-({[1-methyl-4-({[1-methyl-4-({4-[(E)-2-(3-quinolinyl)
ethenyl]benzoyl}amino)-1H-pyrrol-2-yl]carbonyl}amino)-1H-pyrrol-
2-yl]carbonyl}amino)ethylcarbamate (8c) (20 mg, 0.03 mmol) was
dissolved in DCM(2 mL) towhich was added trifluoroacetic acid (1 mL)
and this was heated to 40 ꢀC for 1 h. After this, the solvents were
removed under reduced pressure. The resultant residue was dissolved
in DMF (1 mL) and subjected to HPLC purification to obtain the desired
400 Hz]: dH 10.35 (1H, s), 9.99 (1H, s), 8.24 (1H, t, J ¼ 5.5 Hz), 7.99 (2H,
d, J ¼ 8.5 Hz), 7.76 (2H, d, J ¼ 8.5 Hz), 7.38e7.31 (4H, m), 7.23e7.22 (3H,
m), 7.10 (1H, d, J ¼ 1.8 Hz), 6.92e6.88 (2H, m), 3.88 (3H, s), 3.45e3.24
(4H, m), 2.87 (3H). HRESIMS: Found: 641.2834; calculated for
C33H37O6N8 641.2831.
4.3.15. 1-Methyl-N-(1-methyl-5-{[(2-{[(E)-1-(methylamino)-2-
nitroethenyl]amino}ethyl)amino]carbonyl}-1H-pyrrol-3-yl)-4-
({4-[(E)-2-(3-quinolinyl)ethenyl]benzoyl}amino)-1H-pyrrole-2-
carboxamide trifluoroacetate (11c)
product (24 mg, 99% yield), with no distinct melting point. IR nmax
:
This material was prepared using an analogous procedure to that
for (11a) from (8c) as an orange solid in (28 mg, 23%), Mp. > 230 ꢀC,
purity by HPLC ¼ 98%. IR nmax: 3414, 3072, 2926, 1660, 1570 and
1384 cmꢂ1. 1H NMR [DMSO-d6, 500 Hz]: dH 2.58 (3H, s, N-Me), 3.28
(2H, m, CH2), 3.33 (2H, m, CH2), 3.91 (1H, s, C]CeH), 3.92 (3H, s, Ne
Me), 3.96 (3H, s, NeMe), 7.08 (1H, d, AreH, J ¼ 1.7 Hz), 7.21 (1H, d,
AreH, J ¼ 1.7 Hz), 7.38 (1H, d, AreH, J ¼ 1.7 Hz), 7.49 (1H, d, C]CeH,
J ¼ 16.5 Hz), 7.64 (4H, m, AreH), 7.81 (3H, m, AreH), 8.02 (2H, m,
AreH), 8.63 (1H, d, AreH, J ¼ 1.9 Hz), 9.24 (1H, d, AreH, J ¼ 2.1 Hz),
9.96 (1H, s, NeH), 10.36 (1H, d, NeH). [DMSO-d6, 500 Hz]: dC 163.7,
162.4, 158.9, 158.8, 158.5, 149.6, 149.5, 146.5, 139.9, 134.3, 133.9,
133.8, 130.6, 130.5, 128.8, 128.4127.9, 127.3, 127.0, 123.4, 122.9, 122.7,
119.3, 118.7, 117.5, 115.5, 105.4, 105.3. LRMS: Found: 662.13 calcu-
lated for C35H36N9O5þ, 662.28.
3424, 2928, 2857, 1677, 1641, 1580, 1465, 1436, 1405, 1203, 1133, 837,
773 and 722 cmꢂ1. 1H NMR [DMSO-d6, 400 Hz]: dH 10.35 (1H, s), 9.96
(1H, s), 9.26 (1H, d, J ¼ 2.0 Hz), 8.55 (1H, d, J ¼ 2.0 Hz), 8.11 (1H, t,
J ¼ 6.0 Hz), 7.98e8.04 (4H, m), 7.81 (2H, d, J ¼ 9.0 Hz), 7.59e7.77 (8H,
m), 7.34(1H, d,J¼ 2.0 Hz), 7.19 (1H, d, J¼ 2.0 Hz), 7.12 (1H, d, J ¼ 2.0 Hz),
6.98 (1H, d, J ¼ 2.0 Hz), 3.87 (3H, s), 3.82 (3H, s), 3.14 (2H, q, J ¼ 6.0 Hz),
2.92e2.97 (2H, m). HRESIMS: Found, 562.2559; calculated for
C32H32O3N7, 562.2561.
