A site-selective, irreversible inhibitor of the DNA replication auxiliary factor proliferating cell nuclear antigen (PCNA)

Article abstract of DOI:10.1016/j.bmc.2014.09.058

Proliferating cell nuclear antigen (PCNA) assumes an indispensable role in supporting cellular DNA replication and repair by organizing numerous protein components of these pathways via a common PCNA-interacting sequence motif called a PIP-box. Given the multifunctional nature of PCNA, the selective inhibition of PIP-box-mediated interactions may represent a new strategy for the chemosensitization of cancer cells to existing DNA-directed therapies; however, promiscuous blockage of these interactions may also be universally deleterious. To address these possibilities, we utilized a chemical strategy to irreversibly block PIP-box-mediated interactions. Initially, we identified and validated PCNA methionine 40 (M40) and histidine 44 (H44) as essential residues for PCNA/PIP-box interactions in general and, more specifically, for efficient PCNA loading onto chromatin within cells. Next, we created a novel small molecule incorporating an electrophilic di-chloro platinum moiety that preferentially alkylated M40 and H44 residues. The compound, designated T2Pt, covalently cross-linked wild-type but not M40A/H44A PCNA, irreversibly inhibited PCNA/PIP-box interactions, and mildly alkylated plasmid DNA in vitro. In cells, T2Pt persistently induced cell cycle arrest, activated ATR-Chk1 signaling and modestly induced DNA strand breaks, features typical of cellular replication stress. Despite sustained activation of the replication stress response by the compound and its modestly genotoxic nature, T2Pt demonstrated little activity in clonogenic survival assays as a single agent, yet sensitized cells to cisplatin. The discovery of T2Pt represents an original effort directed at the development of irreversible PCNA inhibitors and sets the stage for the discovery of analogues more selective for PCNA over other cellular nucleophiles.

Full text of DOI:10.1016/j.bmc.2014.09.058

Bioorganic & Medicinal Chemistry 22 (2014) 6333–6343
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
A site-selective, irreversible inhibitor of the DNA replication auxiliary
factor proliferating cell nuclear antigen (PCNA)
Benjamin J. Evison a, Marcelo L. Actis a, Sean Z. Wu a, Youming Shao b, Richard J. Heath b, Lei Yang a,
Naoaki Fujii a,
⇑
a Department of Chemical Biology and Therapeutics, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, Memphis, TN 38105, USA
b Protein Production Facility, St. Jude Children’s Research Hospital, 262 Danny Thomas Place, Memphis, TN 38105, USA
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 27 June 2014
Revised 18 September 2014
Accepted 29 September 2014
Available online 8 October 2014
Proliferating cell nuclear antigen (PCNA) assumes an indispensable role in supporting cellular DNA
replication and repair by organizing numerous protein components of these pathways via a common
PCNA-interacting sequence motif called a PIP-box. Given the multifunctional nature of PCNA, the selec-
tive inhibition of PIP-box-mediated interactions may represent a new strategy for the chemosensitization
of cancer cells to existing DNA-directed therapies; however, promiscuous blockage of these interactions
may also be universally deleterious. To address these possibilities, we utilized a chemical strategy to
irreversibly block PIP-box-mediated interactions. Initially, we identified and validated PCNA methionine
40 (M40) and histidine 44 (H44) as essential residues for PCNA/PIP-box interactions in general and, more
specifically, for efficient PCNA loading onto chromatin within cells. Next, we created a novel small
molecule incorporating an electrophilic di-chloro platinum moiety that preferentially alkylated M40
and H44 residues. The compound, designated T2Pt, covalently cross-linked wild-type but not
M40A/H44A PCNA, irreversibly inhibited PCNA/PIP-box interactions, and mildly alkylated plasmid DNA
in vitro. In cells, T2Pt persistently induced cell cycle arrest, activated ATR-Chk1 signaling and modestly
induced DNA strand breaks, features typical of cellular replication stress. Despite sustained activation
of the replication stress response by the compound and its modestly genotoxic nature, T2Pt demon-
strated little activity in clonogenic survival assays as a single agent, yet sensitized cells to cisplatin.
The discovery of T2Pt represents an original effort directed at the development of irreversible PCNA
inhibitors and sets the stage for the discovery of analogues more selective for PCNA over other cellular
nucleophiles.
Keywords:
PCNA protein–protein interaction
Chemotherapy
Small molecule
Irreversible inhibitor
Platinum complex
Ó 2014 Elsevier Ltd. All rights reserved.
Abbreviations: APC, allophycocyanin; ATR, ataxia telangiectasia mutated and
rad3-related; BCA, bicinchoninic acid; Chk1, checkpoint kinase 1; CSK buffer,
cytoskeleton buffer; DBU, 1,8-diazabicyclo[5.4.0]undec-7-ene; DCM, dichlorometh-
ane; DIPEA, N,N-diisopropylethylamine; DMF, dimethylformamide; DMSO,
dimethyl sulfoxide; DPPA, diphenylphosphoryl azide; EDTA, ethylenediaminetet-
1. Introduction
Proliferating cell nuclear antigen (PCNA) is a homotrimeric pro-
tein that organizes numerous components of the DNA replication
and repair machinery by functioning as a clamp platform1–3 that
encircles and slides along DNA.2–4 In higher eukaryotes, many DNA
replication and repair proteins interact with PCNA using a common
PCNA-binding motif called a PCNA-interacting protein box (PIP-
box).2 PCNA accommodates these interactions via a cavity located
underneath an interdomain connecting loop on the outer face of
the PCNA clamp.2,4 Given the ubiquitous role PCNA adopts in sup-
porting DNA replication and repair pathways2 and neutrophil sur-
vival,5 it was rationalized that an inhibitor targeting the PIP-box
binding cavity of PCNA may impair these cellular processes and ren-
der cancer cells more susceptible to existing DNA damage-based
therapies.6,7 Conversely, it is also a reasonable concern that the
functional inactivation of the PIP-box binding cavity may be
raacetic acid; FP, fluorescence polarization;
cH2AX, phosphorylation of histone
H2AX at Ser139; HATU, 2-(1H-7-azabenzo[d][1,2,3]triazol-1-yl)-1,1,3,3-tetra-
methyl-uronium hexafluorophosphate; HEPES, 2-[4-(2-hydroxyethyl)piperazin-1-
yl]ethanesulfonic acid; HRP, horse radish peroxidase; IDCL, interdomain connecting
loop; LDS, lithium dodecyl sulfate; MOPS, 3-morpholinopropane-1-sulfonic acid;
N3-T2Pt, chloro(dimethylsulfoxide)((S)-N-(3-azidopropyl)-5-(4-(2,3-diaminopro-
pyl)-2,6-diiodophenoxy)-2-hydroxybenzamide)platinum(II) chloride; PCNA, prolif-
erating cell nuclear antigen; PIP-box, PCNA-interacting protein box; PL peptide,
polo-ligase peptide; PMSF, phenylmethylsulfonyl fluoride; SDS–PAGE, sodium
dodecyl sulfate–polyacrylamide gel electrophoresis; T2AA, T2 amino alcohol;
T2Pt, chloro(dimethylsulfoxide)((S)-4-(4-(2,3-diaminopropyl)-2,6-diiodophenoxy)
phenol)platinum(II) chloride; TBS, tris-buffered saline; TCEP, tris(carboxyethyl)
phosphine; TEA, triethylamine; TES, triethylsilane; THF, tetrahydrofuran; TFA,
trifluoroacetic acid.
⇑
Corresponding author. Tel.: +1 (901) 595 5854; fax: +1 (901) 595 5715.
E-mail address: naoaki.fujii@stjude.org (N. Fujii).
http://dx.doi.org/10.1016/j.bmc.2014.09.058
0968-0896/Ó 2014 Elsevier Ltd. All rights reserved.

6334
B.J. Evison et al. / Bioorg. Med. Chem. 22 (2014) 6333–6343
exceedingly deleterious, prohibiting the therapeutic utility of the
approach.
2.2. Synthesis of T2Pt (8)
Few methods are currently available for investigating the func-
tional consequences of rapidly inactivating essential protein–
protein interactions such as PIP-box-mediated binding events.
RNA interference has emerged as a leading technology in proof-
of-concept studies designed to validate the suitability of a protein
target for therapeutic inhibition; however, the technology is not
applicable for analyzing specific protein–protein interactions since
it entirely erases the protein target.8 Although the technique is not
especially rapid, site-directed mutagenesis provides an ideal start-
ing point for defining the functional relevance of specific amino
acid residues within a target protein. Numerous studies have suc-
cessfully identified the sequence requirements of the PIP-box
within PCNA binding partners, and these studies have yielded a
characteristic consensus sequence.9 In contrast, very little is
known of the structural elements located within the PIP-box bind-
ing cavity of PCNA itself that are required for binding. We sought to
identify these elements and initiated our studies with methionine
40 (M40) and histidine 44 (H44), two nucleophilic residues lining
the PIP-box binding cavity of PCNA.
All commercial reagents were used without further purification,
and the solvents were dried using a dry solvent system (Glass Con-
tour Solvent Systems, SG Water, USA). Reactions requiring the
exclusion of air were carried out under an atmosphere of dry nitro-
gen in oven dried glassware. All reactions were monitored by thin-
layer chromatography (TLC) carried out on EMD Chemicals silica
gel 60-F 254 coated glass plates and visualized using UV light
(254 nm). Analysis by LC–MS was performed by using an XBridge
C18 column run at 1 mL/min and using gradient mixtures of (A)
water (0.05% TFA) and (B) methanol. Low-resolution mass spectra
(ESI) were collected on a Waters Micromass ZQ in positive-ion
mode. Flash-chromatography was performed on a Biotage SP4
chromatography system using Biotage Flash + KP SIL pre-packed
columns, and the solvent mixture in brackets was used as eluent.
Nuclear magnetic resonance (NMR) spectra were obtained on a
Bruker Avance II NMR spectrometer at 400 MHz for 1H NMR spec-
tra. Chemical shifts (ppm) are reported relative to TMS or the sol-
vent peak. Signals are designated as follows: s, singlet; d, doublet;
dd, doublet of doublet; t, triplet; q, quadruplet; m, multiplet. Cou-
pling constants (J) are shown in Hertz.
2. Material and methods
2.1. Materials
2.2.1. (S)-tert-Butyl (1-hydroxy-3-(4-(4-hydroxyphenoxy)-3,5-
diiodophenyl)propan-2-yl)carbamate (2)
A solution of lithium borohydride (2 M in THF, 3 mL, 6 mmol)
was added to a two-neck flask flushed with nitrogen and containing
1,4-dioxane (5 mL). Chlorotrimethylsilane (1.53 mL, 12.0 mmol)
was added dropwise to the reaction mixture, and the solution
was stirred under nitrogen for 20 min. The white opaque solution
was cooled to 0 °C, and (S)-3,5-diiodo-2-amino-3-[4-(4-hydroxy-
phenoxy)phenyl]propanoic acid (1) (1.05 g, 2.00 mmol) was added
in one portion. The reaction mixture was stirred overnight allowing
the solution to reach room temperature. Additional lithium borohy-
dride (2 M in THF, 3 mL, 6 mmol) and chlorotrimethylsilane
(1.53 mL, 12.0 mmol) were added to the reaction mixture and stir-
red for an additional 24 h. The reaction mixture was slowly poured
into a flask containing 2 g of ice, using THF to rinse the reaction
flask. The solution was stirred at 0 °C and the pH adjusted to 9–10
using 5 M sodium hydroxide. A solution of bis(tert-butyl)carbonate
All chemicals were purchased from Sigma Chemical Co. (St.
Louis, MO) unless stated otherwise. All chemical compounds
assayed were prepared as 10 mM DMSO solutions, except cis-
platin was prepared as a 5 mM solution in 0.9% aqueous sodium
chloride. T2AA was prepared as previously described.6 Micro Bio-
Spin 6 chromatography columns and 10ꢀ TBS solution were
obtained from Bio-Rad (Hercules, CA), an APC BrdU Flow Kit
was purchased from BD Pharmingen (San Jose, CA), and 20ꢀ
MOPS/SDS–PAGE Running Buffer was obtained from Teknova
(Hollister, CA). Halt Phosphatase Inhibitor Cocktail was from
Thermo Scientific (Waltham, MA). EconoTips were from New
Objective (Woburn, MA), and propidium iodide was purchased
from Roche (Mannheim, Germany). Biotin-alkyne, 4ꢀ LDS Sample
Buffer, 10ꢀ Sample Reducing Agent, Novex 4–12% Bis–Tris Gels,
(564 lL, 2.43 mmol) in THF (6 mL) was added, and the reaction
Alexa Fluor 488 goat
a-rabbit antibody, iBlot Gel Transfer Nitro-
mixture was stirred for 3 h allowing the solution to reach room
temperature. The reaction mixture was acidified with 2 M
hydrochloric acid and extracted with ethyl acetate (3 ꢀ 30 mL).
The combined organic layers were washed with saturated brine,
dried over anhydrous sodium sulfate, filtered, and concentrated.
The crude product was purified by flash column chromatography
(Biotage SP4, 40+M column, eluting with hexanes/ethyl acetate,
20–100% gradient) to give an off-white solid (834 mg, 68% yield).
cellulose Stacks, Opti-MEM medium, Lipofectamine 2000, and a
GeneArt Site-Directed Mutagenesis System were from Life
Technologies (Carlsbad, CA). Rabbit
mouse -PCNA PC10 antibody,
secondary antibody, rabbit -b-actin (13E5) HRP-linked antibody,
and streptavidin-HRP conjugate were obtained from Cell
Signaling Technology (Beverly, MA). Goat -rabbit IRDye 800CW
a
-Chk1 (pSer345) antibody,
a
a-mouse IgG HRP-linked
a
a
a
secondary antibody was from LI-COR Biosciences (Lincoln, NE).
A FlowCellect H2AX DNA Damage Kit, c4 and c8 Zip Tips, and
Amicon Ultra-0.5 Centrifugal Filter Devices were purchased from
Millipore (Billerica, MA). A Micro BCA Protein Assay Kit, Halt
Protease Inhibitor Cocktail, Supersignal Pico West chemilumines-
cent substrate, SuperBlock Blocking Buffer, and Restore Stripping
Buffer were obtained from Thermo Scientific (Waltham, MD).
Vectashield mounting medium was from Vector Laboratories
1H NMR (400 MHz, DMSO-d6)
d 9.05 (s, 1H), 7.71 (s, 2H),
6.70–6.58 (m, 3H), 6.47 (d, J = 8.9 Hz, 2H), 4.73 (t, J = 5.5 Hz, 1H),
3.61–3.47 (m, 1H), 3.37–3.31 (m, 1H), 3.29–3.21 (m, 1H),
2.80 (dd, J = 13.5, 3.9 Hz, 1H), 2.41 (dd, J = 13.3, 10.2 Hz, 1H), 1.29
(s, 9H).
2.2.2. (S)-tert-Butyl (1-(3,5-diiodo-4-(4-((4-methoxybenzyl)oxy)
phenoxy)phenyl)-3-hydroxypropan-2-yl)carbamate (3)
(Burlingame, CA).
A 5-carboxyfluorescein-labeled PL peptide
(SAVLQKKITDYFHPKK)9 was synthesized by the Hartwell Center
for Bioinformatics & Biotechnology, St. Jude Children’s Research
Hospital. Oligonucleotides were purchased from Integrated
DNA Technologies (Coralville, IA). The pEGFP-PCNA plasmid
was originally obtained from David Gerlich10 via Addgene
(Cambridge, MA), and a T7-PCNA plasmid encoding full-length
human PCNA was provided by Toshiki Tsurimoto (Kyusyu
University, Japan).11
1-(Bromomethyl)-4-methoxybenzene (144 lL, 0.988 mmol)
and potassium carbonate (372 mg, 2.69 mmol) were added to a
solution of compound 2 (549 mg, 0.898 mmol) in DMF (3 mL)
and stirred overnight at room temperature. Additional 1-(bromo-
methyl)-4-methoxybenzene (55 lL, 0.45 mmol) and potassium
carbonate (185 mg, 1.35 mmol) were added to the reaction mix-
ture, which was stirred at room temperature for an additional
3.5 h. Saturated aqueous ammonium chloride (10 mL) was added

B.J. Evison et al. / Bioorg. Med. Chem. 22 (2014) 6333–6343
6335
to the reaction mixture, and extracted with ethyl acetate
(3 ꢀ 10 mL). The ethyl acetate layers were combined, washed with
saturated brine, dried over anhydrous sodium sulfate, and concen-
trated. The crude product was purified by flash column chromatog-
raphy (Biotage SP4, 40+M column, eluting with hexanes/ethyl
acetate, 0–50% gradient) to give a white solid (291.5 mg, 44.4%
yield). 1H NMR (400 MHz, chloroform-d) d 7.72 (s, 2H), 7.34 (d,
J = 8.5 Hz, 2H), 7.26 (s, 1H), 6.90 (t, J = 8.5 Hz, 4H), 6.70 (d,
J = 9.1 Hz, 2H), 4.93 (s, 2H), 4.81 (d, J = 6.5 Hz, 1H), 3.81 (s, 3H),
3.71 (d, J = 11.0 Hz, 1H), 3.66–3.57 (m, 1H), 2.80 (d, J = 7.1 Hz,
2H), 2.12 (s, 1H), 1.58 (s, 1H), 1.44 (s, 9H).
was stirred for 20 min and then basified with 6 M sodium hydrox-
ide (32 L, 193 mol). The homogeneous solution was stirred over-
night at room temperature. Saturated aqueous ammonium
chloride (400 L) and ethyl acetate (400 L) were added to the
reaction mixture. A precipitate formed and collected at the inter-
face of the two liquid phases after a short time in a centrifuge.