4.3.13. 6-[(E)-2-(4-Methoxyphenyl)ethenyl]-N-(1-methyl-5-{[(1-
methyl-5-{[(2-{[(E)-1-(methylamino)-2-nitroethenyl]amino}ethyl)
amino]carbonyl}-1H-pyrrol-3-yl)amino]carbonyl}-1H-pyrrol-3-yl)
nicotinamide (11a)
tert-Butyl 2-[({4-[({4-[({6-[(E)-2-(4-methoxyphenyl)ethenyl]-3-
pyridinyl}carbonyl)
amino]-1-methyl-1H-pyrrol-2-yl}carbonyl)
4.3.16. N-(5-{[(2-{[(E)-(Cyanoimino)(methylamino)methyl]amino}
ethyl)amino]carbonyl}-1-methyl-1H-pyrrol-3-yl)-1-methyl-4-({4-
[(E)-2-(3-quinolinyl)ethenyl]benzoyl}amino)-1H-pyrrole-2-
carboxamide trifluoroacetate (12c)
tert-Butyl 2-({[1-methyl-4-({[1-methyl-4-({4-[(E)-2-(3-quinolinyl)
ethenyl]benzoyl}amino)-1H-pyrrol-2-yl]carbonyl}amino)-1H-pyrrol-
amino]-1-methyl-1H-pyrrol-2-yl}carbonyl)amino]ethylcarbamate
(8a) (0.020 g, 0.03 mmol) was dissolved in DCM (3 mL) and tri-
fluoroacetic acid (3 mL) and the solution refluxed for 30 min. The
solvents where then removed under reduced pressure to yield the
amine salt. This was then dissolved in 80% aqueous ethanol (3 mL),

46
A.I. Khalaf et al. / European Journal of Medicinal Chemistry 56 (2012) 39e47
2-yl]carbonyl}amino)ethylcarbamate (8c) (0.100 g, 0.15 mmol) was
dissolved in DCM (3 mL) and trifluoroacetic acid (3 mL) and the
solution refluxed for 30 min. The solvents where then removed under
reduced pressure to yield the amine salt. This was then dissolved in
80% aqueous ethanol (3 mL), potassium carbonate (0.080 g,
0.30 mmol) is then added followed by (E)-phenyl N0-cyano-N-meth-
ylcarbamimidate (0.052 g, 0.30 mmol) the solution was then refluxed
over night. The solution was then allowed to cool to room temperature
before removing the solvent under reduced pressure; the residue was
then dissolved in DMF and purified by HPLC to yield the desired
product as a yellow solid (27 mg, 27%), Mp. >230 ꢀC, purity by
HPLC ¼ 97%. IR nmax: 3438, 3137, 2908, 1628, 1530 and 1353 cmꢂ1. 1H
NMR [DMSO-d6, 500 Hz]: dH 2.68 (3H, d, J ¼ 4.65 Hz), 3.24 (2H, m),
3.27(2H, m), 3.80 (3H, s), 3.87 (3H, s), 6.89 (1H, d, J ¼ 1.7 Hz), 7.00 (1H,
m), 7.09(1H, d, J¼ 1.7 Hz), 7.21 (1H, d, J ¼ 1.7Hz), 7.35(1H, d, J¼ 1.7 Hz),
7.66 (3H, m), 7.80 (3H, m), 8.01 (5H, m), 8.11 (1H, m), 8.61 (1H, s), 9.28
(1H, s), 9.95 (1H, s), 10.36 (1H, s). HRFABMS: Found: 643.2887;
calculated for C35H35N10O3þ, 643.2888.
(C]CeH), J ¼ 16.1 Hz), 7.35 (1H, d, AreH, J ¼ 1.8 Hz), 7.67 (3H, m,
AreH), 7.76 (1H, d, (C]CeH), J ¼ 16.1 Hz), 8.02 (1H, t, NH,
J ¼ 5.6 Hz), 8.27 (1H, d of d, AreH, J ¼ 2.30 and 8.2 Hz), 9.05 (1H, d,
AreH, J ¼ 2.2 Hz), 9.96 (1H, s, NH), 10.48 (1H, s, NH). HRFABMS:
Found: 585.2769; calculated for C30H35N9O4þ, 585.2769.
4.3.19. N-(5-{[(2-{[Amino(imino)methyl]amino}ethyl)amino]
carbonyl}-1-methyl-1H-pyrrol-3-yl)-4-({4-[(E)-2-(3-
methoxyphenyl)ethenyl]benzoyl}amino)-1-methyl-1H-pyrrole-2-
carboxamide (13b)
N-(5-{[(2-Aminoethyl)amino]carbonyl}-1-methyl-1H-pyrrol-3-
yl)-4-({4-[(E)-2-(3-methoxyphenyl)ethenyl]benzoyl}amino)-1-me
thyl-1H-pyrrole-2-carboxamide (10b) (16 mg, 0.03 mmol) was
dissolved in ethanol (4 mL). Potassium carbonate (17 mg,
0.13 mmol) and methyl imidothiocarbamate hydroiodide (33 mg,
0.12 mmol) were added and the solution was heated under reflux
for 48 h. Solvent was removed under reduced pressure and the
crude product was purified by HPLC; fractions containing the right
material were collected and freeze-dried to give the required
product as a pale yellow solid (4 mg, 23%) with no distinct melting
point. IR nmax: 1691, 1583, 1536, 1510, 1436, 1362, 1270, 1201, 1146,
1069 and 778 cmꢂ1. 1H NMR [DMSO-d6, 500 Hz]: dH 10.35 (1H, s),
9.98 (1H, s), 8.13 (1H, t, J ¼ 5.5 Hz), 7.99 (2H, d, J ¼ 8.5 Hz), 7.76 (2H,
d, J ¼ 8.5 Hz), 7.46 (1H, t, J ¼ 5.5 Hz), 7.39e7.31 (4H, m), 7.23e7.22
(2H, m), 7.20 (1H, d, J ¼ 1.8 Hz), 7.12 (1H, d, J ¼ 1.8 Hz), 6.98 (1H, d,
J ¼ 1.8 Hz), 6.91e6.88 (1H, m), 3.88 (3H, s), 3.83 (3H, s), 3.82 (3H, s),
3.33e3.27 (4H, m). HRESIMS: Found, 583.2770; calculated for
C31H35O4N8, 583.2776.
4.3.17. N-(5-{[(2-{[(E)-(Cyanoimino)(methylamino)methyl]amino}
ethyl)amino]carbonyl}-1-methyl-1H-pyrrol-3-yl)-4-({4-[(E)-2-(3-
methoxyphenyl)ethenyl]benzoyl}amino)-1-methyl-1H-pyrrole-2-
carboxamide (12b)
N-(5-{[(2-Aminoethyl)amino]carbonyl}-1-methyl-1H-pyrrol-3-
yl)-4-({4-[(E)-2-(3-methoxyphenyl)ethenyl]benzoyl}amino)-1-me
thyl-1H-pyrrole-2-carboxamide (10b) (20 mg, 0.03 mmol) in
ethanol (4 mL) to which phenyl N0-cyano-N-methylimidocarbamate
(30 mg, 0.17 mmol) and potassium carbonate (17 mg, 0.13 mmol)
were added. The reaction mixture was heated under reflux for 4
days in a sealed tube. Solvent was removed under reduced pressure
and the crude product was purified by HPLC; fractions containing
the required product were collected and freeze-dried to give the
desired product as a pale yellow solid (0.008 g, 43%) with no distinct
melting point. IR nmax: 2170, 1639, 1464, 1436, 1405, 1268, 1206,
1050, 964 and 777 cmꢂ1. 1H NMR [DMSO-d6, 500 Hz]: dH 10.32 (1H,
s), 9.95 (1H, s), 8.12 (1H, t, J ¼ 5.5 Hz), 7.97 (2H, d, J ¼ 8.5 Hz), 7.74
(2H, d, J ¼ 8.5 Hz), 7.36e7.29 (4H, m), 7.22e7.20 (3H, m), 7.09 (1H, d,
J ¼ 1.8 Hz), 7.00e6.99 (2H, m), 6.89 (1H, d, J ¼ 1.8 Hz), 6.87e6.86 (1H,
m), 3.87 (3H, s), 3.81 (3H, s), 3.80 (3H, s), 3.31 (2H, q, J ¼ 7.0 Hz), 3.25
(2H, q, J ¼ 7.0 Hz), 2.69 (3H, d, J ¼ 4.6 Hz). HRESIMS: Found:
622.2885; calculated for C33H36O4N9 622.2885.