The aqueous layer was removed, and the precipitate was washed
l
l
l
l
with saturated aqueous ammonium chloride (400
lL), water
(2 ꢀ 400
l
L), and saturated brine (400 L). The suspended precip-
l
itate in the organic layer was concentrated to give a pale brown
solid (17 mg, 57% yield).
2.2.7. Chloro(dimethylsulfoxide)((S)-4-(4-(2,3-diaminopropyl)-
2,6-diiodophenoxy)phenol)platinum(II) chloride (T2Pt, 8)
Compound 7 was dissolved with DMSO to generate a 10 mM
stock solution of 8. Purity and DMSO complexation were verified
by LC–MS (Fig. S1). 1H NMR (400 MHz, DMSO-d6) d 9.09 (s, 1H),
7.83–7.73 (m, 2H), 6.67 (d, J = 8.1 Hz, 2H), 6.53 (d, J = 8.1 Hz, 2H),
5.58–5.38 (m, 2H), 5.31–5.09 (m, 2H), 2.94–2.69 (m, 3H), 2.31 (d,
J = 9.3 Hz, 1H), 2.18 (d, J = 6.4 Hz, 1H).
2.2.3. (S)-tert-Butyl (1-azido-3-(3,5-diiodo-4-(4-((4-methoxy-
benzyl)oxy)phenoxy)phenyl)propan-2-yl)carbamate (4)
DBU (270 lL, 1.79 mmol) and DPPA (386 lL, 1.79 mmol) were
added to a solution of compound 3 (873 mg, 1.19 mmol) in DMF
(12 mL). The solution was stirred under nitrogen and heated to
100 °C for 18 h. The reaction mixture was cooled, added to water
(50 mL), and extracted with ethyl acetate (3 ꢀ 50 mL). The com-
bined organic layers were washed with saturated brine, dried over
sodium sulfate, filtered, and concentrated. The crude product was
purified by flash column chromatography (Biotage SP4, 40+M col-
umn, eluting with hexanes/ethyl acetate, 0–80% gradient) to give a
white solid (409 mg, 45% yield). 1H NMR (400 MHz, chloroform-d)
d 7.70 (s, 2H), 7.34 (d, J = 8.5 Hz, 2H), 7.26 (s, 1H), 6.93–6.86 (m,
4H), 6.70 (d, J = 9.0 Hz, 2H), 4.93 (s, 2H), 4.69 (d, J = 8.3 Hz, 1H),
3.92 (s, 1H), 3.82 (s, 3H), 3.45 (qd, J = 12.4, 4.2 Hz, 2H), 2.85–2.64
(m, 2H), 1.44 (s, 9H).
2.3. Synthesis of azide-tagged T2Pt (N3-T2Pt)
See Supporting Information (Scheme S1 and Figs. S2 and S3).
2.4. Site-directed mutagenesis
PCNA mutant plasmids were generated from T7-PCNA or pEG-
FP-PCNA expression vectors using a GeneArt Site-Directed Muta-
genesis System according to the manufacturer’s instructions. A
M40A mutant template was generated using the oligonucleotides
50 GTGTAAACCTGCAGAGCGCAGACTCGTCCCACGTCTC and 50
GAGACGTGGGACGAGTCTGCGCTCTGCAGGTTTACAC, while a H44A
mutant template was produced using the oligonucleotides 50 GAG-
CATGGACTCGTCCGCAGTCTCTTTGGTGCAG and 50 CTGCACCAAA-
2.2.4. (S)-tert-Butyl (1-amino-3-(3,5-diiodo-4-(4-((4-methoxy-
benzyl)oxy)phenoxy)phenyl)propan-2-yl)carbamate (5)
Triphenylphosphine (40.4 mg, 0.154 mmol) was added to a
solution of compound 4 (107 mg, 0.141 mmol) in THF (1.6 mL)
and water (161 lL). After stirring at room temperature for 18 h,
the reaction mixture was concentrated and purified by flash col-
umn chromatography (Biotage SP4, 25+S column, eluting with
DCM/methanol/28% ammonia aq, 100:0:0 to 85:14.8:0.2 gradient)
to give a pale brown solid (89.7 mg, 87.0% yield). 1H NMR
(400 MHz, chloroform-d) d 7.70 (s, 1H), 7.35 (d, J = 8.6 Hz, 1H),
6.90 (t, J = 8.9 Hz, 2H), 6.70 (d, J = 9.0 Hz, 1H), 4.93 (s, 1H), 4.06–
3.55 (m, 2H), 2.72 (br s, 1H), 1.59–1.10 (m, 7H).
GAGACTGCGGACGAGTCCATGCTC.
A M40A/H44A double PCNA
mutant was also generated from the M40A template using oligonu-
cleotides 50 GTGTAAACCTGCAGAGCGCAGACTCGTCCGCAGTCTC
and 50 GAGACTGCGGACGAGTCTGCGCTCTGCAGGTTTACAC. The
sequences of mutated plasmids were subsequently validated by
Sanger DNA sequencing performed by the Hartwell Center. Recom-
binant PCNA proteins were prepared as described previously.6
2.2.5. (S)-4-(4-(2,3-Diaminopropyl)-2,6-diiodophenoxy)phenol
(6)
2.5. Fluorescence polarization
Triethylsilane (65
compound 6 (75.5 mg, 0.103 mmol) in DCM (585
(650 L) was added to the reaction mixture and stirred for 1 h at
l
L, 0.41 mmol) was added to a solution of
l
L) at 0 °C. TFA
A fluorescence polarization (FP) assay was performed as previ-
ously described.6 Briefly, a 5-carboxyfluorescein-labeled PL peptide
(10 nM) was mixed with 0–333 nM solutions of either wild-type or
mutant PCNAs in FP buffer (35 mM HEPES, pH 7.4, 10% glycerol,
and 0.01% Triton X-100) at room temperature. FP was measured
immediately on an EnVision plate reader (PerkinElmer Life Sci-
ences, Waltham, MA) using 485 nm excitation (20 nm bandpass)
and 535 nm emission (20 nm bandpass) filters and a 510 nm
dichroic mirror. For competitive displacement assays, 5-carboxy-
fluorescein-labeled PL peptide (10 nM) was mixed with 100 nM
recombinant human PCNA in FP buffer, and the complex was
l
0 °C and 1.5 h at room temperature. The solution was concentrated
and then treated with 2 M sodium hydroxide (3 mL) and ethyl ace-
tate (3 ꢀ 3 mL). The ethyl acetate layers were combined, washed
with saturated brine, dried over anhydrous sodium sulfate, filtered,
and concentrated. The crude product was dissolved in aqueous 1 M
hydrochloric acid (3 mL) and washed with ethyl acetate (3 mL).
The aqueous layer was basified with aqueous 2 M sodium hydrox-
ide and then extracted with ethyl acetate (3 mL). The ethyl acetate
layer was concentrated to give a pale yellow solid (38.3 mg, 72.6%
yield). 1H NMR (400 MHz, DMSO-d6) d 7.81 (s, 2H), 6.69 (d,
J = 8.9 Hz, 2H), 6.55 (d, J = 8.9 Hz, 2H), 3.00 (br s, 1H), 2.84–2.66
(m, 2H), 2.61–2.50 (m, 2H), 1.91 (s, 1H).
exposed to 0–100 lM solutions of either T2AA or T2Pt at room
temperature. At defined time points, the FP of each sample was
measured as described above.
2.2.6. Dichloro((S)-4-(4-(2,3-diaminopropyl)-2,6-diiodophenoxy)
2.6. Crosslinking of PCNA by T2Pt
phenol)platinum(II) (7)
Potassium tetrachloroplatinate(II) (17 mg, 41
to a solution of compound 6 (20 mg, 39 mol) and 1 M hydrochlo-
ric acid (81 L, 81 mol) in water (382 L). The reaction mixture
l
mol) was added
Recombinant wild-type and mutant PCNAs (1
pretreated with N3-T2Pt (Fig. S2) as indicated in 35 mM HEPES,
pH 7.4 (40 L), for 2 h at room temperature. Biotin-alkyne
lg) were
l
l
l
l
l

6336
B.J. Evison et al. / Bioorg. Med. Chem. 22 (2014) 6333–6343
(25
l
M), TCEP (1 mM), and copper (II) sulfate (1 mM) were subse-
expression by SDS–PAGE followed by immunoblotting as
described above using 1:1000 -PCNA mouse antibody.
quently added to each sample and incubated for 1 h at room tem-
perature. All samples were denatured in 1ꢀ LDS Sample Buffer and
1ꢀ Sample Reducing Agent at 85 °C for 10 min prior to loading
onto a Novex 4–12% Bis–Tris Gel. Samples were subjected to
SDS–PAGE at 200 V for 50 min in MOPS buffer and electrotrans-
ferred to a nitrocellulose membrane. The membrane was blocked
using SuperBlock Blocking Buffer overnight at 4 °C and then
washed with TBS-Tween 20 (0.05%) for 10–15 min three times.
The membrane was subsequently exposed to 1:2000 streptavi-
din-HRP conjugate for 1 h at room temperature, and the washes
were repeated as above. The membrane was treated with SuperSig-
nal West Pico substrate, and a chemiluminescent image of the
membrane was taken using an ImageQuant LAS4000 imaging sys-
tem (GE Healthcare Bio-sciences, Uppsala, Sweden). Membranes
were subsequently stripped with Restore Stripping Buffer for
15 min at room temperature, washed as above, re-blocked with
SuperBlock Blocking Buffer for 40–60 min at room temperature,
a
2.9. Protein mass spectrometric analysis
Recombinant human PCNA (13.3
lM) was reacted with
0–50 M T2Pt in 35 mM HEPES, pH 7.4, for 2 h at ambient temper-
l
ature. Following the reaction, samples were filtered into 10 mM
ammonium acetate by gel filtration (Micro Bio-Spin 6 chromatog-
raphy column) to remove free T2Pt. Samples were subsequently
desalted using a reverse phase c4 or c8 Zip Tip and eluted into
50% acetonitrile, 2% formic acid. The eluent was ionized by static
nanospray using EconoTips on a Micromass LCT mass spectrometer
[Waters (Milford, MA)] operating in positive mode. The resultant
charge envelope was deconvoluted using MaxEnt 1 algorithm of
MassLynx V 4.0 sp 4 software. A mass error of 1 Da for every
10,000 Da was permissible using this mass spectrometer.
washed again, and probed overnight at 4 °C with 1:2000
a-PCNA
2.10. Electrophoretic band shift assay
mouse antibody. A chemiluminescent image of the membrane
was taken as described above after treatment with 1:2000
Supercoiled pEGFP-PCNA plasmid (500 ng) was reacted with
a
-mouse HRP-linked secondary antibody.
cisplatin or T2Pt (0–50
night. Samples were subjected to electrophoresis through 0.8%
agarose gels containing 0.5 g/mL ethidium bromide for 5 h at
lM) in 35 mM HEPES, pH 7.4, at 37 °C over-
2.7. Cell culture
l
50 V in 1ꢀ TAE buffer and then visualized and photographed under
All cells were obtained from American Type Culture Collection
(ATCC, Manassas, VA) and maintained at sub-confluent levels in
Dulbecco’s modified Eagle’s medium (Mediatech, Inc., Manassas,
VA) supplemented with 10% fetal bovine serum (Thermo Scientific,
Waltham, MD) at 37 °C in a humidified 5% CO2 atmosphere. Unless
otherwise stated, cells were typically seeded into 6-well cluster
plates at 100,000 cells per well and allowed to attach overnight
prior to treatment the following day. Each specific treatment sche-
dule is defined in the relevant figure legend.
UV illumination.
2.11. Alkaline comet assay
U2OS cells were initially seeded and allowed to attach over-
night prior to treatment with either cisplatin or T2Pt (0–50 lM)
for 5–7 h. Compound-containing media was then removed, the
samples washed once with PBS and then released into com-
pound-free media for a further 17 h. Cells were subsequently har-
vested and then subjected to the alkaline comet assay as described
previously.12 Briefly, cells were suspended in molten Type VII low
gelling temperature agarose following harvest and allowed to set
on glass slides. Cells were lysed in gels with ice-cold lysis buffer
[100 mM EDTA, 2.5 M NaCl, 10 mM Tris–HCl (pH 10.5), 1% Triton
X-100] for 1 h and then subsequently washed with ice-cold Milli-
Q water for 15 min ꢀ 4. Samples were submerged in chilled 1ꢀ
alkali buffer (300 mM sodium hydroxide, 1 mM EDTA) for 1 h at
4 °C and then subjected to electrophoresis at 30 V for 30 min at
4 °C. Neutralization buffer [500 mM Tris–HCl (pH 7.5)] was added
to each slide and then removed with 2 ꢀ 10 min PBS (pH 7.4)
2.8. Plasmid transfection, chromatin staining, confocal
microscopy, and immunoblotting
On the day after seeding onto coverslips, U2OS cells were
transfected with 4 lg of either wild-type pEGFP-PCNA or M40A
pEGFP-PCNA plasmid using Opti-MEM media and Lipofectamine
2000 according to the manufacturer’s instructions. Approxi-
mately 20 h after transfection, cells were processed in prepara-
tion for analysis by either confocal microscopy or
immunoblotting. In preparation for confocal microscopy, cells
were pre-extracted with ice-cold CSK buffer (100 mM NaCl,
3 mM MgCl2, 10 mM HEPES, pH 7.4, 300 mM sucrose, 0.5% Triton
X-100, and 1ꢀ Halt Protease Inhibitor Cocktail) for 2 min on ice
and then fixed with 4% paraformaldehyde for 12 min at room
temperature. Samples were blocked in 3% FBS in PBS, pH 7.4,
for 20 min at room temperature, washed three times with PBS,
pH 7.4, and then mounted onto glass slides in VectaShield con-
washes. Each sample was stained twice with 2.5 lg/mL propidium
iodide for 5 min each, rinsed with Milli-Q water and visualized
using epi-fluorescence microscopy. DNA damage was visually mea-
sured using the scoring system described previously.12 Approxi-
mately 100 cells were scored per sample.
2.12. Cell cycle analysis by flow cytometry
taining 1 lg/mL DAPI. The stained cells were examined on a
TE2000 microscope equipped with a C2 confocal and a 20ꢀ/0.8
NA Plan Apo objective (Nikon, Tokyo, Japan). Images were taken
and processed using Nikon NIS-Elements and Photoshop 7 soft-
ware (Adobe Systems, San Jose, CA). For immunoblotting, trans-
fected cells were harvested, washed with 1 mM PMSF in PBS, pH
7.4, and lysed in 50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1% Tri-
ton X-100, and 1ꢀ Halt Protease Inhibitor Cocktail for 10 min on
ice. Lysates were sonicated to release chromatin-bound protein
and then assayed for protein concentration using a Micro BCA
Protein Assay Kit according to the manufacturer’s instructions.
HeLa cells were seeded into 60 mm dishes (100,000 per dish)
and allowed to attach overnight. The following day, samples were
exposed to 100 lM T2Pt, 40 lM T2AA, or DMSO continuously for
24 h. The cells were washed twice with PBS and then released into
compound-free medium. At defined time points after release, sam-
ples were processed using an APC BrdU Flow Kit according to the
manufacturer’s instructions and then analyzed using an LSR Fort-
essa flow cytometer (BD Biosciences, San Jose, CA) equipped with
a 488-nm laser line which was used for sample excitation. Fluores-
cence emission was collected using the FL5 channel. Ten thousand
events were collected for each sample and gated using
Approximately 13 lg of each lysate was analyzed for PCNA

B.J. Evison et al. / Bioorg. Med. Chem. 22 (2014) 6333–6343
6337
forward- versus side-scatter to eliminate cell debris and doublets.