4.3.20. N-(5-{[(2-{[Amino(imino)methyl]amino}ethyl)amino]
carbonyl}-1-methyl-1H-pyrrol-3-yl)-1-methyl-4-({4-[(E)-2-(3-
quinolinyl)ethenyl]benzoyl}amino)-1H-pyrrole-2-carboxamide
trifluoroacetate (13c)
This material was prepared using an analogous procedure to
that for (13a) from (8c) as an orange solid in (11 mg, 16% yield), m.p.
>230 ꢀC, purity by HPLC ¼ 97%. IR nmax: 3371, 2938, 1650, 1580 and
1353 cmꢂ1. 1H NMR [DMSO-d6, 500 Hz]: dH 3.26 (2H, m, CH2), 3.35
(2H, m, CH2), 3.82 (3H, s, NeMe), 3.88 (3H, s, NeMe), 6.98 (1H, d,
AreH, J ¼ 1.7 Hz), 7.16 (1H, d, AreH, J ¼ 1.7 Hz), 7.19 (1H, d, AreH,
J ¼ 1.7 Hz), 7.36 (1H, d, AreH, J ¼ 1.7 Hz), 7.63 (3H, m, AreH), 7.75
(1H, m, AreH), 7.81 (2H, m, AreH), 8.03 (4H, m, AreH), 8.55 (1H, d,
AreH, J ¼ 2.1 Hz), 8.93 (1H, m, NeH), 9.25 (1H, d, AreH, J ¼ 2.1 Hz),
9.96 (1H, s, NeH), 10.36 (1H, d, NeH). LRMS: Found: 604.27
calculated for C33H34N9O3þ, 604.27.
4.3.18. Amino({2-[({4-[({4-[({6-[(E)-2-(4-methoxyphenyl)ethenyl]-
3-pyridinyl}carbonyl)amino]-1-methyl-1H-pyrrol-2-yl}carbonyl)
amino]-1-methyl-1H-pyrrol-2-yl}carbonyl)amino]ethyl}amino)
methaniminium trifluoroacetate (13a)
4.3.21. 3-((E)-2-{4-[({1-Methyl-5-[({1-methyl-5-[({2-
tert-Butyl-2-[({4-[({4-[({6-[(E)-2-(4-methoxyphenyl)ethenyl]-
3-pyridinyl}carbonyl) amino]-1-methyl-1H-pyrrol-2-yl}carbonyl)
amino]-1-methyl-1H-pyrrol-2-yl}carbonyl) amino]ethylcarbamate
(8a) (20 mg, 0.03 mmol) was dissolved in DCM (3 mL) and tri-
fluoroacetic acid (3 mL) and the solution refluxed for 30 min. The
solvents were then removed under reduced pressure to yield the
amine salt. This was then dissolved in 80% aqueous ethanol (3 mL),
potassium bicarbonate (0.015 g, 0.06 mmol) was then added fol-
lowed by amino(methylsulfanyl) methaniminium sulphate
(0.010 g, 0.06 mmol). The solution was then heated under reflux
over night. The solution was then allowed to cool to room
temperature before removing the solvent under reduced pressure,
the residue was then dissolved in DMF and purified by HPLC to yield
the desired product as a yellow/orange solid (2 mg, 11%), Mp.