The data were analyzed using FlowJo version 7.6.5 software (Tree
Star, San Carlos, CA).
representative PIP-box–containing PL peptide9 were evaluated by
an FP assay. Wild-type PCNA was bound strongly by the PIP-box-
containing PL peptide, consistent with a reasonably low dissocia-
tion constant (Kd ꢁ100 nM) reported for the interaction.9 In con-
trast and quite strikingly, mutant M40A PCNA completely failed
to interact with the PL peptide while binding of the peptide by a
H44A mutant was also significantly attenuated relative to wild-
type PCNA (Fig. 1). An M40A/H44A PCNA double mutant also com-
pletely failed to bind the PL peptide (Fig. 1), further highlighting
the importance of these residues in facilitating PIP-box-mediated
interactions. It should be noted that a more rigorous analysis of
absolute binding affinities was not feasible given the excessively
high concentrations of each mutant required to attain saturating
binding conditions. Correspondingly, it is emphasized that the data
presented in Figure 1 reflect only the relative affinities of each
mutant for the PIP-box-containing PL peptide.
2.13. Immunocytochemical detection of pSer345 Chk1 and
cH2AX by flow cytometry
Following detachment, cells were fixed with 4% paraformalde-
hyde in PBS for 10–15 min at room temperature, and the samples
were washed with 1ꢀ TBS. Cells were then permeabilized with
TFX (1ꢀ TBS, 4% fetal bovine serum, and 0.1% Triton X-100) for
10 min on ice and then exposed to 1:200 a-Chk1 (pSer345) rabbit
antibody in TFX for 2 h at room temperature. After the primary
antibody was removed using two washes with TFX, samples were
probed with 1:500 goat a-rabbit Alexa 488 secondary antibody in
TFX for 30 min at room temperature away from light. Unbound
secondary antibody was removed with a TFX wash, and the sam-
ples were incubated with 2.5
in TFX for 30 min at room temperature. For
l
g/mL propidium iodide and RNase
H2AX staining, sam-
3.2. PCNA M40 is essential for efficient chromatin loading of
PCNA
c
ples were harvested and processed using the FlowCellect H2AX
DNA Damage Kit according to the manufacturer’s instructions. All
samples were analyzed by flow cytometry using an LSR Fortessa
flow cytometer as described for cell cycle analysis with one excep-
tion: green and red fluorescence was collected using FL1 and FL3
channels, respectively.
Given the importance of M40 in mediating the PCNA-PL peptide
interaction in vitro, it was subsequently rationalized that the resi-
due may assume a functionally significant role within cells. To ver-
ify a functional role for PCNA M40, GFP-fusions of either wild-type
or M40A PCNA were exogenously expressed in U2OS cells. Follow-
ing removal of non-chromatin-bound protein by pre-extraction,
cell samples were analyzed for chromatin-bound GFP-PCNA by
confocal microscopy (Fig. 2A). Cells expressing GFP-fused wild-
type PCNA (Fig. 2A) showed a pattern of chromatin-bound PCNA
foci consistent with those described in previous reports,13 suggest-
ing that the wild-type fusion protein was successfully loaded onto
DNA. It is noteworthy that only a minor fraction of cells were posi-
tive for wild-type PCNA tagged with GFP (Fig. 2A), a feature that
may be attributed to two complementary factors. First, not all cells
take up the vector upon transfection. Second, and more impor-
tantly, the fraction of cells in S phase in an asynchronous popula-
tion at any given point is typically low. GFP-PCNA loaded onto
chromatin in S phase is resistant to the pre-extraction method
applied to the cells, while unloaded GFP-PCNA is typically removed
through washing, leaving the small population of GFP-positive
cells evident in Figure 2A. Unlike wild-type GFP-PCNA, chroma-
tin-bound M40A PCNA was barely detectable (Fig. 2A), indicating
that the mutant was not efficiently loaded onto chromatin, despite
expression levels that were similar to those of GFP-tagged wild-
type PCNA (Fig. 2B). This observation suggests that the M40A sub-
stitution abolishes fundamental functions of the protein and led us
2.14. Immunoblotting for pSer345 Chk1
Immunoblotting for pSer345 Chk1 was performed as described
for the analysis of EGFP-PCNA expression with some modifications.
Lysis buffer was supplemented with 1ꢀ Halt Phosphatase Inhibitor
Cocktail and the nitrocellulose membrane was initially exposed to
1:500
a-Chk1 (pSer345) rabbit antibody. Primary antibody was
subsequently detected with
a
1:10,000 goat -rabbit IRDye
a
800CW secondary antibody using a LI-COR Odyssey infrared imag-
ing system. The membrane was subsequently stripped, re-probed
with 1:1000 a-b-actin (13E5) HRP-linked antibody and a chemilu-
minescent image of the membrane taken as described above.
2.15. Clonogenic survival assay
U2OS cells (300 cells/well) were initially allowed to settle in
6-well cluster plates overnight prior to treatment with 0–300 nM
cisplatin as indicated. After 24 h, T2Pt was added. Another 24 h
after T2Pt addition, the culture medium was replaced with fresh
compound-free medium, and cells allowed to expand into colonies
for a further 6 days. Each treatment was performed in triplicate.
The cells were gently rinsed twice with PBS, fixed with 3.7% form-
aldehyde, and stained with 0.5% crystal violet. Colonies containing
more than approximately 40 cells were scored. The clonogenic sur-
vival rate for each condition was expressed relative to the average
number of colonies that received the vehicle control (0.9% sodium
chloride and DMSO) which was normalized to a value of 1.
3. Results
3.1. PCNA M40 and H44 residues are essential for PIP-box–
mediated interactions in vitro
Based on the structure of the PIP-box binding cavity of human
PCNA,1 it was anticipated that methionine 40 (M40) and histidine
44 (H44), both suspended on a small loop overhanging the cavity,
may be key residues for PIP-box-mediated binding events. In an
initial effort to address this idea, PCNA alanine mutants were gen-
erated at each of these residues and their relative affinities for a
Figure 1. PCNA M40 and H44 residues are essential for PIP-box-mediated
interactions. The fluorescence polarization (mP) of samples containing fluorescently
labeled PL peptide (10 nM) is presented as a function of PCNA concentration as
indicated. Error bars represent the standard deviation of triplicate experiments.
WT: wild-type.

6338
B.J. Evison et al. / Bioorg. Med. Chem. 22 (2014) 6333–6343
designated N3-T2Pt, was also generated (Scheme S1) by incorpo-
rating an additional azide tag at a non-pharmacophore position
that was based on the PCNA/T3 co-crystal structure (Fig. 3 and
S3). T2Pt and N3-T2Pt were insoluble in either aqueous buffers
or ethanol, yet readily dissolved in DMSO. The co-ordination of cis-
platin by DMSO has previously been described and may reduce its
DNA reactivity16 while increasing its reactivity with the histidine
residues of protein.17 Correspondingly, the solvation of T2Pt in
DMSO was expected to increase the selectivity of T2Pt for PCNA
H44 over DNA. The co-ordination of T2Pt by DMSO following solva-
tion was confirmed via the identification of a mono-DMSO-T2Pt
complex by mass spectrometry (Figs. S1 and S2).
The PCNA/T2Pt interaction was initially characterized using a
competitive FP assay. A mixture of recombinant wild-type PCNA
and fluorescently tagged PIP-box–containing PL peptide9 was
titrated with either T2Pt or T2AA. Unlike T2AA, T2Pt showed a very
potent and time-dependent displacement of PL peptide from PCNA
(Fig. 4B). Whereas the IC50 of T2AA essentially remained
unchanged (Fig. 4A), the apparent IC50 of T2Pt proceeded to
decrease by a factor of ꢁ10-fold throughout the time course
(Fig. 4B), a characteristic typical of a covalent interaction.18 Similar
reactivity was also demonstrated by N3-T2Pt (data not shown). In
an effort to identify the site of PCNA/T2Pt cross-linking, recombi-
nant M40A and H44A single PCNA mutants and a M40A/H44A dou-
ble PCNA mutant were prepared by site-directed mutagenesis. The
PCNAs were treated with N3-T2Pt and conjugated with a biotin-
alkyne probe via click chemistry, and the products were subjected
to SDS–PAGE followed by blotting using a streptavidin probe.
Unlike wild-type PCNA, which readily reacted with N3-T2Pt, both
single mutants showed attenuated bonding by N3-T2Pt, implicat-
ing both M40 and H44 as sites of modification. Consistent with
this, the double mutant essentially failed to accommodate bonding
by the N3-T2Pt beyond background (Fig. 4C).