>230 ꢀC, purity by HPLC ¼ 96%. IR nmax: 3452, 3124, 2941, 1630,
1521 and 1240 cmꢂ1. 1H NMR [DMSO-d6, 500 Hz]: dH 3.10 (2H, m,
CH2), 3.20 (2H, m, CH2), 3.81 (6H, m, NCH3 and OCH3), 3.89 (3H, s,
NCH3), 6.86 (3H, m, AreH, NH), 7.00 (2H, d, AreH, J ¼ 8.8 Hz), 7.10
(1H, d, AreH, J ¼ 1.8 Hz), 7.21 (1H, d, AreH, J ¼ 1.8 Hz), 7.27 (1H, d,
[(trifluoroacetyl)amino]ethyl}amino)carbonyl]-1H-pyrrol-3-yl}
amino)carbonyl]-1H-pyrrol-3-yl}amino)carbonyl]phenyl}ethenyl)
quinolinium trifluoroacetate (14c)
3-[(E)-2-(4-{[(5-{[(5-{[(2-Ammonioethyl)amino]carbonyl}-1-
methyl-1H-pyrrol-3-yl)amino]carbonyl}-1-methyl-1H-pyrrol-3-yl)
amino]carbonyl}phenyl)ethenyl] quinolinium bis(trifluoroacetate)
(8c) (20 mg, 0.025 mmol) was dissolved in DMF (1 mL, dry) and to
this was added triethylamine (5 mg, 0.05 mmol). After 30 min of
stirring, trifluoroacetic acid anhydride (5 mg, 0.025 mmol) was
added dropwise and left to stir for 16 h. The reaction mixture was
subjected to HPLC purification to obtain the desired product
(10 mg, 50% yield), with no distinct melting point. IR nmax: 3421,
2961, 2928, 2851, 1706, 1682, 1650, 1440, 1204 and 723 cmꢂ1 1H
.
NMR [DMSO-d6, 500 Hz]: dH 10.15 (1H, s), 9.75 (1H, s), 9.25 (1H, bs),
9.23 (1H, d, J ¼ 2.0), 8.51 (1H, d, J ¼ 2.0), 7.97e8.03 (5H, m), 7.92 (1H,
m), 7.55e7.81 (5H, m), 7.30 (1H, d, J ¼ 2.0), 7.17 (1H, d, J ¼ 2.0), 7.09
(1H, d, J ¼ 2.0), 6.97 (1H, d, J ¼ 2.0), 3.88 (3H, s), 3.820 (3H, s), 3.359
(4H, m). HRESIMS: Found: 658.2390 calculated for C34H31O4N7F3,
658.2384.

A.I. Khalaf et al. / European Journal of Medicinal Chemistry 56 (2012) 39e47
47
4.3.22. N-(5-{[(5-{[(2-Hydroxyethyl)amino]carbonyl}-1-methyl-
4.4. Thermal denaturation experiments
1H-pyrrol-3-yl)amino]carbonyl}-1-methyl-1H-pyrrol-3-yl)-6-[(E)-
2-(4-methoxyphenyl)ethenyl]nicotinamide (16a)
DNA oligomers and their complements were melted at a rate of
0.5 ꢀC/min in 10 mM PBS buffer solution (pH 7.4) with 50 mM NaCl
on a Cary 300 BIO UVevisible spectrophotometer fitted with
a peltier temperature controller. Programs were set and data was
processed using Cary WinUV software.