To further verify the irreversible nature of the T2Pt-PCNA com-
plex, recombinant wild-type PCNA was reacted with an excess of
T2Pt and subsequently subjected to mass spectrometric analysis
(Fig. 5A and B). The PCNA/T2Pt reaction generated new peaks that
were consistent with a PCNA/T2Pt species. The stoichiometry of
the reaction suggested that one T2Pt was associated with each
PCNA molecule, indicating a site-specific unimolecular reaction
with PCNA. The PCNA/T2Pt species remained intact after removal
of free T2Pt for up to 20 h (data not shown), suggesting that the
interaction was irreversible and covalent in character. Inactivity
of the M40A/H44A double mutant was also verified by mass spec-
trometry (Fig. 5C and D), in which no peak shift was observed
under the same treatment conditions utilized for wild-type PCNA.
Collectively, these results strongly suggest that T2Pt site-selec-
tively alkylated PCNA via M40 and H44 (Fig. 3).
Figure 2. The M40A mutation of PCNA impairs chromatin loading within cells. (A)
U2OS cells were initially transfected with an EGFP-wild-type PCNA or EGFP-M40A
PCNA construct, pre-extracted to remove all nonchromatin-bound proteins, and
imaged for GFP. DAPI was used as a nuclear counterstain. (B) The expression level of
each GFP fusion presented in (A) as assayed by immunoblotting. Endogenous PCNA
served as a loading control.
to hypothesize that the functional deactivation of PCNA may be
achieved by selective alkylation of M40.
3.3. The rational generation of T2Pt, a chemical agent that
preferentially alkylates PCNA via M40 and H44
The thyroid hormone T3 and its structural analogue T2AA are
non-peptide small molecules that bind reversibly to the PIP-box
binding cavity of PCNA.6,7 T2AA efficiently and reversibly sup-
pressed DNA synthesis in cells, most likely via inhibition of the
PCNA/DNA polymerase d PIP-box interaction. Moreover, T2AA
and its analogues inhibited translesion DNA synthesis, an impor-
tant DNA damage tolerance mechanism in cells.6,14 In a PCNA/T3
co-crystal structure,6 it was noted that the amino acid moiety of
T3 was juxtaposed with the functionally important M40 and H44
residues of PCNA. Accordingly, we surmised that a T2AA analogue
bearing an appropriately positioned electrophilic moiety may pro-
mote the generation of persistent, covalent bonds with the nucle-
ophilic M40 and H44 residues of PCNA. Few organic electrophiles
conventionally utilized for bioconjugation (such as alkyl halides
and Michael acceptors) alkylate methionine and histidine residues
within a physiological environment. In an effort to circumvent
these restrictions, we selected an inorganic electrophilic moiety
capable of strong coordination by methionine and histidine,
namely platinum.15 We have generated a T2AA analogue, T2Pt,
by substituting the aminoalcohol moiety of T2AA for a cisplatin-
like structure (Scheme 1 and Fig. 3). An azide variant of T2Pt,
3.4. T2Pt demonstrates modest DNA reactivity
Cisplatin is a well-established anticancer therapeutic that gen-
erates stable covalent DNA adducts within cells, a property that
is widely considered to underpin its significant biological activ-
ity.19 The electrophilic platinum moiety of T2Pt (Scheme 1) is
structurally analogous to cisplatin and may promote the genera-
tion of stable T2Pt–DNA adducts, much like cisplatin itself. To ver-
ify this in vitro, an electrophoretic band shift assay was used.
Covalent bonding of supercoiled plasmid DNA by cisplatin typically
renders the cisplatin-plasmid complex more tightly compact and
yields a dose-dependent increase in the complex’s electrophoretic
mobility (Fig. 6A).20 T2platin also induced a dose-dependent
increase in the mobility of plasmid DNA during electrophoresis
(Fig. 6A), although plasmid compaction by the novel compound
was less efficient relative to cisplatin. Nonetheless, the T2platin-
induced plasmid shift indicates that the novel compound may

B.J. Evison et al. / Bioorg. Med. Chem. 22 (2014) 6333–6343
6339
Scheme 1. Synthetic route of T2Pt (8) and chemical structure of T2AA (9).
Figure 3. The rational design of T2Pt. A hypothetical model of the PCNA/T2Pt
interaction. Platinum, orange; nitrogen, blue; sulfur, yellow; oxygen, red; iodine,
violet. IDCL: interdomain connecting loop. The structure of T2Pt (cyan) was docked
to the PIP-box binding cavity of PCNA (gray) using the PCNA/T3 complex,6 in which
projections of M40 and H44 residues were optimized to adopt the octahedral
platinum coordination (while dotted line). DMSO and a chloride atom coordinating
the platinum atom were omitted for clarity.
covalently interact with DNA. An alkaline comet assay was next
applied to evaluate DNA damage induction by T2Pt within cells.
Notably, T2Pt was reasonably membrane-permeable (Table S1),
thereby permitting its use in cellular assays. T2Pt dose-depen-
dently induced DNA strand breaks in cells, however the levels were
rather modest and attenuated relative to cisplatin at equimolar
doses (Fig. 6B).
Figure 4. T2Pt forms an irreversible complex with PCNA. The fluorescence
polarization (mP) of samples containing fluorescently labeled PL peptide (10 nM)
and PCNA (100 nM) were measured at defined time points after the addition of
either T2AA (A) or T2Pt (B) (0–100
remained unchanged throughout the time course (IC50 ꢁ1.5
of T2Pt proceeded to decrease to ꢁ0.1 M through 4 h. Error bars represent the
standard deviation of triplicate experiments. (C) Recombinant human wild-type or
mutant PCNAs (0.9 M) were reacted with N3-T2Pt (0, 2.5, 5, and 10 M as denoted
by an open triangle) for 2 h at room temperature. Samples were conjugated to a
biotin-alkyne probe using a copper catalyst and then analyzed by probing with a
streptavidin-HRP conjugate as described in Section 2. Membranes were subse-
l
M). Whereas the IC50 of T2AA essentially
l
M), the apparent IC50
3.5. T2Pt elicits a persistent cellular DNA damage response
l
Given the relatively mild induction of DNA strand breaks by
T2Pt (Fig. 6B), it was rationalized that T2platin may elicit a DNA
damage response. To investigate the potential nature of such a
response, the recovery of cells from T2Pt- or T2AA-induced cell
cycle arrest was analyzed by flow cytometry. T2Pt induced a sus-
tained cell cycle arrest in late S/G2 phase while cells treated with
the reversible PCNA inhibitor T2AA readily moved from accumula-
tion within early S phase upon release from the compound
l
l
quently stripped and re-probed with a-PCNA antibody as indicated.
(Fig. 7A). The inhibition of DNA replication is often coupled with
phosphorylation of the histone variant H2AX at Ser139 (designated
c
H2AX), a cellular marker of replication stress.21 In accordance

6340
B.J. Evison et al. / Bioorg. Med. Chem. 22 (2014) 6333–6343
Figure 5. Representative mass spectra of products generated by reacting human recombinant PCNA in the presence or absence of 50
Wild type PCNA, no treatment (observed mass, 28770 Da; predicted mass, 28,769 Da). (B) Wild type PCNA and 50 M T2Pt. The peaks were consistent with a reaction
involving the displacement of chlorine atoms from T2Pt and platinum coordination by DMSO (observed mass, 29552 Da; predicted mass, 29,552 Da). (C) M40A/H44A PCNA,
no treatment (observed mass, 28,646 Da; predicted mass, 28,643 Da). (D) M40A/H44A PCNA and 50 M T2Pt. Few peaks distinct from free M40A/H44A PCNA were detected.
lM T2Pt for 2 h at room temperature. (A)
l
l
with this, cells were exposed to T2Pt either continuously for 24 h
or pulsed for 7 h and allowed to recover in T2Pt-free medium for
contrast, the level of damage within cells largely recovered
from pulse treatment with the reversible PCNA inhibitor T2AA
(Fig. 7B).
The induction of cH2AX by T2Pt strongly implicated the
involvement of at least one kinase in the replication stress
17 h. Immunostaining for
robustly induced H2AX within cells in either treatment schedule.
A distinctive feature of T2Pt-induced H2AX was its persistence at
relatively high levels following T2Pt withdrawal. In sharp
cH2AX established that T2Pt
c
c
response. Ataxia telangiectasia mutated and rad3-related (ATR) is

B.J. Evison et al. / Bioorg. Med. Chem. 22 (2014) 6333–6343
6341
clamp onto DNA.27 An ensuing study28 established that D41 of
PCNA was also critical for its loading onto a plasmid DNA template
by RF-C in vitro. Consistent with this observation, the GFP-tagged
M40A PCNA mutant was inefficiently loaded onto chromatin
within living eukaryotic cells (Fig. 2A), implicating an important
functional role for M40 in chromatin loading. It is presently unclear
whether the M40 residue makes direct contact with RF-C or other
factors that are required for loading PCNA onto chromatin within
living cells, although it was noted that D41 most likely directly
interacts with the RF-C loading complex, at least in vitro.28 The
M40A mutant has potential as a molecular tool for the functional
dissection of the role of the PIP-box binding cavity in the recruit-
ment of PCNA binding partners. Moreover, the mutant holds prom-
ise as a tool and for the identification of novel PIP-box containing
PCNA-binding molecules by differential proteomics.11
The identification of PCNA M40 and H44 as functionally rele-
vant in PIP-box recognition indicated that the residues may be
valid targets for the generation of a PIP-box binding inhibitor. Cou-
pled with their functional significance, the relatively nucleophilic
nature of both M40 and H44 presented a rare opportunity for the
generation of a selective small molecule inhibitor capable of a
covalent, irreversible interaction with PCNA. Functionally relevant
nucleophilic amino acid residues have emerged as attractive
ztargets for covalent modification, particularly in the development
of therapeutic inhibitors and activity-based probes.18,29,30 Very few
chemical agents are capable of covalent interaction with methio-
nine residues in an intracellular environment, although it is well
established that platinum bonds avidly with the sulfur atom of
methionine to generate a particularly strong coordination com-
plex.31 Favorably, platinum is coordinated also by the imidazole
ring of histidine,15 and it is likely that T2Pt is coordinated by both
M40 and H44 PCNA residues since only the M40A/H44A double
PCNA mutant completely failed to interact with PCNA (Figs. 4C
and 5D). The robust nature of the PCNA/T2Pt interaction was typ-
ified by detection of the complex following immunoblotting
(Fig. 4C), a technique that involves the application stringent condi-
tions that protein denaturation. The survival of the T2Pt/PCNA
complex, despite the application of these conditions, suggests that
the PCNA/T2Pt complex is likely to endure the relatively mild con-
ditions of the cellular milieu.
Figure 6. T2Pt demonstrates modest DNA reactivity. (A) Supercoiled plasmid DNA
was reacted overnight at 37 °C with various concentrations of cisplatin or T2Pt as
indicated. Samples were then subjected to fractionation through agarose gels
containing ethidium bromide by electrophoresis and photographed under UV
illumination. (B) U2OS cells were initially exposed to 0–50 lM cisplatin or T2Pt for
7 h and then allowed to recover for 17 h in compound-free medium. Cells were then
harvested and subjected to an alkaline comet assay as described in Section 2. DNA
damage was assessed visually and each column represents the mean level of
damage in arbitrary units. Error bars represent the standard error of the mean while
n indicates number of cells scored.
a master kinase known to phosphorylate H2AX at Ser139 and func-
tions in the replication stress response pathway.22–24 Consistent
with this notion, T2Pt-treated cells exhibited intense phosphoryla-
tion at Ser345 of checkpoint kinase 1 (Chk1), an ATR substrate and
a classic hallmark of ATR activation and the DNA replication stress
response.22,25 Furthermore, the level of Chk1 phosphorylation at
Ser345 persisted after the release of cells from T2Pt, while Chk1
phosphorylation levels within T2AA-treated cells recovered by
ꢁ50% in identical conditions (Fig. 7C and D). Collectively, these
results suggest that T2Pt induced replication stress and enforced
a subsequent late S/G2 phase block by persistently activating the
ATR-Chk1 signaling axis.
3.6. T2Pt is not cytotoxic as a single agent, yet sensitizes cells to
cisplatin
PCNA assumes an indispensable role in supporting DNA replica-
tion and is therefore an obvious requirement for smooth S phase
traverse and cell cycle progression.2,9 It follows that the inhibition
of PCNA-mediated functions would be anticipated impair these
biological processes. Consistent with this notion, the onset of cell
cycle arrest following T2Pt exposure (Fig. 7A) correlated with the
Finally, to determine how persistent chemical inhibition of
PCNA function may be detrimental to cells, we assayed T2Pt for
cytotoxicity. Unexpectedly, T2Pt showed little effect as a single
agent in a clonogenic survival assay (Fig. 8A) at a concentration
in which persistent
cH2AX induction and ATR/Chk1 activation
were observed (Fig. 7C and D). This suggests that persistent inhibi-
tion of the PCNA/PIP-box interactions was not cytotoxic in isola-
tion. Previously, we established that the chemical inhibition of
PCNA/PIP-box interactions sensitized U2OS cells to cisplatin.6,14
Similarly, T2Pt predisposed U2OS cells to enhanced cisplatin cyto-
toxicity despite its inactivity as a single agent (Fig. 8B).
induction of
cH2AX (Fig. 7B). ATR phosphorylates H2AX at
Ser139 and functions at the apex of the replication stress response
pathway, particularly in response to extended stretches of
single-stranded DNA generated by arrested replication forks.22–24
T2Pt-treated cells exhibited intense phosphorylation at Ser345 of
Chk1 (Fig. 7C and D), an ATR substrate and a hallmark of ATR acti-
vation and the DNA replication stress response.22,23 Significantly,
ATR-mediated phosphorylation of H2AX in response to replication
4. Discussion
stress stimulated by hydroxyurea,
a well-established DNA
replication inhibitor, occurs exclusively in S and G2 phases,21 the
very same phases in which cells were persistently arrested after
T2Pt release (Fig. 7A). The persistent nature of the replication stress
response induced by T2Pt, but not by the reversible inhibitor T2AA
(Fig. 7C), complements its enduring arrest of the cell cycle (Fig. 7A)
and sustained induction of DNA damage after release (Fig. 7B) and
is entirely consistent with the generation of an irreversible T2Pt/
PCNA complex within cells.
M40 lines part of the PIP-box binding cavity of PCNA, and its
substitution for alanine has deleterious implications for binding
by a PIP-box-bearing peptide (Fig. 1), suggesting that the mutation
may locally disrupt interactions with residues of the PIP-box motif,
which generally adopts a conserved 310 helix hydrophobic plug.26
The importance of M40 in PIP-box recognition may also be exem-
plified by mutational analyses27 of its immediate neighboring res-
idue, aspartic acid 41 (D41). Among 29 individual PCNA mutations,
a D41A PCNA point mutant was uniquely unable to stimulate both
in vitro DNA synthesis by polymerase d and the ATPase activity of
RF-C, the protein complex chiefly responsible for loading the PCNA
It is also a reasonable argument that the T2Pt-induced replica-
tion stress response evident in Figure 7B and C may be a manifes-
tation of direct DNA damage by the compound (Fig. 6) as opposed

6342
B.J. Evison et al. / Bioorg. Med. Chem. 22 (2014) 6333–6343
Figure 7. T2Pt induces persistent cell cycle arrest and DNA replication stress. (A) The cell cycle distribution of HeLa cells upon release from 24 h of exposure to either T2Pt
(100 M) or T2AA (40 M). The phosphorylation of H2AX Ser139 (B) or Chk1 Ser345 (C) in U2OS cells treated with either T2Pt (25 M) or T2AA (25 M) continuously for 24 h
l
l
l
l
or pulsed for 7 h followed by 17 h recovery in compound-free medium. Following treatment, cells were fixed, processed for the immunocytochemical detection of
phosphorylation of H2AX at Ser139 or Chk1 at Ser345 and analyzed by flow cytometry. Solid bars represent the area arbitrarily defined as positive for the phosphorylation
status of each protein. (D) U2OS cells (330,000 per well) were initially seeded into six well cluster plates and allowed to attach overnight. Following treatment as described in
(C), cells were harvested and analyzed for the expression of pSer345 Chk1 and b-actin by immunoblotting as described in Section 2. Densitometry quantification was
performed by dividing band intensity of the pSer345 Chk1 by that of b-actin for each lane, and values normalized to DMSO control are indicated as ratio.

B.J. Evison et al. / Bioorg. Med. Chem. 22 (2014) 6333–6343
6343
Acknowledgements
We thank Dr. Scott Perry for flow cytometry support; Dr. Jenni-
fer Peters for assistance with confocal microscopy; Dr. Akira Inoue
for technical advice and helpful discussions; Mr. Kiran Kodali for
protein mass spectrometry; Mr. Sotaro Kikuchi, Mr. Keita Kawara-
zaki (Yokohama City University), and Dr. Hiroshi Hashimoto (Uni-
versity of Shizuoka) for attempting structural characterization of
PCNA/T2Pt complex; Drs. David Gerlich and Toshiki Tsurimoto
for plasmids; and Mr. David Galloway for grammatical advice
and preparation of this manuscript.