2-[({4-[({4-[({6-[(E)-2-(4-Methoxyphenyl)ethenyl]-3-pyridinyl}
carbonyl)amino]-1-methyl-1H-pyrrol-2-yl}carbonyl)amino]-1-me
thyl-1H-pyrrol-2-yl}carbonyl)amino]ethyl acetate (9a) (0.100 g,
0.17 mmol) was dissolved in ethanol (1 mL), a solution of sodium
hydroxide (0.020 g, 0.5 mmol) in water (5 mL) was then added and
the solution allowed to reflux for 2 h. The whole solution was then
freeze dried and the residue purified by HPLC to give the title
compound as an orange solid (0.020 g, 23%), Mp. >230 ꢀC, purity
Each oligomer made to a concentration of 6 ꢁ 10ꢂ6 M was mixed
with sufficient MGB to give the appropriate ratio. Samples were
heated from 10 ꢀC to 80 ꢀC and cooled from 80 ꢀC to 10 ꢀC with the
spectra being recorded at 260 nm during both of these cycles. The
melting temperatures (Tm) of the hybrids were determined from
the derivative maxima [16]. This process was repeated a total of 4
times to ensure repeatability of the experiment which showed an
average error of ꢃ0.5 ꢀC.
by HPLC ¼ 98%. IR nmax: 1342, 2926, 1632, 1593, 1261 cmꢂ1
.
1H
NMR [DMSO-d6, 500 Hz]: dH 3.24 (2H, q, CH2, J ¼ 5.5 Hz), 3.81 (6H,
m, NCH3 and OCH3), 3.87 (3H, s, NCH3), 3.46 (2H, t, CH2,
J ¼ 5.5 Hz), 6.86 (1H, d, AreH, J ¼ 1.9 Hz), 7.00 (2H, d, AreH,
J ¼ 8.8 Hz), 7.07 (1H, d, AreH, J ¼ 1.9 Hz), 7.18 (1H, d, AreH,
J ¼ 1.8 Hz), 7.24 (1H, d, (C]CeH), J ¼ 16.1 Hz), 7.35 (1H, d, Are
H, J ¼ 1.8 Hz), 7.66 (3H, m, AreH), 7.77 (1H, d, (C]CeH),
J ¼ 16.0 Hz), 7.91 (1H, t, NH, J ¼ 5.6 Hz), 8.25 (1H, d of d, AreH,
J ¼ 2.3 and 8.2 Hz), 9.06 (1H, d, AreH, J ¼ 2.2 Hz), 9.93 (1H, s,
NH), 10.46 (1H, s, NH). HRFABMS: Found: 543.2314 calculated for
C31H33N6O6þ, 543.2311.
Acknowledgements
The authors would like to thank Dr J. Parkinson, Craig Irving, Patricia
Keating, Denise Gilmour and Gavin Bain for all the help and support
which they have provided during the course of this research work.
Appendix A. Supplementary material
4.3.23. N-(5-{[(2-Hydroxyethyl)amino]carbonyl}-1-methyl-1H-
pyrrol-3-yl)-4-({4-[(E)-2-(3-methoxyphenyl)ethenyl]benzoyl}
amino)-1-methyl-1H-pyrrole-2-carboxamide (16b)
Supplementary data related to this article can be found online at
http://dx.doi.org/10.1016/j.ejmech.2012.08.013.
2-({[4-({[4-({4-[(E)-2-(3-Methoxyphenyl)ethenyl]benzoyl}ami
no)-1-methyl-1H-pyrrol-2-yl]carbonyl}amino)-1-methyl-1H-pyr-
rol-2-yl]carbonyl}amino)ethyl acetate (9b) (20 mg, 0.03 mmol)
was dissolved in ethanol (1 mL) to which was added sodium
hydroxide solution (2.4 mg, 0.06 mmol, 2 molar equivalent in
water 1 mL) The reaction mixture was heated under reflux for 2 h
then the solvents were removed under reduced pressure. The
crude product was purified by HPLC. Fractions containing the
required material were collected and freeze-dried to give the
required compound as a white solid (0.010 g, 62%) with no distinct
melting point. IR nmax: 3432, 1639, 1585, 1520, 1437, 1403, 1346,
References
[1] A.I. Khalaf, A.J. Drummond, B. Pringle, I. McGroarty, G.G. Skellern, R.D. Waigh,
C.J. Suckling, J. Med. Chem. 47 (2004) 2133e2156.