Supplementary data
Figure 8. As a single agent, T2Pt shows little cytotoxicity yet sensitizes cells to
cisplatin. U2OS cells were cultured with either (A) 0–30 M T2Pt for 24 h and then
allowed to expand into colonies in compound-free medium for a further 6 days, or
(B) 0–300 nM cisplatin for 24 h, followed by incubation with DMSO or 30 M T2Pt
for another 24 h. Cells were allowed to expand into colonies in fresh culture
medium for a further 6 days. Samples were then assayed for clonogenic survival as
detailed in Section 2. The survival rate was reported as 1 for the average of number
colonies that received the vehicle control. Error bars represent the standard
deviation of triplicate experiments.
Supplementary data (Supplementary Figs. S1–S3, Scheme S1,
Table S1, and supplementary methods) associated with this article
can be found, in the online version, at http://dx.doi.org/10.1016/
j.bmc.2014.09.058.
l
l
References and notes
1. Gulbis, J. M.; Kelman, Z.; Hurwitz, J.; O’Donnell, M.; Kuriyan, J. Cell 1996, 87,
297–306.
2. Moldovan, G. L.; Pfander, B.; Jentsch, S. Cell 2007, 129, 665.
3. Paunesku, T.; Mittal, S.; Protic, M.; Oryhon, J.; Korolev, S. V.; Joachimiak, A.;
Woloschak, G. E. Int. J. Radiat. Biol. 2001, 77, 1007–1021.
4. Naryzhny, S. N. Cell. Mol. Life Sci. 2008, 65, 3789–3808.
5. Witko-Sarsat, V.; Mocek, J.; Bouayad, D.; Tamassia, N.; Ribeil, J. A.; Candalh, C.;
Davezac, N.; Reuter, N.; Mouthon, L.; Hermine, O.; Pederzoli-Ribeil, M.;
Cassatella, M. A. J. Exp. Med. 2010, 207, 2631.
6. Punchihewa, C.; Inoue, A.; Hishiki, A.; Fujikawa, Y.; Connelly, M.; Evison, B.;
Shao, Y.; Heath, R.; Kuraoka, I.; Rodrigues, P.; Hashimoto, H.; Kawanishi, M.;
Sato, M.; Yagi, T.; Fujii, N. J. Biol. Chem. 2012, 287, 14289.
7. Inoue, A.; Kikuchi, S.; Hishiki, A.; Shao, Y.; Heath, R.; Evison, B. J.; Actis, M.;
Canman, C. E.; Hashimoto, H.; Fujii, N. J. Biol. Chem. 2014, 289, 7109.
8. Weiss, W. A.; Taylor, S. S.; Shokat, K. M. Nat. Chem. Biol. 2007, 3, 739.
9. Kontopidis, G.; Wu, S. Y.; Zheleva, D. I.; Taylor, P.; McInnes, C.; Lane, D. P.;
Fischer, P. M.; Walkinshaw, M. D. Proc. Natl. Acad. Sci. U.S.A. 2005, 102, 1871.
10. Steigemann, P.; Wurzenberger, C.; Schmitz, M. H.; Held, M.; Guizetti, J.; Maar,
S.; Gerlich, D. W. Cell 2009, 136, 473.
11. Ohta, S.; Shiomi, Y.; Sugimoto, K.; Obuse, C.; Tsurimoto, T. J. Biol. Chem. 2002,
277, 40362.
12. Collins, A. R. Mol. Biotechnol. 2004, 26, 249.
13. Leonhardt, H.; Rahn, H. P.; Weinzierl, P.; Sporbert, A.; Cremer, T.; Zink, D.;
Cardoso, M. C. J. Cell Biol. 2000, 149, 271.
14. Actis, M.; Inoue, A.; Evison, B.; Perry, S.; Punchihewa, C.; Fujii, N. Bioorg. Med.
Chem. 2013, 21, 1972.
to inhibition of PCNA-mediated functions. It is difficult to discern
between the relative involvement of each potential mechanism
given the intimate link shared by PCNA function and DNA metab-
olism. It is noteworthy, however, that the compound induced
modest levels of DNA damage relative to cisplatin (Fig. 6), a fea-
ture that may be attributable in part to platinum complexation of
T2Pt by DMSO. It has been reported that the coordination of cis-
platin by DMSO completely eliminated cytotoxicity demonstrated
by the drug,32 possibly due to a loss in DNA reactivity. Moreover,
T2Pt demonstrated little activity as a single agent in clonogenic
survival assays (Fig. 8A), a result that is inconsistent with the
extremely toxic nature of DNA-directed agents in general.33
Rather, it was observed when cells were challenged with cis-
platin-induced DNA damage prior to T2Pt exposure that the novel
compound significantly impaired clonogenic survival (Fig. 8B), a
feature that is perhaps a reflection of the inhibition of PCNA-
mediated DNA repair by T2Pt.
15. Hohage, O.; Sheldrick, W. S. J. Inorg. Biochem. 2006, 100, 1506.
16. Fischer, S. J.; Benson, L. M.; Fauq, A.; Naylor, S.; Windebank, A. J.
Neurotoxicology 2008, 29, 444.
17. Tanley, S. W.; Schreurs, A. M.; Kroon-Batenburg, L. M.; Meredith, J.;
Prendergast, R.; Walsh, D.; Bryant, P.; Levy, C.; Helliwell, J. R. Acta
Crystallogr., Sect. D 2012, 68, 601.
18. Singh, J.; Petter, R. C.; Baillie, T. A.; Whitty, A. Nat. Rev. Drug Discov. 2011, 10, 307.
19. Kelland, L. Nat. Rev. Cancer 2007, 7, 573.
20. Cohen, G. L.; Bauer, W. R.; Barton, J. K.; Lippard, S. J. Science 1979, 203, 1014.
21. Ward, I. M.; Chen, J. J. Biol. Chem. 2001, 276, 47759.
22. Osborn, A. J.; Elledge, S. J.; Zou, L. Trends Cell Biol. 2002, 12, 509.
23. Cimprich, K. A.; Cortez, D. Nat. Rev. Mol. Cell Biol. 2008, 9, 616.
24. Chanoux, R. A.; Yin, B.; Urtishak, K. A.; Asare, A.; Bassing, C. H.; Brown, E. J.
J. Biol. Chem. 2009, 284, 5994.
25. Lobrich, M.; Shibata, A.; Beucher, A.; Fisher, A.; Ensminger, M.; Goodarzi, A. A.;
Barton, O.; Jeggo, P. A. Cell Cycle 2010, 9, 662.
26. Bruning, J. B.; Shamoo, Y. Structure 2004, 12, 2209.
27. Fukuda, K.; Morioka, H.; Imajou, S.; Ikeda, S.; Ohtsuka, E.; Tsurimoto, T. J. Biol.
Chem. 1995, 270, 22527.
5. Conclusion
The requirement of platinum for interaction with M40 clearly
restricts the design of a second generation of irreversible PCNA/
PIP-box inhibitors; however, it may be possible to substitute the
platinum moiety of T2Pt with a functional group capable of cova-
lent interaction with H44 alone, an approach that has been applied
in the development of a protein–protein interaction inhibitor.34
Inhibitors of this nature may avoid bonding with DNA, improve
selectivity for PCNA and therefore provide a second generation of
analogues potentially useful for probing the rapid inactivation of
PIP-box-mediated PCNA binding events.
28. Zhang, G.; Gibbs, E.; Kelman, Z.; O’Donnell, M.; Hurwitz, J. Proc. Natl. Acad. Sci.
U.S.A. 1999, 96, 1869.
Funding sources
29. Speers, A. E.; Adam, G. C.; Cravatt, B. F. J. Am. Chem. Soc. 2003, 125, 4686.
30. Gushwa, N. N.; Kang, S.; Chen, J.; Taunton, J. J. Am. Chem. Soc. 2012, 134, 20214.
31. Zimmermann, T.; Zeizinger, M.; Burda, J. V. J. Inorg. Biochem. 2005, 99, 2184.
32. Yi, Y. W.; Bae, I. DNA Repair (Amst.) 2011, 10, 1084.
33. Hurley, L. H. Nat. Rev. Cancer 2002, 2, 188.
34. Fujii, N.; Haresco, J. J.; Novak, K. A.; Stokoe, D.; Kuntz, I. D.; Guy, R. K. J. Am.
Chem. Soc. 2003, 125, 12074.
The American Lebanese Syrian Associated Charities (ALSAC)
and American Cancer Society Research Scholar Grant #RSG CDD-
120969 (to N.F.). Microscopy images were acquired at the Cell &
Tissue Imaging Center in St. Jude Children’s Research Hospital
which is supported by ALSAC and NCI P30 CA021765-34.