[2] N. Anthony, D. Breen, J. Clarke, G. Donoghue, A. Drummond, E. Ellis,
C. Gemmell, J.-J. Helesbeux, I. Hunter, A.I. Khalaf, S. Mackay, J. Parkinson,
C.J. Suckling, R.D. Waigh, J. Med. Chem. 50 (2007) 6116e6125.
[3] C.J. Suckling, J. Phys. Org. Chem. 21 (2008) 575e583.
[4] A.M. Aronov, Drug Discov. Today 10 (2) (2005) 149e155.
[5] W. Treesuwan, K. Wittayanarakul, N.G. Anthony, G. Huchet, H. Alniss,
S. Hannongbua, A.I. Khalaf, C.J. Suckling, J.A. Parkinson, R.D. Waigh,
S.P. Mackay, Phys. Chem. Chem. Phys. 11 (2009) 10682e10693.
[6] N.G. Antony, A.I. Khalaf, S.P. Mackay, J.A. Parkinson, C.J. Suckling, R.D. Waigh,
J. Am. Chem. Soc. 126 (2004) 11338e11349.
1274, 1206, 1046 and 777 cmꢂ1 1H NMR [DMSO-d6, 500 Hz]: dH
.
10.31 (1H, s), 9.94 (1H, s), 7.97 (2H, d, J ¼ 8.5 Hz), 7.92 (1H, t,
J ¼ 5.5 Hz), 7.74 (2H, d, J ¼ 8.5 Hz), 7.36e7.30 (4H, m), 7.22e7.20
(3H, m), 7.08 (1H, d, J ¼ 1.8 Hz), 6.89e6.87 (2H, m), 4.66 (1H, br,
OH), 3.87 (3H, s), 3.81 (3H, s), 3.80 (3H, s), 3.48 (2H, t, J ¼ 5.8 Hz),
3.26 (2H, q, J ¼ 5.8 Hz). HRESIMS: Found: 542.2402 calculated for
C30H32O5N5, 542.2398.
[7] D. Breen, A.R. Kennedy, C.J. Suckling, Org. Biomol. Chem. 7 (2009) 179e186.
[8] J. Klose, M. Bienert, C. Mollenkopf, D. Wehle, C. Zhang, L.A. Carpino,
P. Henklein, Chem. Commun. (1999) 1847e1848.
[9] A.J. Hampshire, H. Khairallah, A.I. Khalaf, A.H. Ebrahimabadi, R.D. Waigh,
C.J. Suckling, T. Brown, K.R. Fox, Bioorg. Med. Chem. Lett. 16 (13) (2006) 3469e3474.
[10] (a) C. Jamieson, E.M. Moir, Z. Rankovic, G. Wishart, J. Med. Chem. 49 (17)
(2006) 5029e5046;
(b) M.C. Sanguinetti, M. Tristani-Firouzi, Nature 440 (23) (2006) 463e469.
[11] A.J. Hampshire, D.A. Rusling, V.J. Broughton-Head, K.R. Fox, Methods 42 (2007)
128e140.
[12] A.J. Hampshire, K.R. Fox, Anal. Biochem. 374 (2008) 298e303.
[13] A.J. Hampshire, K.R. Fox, Biochimie 90 (2008) 988e998.
[14] P. Igel, R. Geyer, A. Strasser, S. Dove, R. Seifert, A. Buschauer, J. Med. Chem. 52
(20) (2009) 6297e6313.
4.3.24. Phenyl N0-cyano-N-methylimidocarbamate
Phenyl N0-cyano-N-methylimidocarbamate was prepared
according to the published procedure [14]
[15] X. Chen, J. Wang, S. Sun, J. Fan, S. Wu, J. Liu, S. Ma, L. Zhang, X. Peng, Bioorg.
Med. Chem. Lett. 18 (1) (2008) 109e113.
[16] I. Afonina, M. Zivarts, I. Kutyavin, E. Lukhtanov, H. Gamper, R.B. Meyer, Nucleic
Acids Res. 25 (13) (1997) 2657e2660.
4.3.25. Methyl imidothiocarbamate hydroiodide
Methyl imidothiocarbamate hydroiodide was prepared accord-
ing to the published procedure [15]